WorldWideScience

Sample records for single-strand conformation polymorphisms

  1. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  2. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  3. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  4. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  5. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  6. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  7. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  8. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  9. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  10. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  11. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  12. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  14. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  15. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  16. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  17. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  18. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  19. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  20. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  1. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  2. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  3. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  4. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  5. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  6. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  8. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  9. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  10. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  11. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  12. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  13. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  14. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  16. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  17. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  18. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  19. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  20. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  1. Analysis of major histocompatibility complex class II gene in water voles using capillary electrophoresis-single stranded conformation polymorphism

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Galan, M.; Charbonnel, N.; Cosson, J.-F.

    2005-01-01

    Roč. 5, č. 1 (2005), s. 173-176 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z6093917 Keywords : water vole * population genetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.219, year: 2005

  2. Using single strand conformational polymorphisms (SSCP) to identify Phytophthora species in Oregon forests affected by sudden oak death

    Science.gov (United States)

    E. Hansen; C. Hesse; P. Reeser; W. Sutton; L. Winton

    2006-01-01

    Phytophthora species are abundant in streams, widespread in soils and occasionally found in diseased plants in the tanoak forests of southwestern Oregon. It is time-consuming and expensive to identify hundreds of isolates to species using morphology or internal transribed spacer (ITS) sequencing. We modified a published Phytophthora...

  3. Polymorphism in exon 1 of adiponectin gene and its association with ...

    African Journals Online (AJOL)

    hope&shola

    2010-11-08

    Nov 8, 2010 ... Abbreviations: PCR-SSCP, Polymerase chain reaction-single strand conformation polymorphism; SNPs, single nucleotide polymorphisms; PPARa, peroxisome proliferator-activated receptor alpha; IMF, intramuscular fat; EDTA, ethylene diamine tetraacetic acid; VLDL, very low density lipoprotein; QTLs,.

  4. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  5. Conformational flexibility and packing plausibility of repaglinide polymorphs

    Science.gov (United States)

    Rani, Dimpy; Goyal, Parnika; Chadha, Renu

    2018-04-01

    The present manuscript highlights the structural insight into the repaglinide polymorphs. The experimental screening for the possible crystal forms were carried out using various solvents, which generated three forms. The crystal structure of Form II and III was determined using PXRD pattern whereas structural analysis of Form I has already been reported. Form I, II and II was found to exist in P212121, PNA21 and P21/c space groups respectively. Conformational analysis was performed to account the conformational flexibility of RPG. The obtained conformers were further utilized to obtain the information about the crystal packing pattern of RPG polymorphs by polymorph prediction module. The lattice energy landscape, depicting the relationship between lattice energy and density of the polymorphs has been obtained for various possible polymorphs. The experimentally isolated polymorphs were successfully fitted into lattice energy landscape.

  6. A novel polymorphism of resistin gene and its association with meat ...

    African Journals Online (AJOL)

    Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation polymorphism ...

  7. Polymorphism of growth hormone gene and its association with ...

    African Journals Online (AJOL)

    sunny t

    2016-04-06

    Apr 6, 2016 ... recorded to be more frequent (83.3, 92.86 and 90%) than pattern II (16.7, 7.14 and 10%) in Barki,. Rahmani ... Key words: Sheep, wool, growth hormone (GH) gene, polymorphism, single strand conformation polymorphism. (SSCP). ... electrophoresis and chemical and ribonuclease cleavage,. SSCP has ...

  8. Allelic polymorphism of Makoei sheep leptin gene identified by ...

    African Journals Online (AJOL)

    use

    2011-12-05

    Dec 5, 2011 ... intake, energy expenditure and whole-body energy balance in animals. In the present study, the polymorphism of the leptin gene (LEP) of Makoei sheep was investigated by polymerase chain reaction and single strand conformation polymorphism technique (PCR–SSCP). Genomic DNA was extracted.

  9. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  10. Three novel single-nucleotide polymorphisms of the bovine LHX3 ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    In this study, polymerase chain reaction-single strand conformation polymorphism. (PCR-SSCP) and DNA sequencing methods were employed to screen the genetic variations within the bovine LHX3 gene in 802 Chinese indigenous cattle. The results revealed three novel single-nucleotide polymorphisms (SNPs):.

  11. A novel polymorphism of resistin gene and its association with meat ...

    African Journals Online (AJOL)

    Jane

    2011-09-28

    Sep 28, 2011 ... Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation.

  12. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  13. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  14. Application of PCR-RF-SSCP to study major histocompatibility class II B polymorphism in common carp (Cyprinus carpio L.)

    NARCIS (Netherlands)

    Rakus, K.L.; Wiegertjes, G.F.; Adamek, M.; Bekh, V.; Stet, R.J.M.; Irnazarow, I.

    2008-01-01

    A variety of methods have been applied for the characterization of major histocompatibility (MH) polymorphism in fish. We optimized a technique designated polymerase chain reaction-restriction fragments-single strand conformation polymorphism (PCR-RF-SSCP) for screening a large number of individuals

  15. Identification of a common amino acid polymorphism in the p85alpha regulatory subunit of phosphatidylinositol 3-kinase

    DEFF Research Database (Denmark)

    Hansen, Torben; Andersen, C B; Echwald, Søren Morgenthaler

    1997-01-01

    in a phenotype study. Single-strand conformational polymorphism and heteroduplex analysis of the coding region of the regulatory p85alpha subunit in cDNA isolated from human muscle tissue from 70 insulin-resistant NIDDM patients and 12 control subjects revealed three silent polymorphisms and a missense mutation...

  16. Allelic polymorphism of 'Makoei' sheep myostatin gene identified by ...

    African Journals Online (AJOL)

    Administrator

    2011-09-05

    Sep 5, 2011 ... Key words: Myostatin gene, polymerase chain reaction (PCR), single strand conformation polymorphism technique (SSCP), Ovis aries. ..... Kambadur R, Sharmam M, Smith TPL, Bass JJ (1997). Mutations In. Myostatin (GDF8) In Double-Muscled Belgian Blue And Piemontese. Cattle. Genome. Res., 7: ...

  17. Associations of POU1F1 gene polymorphisms and protein structure ...

    Indian Academy of Sciences (India)

    the DNA. Polymerase chain reaction (PCR), single-strand conformation polymorphism (SSCP) and sequence analyses were carried out to examine the exon 3 of POU1F1 to high- light possible SNPs. ... POU1F1 gene mutations by PCR-SSCP and DNA sequenc- ... of 4 μL PCR products were mixed with 12 μL denaturing.

  18. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  19. Conformational polymorphism and aromaticity in crystalline dibenzotetraaza[14]annulene derivatives

    Science.gov (United States)

    Śliwiński, Jan; Eilmes, Julita; Oleksyn, Barbara J.; Stadnicka, Katarzyna

    2004-06-01

    The structures of two single crystal modifications, orange and yellow, of 7,16-dibenzoyl-6,8,15,17-tetramethyl-5,14-dihydrodibenzo [b,i][1,4,8,11]tetraazacyclotetradecine were determined in room and low temperatures. The aromaticity of the 14-membered macrocyclic ring system was studied with the use of HOMA index and compared to the values calculated for the structures found in the Cambridge Structural Database System. The nature of the polymorphism of the investigated molecules was elucidated. The molecules of the orange and yellow modifications differ in the mutual orientation of the benzoyl groups. The molecular conformation in the yellow crystals is stabilized by two intramolecular hydrogen bonds, C-H⋯OC, which do not occur in the orange modification. Weak, but numerous, intermolecular bonds of this type occur in both modifications, but in the orange polymorph a π-π interaction is also observed, while in the yellow modification a C-H⋯N intermolecular bond is formed.

  20. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  1. Molecular Docking Study of Conformational Polymorph: Building Block of Crystal Chemistry

    Science.gov (United States)

    Dubey, Rashmi; Tewari, Ashish Kumar; Singh, Ved Prakash; Singh, Praveen; Dangi, Jawahar Singh; Puerta, Carmen; Valerga, Pedro; Kant, Rajni

    2013-01-01

    Two conformational polymorphs of novel 2-[2-(3-cyano-4,6-dimethyl-2-oxo-2H-pyridin-1-yl)-ethoxy]-4,6-dimethyl nicotinonitrile have been developed. The crystal structure of both polymorphs (1a and 1b) seems to be stabilized by weak interactions. A difference was observed in the packing of both polymorphs. Polymorph 1b has a better binding affinity with the cyclooxygenase (COX-2) receptor than the standard (Nimesulide). PMID:24250264

  2. Molecular Docking Study of Conformational Polymorph: Building Block of Crystal Chemistry

    Directory of Open Access Journals (Sweden)

    Rashmi Dubey

    2013-01-01

    Full Text Available Two conformational polymorphs of novel 2-[2-(3-cyano-4,6-dimethyl-2-oxo-2H-pyridin-1-yl-ethoxy]-4,6-dimethyl nicotinonitrile have been developed. The crystal structure of both polymorphs (1a and 1b seems to be stabilized by weak interactions. A difference was observed in the packing of both polymorphs. Polymorph 1b has a better binding affinity with the cyclooxygenase (COX-2 receptor than the standard (Nimesulide.

  3. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  4. Conformational polymorphs of a novel TCNQ derivative carrying an acetylene group

    Science.gov (United States)

    Iida, Yuki; Kataoka, Makoto; Okuno, Tsunehisa

    2018-01-01

    TCNQ is one of the most important organic acceptors and lots of its derivatives have been prepared. However the reports on their crystal polymorphs are limited to their complexes, and simple polymorphs of TCNQ derivatives are uncommon. We succeeded in preparation of a novel TCNQ derivative, 2,2'-(2-(prop-2-yn-1-yloxy)cyclohexa-2,5-diene-1,4-diylidene)dimalononitrile, having a propynyloxy group on a substituent. This compound was found to have two crystal polymorphs depending on a solvent for recrystallization. In polymorph I, dimeric hydrogen bonds are formed between acetylenic hydrogens and cyano nitrogens with the molecule in an inversion symmetry. While, in polymorph II, the molecules make intermolecular hydrogen bonds between acetylenic hydrogens and cyano nitrogens with the molecule in 21 symmetry, forming a hydrogen bonded molecular helix along the b axis. Besides patterns of the intermolecular hydrogen bonds, difference was recognized in conformation of propynyloxy group. The molecule has an anti conformation in polymorph I and a gauche conformation in polymorph II. DFT calculation indicates that the anti conformer is less stable than the gauche one. But a solvation model suggests the anti conformer is estimated to be more stable in a toluene solution.

  5. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  6. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  7. Rapid identification of cyst (Heterodera spp., Globodera spp.) and root-knot (Meloidogyne spp.) nematodes on the basis of ITS2 sequence variation detected by PCR-single-strand conformational polymorphism (PCR-SSCP) in cultures and field samples

    NARCIS (Netherlands)

    Clapp, J.P.; Van der Stoel, C.D.; Van der Putten, W.H.

    2000-01-01

    Cyst and root-knot nematodes show high levels of gross morphological similarity. This presents difficulties for the study of their ecology in natural ecosystems. In this study, cyst and root-knot nematode species, as well as some ectoparasitic nematode species, were identified using the second

  8. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  9. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  10. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  11. Crystalline structure of the marketed form of Rifampicin: a case of conformational and charge transfer polymorphism

    Science.gov (United States)

    de Pinho Pessoa Nogueira, Luciana; de Oliveira, Yara S.; de C. Fonseca, Jéssica; Costa, Wendell S.; Raffin, Fernanda N.; Ellena, Javier; Ayala, Alejandro Pedro

    2018-03-01

    Rifampicin is a semi-synthetic drug derived from rifamycin B, and currently integrates the fixed dose combination tablet formulations used in the treatment of tuberculosis. It is also used in the leprosy polychemotherapy and prophylaxis, which are diseases classified as neglected according to the World Health Organization. Rifampicin is a polymorphic drug and its desirable polymorphic form is labeled as II, being the main goal of this study the elucidation of its crystalline structure. Polymorph II is characterized by two molecules with different conformations in the asymmetric unit and the following lattice parameters: a = 14.0760 (10) Å, b = 17.5450 (10) Å, c = 17.5270 (10) Å, β = 92.15°. Differently to the previously reported structures, a charge transference from the hydroxyl group of the naphthoquinone of one conformer to the nitrogen of the piperazine group of the second conformer was observed. The relevance of the knowledge of this crystalline structure, which is the preferred polymorph for pharmaceutical formulations, was evidenced by analyzing raw materials with polymorphic mixtures. Thus, the results presented in this contribution close an old information gap allowing the complete solid-state characterization of rifampicin.

  12. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  14. Spi2 gene polymorphism is not associated with recurrent airway obstruction and inflammatory airway disease in thoroughbred horses

    Directory of Open Access Journals (Sweden)

    Aline Correa da Silva

    2011-01-01

    Full Text Available The aim was to detect the presence of polymorphisms at exons 1, 2, 3 and 4 of the Spi2 gene, and evaluate a possible association between them and recurrent airway obstruction (RAO or inflammatory airway disease (IAD in thoroughbred horses, through single-strand conformational-polymorphism (SSCP screening. Although polymorphism was not detected in exons 1, 2 and 3, three alleles and six genotypes were identified in exon 4. The frequencies of allele A (0.6388 and genotype AA (0.3888 were higher in horses affected by RAO, although no association was found between polymorphism and horses with either RAO or IAD.

  15. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  16. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  17. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  18. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  19. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  20. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  1. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Destabilizing polymorphism in cervid prion protein hydrophobic core determines prion conformation and conversion efficiency.

    Directory of Open Access Journals (Sweden)

    Samia Hannaoui

    2017-08-01

    Full Text Available Prion diseases are infectious neurodegenerative disorders of humans and animals caused by misfolded forms of the cellular prion protein PrPC. Prions cause disease by converting PrPC into aggregation-prone PrPSc. Chronic wasting disease (CWD is the most contagious prion disease with substantial lateral transmission, affecting free-ranging and farmed cervids. Although the PrP primary structure is highly conserved among cervids, the disease phenotype can be modulated by species-specific polymorphisms in the prion protein gene. How the resulting amino-acid substitutions impact PrPC and PrPSc structure and propagation is poorly understood. We investigated the effects of the cervid 116A>G substitution, located in the most conserved PrP domain, on PrPC structure and conversion and on 116AG-prion conformation and infectivity. Molecular dynamics simulations revealed structural de-stabilization of 116G-PrP, which enhanced its in vitro conversion efficiency when used as recombinant PrP substrate in real-time quaking-induced conversion (RT-QuIC. We demonstrate that 116AG-prions are conformationally less stable, show lower activity as a seed in RT-QuIC and exhibit reduced infectivity in vitro and in vivo. Infectivity of 116AG-prions was significantly enhanced upon secondary passage in mice, yet conformational features were retained. These findings indicate that structurally de-stabilized PrPC is readily convertible by cervid prions of different genetic background and results in a prion conformation adaptable to cervid wild-type PrP. Conformation is an important criterion when assessing transmission barrier, and conformational variants can target a different host range. Therefore, a thorough analysis of CWD isolates and re-assessment of species-barriers is important in order to fully exclude a zoonotic potential of CWD.

  3. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  4. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  5. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  6. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  7. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  8. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  9. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  10. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  11. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  12. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  13. Amyloid polymorphisms constitute distinct clouds of conformational variants in different etiological subtypes of Alzheimer's disease.

    Science.gov (United States)

    Rasmussen, Jay; Mahler, Jasmin; Beschorner, Natalie; Kaeser, Stephan A; Häsler, Lisa M; Baumann, Frank; Nyström, Sofie; Portelius, Erik; Blennow, Kaj; Lashley, Tammaryn; Fox, Nick C; Sepulveda-Falla, Diego; Glatzel, Markus; Oblak, Adrian L; Ghetti, Bernardino; Nilsson, K Peter R; Hammarström, Per; Staufenbiel, Matthias; Walker, Lary C; Jucker, Mathias

    2017-12-05

    The molecular architecture of amyloids formed in vivo can be interrogated using luminescent conjugated oligothiophenes (LCOs), a unique class of amyloid dyes. When bound to amyloid, LCOs yield fluorescence emission spectra that reflect the 3D structure of the protein aggregates. Given that synthetic amyloid-β peptide (Aβ) has been shown to adopt distinct structural conformations with different biological activities, we asked whether Aβ can assume structurally and functionally distinct conformations within the brain. To this end, we analyzed the LCO-stained cores of β-amyloid plaques in postmortem tissue sections from frontal, temporal, and occipital neocortices in 40 cases of familial Alzheimer's disease (AD) or sporadic (idiopathic) AD (sAD). The spectral attributes of LCO-bound plaques varied markedly in the brain, but the mean spectral properties of the amyloid cores were generally similar in all three cortical regions of individual patients. Remarkably, the LCO amyloid spectra differed significantly among some of the familial and sAD subtypes, and between typical patients with sAD and those with posterior cortical atrophy AD. Neither the amount of Aβ nor its protease resistance correlated with LCO spectral properties. LCO spectral amyloid phenotypes could be partially conveyed to Aβ plaques induced by experimental transmission in a mouse model. These findings indicate that polymorphic Aβ-amyloid deposits within the brain cluster as clouds of conformational variants in different AD cases. Heterogeneity in the molecular architecture of pathogenic Aβ among individuals and in etiologically distinct subtypes of AD justifies further studies to assess putative links between Aβ conformation and clinical phenotype.

  14. Conformational effects of a common codon 751 polymorphism on the C-terminal domain of the xeroderma pigmentosum D protein

    Science.gov (United States)

    Monaco, Regina; Rosal, Ramon; Dolan, Michael A.; Pincus, Matthew R.; Freyer, Greg

    2009-01-01

    Aim: The xeroderma pigmentosum D (XPD) protein is a DNA helicase involved in the repair of DNA damage, including nucleotide excision repair (NER) and transcription-coupled repair (TCR). The C-terminal domain of XPD has been implicated in interactions with other components of the TFIIH complex, and it is also the site of a common genetic polymorphism in XPD at amino acid residue 751 (Lys->Gln). Some evidence suggests that this polymorphism may alter DNA repair capacity and increase cancer risk. The aim of this study was to investigate whether these effects could be attributable to conformational changes in XPD induced by the polymorphism. Materials and Methods: Molecular dynamics techniques were used to predict the structure of the wild-type and polymorphic forms of the C-terminal domain of XPD and differences in structure produced by the polymorphic substitution were determined. Results: The results indicate that, although the general configuration of both proteins is similar, the substitution produces a significant conformational change immediately N-terminal to the site of the polymorphism. Conclusion: These results provide support for the hypothesis that this polymorphism in XPD could affect DNA repair capability, and hence cancer risk, by altering the structure of the C-terminal domain. PMID:19661678

  15. Self-assembled monolayers of shape-persistent macrocycles on graphite: interior design and conformational polymorphism

    Directory of Open Access Journals (Sweden)

    Joscha Vollmeyer

    2014-11-01

    Full Text Available Three shape-persistent naphthylene–phenylene–acetylene macrocycles of identical backbone structures and extraannular substitution patterns but different (empty, apolar, polar nanopore fillings are self-assembled at the solid/liquid interface of highly oriented pyrolytic graphite and 1,2,4-trichlorobenzene. Submolecularly resolved images of the resulting two-dimensional (2D crystalline monolayer patterns are obtained by in situ scanning tunneling microscopy. A concentration-dependent conformational polymorphism is found, and open and more dense packing motifs are observed. For all three compounds alike lattice parameters are found, therefore the intermolecular macrocycle distances are mainly determined by their size and symmetry. This is an excellent example that the graphite acts as a template for the macrocycle organization independent from their specific interior.

  16. Self-assembled monolayers of shape-persistent macrocycles on graphite: interior design and conformational polymorphism.

    Science.gov (United States)

    Vollmeyer, Joscha; Eberhagen, Friederike; Höger, Sigurd; Jester, Stefan-S

    2014-01-01

    Three shape-persistent naphthylene-phenylene-acetylene macrocycles of identical backbone structures and extraannular substitution patterns but different (empty, apolar, polar) nanopore fillings are self-assembled at the solid/liquid interface of highly oriented pyrolytic graphite and 1,2,4-trichlorobenzene. Submolecularly resolved images of the resulting two-dimensional (2D) crystalline monolayer patterns are obtained by in situ scanning tunneling microscopy. A concentration-dependent conformational polymorphism is found, and open and more dense packing motifs are observed. For all three compounds alike lattice parameters are found, therefore the intermolecular macrocycle distances are mainly determined by their size and symmetry. This is an excellent example that the graphite acts as a template for the macrocycle organization independent from their specific interior.

  17. Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

    Directory of Open Access Journals (Sweden)

    Sujeong Yang

    2014-01-01

    Full Text Available Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie.

  18. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  19. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  20. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  1. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  2. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  3. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  4. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  5. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  6. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  7. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  8. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  9. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  10. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  11. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  12. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  13. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  14. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  15. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  16. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  17. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  18. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  19. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  20. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  1. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  2. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  4. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  5. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  6. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  7. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  8. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  9. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  10. Discovery of Black Dye Crystal Structure Polymorphs: Implications for Dye Conformational Variation in Dye-Sensitized Solar Cells.

    Science.gov (United States)

    Cole, Jacqueline M; Low, Kian Sing; Gong, Yun

    2015-12-23

    We present the discovery of a new crystal structure polymorph (1) and pseudopolymorph (2) of the Black Dye, one of the world's leading dyes for dye-sensitized solar cells, DSSCs (10.4% device performance efficiency). This reveals that Black Dye molecules can adopt multiple low-energy conformers. This is significant since it challenges existing models of the Black Dye···TiO2 adsorption process that renders a DSSC working electrode; these have assumed a single molecular conformation that refers to the previously reported Black Dye crystal structure (3). The marked structural differences observed between 1, 2, and 3 make the need for modeling multiple conformations more acute. Additionally, the ordered form of the Black Dye (1) provides a more appropriate depiction of its anionic structure, especially regarding its anchoring group and NCS bonding descriptions. The tendency toward NCS ligand isomerism, evidenced via the disordered form 2, has consequences for electron injection and electron recombination in Black Dye embedded DSSC devices. Dyes 2 and 3 differ primarily by the absence or presence of a solvent of crystallization, respectively; solvent environment effects on the dye are thereby elucidated. This discovery of multiple Black Dye conformers from diffraction, with atomic-level definition, complements recently reported nanoscopic evidence for multiple dye conformations existing at a dye···TiO2 interface, for a chemically similar DSSC dye; those results emanated from imaging and spectroscopy, but were unresolved at the submolecular level. Taken together, these findings lead to the general notion that multiple dye conformations should be explicitly considered when modeling dye···TiO2 interfaces in DSSCs, at least for ruthenium-based dye complexes.

  11. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  12. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  13. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  14. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  15. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Mutation analysis of peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1) and relationships of identified amino acid polymorphisms to Type II diabetes mellitus

    DEFF Research Database (Denmark)

    Ek, J; Andersen, G; Urhammer, S A

    2001-01-01

    single strand conformational polymorphism analysis followed by nucleotide sequencing. Identified variants were genotyped in an association study comprising 483 Type II diabetic patients and 216 glucose-tolerant control subjects. A replication study was done in an additional 201 Type II diabetic patients...... and 293 glucose-tolerant subjects. Furthermore, a potential interaction between the Pro12Ala polymorphism of PPAR-gamma2 and the PGC-1 Gly482Ser variant on risk of Type II diabetes was investigated. RESULTS: A total of seven variants (Ser74Leu, IVS2 + 52C-->A, Thr394Thr, Asp475Asp, Gly482Ser, Thr528Thr.......0007). No interaction between this variant and the Pro12Ala polymorphism of PPAR-gamma2 was observed. CONCLUSION/INTERPRETATION: A widespread Gly482Ser polymorphism of PGC-1 is associated with a 1.34 genotype relative risk of Type II diabetes....

  17. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  18. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  19. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  20. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  1. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  2. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  4. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  5. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  6. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  7. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  9. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  10. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  11. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  12. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  13. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  14. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2013-01-01

    Roč. 61, Oct (2013), s. 448-452 ISSN 0141-8130 R&D Projects: GA ČR GAP208/10/0559 Institutional support: RVO:61388963 Keywords : metal ions * polyA * metal lized form * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  15. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  16. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  17. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  18. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  20. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  1. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  2. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  3. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  4. Structural and computational investigations of the conformation of antigenic peptide fragments of human polymorphic epithelial mucin.

    OpenAIRE

    Scanlon, M J; Morley, S D; Jackson, D E; Price, M R; Tendler, S J

    1992-01-01

    Human polymorphic epithelial mucins (PEM) are complex glycoproteins that are associated with breast and ovarian carcinomas. The PEM core protein consists of variable numbers of a tandem repeat sequence which contains a short antigenic hydrophilic region (Pro1-Asp-Thr-Arg-Pro-Ala-Pro7). High-field n.m.r. studies undertaken on antigenic 20- and 11-amino acid fragments of the PEM core protein in dimethyl sulphoxide have identified a type-I beta-turn to be present in the region Pro1-Asp-Thr-Arg4....

  5. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  6. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  7. Polymorphism of exon 3 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, T V; Meldgaard, Michael; Sørensen, S

    1997-01-01

    rate of embryos. HLA-G seems to play an important role in the feto-maternal relationship. The polymorphism of the HLA-G locus is not fully clarified. One study has shown extensive nucleotide sequence variation in the exon 3 (alpha-2 domain) in healthy African Americans. A few studies in other...... populations have only revealed a limited polymorphism. We investigated the polymorphism of the exon 3 of HLA-G by means of Polymerase Chain Reaction (PCR)-Single Strand Conformation Polymorphism (SSCP)- and DNA sequencing analysis in a Danish population. We detected four single-base substitutions in exon 3...... compared to the sequence of HLA-6.0 (G*01011); one of these has not been reported before. We also found a deletion of the first base of codon 130 or the third of codon 129 in a heterozygous individual. This study, together with previous results, suggests that the polymorphism of exon 3 of the HLA-G gene...

  8. Polymorphism of exon 3 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, T V; Meldgaard, Michael; Sørensen, S

    1997-01-01

    populations have only revealed a limited polymorphism. We investigated the polymorphism of the exon 3 of HLA-G by means of Polymerase Chain Reaction (PCR)-Single Strand Conformation Polymorphism (SSCP)- and DNA sequencing analysis in a Danish population. We detected four single-base substitutions in exon 3...... compared to the sequence of HLA-6.0 (G*01011); one of these has not been reported before. We also found a deletion of the first base of codon 130 or the third of codon 129 in a heterozygous individual. This study, together with previous results, suggests that the polymorphism of exon 3 of the HLA-G gene...... rate of embryos. HLA-G seems to play an important role in the feto-maternal relationship. The polymorphism of the HLA-G locus is not fully clarified. One study has shown extensive nucleotide sequence variation in the exon 3 (alpha-2 domain) in healthy African Americans. A few studies in other...

  9. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  10. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  11. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  12. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  13. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  14. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  15. The (CTGn polymorphism in the NOTCH4 gene is not associated with schizophrenia in Japanese individuals

    Directory of Open Access Journals (Sweden)

    Okubo Takehito

    2001-06-01

    Full Text Available Abstract Background The human NOTCH4 gene is a candidate gene for schizophrenia due to its chromosomal location and neurobiological roles. In a British linkage study, NOTCH4 gene polymorphisms were highly associated with schizophrenia. In a Japanese case-control association study, however, these polymorphisms did not show significant associations with schizophrenia. We conducted a case-control study with Japanese subjects to explore an association between the triplet repeat polymorphism in the NOTCH4 gene and schizophrenia, including subtypes of schizophrenia, longitudinal disease course characteristics, and a positive family history for psychoses. Methods We examined the (CTGn repeat polymorphism in the NOTCH4 gene among 100 healthy Japanese individuals and 102 patients with schizophrenia (22 paranoid, 38 disorganized, 29 residual, 64 episodic, 31 continuous, 42 with prominent negative symptoms, and 46 with positive family histories using a polymerase chain reaction-based, single-strand conformational polymorphism analysis. Results Five different alleles consisting of 6, 9, 10, 11, and 13 repeats of CTG (Leu in patients with schizophrenia, and 4 alleles consisting of 6, 9, 10, and 11 repeats in controls were found. No significant differences in genotype or allele frequencies of repeat numbers were found between controls and patients. In addition, there were no associations between the polymorphism and schizophrenia subtypes, longitudinal disease course characteristics, or positive family history of the patients. Conclusions Our data suggest a lack of association between the NOTCH4 gene triplet repeat polymorphism and schizophrenia in Japanese individuals.

  16. Deuterium magnetic resonance of some polymorphic liquid crystals: The conformation of the aliphatic end chains

    International Nuclear Information System (INIS)

    Hsi, S.; Zimmermann, H.; Luz, Z.

    1978-01-01

    Deuterium magnetic resonance measurements of four members of the homologous series p-alkoxybenzylidene-p-alkylaniline (noxm), perdeuterated in their alkoxy chains, are reported. The compounds studied were 40x7, 50x7, 60x7, and 70x7. For 50x7 various isotopic species specifically deuterated in the alkoxy chains, as well as in the benzylidine moiety, were prepared and their DMR studied. These measurements allowed a complete assignment of the resonances from the alkoxy chain. The spectrum of all four compounds was studied over their whole mesomorphic regions. In most phases well resolved spectra were obtained yielding the various quadrupole splittings and in many cases also the dipolar interactions within the methylene and methyl groups. Using double quantum spectroscopy dipolar splitting between different methylene deuterons could also be resolved. The methylene quadrupolar splittings and the dipolar interaction within the methylene groups decrease along the chain towards the methyl end in a characteristic stepwise manner. This behavior is attributed to chain reorientational freedom and is quantitatively interpreted in terms of two structural factors: (i) Fast dynamical equilibrium between the all-trans conformation of the alkoxy chains and chain conformations involving one or more kinks, and (ii) a molecular model in which the aliphatic chain axis is inclined with respect to the molecular long axis. The characteristic pattern of the splitting can then be reproduced by assuming a monotonically increasing kink probabilities along the chain towards its methyl end. This interpretation is used to estimate the kink probability distribution in the alkoxy chains in the various compounds and mesophases. No significant effect of the mesophase structure on the kink statistics was found

  17. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  18. Solution structure of Atg8 reveals conformational polymorphism of the N-terminal domain

    Energy Technology Data Exchange (ETDEWEB)

    Schwarten, Melanie, E-mail: m.schwarten@fz-juelich.de [Institut fuer Strukturbiologie und Biophysik, ISB-3, Forschungszentrum Juelich, 52425 Juelich (Germany); Institut fuer Physikalische Biologie und BMFZ, Heinrich-Heine-Universitaet Duesseldorf, 40225 Duesseldorf (Germany); Stoldt, Matthias, E-mail: m.stoldt@fz-juelich.de [Institut fuer Strukturbiologie und Biophysik, ISB-3, Forschungszentrum Juelich, 52425 Juelich (Germany); Institut fuer Physikalische Biologie und BMFZ, Heinrich-Heine-Universitaet Duesseldorf, 40225 Duesseldorf (Germany); Mohrlueder, Jeannine, E-mail: j.mohrlueder@fz-juelich.de [Institut fuer Strukturbiologie und Biophysik, ISB-3, Forschungszentrum Juelich, 52425 Juelich (Germany); Willbold, Dieter, E-mail: dieter.willbold@uni-duesseldorf.de [Institut fuer Strukturbiologie und Biophysik, ISB-3, Forschungszentrum Juelich, 52425 Juelich (Germany); Institut fuer Physikalische Biologie und BMFZ, Heinrich-Heine-Universitaet Duesseldorf, 40225 Duesseldorf (Germany)

    2010-05-07

    During autophagy a crescent shaped like membrane is formed, which engulfs the material that is to be degraded. This membrane grows further until its edges fuse to form the double membrane covered autophagosome. Atg8 is a protein, which is required for this initial step of autophagy. Therefore, a multistage conjugation process of newly synthesized Atg8 to phosphatidylethanolamine is of critical importance. Here we present the high resolution structure of unprocessed Atg8 determined by nuclear magnetic resonance spectroscopy. Its C-terminal subdomain shows a well-defined ubiquitin-like fold with slightly elevated mobility in the pico- to nanosecond timescale as determined by heteronuclear NOE data. In comparison to unprocessed Atg8, cleaved Atg8{sup G116} shows a decreased mobility behaviour. The N-terminal domain adopts different conformations within the micro- to millisecond timescale. The possible biological relevance of the differences in dynamic behaviours between both subdomains as well as between the cleaved and uncleaved forms is discussed.

  19. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  20. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  1. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  2. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  3. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  4. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  5. [Analyses of coding sequence point mutation and polymorphism of TGFBI gene in Chinese patients with keratoconus].

    Science.gov (United States)

    GUAN, Tao; MA, Zhang-wei; DING, Shi-ping

    2011-04-01

    To investigate the point mutations and polymorphisms of transforming growth factor beta-induced gene (TGFBI) in Chinese patients with keratoconus and discuss the relationship between the feature of gene mutations and single nucleotide polymorphisms of TGFBI gene and keratoconus. Polymerase chain reaction single strand conformation polymorphism and DNA direct sequencing were performed in 30 keratoconus cases and 30 healthy controls. All 17 exons of the TGFBI gene were analyzed for point mutations and single nucleotide polymorphisms. Totally two heterozygous nucleotide changes were identified in exon 12 of the TGFBI gene. The codon 535 is changed from GGA to TGA in 1 patient, leading to a substitution of glycine to a stop codon at the protein level (G535X). The codon 540 is changed from TTT to TTC in 2 patients and 1 control individual, resulting in a nonsense mutation (F54F), and is a single nucleotide polymorphism of the gene. Mutation and polymorphisms of the TGFBI gene were detected in Chinese patients with keratoconus in this study. The results suggest that TGFBI gene might play an important role in the pathogenesis of keratoconus.

  6. Genetic polymorphisms in calcitonin receptor gene and risk for recurrent kidney calcium stone disease.

    Science.gov (United States)

    Shakhssalim, Nasser; Basiri, Abbas; Houshmand, Massoud; Pakmanesh, Hamid; Golestan, Banafsheh; Azadvari, Mohaddeseh; Aryan, Hajar; Kashi, Amir H

    2014-01-01

    In this study the full sequence of the calcitonin receptor gene (CALCR) in a group of Iranian males suffering from recurrent calcium urinary stones was compared with that of a control group. Serum and urinary biochemistry related to urolithiasis were evaluated in 105 males diagnosed with recurrent kidney calcium stones and 101 age-matched healthy control males. The polymerase chain reaction single-strand conformation polymorphism method was used to detect new polymorphisms in the CALCR. Nine polymorphisms were detected; seven were in the non-coding and two in the coding region. The T allele associated with the 3'UTR+18C>T polymorphism was observed exclusively in the stone formers. The exact odds ratio for the T allele in this locus for those at risk of stone formation was 36.72 (95% CI 4.95-272.0) (p C and IVS1insA polymorphisms in intron 1 were associated with kidney stone disease (p T and intron 1 polymorphisms in the CALCR and the risk of kidney stone disease. 2013 S. Karger AG, Basel.

  7. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  9. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  10. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  11. DNA polymorphism of 3’ UTR of Nramp1 gene in Malvi breed of cattle

    Directory of Open Access Journals (Sweden)

    R. Ranjan

    2011-10-01

    Full Text Available The natural resistance-associated macrophage protein 1 gene (Nramp1, which is a member of large family of metal ion–transport protein. Nramp1 gene plays a critical role in innate immunity favoring bacterial killing by macrophages in addition to its influence on adaptive immunity. The aim of the present investigation was to identify the genetic variations in the 3’UTR (Untranslated region of Nramp1 gene in the Malvi breed (Bos indicus cattle, using the technique PCR-SSCP and by sequencing. PCR-SSCP (Single Strand conformational polymorphism of 440 bp amplicon of Nramp1 gene revealed three common SSCP patterns in Malvi breed. A total of 3 SSCP patterns viz Pattern I, Pattern II and Pattern III were observed with frequency of 0.361, 0.426 and 0.213 respectively. The patterns variations were confirmed by cloning and sequencing, which showed total 6 mutations in 3 patterns.

  12. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  13. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  14. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  15. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  16. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  17. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  18. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  19. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  20. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  1. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  2. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  3. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  4. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  5. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  6. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  7. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  8. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  9. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  10. Beta fibrinogen gene polymorphisms are associated with plasma fibrinogen and coronary artery disease in patients with myocardial infarction. The ECTIM Study. Etude Cas-Temoins sur l'Infarctus du Myocarde.

    Science.gov (United States)

    Behague, I; Poirier, O; Nicaud, V; Evans, A; Arveiler, D; Luc, G; Cambou, J P; Scarabin, P Y; Bara, L; Green, F; Cambien, F

    1996-02-01

    Polymorphisms of the beta fibrinogen gene have been shown to affect plasma fibrinogen levels and the risk of peripheral arterial disease. We now present the results of a detailed analysis of the beta fibrinogen gene in relation to plasma fibrinogen and to the severity of coronary artery disease (CAD) in patients with myocardial infarction (MI) in the ECTIM Study. Ten polymorphisms of the beta fibrinogen gene, including five new polymorphisms identified by single-strand conformation polymorphism analysis, and one polymorphism in the 3' flanking region of the alpha fibrinogen gene were investigated in 565 patients with MI and 668 control subjects. The polymorphisms were in tight linkage disequilibrium and the genotype frequencies were similar in patients with MI and control subjects. In the multivariate analysis, only two polymorphisms, beta Hae III (P 50% stenosis was estimated by angiography and used as a criterion for severity of CAD. Presence of the less frequent allele of the beta Bcl I (P < .0003) and of other polymorphisms was positively associated with the severity of CAD. Genetic variants of the beta fibrinogen gene are associated with an increased plasma level of fibrinogen, especially in smokers. The association with CAD appears to be the consequence of an increased risk of MI in subjects with severe CAD who carry the predisposing beta fibrinogen genotypes.

  11. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  12. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  13. Polymorphism of the DQA2 gene in goats.

    Science.gov (United States)

    Zhou, H; Hickford, J G H; Fang, Q

    2005-05-01

    Variation in the caprine DQA2 gene was investigated using PCR-single-strand conformational polymorphism (SSCP) and DNA sequencing. Eleven DQA2 alleles were defined by SSCP patterns from 23 goats. All the caprine alleles shared high sequence homology to ovine DQA2 sequences, and exhibited a pattern of polymorphism similar to DQA2 alleles from sheep and cattle but different from caprine DQA1 sequences. Thirty-eight AA positions in the alpha1 domain of caprine DQA2 molecules were polymorphic, and a high degree of polymorphism was observed in the putative antigen-binding region, with 74% of the positions being polymorphic. Phylogenetic analysis of caprine, ovine, and bovine DQA sequences revealed that the caprine DQA2 sequences identified here grouped with ovine DQA2, bovine DQA2, DQA3, and DQA4 sequences but are separate from the group of caprine DQA1 alleles. Nine of the caprine DQA2 sequences were more similar to ovine DQA2 alleles, whereas the remaining two were more closely related to ovine DQA2-like and bovine DQA3 alleles. This finding suggests that the caprine DQA2 sequences may represent two loci, which probably arose by either gene duplication or gene conversion events. Allelic lineages were evident for both DQA2 and DQA2-like loci, supporting the trans-species mode of evolution of major histocompatibilitly complex genes. The high level of polymorphism and similarity between caprine and ovine DQA2 alleles suggests that the DQA2 gene may play an important role in immune responses to shared pathogens.

  14. The point mutation and polymorphism in keratoconus candidate gene TGFBI in Chinese population.

    Science.gov (United States)

    Guan, Tao; Liu, Chibo; Ma, Zhangwei; Ding, Shiping

    2012-07-15

    To understand the region point mutations and single nucleotide polymorphisms characteristic of keratoconus candidate gene in Chinese population, the TGFBI. Polymerase chain reaction-single strand conformation polymorphism and DNA direct sequencing were performed on blood samples from 30 cases of keratoconus patients and 30 normal controls. 17 exons from the coding region of TGFBI gene were examined for point mutations and single nucleotide polymorphisms. Two types of base mutation were found in exon 12, which were both heterozygous. In 1 patient the site 535 showed GGA→TGA substitution, which was the change from glycine to stop codon (G535X). This was not found in all control cases. In 2 patients and 1 control case the site 540 showed TTT→TTC substitutions without changing of the coding for phenylalanine (F540F), suggesting for the polymorphism. The candidate keratoconus gene TGFB1 showed genetic variation and mutation in keratoconus population. The gene might play a role in the development of keratoconus in Chinese population. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. IDENTIFICATION OF GH|ALUI AND GHR|ALUI GENES POLYMORPHISMS IN INDONESIAN BUFFALO

    Directory of Open Access Journals (Sweden)

    E. Andreas

    2014-10-01

    Full Text Available Growth hormone (GH is an anabolic hormone which sintesized and secreted by somatrotop cell inpituitary anterior lobe. GH exert its effect on growth and metabolism by interacting with a specificreceptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested ascandidate gene for traits related to meat production in Bovidae. The objectives of this study were toidentify polymorphism of GH and GHR genes in buffalo. The 452 DNA samples buffalo were collectedfrom five populations in Indonesia (Siborong-Borong-Medan (65, Lebak-Banten (29, Pandeglang-Banten (180, Semarang-Central Java, and Mataram-West Nusa Tenggara (103. A gene fragment of theGH|AluI gene at 432 bp located on exon 3 and GHR|AluI gene at 298 bp on exon 10 were successfullyamplified by using the techniques of a PCR (polymerase chain reaction and genotyped by PCR-RFLP(restriction fragment length polymorphism then -SSCP (single strand conformation polymorphism. Theresults showed no polymorphisms were detected in these genes. All buffaloes tested had LL genotype forlocus GH|AluI and AA genotype for locus GHR|AluI.

  16. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  17. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  18. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  19. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  20. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  1. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  2. Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

    Science.gov (United States)

    Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

    2017-08-01

    Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

  3. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  4. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  5. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  7. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  8. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  9. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  10. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  11. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  12. Conformational stability of mammalian prion protein amyloid fibrils is dictated by a packing polymorphism within the core region.

    Science.gov (United States)

    Cobb, Nathan J; Apostol, Marcin I; Chen, Shugui; Smirnovas, Vytautas; Surewicz, Witold K

    2014-01-31

    Mammalian prion strains are believed to arise from the propagation of distinct conformations of the misfolded prion protein PrP(Sc). One key operational parameter used to define differences between strains has been conformational stability of PrP(Sc) as defined by resistance to thermal and/or chemical denaturation. However, the structural basis of these stability differences is unknown. To bridge this gap, we have generated two strains of recombinant human prion protein amyloid fibrils that show dramatic differences in conformational stability and have characterized them by a number of biophysical methods. Backbone amide hydrogen/deuterium exchange experiments revealed that, in sharp contrast to previously studied strains of infectious amyloid formed from the yeast prion protein Sup35, differences in β-sheet core size do not underlie differences in conformational stability between strains of mammalian prion protein amyloid. Instead, these stability differences appear to be dictated by distinct packing arrangements (i.e. steric zipper interfaces) within the amyloid core, as indicated by distinct x-ray fiber diffraction patterns and large strain-dependent differences in hydrogen/deuterium exchange kinetics for histidine side chains within the core region. Although this study was limited to synthetic prion protein amyloid fibrils, a similar structural basis for strain-dependent conformational stability may apply to brain-derived PrP(Sc), especially because large strain-specific differences in PrP(Sc) stability are often observed despite a similar size of the PrP(Sc) core region.

  13. Development of twenty-nine polymorphic microsatellite loci from ...

    Indian Academy of Sciences (India)

    GAT GAG. TCC TGA GTA AN-3 ) as the primer. The PCR products were then hybridized to 5 -biotinylated probes (AC)n or (GATA)n. Single-stranded DNA fragments contained. Keywords. microsatellite; polymorphic; Coreius guichenoti. Journal of ...

  14. p53 gene mutations and codon 72 polymorphism in ovarian carcinoma patients from Serbia.

    Science.gov (United States)

    Malisic, E; Jankovic, R; Slavkovic, D; Milovic-Kovacevic, M; Radulovic, S

    2010-01-01

    Ovarian cancer is the leading cause of death from gynecological malignancies. The early stages of this disease are asymptomatic and more than 75% of the cases are diagnosed with regional or distant metastases. p53 gene is frequently mutated in some histological subtypes of ovarian carcinomas. The role of p53 mutations and polymorphic variant of codon 72 in the prognosis of disease is still unclear. The aim of this study was to determine the frequency of p53 mutations and polymorphic variants of codon 72 among ovarian carcinoma patients and to correlate them with clinicopathological characteristics of disease. 54 ovarian carcinoma patients were included in the study. DNA was isolated from tumor tissue by the salting- out method. p53 mutations in exons 4-8 were detected by PCR-SSCP (polymerase chain reaction - single-stranded conformational polymorphism) electrophoresis. Codon 72 polymorphism was assessed by RFLP (restriction fragment-length polymorphism) method. p53 mutations were present in 11 out of 54 patients (20.4%). Twenty-four patients (44.4%) exhibited Arg/ Arg, 24 patients (44.4%) Arg/Pro and 6 patients (11.2%) Pro/ Pro genotype of 72 codon polymorphism. Correlations between p53 mutations and various clinicopathological characteristics were not found. However, we observed that the frequency of Pro/Pro genotype was increasing with higher histological grade as well as in advanced compared to localized disease, but without statistical significance. Distribution of p53 gene mutations between Pro/Pro genotype and Arg/Pro plus Arg/Arg genotypes was not statistically significant. Our study suggests that Pro/Pro genotype of 72 codon polymorphism could be an independent prognostic marker in ovarian carcinomas.

  15. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  16. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  18. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  19. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  20. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  1. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  2. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  3. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  4. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail.

    Science.gov (United States)

    Niraj, Diwesh Kumar; Kumar, Pushpendra; Mishra, Chinmoy; Narayan, Raj; Bhattacharya, Tarun Kumar; Shrivastava, Kush; Bhushan, Bharat; Tiwari, Ashok Kumar; Saxena, Vishesh; Sahoo, Nihar Ranjan; Sharma, Deepak

    2015-12-01

    An attempt has been made to study the Myxovirus resistant (Mx1) gene polymorphism in Japanese quail. In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region), Fragment II of 148 bp (Exon 5 region), Fragment III of 161 bp (Exon 7 region), and Fragment IV of 176 bp (Exon 13 region) of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Out of the four fragments, one fragment (Fragment II) was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV) were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  5. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj

    2015-12-01

    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  6. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  7. Collagen type I alpha 1 gene polymorphism in premature ovarian failure

    Directory of Open Access Journals (Sweden)

    Vujović Svetlana

    2013-01-01

    Full Text Available Introduction. Premature ovarian failure (POF is characterized by amenorrhea, hypergonadotropism and hypoestrogenism in women bellow 40 years. Osteoporosis is one of the late complications of POF. Objective. To correlate collagen type I alpha1 (COLIA1 gene polymorphism with bone mineral density (BMD in women with POF. Methods. We determined the COLIA1 genotypes SS, Ss, ss in 66 women with POF. Single nucleotide polymorphism (G to T substitution within the Sp 1-binding site in the first intron of the COLIA1 gene was assessed by polymerase chain reaction (PCR followed by single-stranded conformation polymorphism (SSCP analysis. Bone mineral density (BMD was measured at the lumbar spine region by dual X-ray absorptiometry. Statistics: Kruskal-Wallis ANOVA, Chisquare test, Spearman correlation test. Results. The relative distribution of COLIA1 genotype alleles was SS - 54.4%, Ss - 41.0% and ss - 4.5%. No significant differences were found between genotype groups in body mass index, age, duration of amenorrhea or BMD. A significant positive correlation was observed between BMI and parity. Conclusion. The COLIA1 gene is just one of many genes influencing bone characteristics. It may act as a marker for differences in bone quantity and quality, bone fragility and accelerated bone loss in older women. However, in young women with POF, COLIA1 cannot identify those at higher risk for osteoporosis. [Projekat Ministarstva nauke Republike Srbije, br. ON 173056

  8. Genetic Effects of Polymorphisms in Myogenic Regulatory Factors on Chicken Muscle Fiber Traits

    Directory of Open Access Journals (Sweden)

    Zhi-Qin Yang

    2015-06-01

    Full Text Available The myogenic regulatory factors is a family of transcription factors that play a key role in the development of skeletal muscle fibers, which are the main factors to affect the meat taste and texture. In the present study, we performed candidate gene analysis to identify single-nucleotide polymorphisms in the MyoD, Myf5, MyoG, and Mrf4 genes using polymerase chain reaction-single strand conformation polymorphism in 360 Erlang Mountain Chickens from three different housing systems (cage, pen, and free-range. The general linear model procedure was used to estimate the statistical significance of association between combined genotypes and muscle fiber traits of chickens. Two polymorphisms (g.39928301T>G and g.11579368C>T were detected in the Mrf4 and MyoD gene, respectively. The diameters of thigh and pectoralis muscle fibers were higher in birds with the combined genotypes of GG-TT and TT-CT (p0.05. Our findings suggest that the combined genotypes of TT-CT and GG-TT might be advantageous for muscle fiber traits, and could be the potential genetic markers for breeding program in Erlang Mountain Chickens.

  9. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  10. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  11. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  12. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  13. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  14. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  15. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  16. Estimating Genetic Conformism of Korean Mulberry Cultivars Using Random Amplified Polymorphic DNA and Inter-Simple Sequence Repeat Profiling

    Directory of Open Access Journals (Sweden)

    Sunirmal Sheet

    2018-03-01

    Full Text Available Apart from being fed to silkworms in sericulture, the ecologically important Mulberry plant has been used for traditional medicine in Asian countries as well as in manufacturing wine, food, and beverages. Germplasm analysis among Mulberry cultivars originating from South Korea is crucial in the plant breeding program for cultivar development. Hence, the genetic deviations and relations among 8 Morus alba plants, and one Morus lhou plant, of different cultivars collected from South Korea were investigated using 10 random amplified polymorphic DNA (RAPD and 10 inter-simple sequence repeat (ISSR markers in the present study. The ISSR markers exhibited a higher polymorphism (63.42% among mulberry genotypes in comparison to RAPD markers. Furthermore, the similarity coefficient was estimated for both markers and found to be varying between 0.183 and 0.814 for combined pooled data of ISSR and RAPD. The phenogram drawn using the UPGMA cluster method based on combined pooled data of RAPD and ISSR markers divided the nine mulberry genotypes into two divergent major groups and the two individual independent accessions. The distant relationship between Dae-Saug (SM1 and SangchonJo Sang Saeng (SM5 offers a possibility of utilizing them in mulberry cultivar improvement of Morus species of South Korea.

  17. Estimating Genetic Conformism of Korean Mulberry Cultivars Using Random Amplified Polymorphic DNA and Inter-Simple Sequence Repeat Profiling.

    Science.gov (United States)

    Sheet, Sunirmal; Ghosh, Kuntal; Acharya, Satabdi; Kim, Kwang-Pyo; Lee, Yang Soo

    2018-03-15

    Apart from being fed to silkworms in sericulture, the ecologically important Mulberry plant has been used for traditional medicine in Asian countries as well as in manufacturing wine, food, and beverages. Germplasm analysis among Mulberry cultivars originating from South Korea is crucial in the plant breeding program for cultivar development. Hence, the genetic deviations and relations among 8 Morus alba plants, and one Morus lhou plant, of different cultivars collected from South Korea were investigated using 10 random amplified polymorphic DNA (RAPD) and 10 inter-simple sequence repeat (ISSR) markers in the present study. The ISSR markers exhibited a higher polymorphism (63.42%) among mulberry genotypes in comparison to RAPD markers. Furthermore, the similarity coefficient was estimated for both markers and found to be varying between 0.183 and 0.814 for combined pooled data of ISSR and RAPD. The phenogram drawn using the UPGMA cluster method based on combined pooled data of RAPD and ISSR markers divided the nine mulberry genotypes into two divergent major groups and the two individual independent accessions. The distant relationship between Dae-Saug (SM1) and SangchonJo Sang Saeng (SM5) offers a possibility of utilizing them in mulberry cultivar improvement of Morus species of South Korea.

  18. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  19. Conformational polymorphism of m7GTP in crystal structure of the PB2 middle domain from human influenza A virus.

    Directory of Open Access Journals (Sweden)

    Toshiharu Tsurumura

    Full Text Available Influenza pandemics with human-to-human transmission of the virus are of great public concern. It is now recognized that a number of factors are necessary for human transmission and virulence, including several key mutations within the PB2 subunit of RNA-dependent RNA polymerase. The structure of the middle domain in PB2 has been revealed with or without m(7GTP, thus the middle domain is considered to be novel target for structure-based drug design. Here we report the crystal structure of the middle domain of H1N1 PB2 with or without m(7GTP at 1.9 Å and 2.0 Å resolution, respectively, which has two mutations (P453H, I471T to increase electrostatic potential and solubility. Here we report the m(7GTP has unique conformation differ from the reported structure. 7-methyl-guanine is fixed in the pocket, but particularly significant change is seen in ribose and triphosphate region: the buried 7-methyl-guanine indeed binds in the pocket forming by H357, F404, E361 and K376 but the triphosphate continues directly to the outer domain. The presented conformation of m(7GTP may be a clue for the anti-influenza drug-design.

  20. Drug Development in Conformational Diseases: A Novel Family of Chemical Chaperones that Bind and Stabilise Several Polymorphic Amyloid Structures.

    Directory of Open Access Journals (Sweden)

    Marquiza Sablón-Carrazana

    Full Text Available The increasing prevalence of conformational diseases, including Alzheimer's disease, type 2 Diabetes Mellitus and Cancer, poses a global challenge at many different levels. It has devastating effects on the sufferers as well as a tremendous economic impact on families and the health system. In this work, we apply a cross-functional approach that combines ideas, concepts and technologies from several disciplines in order to study, in silico and in vitro, the role of a novel chemical chaperones family (NCHCHF in processes of protein aggregation in conformational diseases. Given that Serum Albumin (SA is the most abundant protein in the blood of mammals, and Bovine Serum Albumin (BSA is an off-the-shelf protein available in most labs around the world, we compared the ligandability of BSA:NCHCHF with the interaction sites in the Human Islet Amyloid Polypeptide (hIAPP:NCHCHF, and in the amyloid pharmacophore fragments (Aβ17-42 and Aβ16-21:NCHCHF. We posit that the merging of this interaction sites is a meta-structure of pharmacophore which allows the development of chaperones that can prevent protein aggregation at various states from: stabilizing the native state to destabilizing oligomeric state and protofilament. Furthermore to stabilize fibrillar structures, thus decreasing the amount of toxic oligomers in solution, as is the case with the NCHCHF. The paper demonstrates how a set of NCHCHF can be used for studying and potentially treating the various physiopathological stages of a conformational disease. For instance, when dealing with an acute phase of cytotoxicity, what is needed is the recruitment of cytotoxic oligomers, thus chaperone F, which accelerates fiber formation, would be very useful; whereas in a chronic stage it is better to have chaperones A, B, C, and D, which stabilize the native and fibril structures halting self-catalysis and the creation of cytotoxic oligomers as a consequence of fiber formation. Furthermore, all the

  1. Development of 112 unique expressed sequence tags from chicken liver using an arbitrarily primed reserve transcriptase-polymerase chain reaction and single strand conformation gel purification method

    NARCIS (Netherlands)

    Carré, W.; Diot, C.; Fillon, V.; Crooijmans, R.P.M.A.; Lagarrique, S.; Morrisson, M.; Vignal, A.; Groenen, M.A.M.; Douai, M.

    2001-01-01

    In order to provide information on chicken genome expression, expressed sequence tags (ESTs) were developed from chicken liver RNAs using a method based on arbitrarily primed reverse transcription-polymerase chain reaction (RT-PCR) of total RNAs. The method is similar to differential display, using

  2. Relationship of plasminogen activator inhibitor 1 gene 4G/5G polymorphisms to hypertension in Korean women.

    Science.gov (United States)

    Kim, Kyu-nam; Kim, Kwang-min; Kim, Bom-taeck; Joo, Nam-seok; Cho, Doo-yeoun; Lee, Duck-joo

    2012-04-01

    Hypertension (HTN) is a major determinant of various cardiovascular events. Plasma levels of plasminogen activator inhibitor 1 (PAI-1) modulate this risk. A deletion/insertion polymorphism within the PAI-1 loci (4G/4G, 4G/5G, 5G/5G) affects the expression of this gene. The present study investigated the association between PAI-1 loci polymorphisms and HTN in Korean women. Korean women (n = 1312) were enrolled in this study to evaluate the association between PAI-1 4G/5G gene polymorphisms and HTN as well as other metabolic risk factors. PAI-1 loci polymorphisms were investigated using polymerase chain reaction amplification and single-strand conformation polymorphism analysis. The three genotype groups differed with respect to systolic blood pressure (P = 0.043), and diastolic blood pressure (P = 0.009) but not with respect to age, body mass index, total cholesterol, low or high density lipoprotein cholesterol, triglycerides, or fasting blood glucose. Carriers of the PAI-1 4G allele had more hypertension significantly (PAI-1 4G/5G vs. PAI-1 5G/5G, P = 0.032; PAI-1 4G/4G vs. PAI-1 5G/5G, P = 0.034). When stratified according to PAI-1 4G/5G polymorphism, there was no significant difference in all metabolic parameters among PAI-1 genotype groups in patients with HTN as well as subjects with normal blood pressure. The estimated odds ratio of the 4G/4G genotype and 4G/5G for HTN was 1.7 (P = 0.005), and 1.6 (P = 0.015), respectively. These findings might indicate that PAI-1 loci polymorphisms independently contribute to HTN and that gene-environmental interaction may be not associated in Korean women.

  3. Effects of rs769217 and rs1001179 polymorphisms of catalase gene on blood catalase, carbohydrate and lipid biomarkers in diabetes mellitus.

    Science.gov (United States)

    Góth, László; Nagy, Teréz; Kósa, Zsuzsanna; Fejes, Zsolt; Bhattoa, Harjit Pal; Paragh, György; Káplár, Miklós

    2012-10-01

    Oxidative stress and deficiency of the enzyme catalase, which is the primary scavenger of the oxidant H(2)O(2), may contribute to diabetes. The current study examined two polymorphisms in the catalase gene, -262C>nT in the promoter and 111C>T in exon 9, and their effects on blood catalase activity as well as on concentrations of blood glucose, haemoglobin A1c, triglyceride, cholesterol, HDL, LDL, ApoA-I and ApoB. Subjects were type-1 and type-2 diabetics. We evaluated PCR-single strand conformational polymorphism for 111C>T and PCR-restriction fragment length polymorphism for - 262C>T. TT genotype frequency of 111C>T polymorphism was increased in type-1 diabetes. Type-2 diabetics with the CC or CT genotypes had decreased catalase and increased glucose, hemoglobinA1c and ApoB. Type-2 diabetics who have TT genotype in -262C>T may have elevated risk for diabetes complications; these patients had the lowest mean catalase and HDL, as well as the highest glucose, haemoglobin A1c, cholesterol and ApoB.

  4. Mapping of the serotonin 5-HT{sub 1D{alpha}} autoreceptor gene (HTR1D) on chromosome 1 using a silent polymorphism in the coding region

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, N.; Lappalainen, J.; Linnoila, M. [National Institute on Alcohol Abuse and Alcoholism, Rockville, MD (United States)] [and others

    1995-04-24

    Serotonin (5-HT){sub ID} receptors are 5-HT release-regulating autoreceptors in the human brain. Abnormalities in brain 5-HT function have been hypothesized in the pathophysiology of various psychiatric disorders, including obsessive-compulsive disorder, autism, mood disorders, eating disorders, impulsive violent behavior, and alcoholism. Thus, mutations occurring in 5-HT autoreceptors may cause or increase the vulnerability to any of these conditions. 5-HT{sub 1D{alpha}} and 5-HT{sub 1D{Beta}} subtypes have been previously localized to chromosomes 1p36.3-p34.3 and 6q13, respectively, using rodent-human hybrids and in situ localization. In this communication, we report the detection of a 5-HT{sub 1D{alpha}} receptor gene polymorphism by single strand conformation polymorphism (SSCP) analysis of the coding sequence. The polymorphism was used for fine scale linkage mapping of 5-HT{sub 1D{alpha}} on chromosome 1. This polymorphism should also be useful for linkage studies in populations and in families. Our analysis also demonstrates that functionally significant coding sequence variants of the 5-HT{sub 1D{alpha}} are probably not abundant either among alcoholics or in the general population. 14 refs., 1 fig., 1 tab.

  5. T-cell receptor variable alpha (TCRAV) polymorphisms in European, Chinese, South American, AfroCaribbean, and Gambian populations.

    Science.gov (United States)

    Ibberson, M R; Copier, J P; Llop, E; Navarrete, C; Hill, A V; Cruickshank, J K; So, A K

    1998-01-01

    Interactions involving the T-cell receptor (TCR) and major histocompatibility complex (MHC) are fundamental to the generation of a specific immune response. The study of interpopulation differences in TCR genes may identify those genes which are subject to selection, and also provides useful information for future genetic studies in these populations. In this study we present analysis of five TCRAV polymorphisms, for V5S1, V6S1, V8S1, V17S1, and V21S1 loci in five human populations by single-strand conformational polymorphism (SSCP) analysis. Caucasian, Chinese, Gambian, AfroCaribbean, and South American Indians (Mapuches) showed marked interpopulation variation for both the silent (V5S1, V17S1, and V21S1) and coding (V6S1 and V8S1) polymorphisms. In general the alleles were conserved in the different populations, but new, additional variants were found for V5S1 and V17S1 in Gambians and Caucasians. V6S1 overall showed the highest nucleotide diversity, and V6S1 genotype distributions were skewed away from expected values in Chinese and Mapuches. Analysis of allelic associations showed a general lack of linkage disequilibrium between the loci, which was reflected by the absence of strong population-specific haplotypes.

  6. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  7. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  8. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  9. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  10. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  11. Codon 201Gly Polymorphic Type of the DCC Gene is Related to Disseminated Neuroblastoma

    Directory of Open Access Journals (Sweden)

    Xiao-Tang Kong

    2001-01-01

    Full Text Available The deleted in colorectal carcinoma (DCC gene is a potential tumor- suppressor gene on chromosome 18821.3. The relatively high frequency of loss of heterozygosity (LOH and loss of expression of this gene in neuroblastoma, especially in the advanced stages, imply the possibility of involvement of the DCC gene in progression of neuroblastoma. However, only few typical mutations have been identified in this gene, indicating that other possible mechanisms for the inactivation of this gene may exist. A polymorphic change (Arg to Gly at DCC codon 201 is related to advanced colorectal carcinoma and increases in the tumors with absent DCC protein expression. In order to understand whether this change is associated with the development or progression of neuroblastoma, we investigated codon 201 polymorphism of the DCC gene in 102 primary neuroblastomas by polymerase chain reaction single-strand conformation polymorphism. We found no missense or nonsense mutations, but a polymorphic change from CGA (Arg to GGA (Gly at codon 201 resulting in three types of polymorphism: codon 201Gly type, codon 201Arg/Gly type, and codon 201Arg type. The codon 201Gly type occurred more frequently in disseminated (stages IV and IVs neuroblastomas (72% than in localized (stages I, II, and III tumors (48% (P=.035, and normal controls (38% (P=.024. In addition, the codon 201Gly type was significantly more common in tumors found clinically (65% than in those found by mass screening (35% (P=.002. The results suggested that the codon 201Gly type of the DCC gene might be associated with a higher risk of disseminating neuroblastoma.

  12. Association of transforming growth-factor alpha gene polymorphisms with nonsyndromic cleft palate only (CPO)

    Energy Technology Data Exchange (ETDEWEB)

    Shiang, R. (Univ. of California, Irvine, CA (United States)); Lidral, A.C.; Ardinger, H.H.; Murray, J.C.; Romitti, P.A.; Munger, R.G.; Buetow, K.H.

    1993-10-01

    Genetic analysis and tissue-specific expression studies support a role for transforming growth-factor alpha (TGFA) in craniofacial development. Previous studies have confirmed an association of alleles for TGFA with nonsyndromic cleft lip with or without cleft palate (CL/P) in humans. The authors carried out a retrospective association study to determine whether specific allelic variants of the TGFA gene are also associated with cleft palate only (CPO). The PCR products from 12 overlapping sets of primers to the TGFA cDNA were examined by using single-strand conformational polymorphism analysis. Four DNA polymorphic sites for TGFA were identified in the 3[prime] untranslated region of the TGFA gene. These variants, as well as previously identified RFLPs for TGFA, were characterized in case and control populations for CPO by using X[sup 2] analysis. A significant association between alleles of TGFA and CPO was identified which further supports a role for this gene as one of the genetic determinants of craniofacial development. Sequence analysis of the variants disclosed a cluster of three variable sites within 30 bp of each other in the 3[prime] untranslated region previously associated with an antisense transcript. These studies extend the role for TGFA in craniofacial morphogenesis and support an interrelated mechanism underlying nonsyndromic forms of CL/P. 46 refs., 3 figs., 3 tabs.

  13. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  15. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  16. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  17. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  18. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  19. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  20. New polymorphisms of the angiotensin II type 1 receptor gene and their associations with myocardial infarction and blood pressure: the ECTIM study. Etude Cas-Témoin de l'Infarctus du Myocarde.

    Science.gov (United States)

    Poirier, O; Georges, J L; Ricard, S; Arveiler, D; Ruidavets, J B; Luc, G; Evans, A; Cambien, F; Tiret, L

    1998-10-01

    In an earlier report, we suggested that a polymorphism located in the 3' untranslated region of the angiotensin II type 1 receptor gene (AT1R+1166 A/C) might interact with the angiotensin I converting enzyme (ACE) insertion/deletion (I/D) polymorphism to increase the risk of myocardial infarction. Since the AT1R+1166 A/C polymorphism does not appear to be functional, we postulated that it might be in linkage disequilibrium with an unidentified functional variant which would affect the regulation of the gene in response to angiotensin II. The present study was conducted to identify new polymorphisms of the AT1R gene that might be responsible for this interaction. The first four exons, which are untranslated, and 2.2 kb in the 5' flanking region of the AT1R gene were explored by polymerase chain reaction/single-strand conformation polymorphism. Seven polymorphisms were detected in the 5' region at positions -1424, -810, -713, -521, -214, -213 and -153 upstream from the start of transcription. The genotypes of the -810, -713, -214, -213 and -153 polymorphisms were completely concordant. One substitution was detected at the 55th nucleotide of exon 4. These polymorphisms, together with the +1166 A/C polymorphism and a previously described T/C substitution at the 573th nucleotide of exon 5, were genotyped in the Etude Cas-Témoin de l'Infarctus du Myocarde (ECTIM) study, a multicentre study comparing 651 patients who had survived a myocardial infarction and 728 controls from Belfast (United Kingdom) and Lille, Strasbourg and Toulouse (France). The newly identified polymorphisms were not in linkage disequilibrium with the +1166 A/C polymorphism and therefore could not explain the interaction observed with ACE I/D. None of the polymorphisms was associated with blood pressure levels in control subjects. In the four populations, the A allele of the -810 polymorphism was associated with a lower risk of myocardial infarction (population-adjusted odds ratio of 0.80, confidence

  1. Influences of melatonin treatment, melatonin receptor 1A (MTNR1A) and kisspeptin (KiSS-1) gene polymorphisms on first conception in Sarda ewe lambs.

    Science.gov (United States)

    Luridiana, S; Mura, M C; Daga, C; Cosso, G; Bodano, S; Farci, F; Zidda, F; Carcangiu, V

    2016-04-01

    In order to investigate if the melatonin receptor 1A (MTNR1A) and kisspeptin (KiSS-1) genes influence the reproductive response to melatonin treatment, 510 Sarda ewe lambs were divided into groups C (control) and M; Group M received one melatonin implant (18mg). After 35 days rams were introduced for 40 days and subsequent lambing dates and number of newborns were recorded. The MTNR1A gene Exon II and KiSS-1 gene Exon I were amplified and genotyped by restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism analysis. Two single nucleotide polymorphisms (SNPs; C606T and G612A) in MTNR1A and one (G1035A) in KiSS-1 were found. The most frequent genotypes were G/G (63%) and C/C (53%) for MTNR1A and G/G (92%) for KiSS-1. Treated animals showed a higher lambing rate (Pewe lambs and highlighted that the G/G genotype of the MTNR1A gene is able to influence the reproductive response to melatonin treatment.

  2. The p.Arg86Gln change in GARP2 (glutamic acid-rich protein-2) is a common West African-related polymorphism.

    Science.gov (United States)

    Gibriel, Abdullah A Y; Tate, Rothwelle J; Yu, Yongbin; Rawson-Lax, Emma; Hammer, Harold M; Tettey, Justice N A; Pyne, Nigel J; Converse, Carolyn A

    2013-02-15

    The aim of the present study is to probe the potential association between previously-reported GARP2 mutations and retinitis pigmentosa (RP) using Scottish RP patients and controls. Exons 4, 5 and 8 in DNA from blood or buccal samples (130 autosomal recessive and simplex RP patients, 31 controls) were amplified and analysed for single-strand conformational polymorphism by capillary electrophoresis (CE-SSCP) and confirmed by sequencing. The p.Arg86Gln mutation in exon 4 was found in just one patient (out of 130), and in 10 of the 31 unaffected subjects. All of these occurrences were in people of West African origin (patient and controls). Two polymorphisms in exon 5, p.His100Arg and p.Gly109Gly, and a c.534+20A>G change in the intronic region flanking the 3' end of exon 8 were also found not to be associated with RP. The Scottish population examined here had no mutations in the GARP2 exons surveyed that could be associated with RP. The p.Arg86Gln mutation actually appears to be a polymorphism common in ethnic West Africans and not associated with RP. This change may provide a useful marker for West African ancestry. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Chromosome Conformation Capture Carbon Copy (5C) in Budding Yeast.

    Science.gov (United States)

    Belton, Jon-Matthew; Dekker, Job

    2015-06-01

    Chromosome conformation capture carbon copy (5C) is a high-throughput method for detecting ligation products of interest in a chromosome conformation capture (3C) library. 5C uses ligation-mediated amplification (LMA) to generate carbon copies of 3C ligation product junctions using single-stranded oligonucleotide probes. This procedure produces a 5C library of short DNA molecules which represent the interactions between the corresponding restriction fragments. The 5C library can be amplified using universal primers containing the Illumina paired-end adaptor sequences for subsequent high-throughput sequencing. © 2015 Cold Spring Harbor Laboratory Press.

  4. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  5. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  6. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  7. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  8. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  9. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  10. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  11. Genetic polymorphisms and possible gene-gene interactions in metabolic and DNA repair genes: Effects on DNA damage

    Czech Academy of Sciences Publication Activity Database

    Naccarati, Alessio; Souček, P.; Štětina, R.; Haufroid, V.; Kumar, R.; Vodičková, Ludmila; Trtková, K.; Dušinská, M.; Hemminki, K.; Vodička, Pavel

    2006-01-01

    Roč. 593, 1-2 (2006), s. 22-31 ISSN 0027-5107 R&D Projects: GA ČR GA310/03/0437 Institutional research plan: CEZ:AV0Z5039906 Keywords : Single-strand breaks * Genetic polymorphisms * Metabolism Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.111, year: 2006

  12. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Science.gov (United States)

    Ni, Jing; You, Feng; Xu, Jianhe; Xu, Dongdong; Wen, Aiyun; Wu, Zhihao; Xu, Yongli; Zhang, Peijun

    2012-03-01

    The growth hormone gene ( GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits. In this study, we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker, Larimichthys crocea, from Zhejiang and Fujian stocks. The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1, named AA and AB genotypes, in Zhejiang stock. AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height ( P≤0.05). Two different genotypes, CC and CD, were identified in intron 2 in Fujian stock, with CD showing an SNP at position 692 (T→C). The CD genotype had a significantly positive correlation with both weight and total length ( P≤0.01). These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  13. Doppel gene polymorphisms in Portuguese sheep breeds: insights on ram fertility.

    Science.gov (United States)

    Pereira, R M; Mesquita, P; Batista, M; Baptista, M C; Barbas, J P; Pimenta, J; Santos, I C; Marques, M R; Vasques, M I; Silva Pereira, M; Santos Silva, F; Oliveira Sousa, M C; Fontes, C M G; Horta, A E M; Prates, J A M; Marques, C C

    2009-08-01

    Transgenic knockout of the gene encoding the prion-like protein Doppel leads to male infertility in mice. The precise role of Doppel in male fertility is still unclear, but sperm from Doppel-deficient mice appear to be unable to undergo the normal acrosome reaction necessary to penetrate the zona pellucida of the oocyte. The objective of this study was to characterize Doppel (Prnd) gene polymorphisms in eight Portuguese sheep breeds and to determine a possible relationship between these polymorphisms and ram fertility. Ovine genomic DNA of 364 animals of different breeds (Bordaleira entre Douro e Minho, Churra Badana, Churra Galega Mirandesa, Churra Mondegueira, Merino da Beira Baixa, Merino Branco, Saloia and Serra da Estrela) were analysed by multiple restriction fragment-single-strand conformation polymorphism (MRF-SSCP). This analysis revealed a synonymous substitution G-->A in codon 26 of Prnd gene. Churra Galega Mirandesa and Saloia breeds were more polymorphic (P=0.005 and P=0.04, respectively) than the overall population, while Serra da Estrela and Merino Branco animals were less polymorphic (P=0.007 and P=0.04). No polymorphism was found in Churra Mondegueira breed. Semen from 11 rams of Churra Galega Mirandesa breed (7 homozygous wildtype GG and 4 heterozygous GA) routinely used in the Portuguese Animal Germoplasm Bank was collected and frozen for fertility tests. A classification function was estimated, using data from post-swim-up semen motility and concentration and Day 6 embryo production rate, allowing the identification of the Doppel homozygous GG genotype with 86.7% of accuracy. This preliminary study detected the presence of only one polymorphism in codon 26 of Prnd gene in the Portuguese sheep breeds. In the polymorphic Churra Galega Mirandesa breed, GG genotype could be characterized through a model using three fertility traits, suggesting a relationship with male reproduction. Any future research should investigate not only AA genotype and its

  14. Further exploration of the conformational space of α-synuclein fibrils: solid-state NMR assignment of a high-pH polymorph.

    Science.gov (United States)

    Verasdonck, Joeri; Bousset, Luc; Gath, Julia; Melki, Ronald; Böckmann, Anja; Meier, Beat H

    2016-04-01

    Polymorphism is a common and important phenomenon for protein fibrils which has been linked to the appearance of strains in prion and other neurodegenerative diseases. Parkinson disease is a frequently occurring neurodegenerative pathology, tightly associated with the formation of Lewy bodies. These deposits mainly consist of α-synuclein in fibrillar, β-sheet-rich form. α-synuclein is known to form numerous different polymorphs, which show distinct structural features. Here, we describe the chemical shift assignments, and derive the secondary structure, of a polymorph that was fibrillized at higher-than-physiological pH conditions. The fibrillar core contains residues 40-95, with both the C- and N-terminus not showing any ordered, rigid parts. The chemical shifts are similar to those recorded previously for an assigned polymorph that was fibrillized at neutral pH.

  15. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  16. Association of ATP1A1 gene polymorphism with thermotolerance in Tharparkar and Vrindavani cattle

    Directory of Open Access Journals (Sweden)

    Neeraj Kashyap

    2015-07-01

    Full Text Available Aim: One of the major biochemical aspects of thermoregulation is equilibrium of ion gradient across biological membranes. Na+/K+-ATPase, a member of P type-ATPase family, is a major contributor to the mechanism that actively controls crossmembrane ion gradient. Thus, we examined ATP1A1 gene that encodes alpha-1 chain of Na+/K+-ATPase, for genetic polymorphisms. Materials and Methods: A total of 100 Vrindavani (composite cross strain of Hariana x Holstein-Friesian/Brown Swiss/Jersey and 64 Tharparkar (indigenous cattle were screened for genetic polymorphism in ATP1A1 gene, using polymerase chain reaction single-strand conformation polymorphism and DNA sequencing. For association studies, rectal temperature (RT and respiration rate (RR of all animals were recorded twice daily for 3 seasons. Results: A SNP (C2789A was identified in exon 17 of ATP1A1 gene. Three genotypes namely CC, CA, and AA were observed in both, Vrindavani and Tharparkar cattle. The gene frequencies in Tharparkar and Vrindavani for allele A were 0.51 and 0.48, and for allele C were 0.49 and 0.52, respectively, which remained at intermediate range. Association study of genotypes with RT and RR in both cattle population revealed that the animals with genotype CC exhibited significantly lower RT and higher heat tolerance coefficient than CA and AA genotypes. Conclusion: Differential thermoregulation between different genotypes of ATP1A1 gene indicate that the ATP1A1 gene could be potentially contributing to thermotolerance in both, Tharparkar, an indigenous breed and Vrindavani, a composite crossbred cattle.

  17. Programmed Switching of Single Polymer Conformation on DNA Origami

    DEFF Research Database (Denmark)

    Krissanaprasit, Abhichart; Madsen, Mikael; Knudsen, Jakob Bach

    2016-01-01

    ) by DNA hybridization directed by single-stranded guiding strands and ssDNA tracks extending from the origami surface and polymer handle. We demonstrate switching of a conjugated organic polymer conformation between left- and right-turned conformations of the polymer on DNA origami based on toehold......-mediated strand displacement. The switching is observed by atomic force microscopy and by Förster resonance energy transfer between the polymer and two different organic dyes positioned in close proximity to the respective patterns. Using this method, the polymer conformation can be switched six times...... successively. This controlled nanomechanical switching of conjugated organic polymer conformation demonstrates unique control of the shape of a single polymer molecule, and it may constitute a new component for the development of reconfigurable nanophotonic and nanoelectronic devices....

  18. Ionic interactions and the global conformations of the hammerhead ribozyme

    DEFF Research Database (Denmark)

    Bassi, G S; Møllegaard, N E; Murchie, A I

    1995-01-01

    Here we investigate the global conformation of the hammerhead ribozyme. Electrophoretic studies demonstrate that the structure is folded in response to the concentration and type of ions present. Folding based on colinear alignment of arms II and III is suggested, with a variable angle subtended ......-line attack of the 2'-hydroxyl group, with a bound metal ion playing an integral role in the chemistry.......Here we investigate the global conformation of the hammerhead ribozyme. Electrophoretic studies demonstrate that the structure is folded in response to the concentration and type of ions present. Folding based on colinear alignment of arms II and III is suggested, with a variable angle subtended...... by the remaining helix I. In the probable active conformation, a small angle is subtended between helices I and II. Using uranyl photocleavage, an ion binding site has been detected in the long single-stranded region. The folded conformation could generate a preactivation of the scissile bond to permit in...

  19. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  20. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  1. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  2. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  3. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  4. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  5. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  6. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  7. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  10. Sequence polymorphisms at the growth hormone GH1/GH2-N and GH2-Z gene copies and their relationship with dairy traits in domestic sheep (Ovis aries).

    Science.gov (United States)

    Vacca, G M; Dettori, M L; Balia, F; Luridiana, S; Mura, M C; Carcangiu, V; Pazzola, M

    2013-09-01

    The purpose was to analyze the growth hormone GH1/GH2-N and GH2-Z gene copies and to assess their possible association with milk traits in Sarda sheep. Two hundred multiparous lactating ewes were monitored. The two gene copies were amplified separately and each was used as template for a nested PCR, to investigate single strand conformation polymorphism (SSCP) of the 5'UTR, exon-1, exon-5 and 3'UTR DNA regions. SSCP analysis revealed marked differences in the number of polymorphic patterns between the two genes. Sequencing revealed five nucleotide changes at the GH1/GH2-N gene. Five nucleotide changes occurred at the GH2-Z gene: one was located in exon-5 (c.556G > A) and resulted in a putative amino acid substitution G186S. All the nucleotide changes were copy-specific, except c.*30delT, which was common to both GH1/GH2-N and GH2-Z. Variability in the promoter regions of each gene might have consequences on the expression level, due to the involvement in potential transcription factor binding sites. Both gene copies influenced milk yield. A correlation with milk protein and casein content was also evidenced. These results may have implications that make them useful for future breeding strategies in dairy sheep breeding.

  11. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  12. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen

    2005-01-01

    Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed...

  13. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  14. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  15. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  16. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  17. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  18. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Polymorphisms but Not Mutations of the KCNQ1 Gene Are Associated with Lone Atrial Fibrillation in the Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Hui-min Chu

    2013-01-01

    Full Text Available Background. Recent studies suggest that mutation of the slow delayed rectifier potassium channel (IKs contributes to familial atrial fibrillation (FAF. In the current study, we identified common genetic variants of KCNQ1 and explored the potential association between KCNQ1 polymorphism with lone AF (LAF. Methods. Clinical data and blood samples were collected from 190 Han Chinese patients with sporadic AF and matched healthy controls. Variants of the KCNQ1 gene were identified using single-strand conformational polymorphism (SSCP analysis. A case-control association study in KCNQ1 identified six known single-nucleotide polymorphisms (SNPs during SSCP screening of the 190 LAF patients and 190 healthy controls. Results. One of the SNPs in KCNQ1 was strongly associated with LAF; significant allelic association was detected rs59233444 (P=0.013, OR=1.469, 95% confidence interval (CI: 1.083–1.993. A multiple regression analysis indicated that rs59233444 is an independent risk factor for LAF. Twelve new variants were identified in KCNQ1, including one in the 5′-UTR, two in the 3′-UTR, six in introns, two synonymous substitutions, and one missense substitution. Variants c.1009C>T, c.1860C>T, and c.+2285C>T were not present in the 190 controls, and the others were identified in controls at various frequencies. Conclusions. rs59233444, a common SNP but not mutation in the coding regions of the KCNQ1 gene, is a risk factor for LAF in Chinese Han population.

  1. Detection of polymorphisms of the mtDNA control region of Caretta caretta (Testudines: Cheloniidae) by PCR-SSCP.

    Science.gov (United States)

    Reis, E C; Albano, R M; Bondioli, A C V; Soares, L S; Lôbo-Hajdu, G

    2009-02-25

    Marine turtles are increasingly being threatened worldwide by anthropogenic activities. Better understanding of their life cycle, behavior and population structure is imperative for the design of adequate conservation strategies. The mtDNA control region is a fast-evolving matrilineal marker that has been employed in the study of marine turtle populations. We developed and tested a simple molecular tracing system for Caretta caretta mtDNA haplotypes by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). Using this technique, we were able to distinguish the SSCP patterns of 18 individuals of the haplotypes CC-A4, CC-A24 and CCxLO, which are commonly found in turtles sampled on the Brazilian coast. When we analyzed 15 turtles with previously unknown sequences, we detected two other haplotypes, in addition to the other four. Based on DNA sequencing, they were identified as the CC-A17 and CC-A1 haplotypes. Further analyses were made with the sea turtles, Chelonia mydas (N = 8), Lepidochelys olivacea (N = 3) and Eretmochelys imbricata (N = 1), demonstrating that the PCR-SSCP technique is able to distinguish intra- and interspecific variation in the family Cheloniidae. We found that this technique can be useful for identifying sea turtle mtDNA haplotypes, reducing the need for sequencing.

  2. Ionic interactions and the global conformations of the hammerhead ribozyme

    DEFF Research Database (Denmark)

    Bassi, G S; Møllegaard, N E; Murchie, A I

    1995-01-01

    Here we investigate the global conformation of the hammerhead ribozyme. Electrophoretic studies demonstrate that the structure is folded in response to the concentration and type of ions present. Folding based on colinear alignment of arms II and III is suggested, with a variable angle subtended......-line attack of the 2'-hydroxyl group, with a bound metal ion playing an integral role in the chemistry....... by the remaining helix I. In the probable active conformation, a small angle is subtended between helices I and II. Using uranyl photocleavage, an ion binding site has been detected in the long single-stranded region. The folded conformation could generate a preactivation of the scissile bond to permit in...

  3. [The relationships between the single nueleotide polymorphisms of CACNA1S gene 11 exon and thyrotoxic hypokalemic periodic paralysis in the people of Han Nationality in Sichuan Province, China].

    Science.gov (United States)

    Xiao, Zhu; Li, Li; Li, Sheyu; Yao, Yu; Liu, Yuping; Tian, Haoming

    2011-06-01

    The present research was aimed to investigate the relationships between the single nueleotide polymorphisms (SNPs) of CACNA1S gene 11 exon and thyrotoxic hypokalemic periodic paralysis (THPP)in the people of Han Nationality in Sichuan China. 100 male subjects were divided into four groups in this study, i.e., 22 patients with THPP, 23 patients with hypokalemic periodic paralysis (HPP), 33 patients with thyrotoxicosis but without hypokalemic periodic paralysis (NTHPP), and 22 healthy (control group) subjects. The sequences of the CACNA1S gene exon 11 polymorphisms, for the four groups respectively, were analysed by the SNPs method with polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA direct sequencing. A meta-analysis of three additional studies was also performed. Three SNPs of exon 11 of the CACNA1S gene (C1491T, T1551C, C1564T) were present in all the four groups. The polymorphisms C1491T and T1551C were present in both homozygotes and heterozygotes, while the C1564T polymorphism was present only in heterozygotes. The genotype frequencies of variants at C1491T and T1551C were not significantly associated with TPP (dominant model: P=0.530 and P=0.568; allele frequency model: P=0.563 and P=0.568). A Meta-analysis yielded combined odds ratio (OR) for TPP of 2. 12 (95% CI: 0.80-5.60) at C1491T, 2.90 (95% CI: 0.71-11.78) at T1551C, and 1.61 (95% CI: 0.36-7.26) at C1564T with the dominant model. These results suggested that three SNPs of CACNA1S gene exon 11 definitely could exist but could not be associated with TPP people of Han Nationality in Sichuan.

  4. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  5. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  6. Gene-based single nucleotide polymorphism markers for genetic and association mapping in common bean.

    Science.gov (United States)

    Galeano, Carlos H; Cortés, Andrés J; Fernández, Andrea C; Soler, Álvaro; Franco-Herrera, Natalia; Makunde, Godwill; Vanderleyden, Jos; Blair, Matthew W

    2012-06-26

    In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. In short, this study illustrates the power of intron-based markers for linkage and association mapping in

  7. Conformal House

    DEFF Research Database (Denmark)

    Ryttov, Thomas; Sannino, Francesco

    2010-01-01

    fixed point. As a consistency check we recover the previously investigated conformal windows bounds when restricting to a single matter representation. The earlier conformal windows can be imagined to be part now of the new conformal house. We predict the nonperturbative anomalous dimensions...... at the infrared fixed points. We further investigate the effects of adding mass terms to the condensates on the conformal house chiral dynamics and construct the simplest instanton induced effective Lagrangian terms....

  8. Investigations of the conformation of DNA, native or alterated by irradiation, with ultraviolet radiation

    International Nuclear Information System (INIS)

    Zierenberg, B.

    1971-01-01

    An extension of the range of scattering angles in the direction of smaller angles (up to delta = 12 0 ) made it possible to successfully use the light scattering methods for the determination of DNA molecular weights >= 3 x 10 6 . In order to determine the conformation of native DNA in solution, different molecular weights were prepared by ultrasonic degradation. According to their hyperchromicity, these preparations are practically native. When native DNA in solution is irradiated with UV light of the wavelength lambda = 313 nm, two different photoreactions may occur: a) double and single strand breaks leading to degradation of the DNA molecule, and b) dimerisation of neighbouring thymine bases. The two reactions are independent of each other. In the presence of acetophenone as photosensitizer, the reaction type a) is greater by a factor 4 (in terms of single-strand breaks), while the reaction type b) is greater by a factor 16. The number of thymidine dimers per single strand break amounts to 100 for photosensitized reactions and to 25 for non-photosensitized reactions. The number of single strand breaks in terms of the quantum flux of 1 μ Einstein absorbed by the DNA is greater by a factor 3 during irradiation with UV light lambda = 254 nm as compared to the wavelength lambda = 313 nm. At this wavelength, DNA degradation starts at absorption energies as low as >= 2 x 10 7 erg/cm 3 . Light scattering and measurements with DNA containing thymidine dimers indicated neither a change in the total conformation nor a noticeable change in the microstructure. The hyperchromicity of the DNA was also unchanged. From these experimental results, it is concluded that the double helix of DNA is essentially stable to thymidine dimerisation. (orig./MG) [de

  9. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  10. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  11. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  12. Transportation Conformity

    Science.gov (United States)

    This section provides information on: current laws, regulations and guidance, policy and technical guidance, project-level conformity, general information, contacts and training, adequacy review of SIP submissions

  13. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  14. Characterization of a novel mutation in the cardiac ryanodine receptor that results in catecholaminergic polymorphic ventricular tachycardia

    Science.gov (United States)

    Jiang, Dawei; Jones, Peter P; Davis, Darryl R; Gow, Robert; Green, Martin S; Birnie, David H; Chen, SR Wayne

    2010-01-01

    Catecholaminergic polymorphic ventricular tachycardia (CPVT) is an arrhythmogenic disease that manifests as syncope or sudden death during high adrenergic tone in the absence of structural heart defects. It is primarily caused by mutations in the cardiac ryanodine receptor (RyR2). The mechanism by which these mutations cause arrhythmia remains controversial, with discrepant findings related to the role of the RyR2 binding protein FKBP12.6. The purpose of this study was to characterize a novel RyR2 mutation identified in a kindred with clinically diagnosed CPVT. Single-strand conformational polymorphism analysis and direct DNA sequencing were used to screen the RyR2 gene for mutations. Site-directed mutagenesis was employed to introduce the mutation into the mouse RyR2 cDNA. The impact of the mutation on the interaction between RyR2 and a 12.6 kDa FK506 binding protein (FKBP12.6) was determined by immunoprecipitation and immunoblotting and its effect on RyR2 function was characterized by single cell Ca2+ imaging and [3H]ryanodine binding. A novel CPVT mutation, E189D, was identified. The E189D mutation does not alter the affinity of the channel for FKBP12.6, but it increases the propensity for store-overload-induced Ca2+ release (SOICR). Furthermore, the E189D mutation enhances the basal channel activity of RyR2 and its sensitivity to activation by caffeine. The E189D RyR2 mutation is causative for CPVT and functionally increases the propensity for SOICR without altering the affinity for FKBP12.6. These observations strengthen the notion that enhanced SOICR, but not altered FKBP12.6 binding, is a common mechanism by which RyR2 mutations cause arrhythmias. PMID:20676041

  15. The use of reference strand-mediated conformational analysis for the study of cheetah (Acinonyx jubatus) feline leucocyte antigen class II DRB polymorphisms.

    Science.gov (United States)

    Drake, G J C; Kennedy, L J; Auty, H K; Ryvar, R; Ollier, W E R; Kitchener, A C; Freeman, A R; Radford, A D

    2004-01-01

    There is now considerable evidence to suggest the cheetah (Acinonyx jubatus) has limited genetic diversity. However, the extent of this and its significance to the fitness of the cheetah population, both in the wild and captivity, is the subject of some debate. This reflects the difficulty associated with establishing a direct link between low variability at biologically significant loci and deleterious aspects of phenotype in this, and other, species. Attempts to study one such region, the feline leucocyte antigen (FLA), are hampered by a general reliance on cloning and sequencing which is expensive, labour-intensive, subject to PCR artefact and always likely to underestimate true variability. In this study we have applied reference strand-mediated conformational analysis (RSCA) to determine the FLA-DRB phenotypes of 25 cheetahs. This technique was rapid, repeatable and less prone to polymerase chain reaction (PCR)-induced sequence artefacts associated with cloning. Individual cheetahs were shown to have up to three FLA-DRB genes. A total of five alleles were identified (DRB*ha14-17 and DRB*gd01) distributed among four genotypes. Fifteen cheetahs were DRB*ha14/ha15/ha16/ha17, three were DRB*ha15/ha16/ha17, six were DRB*ha14/ha16/ha17 and one was DRB*ha14/ha15/ha16/ha17/gd01. Sequence analysis of DRB*gd01 suggested it was a recombinant of DRB*ha16 and DRB*ha17. Generation of new alleles is difficult to document, and the clear demonstration of such an event is unusual. This study confirms further the limited genetic variability of the cheetah at a biologically significant region. RSCA will facilitate large-scale studies that will be needed to correlate genetic diversity at such loci with population fitness in the cheetah and other species.

  16. Workers’ Conformism

    Directory of Open Access Journals (Sweden)

    Nikolay Ivantchev

    2013-10-01

    Full Text Available Conformism was studied among 46 workers with different kinds of occupations by means of two modified scales measuring conformity by Santor, Messervey, and Kusumakar (2000 – scale for perceived peer pressure and scale for conformism in antisocial situations. The hypothesis of the study that workers’ conformism is expressed in a medium degree was confirmed partly. More than a half of the workers conform in a medium degree for taking risk, and for the use of alcohol and drugs, and for sexual relationships. More than a half of the respondents conform in a small degree for anti-social activities (like a theft. The workers were more inclined to conform for risk taking (10.9%, then – for the use of alcohol, drugs and for sexual relationships (8.7%, and in the lowest degree – for anti-social activities (6.5%. The workers who were inclined for the use of alcohol and drugs tended also to conform for anti-social activities.

  17. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  18. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  19. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  20. Fc receptor gamma subunit polymorphisms and systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Al-Ansari, Aliya; Ollier, W.E.; Gonzalez-Gay, Miguel A.; Gul, Ahmet; Inanac, Murat; Ordi, Jose; Teh, Lee-Suan; Hajeer, Ali H.

    2004-01-01

    To investigate the possible association between Fc receptor gamma polymorphisms and systemic lupus erythematosus (SLE). We have investigated the full FcR gamma gene for polymorphisms using polymerase chain reaction (PCR)-single strand confirmational polymorphisms and DNA sequencing .The polymorphisms identified were genotype using PCR-restriction fragment length polymorphism. Systemic lupus erythematosus cases and controls were available from 3 ethnic groups: Turkish, Spanish and Caucasian. The study was conducted in the year 2001 at the Arthritis Research Campaign, Epidemiology Unit, Manchester University Medical School, Manchester, United Kingdom. Five single nucleotide polymorphisms were identified, 2 in the promoter, one in intron 4 and, 2 in the 3'UTR. Four of the 5 single nucleotide polymorphisms (SNPs) were relatively common and investigated in the 3 populations. Allele and genotype frequencies of all 4 investigated SNPs were not statistically different cases and controls. fc receptor gamma gene does not appear to contribute to SLE susceptibility. The identified polymorphisms may be useful in investigating other diseases where receptors containing the FcR gamma subunit contribute to the pathology. (author)

  1. Genotyping human papillomavirus type 16 isolates from persistently infected promiscuous individuals and cervical neoplasia patients

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); L. Juffermans (Leon); L. Schrauwen (Lianne); M. Burger; G.J.J. van Doornum (Gerard); W.G.V. Quint (Wim)

    1995-01-01

    textabstractNucleotide sequence variation in the noncoding region of the genome of human papillomavirus type 16 (HPV16) was determined by direct sequencing and single-strand conformation polymorphism analysis of DNA fragments amplified by PCR. Individuals of diverse

  2. Improvement of the sensitivity and resolution of PCR-SSCP analysis ...

    Indian Academy of Sciences (India)

    25-dihydroxyvitamin D3) re- ceptor (VDR) to ... C for 5 min. After amplifi- cation, PCR product was purified with low-melting agarose. Keywords. single-strand conformation polymorphism; mutation screening; primer; PCR. Journal of Genetics ...

  3. Conformal Infinity

    Directory of Open Access Journals (Sweden)

    Frauendiener Jörg

    2004-01-01

    Full Text Available The notion of conformal infinity has a long history within the research in Einstein's theory of gravity. Today, 'conformal infinity' is related to almost all other branches of research in general relativity, from quantisation procedures to abstract mathematical issues to numerical applications. This review article attempts to show how this concept gradually and inevitably evolved from physical issues, namely the need to understand gravitational radiation and isolated systems within the theory of gravitation, and how it lends itself very naturally to the solution of radiation problems in numerical relativity. The fundamental concept of null-infinity is introduced. Friedrich's regular conformal field equations are presented and various initial value problems for them are discussed. Finally, it is shown that the conformal field equations provide a very powerful method within numerical relativity to study global problems such as gravitational wave propagation and detection.

  4. Conformal Infinity

    Directory of Open Access Journals (Sweden)

    Frauendiener Jörg

    2000-08-01

    Full Text Available The notion of conformal infinity has a long history within the research in Einstein's theory of gravity. Today, ``conformal infinity'' is related with almost all other branches of research in general relativity, from quantisation procedures to abstract mathematical issues to numerical applications. This review article attempts to show how this concept gradually and inevitably evolved out of physical issues, namely the need to understand gravitational radiation and isolated systems within the theory of gravitation and how it lends itself very naturally to solve radiation problems in numerical relativity. The fundamental concept of null-infinity is introduced. Friedrich's regular conformal field equations are presented and various initial value problems for them are discussed. Finally, it is shown that the conformal field equations provide a very powerful method within numerical relativity to study global problems such as gravitational wave propagation and detection.

  5. General Conformity

    Science.gov (United States)

    The General Conformity requirements ensure that the actions taken by federal agencies in nonattainment and maintenance areas do not interfere with a state’s plans to meet national standards for air quality.

  6. Conformity evaluation

    International Nuclear Information System (INIS)

    2010-01-01

    The conformity assessment activities involve the IRD's actions related to the CNEN regulatory processing for licensing and control of nuclear and radioactive facilities in the country. They include regulatory inspections of radiation protection

  7. Polymorphisms of the endothelin-A and -B receptor genes in relation to blood pressure and myocardial infarction: the Etude Cas-Témoins sur l'Infarctus du Myocarde (ECTIM) Study.

    Science.gov (United States)

    Nicaud, V; Poirier, O; Behague, I; Herrmann, S M; Mallet, C; Troesch, A; Bouyer, J; Evans, A; Luc, G; Ruidavets, J B; Arveiler, D; Bingham, A; Tiret, L; Cambien, F

    1999-03-01

    Endothelin-1 is a potent vasoconstrictor that has also mitogenic properties, stimulating the synthesis and secretion of several vasoactive molecules. There is much evidence to suggest that endothelin-1 might be involved in the pathogenesis of hypertension, atherosclerosis, and ischemic heart disease. Endothelin-1 exerts its effects through at least two receptors, ET(A) and ET(B), which are encoded by different genes and have separate tissue distributions and biologic properties. The objective of this study was to identify polymorphisms of the ET(A) and ET(B) receptor genes and to study their association with myocardial infarction (MI) and blood pressure. The coding regions and 1.3 kb upstream of the ET(A) and ET(B) receptor genes were explored by polymerase chain reaction/single strand conformation polymorphism. Six polymorphisms were found in the ET(A) receptor gene and three in the ET(B) receptor gene. Most of these polymorphisms were frequent. Associations between the detected polymorphisms, blood pressure, and MI were examined in the ECTIM study, a multicenter study comparing 652 patients having survived an MI and 773 controls from Belfast (Northern Ireland) and France. Alleles at the different polymorphic sites were similarly distributed in patients with MI and controls. Allele frequencies were similar in both countries, except for the ET(A)/-231 G allele, which appeared more frequently in France than in Belfast (P < .01). The mean systolic and diastolic blood pressure levels did not significantly differ between genotypes. However, a C/T substitution located in the nontranslated part of exon 8 of the ET(A) receptor gene (ET(A)/EX8nt1363) was associated with pulse pressure (P < .005). These results do not support an involvement of the endothelin receptor genes in a predisposition to MI or the determination of blood pressure levels, but suggest that a polymorphism of the ET(A) receptor gene might influence the pulse pressure. This result will have to be

  8. Correlation between Heart-type Fatty Acid-binding Protein Gene Polymorphism and mRNA Expression with Intramuscular Fat in Baicheng-oil Chicken

    Directory of Open Access Journals (Sweden)

    Yong Wang

    2015-10-01

    Full Text Available This study aims to determine the polymorphism and mRNA expression pattern of the heart-type fatty acid-binding protein (H-FABP gene and their association with intramuscular fat (IMF content in the breast and leg muscles of Baicheng oil chicken (BOC. A total of 720 chickens, including 240 black Baicheng oil chicken (BBOC, 240 silky Baicheng oil chicken (SBOC, and 240 white Baicheng oil chicken (WBOC were raised. Three genotypes of H-FABP gene second extron following AA, AB, and BB were detected by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP strategy. The G939A site created AA genotype and G956A site created BB genotype. The content of IMF in AA genotype in breast muscle of BBOC was significantly higher than that of AB (p = 0.0176 and the genotype in leg muscle of WBOC was significantly higher than that of AB (p = 0.0145. The G939A site could be taken as genetic marker for higher IMF content selecting for breast muscle of BBOC and leg muscle of WBOC. The relative mRNA expression of H-FABP was measured by real-time PCR at 30, 60, 90, and 120 d. The IMF content significantly increased with age in both muscles. The mRNA expression level of H-FABP significantly decreased with age in both muscles of the three types of chickens. Moreover, a significant negative correlation between H-FABP abundance and IMF content in the leg muscles of WBOC (p = 0.035 was observed. The mRNA expression of H-FABP negatively correlated with the IMF content in both breast and leg muscles of BOC sat slaughter time.

  9. Association between the MnSOD Ala-9Val polymorphism and development of schizophrenia and abnormal involuntary movements in the Xhosa population.

    Science.gov (United States)

    Hitzeroth, Angelika; Niehaus, Dana J H; Koen, Liezl; Botes, Willem C; Deleuze, J F; Warnich, Louise

    2007-04-13

    Reactive oxygen species (ROS)-mediated damage has been hypothesized to play a role in the development and poor outcome of schizophrenia, as well as the development of neuroleptic-induced abnormal involuntary movements. Recently, the functional polymorphism (Ala-9Val) in the manganese superoxide dismutase (MnSOD) gene (part of the antioxidant defense mechanism) was found to be associated with schizophrenia in a Turkish population. This study was aimed at replicating this finding in a Xhosa population. In addition, the role of Ala-9Val in abnormal involuntary movement and tardive dyskinesia development in the Xhosa population was also investigated. The schizophrenic patient group (n=286) and a healthy control group (n=243) were genotyped for the Ala-9Val polymorphism using heteroduplex-single stranded conformational polymorphism (HEX-SSCP) analysis. No significant difference in genotype or allele frequency could be observed between the schizophrenia and control group (P=0.294 and P=0.528 respectively). In addition no association could be found between the polymorphism and symptom severity (SANS and SAPS). The Xhosa schizophrenia patient group with abnormal involuntary movements (n=54) and a subgroup with tardive dyskinesia (n=30) was found to significantly differ in Ala-9Val genotype frequency (P=0.008 and P=0.011 respectively) compared to the Xhosa schizophrenia patient group without abnormal involuntary movements (n=204). However, no significant difference was found for the allele frequencies (P=0.955 and P=0.161). Further, using ANCOVA no association was found between AIMS score and genotype in the group with abnormal involuntary movements (P=0.1234). However, in the patient group with tardive dyskinesia an association was observed between genotype and AIMS score (P=0.0365). These results do not support a major role of the MnSOD Ala-9Val polymorphism in the development of schizophrenia or symptom severity in the Xhosa population. Yet it seems to be involved in the

  10. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen

    2005-01-01

    denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed......Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... in a denaturation bubble are shown to involve an interesting competition of time scales, varying between kinetic blocking of protein binding up to full binding protein-induced denaturation of the DNA. We will also address the potential to use DNA physics for the design of nanosensors. Finally, we report recent...

  11. DNA polymorphism analysis of Xanthomonas campestris pv ...

    African Journals Online (AJOL)

    strand conformation polymorphism (SSCP) techniques using M13 and 16S rRNA primers, respectively, for genotyping of the phytopathogenic bacterium Xanthomonas campestris pv. campestris was studied. RAPD provided a simple, rapid, and ...

  12. Conformality lost

    International Nuclear Information System (INIS)

    Kaplan, David B.; Lee, Jong-Wan; Son, Dam T.; Stephanov, Mikhail A.

    2009-01-01

    We consider zero-temperature transitions from conformal to nonconformal phases in quantum theories. We argue that there are three generic mechanisms for the loss of conformality in any number of dimensions: (i) fixed point goes to zero coupling, (ii) fixed point runs off to infinite coupling, or (iii) an IR fixed point annihilates with a UV fixed point and they both disappear into the complex plane. We give both relativistic and nonrelativistic examples of the last case in various dimensions and show that the critical behavior of the mass gap behaves similarly to the correlation length in the finite temperature Berezinskii-Kosterlitz-Thouless (BKT) phase transition in two dimensions, ξ∼exp(c/|T-T c | 1/2 ). We speculate that the chiral phase transition in QCD at large number of fermion flavors belongs to this universality class, and attempt to identify the UV fixed point that annihilates with the Banks-Zaks fixed point at the lower end of the conformal window.

  13. MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1

    Directory of Open Access Journals (Sweden)

    Olsson Hans

    2013-01-01

    Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in

  14. Detection and characterization of polymorphisms in XRCC DNA repair genes in human population

    International Nuclear Information System (INIS)

    Staynova, A.; Hadjidekova, V.; Savov, A.

    2004-01-01

    Human population is continuously exposed to low levels of ionizing radiation. The main contribution gives the exposure due to medical applications. Nevertheless, most of the damage induced is repaired shortly after exposure by cellular repair systems. The review is focused on the development and application of methods to estimate the character of polymorphisms in repair genes (XRCC1, APE1), involved in single strand breaks repair which is corresponding mainly to the repair of X-ray induced DNA damage. Since, DSB are major factor for chromosomal aberrations formation, the assays described in this review might be useful for the assessment of the radiation risk for human population. (authors)

  15. An examination of melanogenic traits and TYRP1 polymorphism in Nanping and Romney Marsh sheep breeds

    Directory of Open Access Journals (Sweden)

    G. Li

    2018-03-01

    Full Text Available The effects of mutations of the gene for tyrosinase-related protein 1 (TYRP1 on the black muscles and coat color in Nanping black-boned sheep were investigated. Tyrosinase activity and melanin content in plasma were measured and compared in three random groups of sheep: Nanping black-boned (101 heads, Nanping normal (106 heads and Romney Marsh sheep (82 heads, Ovis aries. Eight exons and their partial flanking regions of the TYRP1 gene were amplified. Six intronic mutations and six exonic polymorphisms including two non-synonymous mutations [c.203C  >  T (p.A68V and c.1202T  >  C (p.V401A] were identified. Using a bi-directional polymerase chain reaction allele-specific amplification (bi-PASA of the mutation c.203C  >  T it was shown that the frequencies of allele C in the Nanping black-boned, Nanping normal and Romney Marsh sheep were respectively 0.955, 0.967 and 0.744. For the mutation c.1202T  >  C, the frequencies of allele T in the three populations of sheep were respectively 0.777, 0.745 and 0.793 as measured using the single-strand conformation polymorphism. When the data from sheep of all three populations with the CC genotype of SNP c.203C  >  T were pooled, it was found that there was significantly higher (P  <  0.05 tyrosinase activity, content of alkali-soluble melanin and ratio of eumelanin : total melanin than in the plasma of sheep with the CT and TT genotypes. This was not so within each of the three groups of sheep. No significant effect of the TRYP1 genotype on coat color was found. Further studies will be necessary to determine the cause of the black traits in Nanping black-boned sheep.

  16. Family Polymorphism

    DEFF Research Database (Denmark)

    Ernst, Erik

    2001-01-01

    This paper takes polymorphism to the multi-object level. Traditional inheritance, polymorphism, and late binding interact nicely to provide both flexibility and safety — when a method is invoked on an object via a polymorphic reference, late binding ensures that we get the appropriate implementat......This paper takes polymorphism to the multi-object level. Traditional inheritance, polymorphism, and late binding interact nicely to provide both flexibility and safety — when a method is invoked on an object via a polymorphic reference, late binding ensures that we get the appropriate...

  17. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  19. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  20. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  1. Non-conformable, partial and conformable transposition

    DEFF Research Database (Denmark)

    König, Thomas; Mäder, Lars Kai

    2013-01-01

    Although member states are obliged to transpose directives into domestic law in a conformable manner and receive considerable time for their transposition activities, we identify three levels of transposition outcomes for EU directives: conformable, partially conformable and non-conformable...... and the Commission regarding a directive’s outcome, play a much more strategic role than has to date acknowledged in the transposition literature. Whereas disagreement of a member state delays conformable transposition, it speeds up non-conformable transposition. Disagreement of the Commission only prolongs...

  2. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  3. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  4. Genetic variability of bovine GHR, IGF-1 and IGFBP-3 genes in ...

    African Journals Online (AJOL)

    KLDA

    2015-12-01

    Dec 1, 2015 ... single strand conformation polymorphism (PCR-SSCP) analysis. These polymorphisms were confirmed by direct sequencing. The comparative gene sequence analysis in cattle and buffalo breeds revealed 18 single nucleotide polymorphisms (SNPs) across different loci. Eight SNPs were detected in the ...

  5. Conformation of amine-modified DNA: 2-aminofluorene- and 2-(acetylamino)fluorene-modified deoxydinucleoside monophosphates with all possible nearest neighbors. A comparison of search and optimization methods.

    Science.gov (United States)

    Shapiro, R; Sidawi, D; Miao, Y S; Hingerty, B E; Schmidt, K E; Moskowitz, J; Broyde, S

    1994-01-01

    Although a significant part of the replication fork exists as single-stranded DNA, little is known about the effect of carcinogens and mutagens on single-strand conformation. Large-scale conformational searches with potential energy minimization, using the torsion angle space molecular mechanics program DUPLEX, were employed to explore the conformation of all 16 deoxydinucleoside monophosphates bearing 2-aminofluorene (AF) or 2-(acetylamino)fluorene (AAF) modification on guanine. We have thus examined the effect of 3' versus 5' modification, the presence or absence of the acetyl group, and the effect of four different neighbors in each case. The principal effect of the acetyl group appeared to be the destabilization of anti (and, to a lesser degree, borderline anti) conformations for modified guanine. This mattered little in the 5'-substituted dimers, where one conformational type predominated in the low-energy structures for the adducts of both AAF and AF: It was right-handed, with syn-guanine, imperfect base-base stacking, and fluorene to 3'-sugar contacts. Greater divergence was seen in the 3'-substituted series. The AAF-substituted 3'-adducts primarily displayed good base-fluorene stacking, with syn-guanine in contact with the 5'-sugar. The AF-substituted 3'-adducts displayed a variety of structures which included base-base and carcinogen-base stacked forms. Two novel forms were encountered [global minima for d(ApG-AF) and d(GpG-AF)], whose unusual structures suggest mutagenic capability. In order to address the multiple minimum problem, we conducted our searches of conformation space using two alternative optimization methods that also employ differing search strategies. We used the Powell algorithm, BOTM, with starting conformations that are selected combinations of rotamers, and the method of simulated annealing (SA), with random or arbitrary starting conformations. While both approaches were effective in defining the most important structures, SA was more

  6. Single Nucleotide Polymorphism Detection Using Au-Decorated Single-Walled Carbon Nanotube Field Effect Transistors

    Directory of Open Access Journals (Sweden)

    Keum-Ju Lee

    2011-01-01

    Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.

  7. Separation and identification of DNA-carcinogen adduct conformers by polyacrylamide gel electrophoresis with laser-induced fluorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Marsch, G.A.; Jankowiak, R.; Farhat, J.H.; Small, G.J. (Ames Lab., IA (United States) Iowa State Univ., Ames (United States))

    1992-12-01

    The authors have developed a separation protocol utilizing high-resolution polyacrylamide gel electrophoresis (PAGE) to isolate stable anti-benzo[a]pyrene diol epoxide adducts of oligodeoxynucleotides. Both enantiomers produced multiple adduct species. The distribution of adduct types could be quantitated by densitometry of autoradiograms or Cerenkov counting of eluted oligomers modified by anti-BPDE isomers. Laser-induced fluorescence (LIF) spectra of eluted adducts at 4.2 K (fluorescence line-narrowing spectroscopy) and 77 K revealed that bands corresponded to pure conformers of pyrene chromophore. Carcinogen-modified oligodeoxynucleotides were single-stranded, but there were often considerable stacking interactions between the pyrenyl residues and the oligonucleotide bases, indicating that electrophoresed oligomers were single-stranded but in a native, versus random-coil conformation. The ability to identify and quantitate adducts by PAGE-LIF, coupled with the high resolution and sensitivity of both techniques, makes PAGE and LIF in tandem a potentially powerful tool in the study of chemical carcinogenesis or other ligand-DNA interactions. 43 refs., 7 figs., 1 tab.

  8. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne

    2012-01-01

    identified a putative surface motif in mtSSB that may recruit UNG1 to DNA-bound mtSSB. We suggest that the massive amount of mtSSB in mitochondria effectively prevents processing of uracil and other types of damaged bases to avoid introduction of nicks in single-stranded mtDNA formed during replication....... Local enrichment of UNG1 at DNA-bound mtSSB may furthermore facilitate rapid access to- and processing of the damage once the dsDNA conformation is restored. This could be of potential biological importance, since mitochondria have no or limited capacity for homologous recombination to process nicks...

  9. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  10. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

    International Nuclear Information System (INIS)

    Noll, W.W.; Collins, M.

    1987-01-01

    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases

  11. Conformal Einstein spaces

    International Nuclear Information System (INIS)

    Kozameh, C.N.; Newman, E.T.; Tod, K.P.

    1985-01-01

    Conformal transformations in four-dimensional. In particular, a new set of two necessary and sufficient conditions for a space to be conformal to an Einstein space is presented. The first condition defines the class of spaces conformal to C spaces, whereas the last one (the vanishing of the Bach tensor) gives the particular subclass of C spaces which are conformally related to Einstein spaces. (author)

  12. Viscous conformal gauge theories

    DEFF Research Database (Denmark)

    Toniato, Arianna; Sannino, Francesco; Rischke, Dirk H.

    2017-01-01

    We present the conformal behavior of the shear viscosity-to-entropy density ratio and the fermion-number diffusion coefficient within the perturbative regime of the conformal window for gauge-fermion theories.......We present the conformal behavior of the shear viscosity-to-entropy density ratio and the fermion-number diffusion coefficient within the perturbative regime of the conformal window for gauge-fermion theories....

  13. Superspace conformal field theory

    International Nuclear Information System (INIS)

    Quella, Thomas

    2013-07-01

    Conformal sigma models and WZW models on coset superspaces provide important examples of logarithmic conformal field theories. They possess many applications to problems in string and condensed matter theory. We review recent results and developments, including the general construction of WZW models on type I supergroups, the classification of conformal sigma models and their embedding into string theory.

  14. Superspace conformal field theory

    Energy Technology Data Exchange (ETDEWEB)

    Quella, Thomas [Koeln Univ. (Germany). Inst. fuer Theoretische Physik; Schomerus, Volker [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2013-07-15

    Conformal sigma models and WZW models on coset superspaces provide important examples of logarithmic conformal field theories. They possess many applications to problems in string and condensed matter theory. We review recent results and developments, including the general construction of WZW models on type I supergroups, the classification of conformal sigma models and their embedding into string theory.

  15. A novel missense mutation of bovine lipase maturation factor 1 ...

    African Journals Online (AJOL)

    Lipase maturation factor 1 (LMF1) gene is a novel candidate gene in severe hypertriglyceridemia. To detect the polymorphism in LMF1 gene in 804 Chinese cattle, we firstly described the polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), DNA sequence and PCR-RFLP methods for ...

  16. upstream region of the myostatin gene in four chicken breeds and its

    African Journals Online (AJOL)

    user

    2012-05-17

    May 17, 2012 ... polymorphisms (SNPs) of the 5'-upstream region of the myostatin gene were detected by single- stranded conformation polymorphism (SSCP) and DNA sequencing in the Bian, Jinghai, Youxi and. Arbor Acre chickens. Four novel mutations (G673A, G985C, G1085A, and A1278T) were detected. Only.

  17. A novel missense mutation of bovine lipase maturation factor 1 (LMF1)

    African Journals Online (AJOL)

    Jane

    2011-07-27

    Jul 27, 2011 ... Lipase maturation factor 1 (LMF1) gene is a novel candidate gene in severe hypertriglyceridemia. To detect the polymorphism in LMF1 gene in 804 Chinese cattle, we firstly described the polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), DNA sequence and PCR-RFLP.

  18. Study on the association of BoLA-DRB3.2 alleles with clinical ...

    African Journals Online (AJOL)

    Seventy-five Iranian Holstein cattle which comprised of two different groups (49 susceptible cattle to clinical mastitis and 26 resistant cattle to clinical mastitis) as well as forty-five Sarabi breed cattle were studied randomly for polymorphism in BoLA-DRB3.2 gene. Genotyping by single strand conformation polymorphism- ...

  19. Association of Interleukin-17F gene polymorphisms with susceptibility to severe enterovirus 71 infection in Chinese children.

    Science.gov (United States)

    Li, Fei; Liu, Peipei; Guo, Ya; Han, Zhenliang; Liu, Yedan; Wang, Yuanyuan; Song, Long; Cheng, Jianguo; Chen, Zongbo

    2018-03-16

    Enterovirus 71 (EV71) is a single-strand RNA virus that causes hand, foot and mouth disease (HFMD) in infants and young children, leading to neurological complications with significant morbidity and mortality. Unfortunately, the pathogenesis of EV71 infection is not well understood. In this study, we investigated the IL-17F rs1889570 and rs4715290 gene polymorphisms in a Chinese Han population. Severe cases and cases with EV71 encephalitis had a significantly higher frequency of the rs1889570 T/T genotype and T allele. The serum IL-17F levels in rs1889570 T/T and C/T genotypes were also significantly elevated when compared to C/C genotypes. However, there was no significant difference observed in rs4715290 genotype distribution and allele frequency. These findings suggest that IL-17F rs1889570 gene polymorphisms are significantly associated with the susceptibility to severe EV71 infection in Chinese Han children.

  20. Conformational stability of calreticulin

    DEFF Research Database (Denmark)

    Jørgensen, C.S.; Trandum, C.; Larsen, N.

    2005-01-01

    The conformational stability of calreticulin was investigated. Apparent unfolding temperatures (T-m) increased from 31 degrees C at pH 5 to 51 degrees C at pH 9, but electrophoretic analysis revealed that calreticulin oligomerized instead of unfolding. Structural analyses showed that the single C......-terminal a-helix was of major importance to the conformational stability of calreticulin....

  1. Conformational stability of calreticulin

    DEFF Research Database (Denmark)

    Jørgensen, Charlotte S; Trandum, Christa; Larsen, Nanna Brink

    2005-01-01

    The conformational stability of calreticulin was investigated. Apparent unfolding temperatures (Tm) increased from 31 degrees C at pH 5 to 51 degrees C at pH 9, but electrophoretic analysis revealed that calreticulin oligomerized instead of unfolding. Structural analyses showed that the single C......-terminal alpha-helix was of major importance to the conformational stability of calreticulin....

  2. Conformal invariance in supergravity

    International Nuclear Information System (INIS)

    Bergshoeff, E.A.

    1983-01-01

    In this thesis the author explains the role of conformal invariance in supergravity. He presents the complete structure of extended conformal supergravity for N <= 4. The outline of this work is as follows. In chapter 2 he briefly summarizes the essential properties of supersymmetry and supergravity and indicates the use of conformal invariance in supergravity. The idea that the introduction of additional symmetry transformations can make clear the structure of a field theory is not reserved to supergravity only. By means of some simple examples it is shown in chapter 3 how one can always introduce additional gauge transformations in a theory of massive vector fields. Moreover it is shown how the gauge invariant formulation sometimes explains the quantum mechanical properties of the theory. In chapter 4 the author defines the conformal transformations and summarizes their main properties. He explains how these conformal transformations can be used to analyse the structure of gravity. The supersymmetric extension of these results is discussed in chapter 5. Here he describes as an example how N=1 supergravity can be reformulated in a conformally-invariant way. He also shows that beyond N=1 the gauge fields of the superconformal symmetries do not constitute an off-shell field representation of extended conformal supergravity. Therefore, in chapter 6, a systematic method to construct the off-shell formulation of all extended conformal supergravity theories with N <= 4 is developed. As an example he uses this method to construct N=1 conformal supergravity. Finally, in chapter 7 N=4 conformal supergravity is discussed. (Auth.)

  3. Role of non-equilibrium conformations on driven polymer translocation.

    Science.gov (United States)

    Katkar, H H; Muthukumar, M

    2018-01-14

    One of the major theoretical methods in understanding polymer translocation through a nanopore is the Fokker-Planck formalism based on the assumption of quasi-equilibrium of polymer conformations. The criterion for applicability of the quasi-equilibrium approximation for polymer translocation is that the average translocation time per Kuhn segment, ⟨τ⟩/N K , is longer than the relaxation time τ 0 of the polymer. Toward an understanding of conditions that would satisfy this criterion, we have performed coarse-grained three dimensional Langevin dynamics and multi-particle collision dynamics simulations. We have studied the role of initial conformations of a polyelectrolyte chain (which were artificially generated with a flow field) on the kinetics of its translocation across a nanopore under the action of an externally applied transmembrane voltage V (in the absence of the initial flow field). Stretched (out-of-equilibrium) polyelectrolyte chain conformations are deliberately and systematically generated and used as initial conformations in translocation simulations. Independent simulations are performed to study the relaxation behavior of these stretched chains, and a comparison is made between the relaxation time scale and the mean translocation time (⟨τ⟩). For such artificially stretched initial states, ⟨τ⟩/N K equilibrium approximation. Nevertheless, we observe a scaling of ⟨τ⟩ ∼ 1/V over the entire range of chain stretching studied, in agreement with the predictions of the Fokker-Planck model. On the other hand, for realistic situations where the initial artificially imposed flow field is absent, a comparison of experimental data reported in the literature with the theory of polyelectrolyte dynamics reveals that the Zimm relaxation time (τ Zimm ) is shorter than the mean translocation time for several polymers including single stranded DNA (ssDNA), double stranded DNA (dsDNA), and synthetic polymers. Even when these data are rescaled

  4. Conformal expansions and renormalons

    Energy Technology Data Exchange (ETDEWEB)

    Rathsman, J.

    2000-02-07

    The coefficients in perturbative expansions in gauge theories are factorially increasing, predominantly due to renormalons. This type of factorial increase is not expected in conformal theories. In QCD conformal relations between observables can be defined in the presence of a perturbative infrared fixed-point. Using the Banks-Zaks expansion the authors study the effect of the large-order behavior of the perturbative series on the conformal coefficients. The authors find that in general these coefficients become factorially increasing. However, when the factorial behavior genuinely originates in a renormalon integral, as implied by a postulated skeleton expansion, it does not affect the conformal coefficients. As a consequence, the conformal coefficients will indeed be free of renormalon divergence, in accordance with previous observations concerning the smallness of these coefficients for specific observables. The authors further show that the correspondence of the BLM method with the skeleton expansion implies a unique scale-setting procedure. The BLM coefficients can be interpreted as the conformal coefficients in the series relating the fixed-point value of the observable with that of the skeleton effective charge. Through the skeleton expansion the relevance of renormalon-free conformal coefficients extends to real-world QCD.

  5. Polymorphic transformation of helical flagella of bacteria

    Science.gov (United States)

    Lim, Sookkyung; Howard Berg Collaboration; William Ko Collaboration; Yongsam Kim Collaboration; Wanho Lee Collaboration; Charles Peskin Collaboration

    2016-11-01

    Bacteria such as E. coli swim in an aqueous environment by utilizing the rotation of flagellar motors and alternate two modes of motility, runs and tumbles. Runs are steady forward swimming driven by bundles of flagellar filaments whose motors are turning CCW; tumbles involve a reorientation of the direction of swimming triggered by motor reversals. During tumbling, the helical flagellum undergoes polymorphic transformations, which is a local change in helical pitch, helical radius, and handedness. In this work, we investigate the underlying mechanism of structural conformation and how this polymorphic transition plays a role in bacterial swimming. National Science Foundation.

  6. Conformal and non conformal dilaton gravity

    Science.gov (United States)

    Alvarez, Enrique; Herrero-Valea, Mario; Martín, C. P.

    2014-10-01

    The quantum dynamics of the gravitational field non-minimally coupled to an (also dynamical) scalar field is studied in the broken phase. For a particular value of the coupling the system is classically conformal, and can actually be understood as the group averaging of Einstein-Hilbert's action under conformal transformations. Conformal invariance implies a simple Ward identity asserting that the trace of the equation of motion for the graviton is the equation of motion of the scalar field. We perform an explicit one-loop computation to show that the DeWitt effective action is not UV divergent on shell and to find that the Weyl symmetry Ward identity is preserved on shell at that level. We also discuss the fate of this Ward identity at the two-loop level — under the assumption that the two-loop UV divergent part of the effective action can be retrieved from the Goroff-Sagnotti counterterm — and show that its preservation in the renormalized theory requires the introduction of counterterms which exhibit a logarithmic dependence on the dilaton field.

  7. Conformally Coupled Inflation

    Directory of Open Access Journals (Sweden)

    Valerio Faraoni

    2013-07-01

    Full Text Available A massive scalar field in a curved spacetime can propagate along the light cone, a causal pathology, which can, in principle, be eliminated only if the scalar couples conformally to the Ricci curvature of spacetime. This property mandates conformal coupling for the field driving inflation in the early universe. During slow-roll inflation, this coupling can cause super-acceleration and, as a signature, a blue spectrum of primordial gravitational waves.

  8. Delineating the conformal window

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Pickup, Thomas; Teper, Michael

    2011-01-01

    We identify and characterise the conformal window in gauge theories relevant for beyond the standard model building, e.g. Technicolour, using the criteria of metric confinement and causal analytic couplings, which are known to be consistent with the phase diagram of supersymmetric QCD from Seiberg...... duality. Using these criteria we find perturbation theory to be consistent throughout the predicted conformal window for several of these gauge theories and we discuss recent lattice results in the light of our findings....

  9. Conformable variational iteration method

    Directory of Open Access Journals (Sweden)

    Omer Acan

    2017-02-01

    Full Text Available In this study, we introduce the conformable variational iteration method based on new defined fractional derivative called conformable fractional derivative. This new method is applied two fractional order ordinary differential equations. To see how the solutions of this method, linear homogeneous and non-linear non-homogeneous fractional ordinary differential equations are selected. Obtained results are compared the exact solutions and their graphics are plotted to demonstrate efficiency and accuracy of the method.

  10. Quantum massive conformal gravity

    Energy Technology Data Exchange (ETDEWEB)

    Faria, F.F. [Universidade Estadual do Piaui, Centro de Ciencias da Natureza, Teresina, PI (Brazil)

    2016-04-15

    We first find the linear approximation of the second plus fourth order derivative massive conformal gravity action. Then we reduce the linearized action to separated second order derivative terms, which allows us to quantize the theory by using the standard first order canonical quantization method. It is shown that quantum massive conformal gravity is renormalizable but has ghost states. A possible decoupling of these ghost states at high energies is discussed. (orig.)

  11. Conservation of a conformational switch in RadA recombinase from Methanococcus maripaludis.

    Science.gov (United States)

    Li, Yang; He, Yujiong; Luo, Yu

    2009-06-01

    Archaeal RadAs are close homologues of eukaryal Rad51s ( approximately 40% sequence identity). These recombinases promote ATP hydrolysis and a hallmark strand-exchange reaction between homologous single-stranded and double-stranded DNA substrates. Pairing of the 3'-overhangs located at the damaged DNA with a homologous double-stranded DNA enables the re-synthesis of the damaged region using the homologous DNA as the template. In recent studies, conformational changes in the DNA-interacting regions of Methanococcus voltae RadA have been correlated with the presence of activity-stimulating potassium or calcium ions in the ATPase centre. The series of crystal structures of M. maripaludis RadA presented here further suggest the conservation of an allosteric switch in the ATPase centre which controls the conformational status of DNA-interacting loops. Structural comparison with the distant Escherichia coli RecA homologue supports the notion that the conserved Lys248 and Lys250 residues in RecA play a role similar to that of cations in RadA. The conservation of a cationic bridge between the DNA-interacting L2 region and the terminal phosphate of ATP, together with the apparent stability of the nucleoprotein filament, suggests a gap-displacement model which may explain the advantage of ATP hydrolysis for DNA-strand exchange.

  12. DNA conformation of Chinese hamster V79 cells and sensitivity to ionizing radiation

    International Nuclear Information System (INIS)

    Olive, P.L.; Hilton, J.; Durand, R.E.

    1986-01-01

    Chinese hamster V79 cells grown for 20 h in suspension culture form small clusters of cells (spheroids) which are more resistant to killing by ionizing radiation than V79 cells grown as monolayers. This resistance appears to be due to the greater capacity of cells grown in contact to repair radiation damage. Attempts to relate this ''contact effect'' to differences in DNA susceptibility or DNA repair capacity have provided conflicting results. Two techniques, alkaline sucrose gradient sedimentation and alkaline elution, show no difference in the amounts of radiation-induced DNA single-strand breakage or its repair between suspension or monolayer cells. However, using the alkali-unwinding assay, the rate of DNA unwinding is much slower for suspension cells than for monolayer cells. Interestingly, a decrease in salt concentration or in pH of the unwinding solution eliminates these differences in DNA unwinding kinetics. A fourth assay, sedimentation of nucleoids on neutral sucrose gradients, also shows a significant decrease in radiation damage produced in suspension compared to monolayer cultures. It is believed that this assay measures differences in DNA conformation (supercoiling) as well as differences in DNA strand breakage. We conclude from these four assays that the same number of DNA strand breaks/Gy is produced in monolayer and spheroid cells. However, changes in DNA conformation or packaging occur when cells are grown as spheroids, and these changes are responsible for reducing DNA damage by ionizing radiation

  13. Conformal invariance of curvature perturbation

    CERN Document Server

    Gong, Jinn-Ouk; Park, Wan Il; Sasaki, Misao; Song, Yong-Seon

    2011-01-01

    We show that in the single component situation all perturbation variables in the comoving gauge are conformally invariant to all perturbation orders. Generally we identify a special time slicing, the uniform-conformal transformation slicing, where all perturbations are again conformally invariant to all perturbation orders. We apply this result to the delta N formalism, and show its conformal invariance.

  14. Conformity and statistical tolerancing

    Science.gov (United States)

    Leblond, Laurent; Pillet, Maurice

    2018-02-01

    Statistical tolerancing was first proposed by Shewhart (Economic Control of Quality of Manufactured Product, (1931) reprinted 1980 by ASQC), in spite of this long history, its use remains moderate. One of the probable reasons for this low utilization is undoubtedly the difficulty for designers to anticipate the risks of this approach. The arithmetic tolerance (worst case) allows a simple interpretation: conformity is defined by the presence of the characteristic in an interval. Statistical tolerancing is more complex in its definition. An interval is not sufficient to define the conformance. To justify the statistical tolerancing formula used by designers, a tolerance interval should be interpreted as the interval where most of the parts produced should probably be located. This tolerance is justified by considering a conformity criterion of the parts guaranteeing low offsets on the latter characteristics. Unlike traditional arithmetic tolerancing, statistical tolerancing requires a sustained exchange of information between design and manufacture to be used safely. This paper proposes a formal definition of the conformity, which we apply successively to the quadratic and arithmetic tolerancing. We introduce a concept of concavity, which helps us to demonstrate the link between tolerancing approach and conformity. We use this concept to demonstrate the various acceptable propositions of statistical tolerancing (in the space decentring, dispersion).

  15. Axiomatic conformal field theory

    International Nuclear Information System (INIS)

    Gaberdiel, M.R.; Goddard, P.

    2000-01-01

    A new rigourous approach to conformal field theory is presented. The basic objects are families of complex-valued amplitudes, which define a meromorphic conformal field theory (or chiral algebra) and which lead naturally to the definition of topological vector spaces, between which vertex operators act as continuous operators. In fact, in order to develop the theory, Moebius invariance rather than full conformal invariance is required but it is shown that every Moebius theory can be extended to a conformal theory by the construction of a Virasoro field. In this approach, a representation of a conformal field theory is naturally defined in terms of a family of amplitudes with appropriate analytic properties. It is shown that these amplitudes can also be derived from a suitable collection of states in the meromorphic theory. Zhu's algebra then appears naturally as the algebra of conditions which states defining highest weight representations must satisfy. The relationship of the representations of Zhu's algebra to the classification of highest weight representations is explained. (orig.)

  16. Algebraic conformal field theory

    International Nuclear Information System (INIS)

    Fuchs, J.; Nationaal Inst. voor Kernfysica en Hoge-Energiefysica

    1991-11-01

    Many conformal field theory features are special versions of structures which are present in arbitrary 2-dimensional quantum field theories. So it makes sense to describe 2-dimensional conformal field theories in context of algebraic theory of superselection sectors. While most of the results of the algebraic theory are rather abstract, conformal field theories offer the possibility to work out many formulae explicitly. In particular, one can construct the full algebra A-bar of global observables and the endomorphisms of A-bar which represent the superselection sectors. Some explicit results are presented for the level 1 so(N) WZW theories; the algebra A-bar is found to be the enveloping algebra of a Lie algebra L-bar which is an extension of the chiral symmetry algebra of the WZW theory. (author). 21 refs., 6 figs

  17. Killing tensors and conformal Killing tensors from conformal Killing vectors

    International Nuclear Information System (INIS)

    Rani, Raffaele; Edgar, S Brian; Barnes, Alan

    2003-01-01

    Koutras has proposed some methods to construct reducible proper conformal Killing tensors and Killing tensors (which are, in general, irreducible) when a pair of orthogonal conformal Killing vectors exist in a given space. We give the completely general result demonstrating that this severe restriction of orthogonality is unnecessary. In addition, we correct and extend some results concerning Killing tensors constructed from a single conformal Killing vector. A number of examples demonstrate that it is possible to construct a much larger class of reducible proper conformal Killing tensors and Killing tensors than permitted by the Koutras algorithms. In particular, by showing that all conformal Killing tensors are reducible in conformally flat spaces, we have a method of constructing all conformal Killing tensors, and hence all the Killing tensors (which will in general be irreducible) of conformally flat spaces using their conformal Killing vectors

  18. Charged conformal Killing spinors

    Energy Technology Data Exchange (ETDEWEB)

    Lischewski, Andree, E-mail: lischews@mathematik.hu-berlin.de [Humboldt-Universität zu Berlin, Institut für Mathematik, Rudower Chaussee 25, Room 1.310, D12489 Berlin (Germany)

    2015-01-15

    We study the twistor equation on pseudo-Riemannian Spin{sup c}-manifolds whose solutions we call charged conformal Killing spinors (CCKSs). We derive several integrability conditions for the existence of CCKS and study their relations to spinor bilinears. A construction principle for Lorentzian manifolds admitting CCKS with nontrivial charge starting from CR-geometry is presented. We obtain a partial classification result in the Lorentzian case under the additional assumption that the associated Dirac current is normal conformal and complete the classification of manifolds admitting CCKS in all dimensions and signatures ≤5 which has recently been initiated in the study of supersymmetric field theories on curved space.

  19. Conformal field theory

    CERN Document Server

    Ketov, Sergei V

    1995-01-01

    Conformal field theory is an elegant and powerful theory in the field of high energy physics and statistics. In fact, it can be said to be one of the greatest achievements in the development of this field. Presented in two dimensions, this book is designed for students who already have a basic knowledge of quantum mechanics, field theory and general relativity. The main idea used throughout the book is that conformal symmetry causes both classical and quantum integrability. Instead of concentrating on the numerous applications of the theory, the author puts forward a discussion of the general

  20. upstream region of the myostatin gene in four chicken breeds and its ...

    African Journals Online (AJOL)

    user

    2012-05-17

    May 17, 2012 ... DNA Engine® Peltier Thermal cycler. For single-strand conformation polymorphism (SSCP) analysis, 2 μl of each amplification product was mixed with 7 μl denaturing buffer: 98% formamide, 0.025% bromophenol blue, 0.025% xylene cyanole FF, 10 mmol/L ethylenediaminetetraacetic (EDTA) (pH 8.0),.

  1. Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo

    2010-01-01

    to wood dust, using capillary electrophoresis single-strand conformation polymorphism analysis and direct sequencing. A significant association between wood-dust exposure and adenocarcinoma histology was observed [adjusted odds ratio (OR) 12.6, 95% confidence interval (CI), 5.0-31.6]. TP53 mutations...

  2. Glycogen storage disease type Ia : recent experience with mutation analysis, a summary of mutations reported in the literature and a newly developed diagnostic flowchart

    NARCIS (Netherlands)

    Rake, JP; ten Berge, AM; Visser, G; Verlind, E; Niezen-Koning, KE; Buys, CHCM; Smit, GPA; Scheffer, H

    We studied the glucose-6-phosphatase (G6Pase) gene of 30 unrelated glycogen storage disease type Ia (GSD Ia) patients using single strand conformation, polymorphism (SSCP) prior to automated sequencing of exons revealing an aberrant SSCP pattern. In all patients we could identify mutations on both

  3. Glycogen storage disease type Ia : four novel mutations (175delGG, R170X, G266V and V338F) identified. Mutations in brief no. 220. Online

    NARCIS (Netherlands)

    Rake, J P; ten Berge, A M; Verlind, E; Visser, G; Niezen-Koning, K E; Buys, C H; Smit, G P; Scheffer, H

    1999-01-01

    Deficient activity of glucose-6-phosphatase (G6Pase) causes glycogen storage disease type Ia (GSD Ia). We analysed the G6Pase gene of 16 GSD Ia patients using single strand conformation polymorphism (SSCP) analysis prior to automated sequencing of exon(s) revealing an aberrant SSCP pattern. In all

  4. Allelic variants of CAMTA1 and FLJ10737 within a commonly deleted region at 1p36 in neuroblastoma

    DEFF Research Database (Denmark)

    Henrich, Kai-Oliver; Claas, Andreas; Praml, Christian

    2007-01-01

    of poor outcome in neuroblastoma patients. The present study surveys CAMTA1 and FLJ10737 for genetic alterations by fluorescence-based single strand conformation polymorphism (SSCP) using a panel of DNAs from 88 neuroblastomas, their matching blood samples and 97 unaffected individuals. Nucleotide...

  5. (obese) gene of mithun (Bos frontalis)

    African Journals Online (AJOL)

    Nishant-3

    The present study was undertaken with the objectives of sequencing, characterization and single nucleotide polymorphisms (SNPs) identification of mithun leptin gene. The mithun leptin gene (3420 bp) was sequenced, compared with other species and phylogenetic tree were constructed. Single-strand conformation ...

  6. Identification of glucose 6 phosphate dehydrogenase mutations by ...

    African Journals Online (AJOL)

    Identification of glucose 6 phosphate dehydrogenase mutations by single strand conformation polymorphism and gene sequencing analysis. ... Subject: Six DNA samples from Turkish males confirmed to have G-6-PD deficiency where available for the study. Results: One subject was found to have an abnormal mobility shift ...

  7. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    ∗E-mail: mohammed79@agre.uoqasim.edu.iq. polymorphism (RFLP), single stranded conformation poly- morphism (SSCP), or sequencing in the variable .... containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 V / 100 mA at room temperature until the tracking dye reached the end of the gel (100 min).

  8. Association between IGF-IR gene polymorphisms and productive and reproductive traits in Holstein cows Associação entre polimorfismos do gene IGF-IR e características produtivas e reprodutivas em fêmeas bovinas da raça Holandesa

    Directory of Open Access Journals (Sweden)

    W. Schoenau

    2005-12-01

    Full Text Available The association between single-strand conformation polymorphism (SSCP in the gene of insulin-like growth factor-I receptor (IGF-IR and age at first calving (AFC, calving interval (CI, lactation length (LL, and milk yield (MY was studied using 106 graded Holstein females. The polimerase chain reaction (PCR with specific initiating oligonucleotides, resulted an amplified fragment of 335pb. The population genotypes frequencies were 82.1% and 17.9%, for AA and AB genotypes, respectively. The frequency of A allele was 0.91 and 0.09 of B allele. No association between the identified polymorphism and AFC, CI, and MY was observed. The LL was positively associated (PEstudou-se a associação entre polimorfismos de conformação de fita simples (SSCP no gene do receptor do fator-I de crescimento semelhante à insulina (IGF-IR e idade ao primeiro parto (IPP, intervalo entre partos (IEP, duração da lactação (DL e produção de leite (PL, em 106 fêmeas puras por cruza da raça Holandesa. A reação em cadeia da polimerase (PCR com oligonucleotídeos iniciadores específicos gerou um fragmento de 335pb. A freqüência genotípica da população para o polimorfismo foi 82,1% de indivíduos homozigotos para o alelo A e 17,9% de heterozigotos (AB. A freqüência do alelo A foi 0,91 e a do alelo B, 0,09. Não foi encontrada associação entre o polimorfismo estudado e as características IPP, IEP e PL. A característica DL foi positivamente associada (P<0,05 à ausência do alelo B. A lactação dos animais portadores do genótipo AA foi mais longa.

  9. Conformational properties of pyrethroids

    Science.gov (United States)

    Mullaley, Anne; Taylor, Robin

    1994-04-01

    X-ray database searches and theoretical potential-energy calculations indicate that the acid moieties of pyrethroid cyclopropanecarboxylate esters adopt a well-defined, relatively inflexible conformation. In contrast, the alcohol moieties can exist in many low-energy geometries. One of the least conformationally flexible pyrethroid alcohols is 4-phenylindan-2-ol. The approximate overall conformation adopted at the biological binding site by insecticidal esters of this alcohol can be deduced with reasonable confidence by molecular modelling. Graphics superposition of a variety of pyrethroid acids suggests the existence of a large but rather narrow pocket at the binding site, in which substituents at the 3-position of the cyclopropane ring can be accommodated. This pocket is asymmetric with respect to the plane of the cyclopropane ring, extending further on the side remote from the ester group. The effects of α-substitution on the insecticidal activity of pyrethroid esters may be due to the influence of substituents on the preferred conformations of the molecules. This hypothesis rationalises the paradoxical dependence on absolute stereochemistry of the activities of various allylbenzyl and cinnamyl alcohol derivatives.

  10. Conformal special relativity

    International Nuclear Information System (INIS)

    Maia, M.D.

    2006-01-01

    It is shown that the information loss/recovery theorem based on the ADS/CFT correspondence is not consistent with the stability of the Schwarzschild or Reissner-Nordstrom black holes. Nonetheless, the conformal invariance of Yang-Mills theory points to new relativity principle compatible with quantum unitarity near those black holes

  11. Animal culture: chimpanzee conformity?

    Science.gov (United States)

    van Schaik, Carel P

    2012-05-22

    Culture-like phenomena in wild animals have received much attention, but how good is the evidence and how similar are they to human culture? New data on chimpanzees suggest their culture may even have an element of conformity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Conformal Dirac structures

    International Nuclear Information System (INIS)

    Wade, A.

    2000-07-01

    The Courant bracket defined originally on the sections of a vector bundle TM +T*M → M is extended to the direct sum of the 1-jet vector bundle and its dual. The extended bracket allows one to interpret many structures encountered in differential geometry, in terms of Dirac structures. We give a new approach to conformal Jacobi structures. (author)

  13. Detection of an en masse and reversible B- to A-DNA conformational transition in prokaryotes in response to desiccation

    OpenAIRE

    Whelan, Donna R.; Hiscox, Thomas J.; Rood, Julian I.; Bambery, Keith R.; McNaughton, Don; Wood, Bayden R.

    2014-01-01

    The role that DNA conformation plays in the biochemistry of cells has been the subject of intensive research since DNA polymorphism was discovered. B-DNA has long been considered the native form of DNA in cells although alternative conformations of DNA are thought to occur transiently and along short tracts. Here, we report the first direct observation of a fully reversible en masse conformational transition between B- and A-DNA within live bacterial cells using Fourier transform infrared (FT...

  14. Transportation Conformity Training and Presentations

    Science.gov (United States)

    EPA's OTAQ has provided multiple conformity training sessions in the past to assist state and local governments in implementing conformity requirements. As training information is prepared for other venues, it will be posted on this page.

  15. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction*

    Science.gov (United States)

    Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.

    2016-01-01

    Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332

  16. Polymorphic Embedding of DSLs

    DEFF Research Database (Denmark)

    Hofer, Christian; Ostermann, Klaus; Rendel, Tillmann

    2008-01-01

    propose polymorphic embedding of DSLs, where many different interpretations of a DSL can be provided as reusable components, and show how polymorphic embedding can be realized in the programming language Scala. With polymorphic embedding, the static type-safety, modularity, composability and rapid...... prototyping of pure embedding are reconciled with the flexibility attainable by external toolchains....

  17. Conformal boundaries of warped products

    DEFF Research Database (Denmark)

    Kokkendorff, Simon Lyngby

    2006-01-01

    In this note we prove a result on how to determine the conformal boundary of a type of warped product of two length spaces in terms of the individual conformal boundaries. In the situation, that we treat, the warping and conformal distortion functions are functions of distance to a base point....... The result is applied to produce examples of CAT(0)-spaces, where the conformal and ideal boundaries differ in interesting ways....

  18. Conformal radiotherapy: a glossary

    International Nuclear Information System (INIS)

    Dubray, B.; Giraud, P.; Beaudre, A.

    1999-01-01

    Most of the concepts and terms related to conformal radiotherapy were produced by English-speaking authors and eventually validated by international groups of experts, whose working language was also English. Therefore, a significant part of this literature is poorly accessible to the French-speaking radiation oncology community. The present paper gathers the 'official' definitions already published in French, along with propositions for the remaining terms which should be submitted to a more formal and representative validation process. (author)

  19. Conformal scalar field wormholes

    Science.gov (United States)

    Halliwell, Jonathan J.; Laflamme, Raymond

    1989-01-01

    The Euclidian Einstein equations with a cosmological constant and a conformally coupled scalar field are solved, taking the metric to be of the Robertson-Walker type. In the case Lambda = 0, solutions are found which represent a wormhole connecting two asymptotically flat Euclidian regions. In the case Lambda greater than 0, the solutions represent tunneling from a small Tolman-like universe to a large Robertson-Walker universe.

  20. Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA

    Science.gov (United States)

    Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.

    2018-02-01

    Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.

  1. OSI Conformance Testing for Bibliographic Applications.

    Science.gov (United States)

    Arbez, Gilbert; Swain, Leigh

    1990-01-01

    Describes the development of Open Systems Interconnection (OSI) conformance testing sites, conformance testing tools, and conformance testing services. Discusses related topics such as interoperability testing, arbitration testing, and international harmonization of conformance testing. A glossary is included. (24 references) (SD)

  2. DNA repair and cyclin D1 polymorphisms and styrene-induced genotoxicity and immunotoxicity

    International Nuclear Information System (INIS)

    Kuricova, M.; Naccarati, A.; Kumar, R.; Koskinen, M.; Sanyal, S.; Dusinska, M.; Tulinska, J.; Vodickova, L.; Liskova, A.; Jahnova, E.; Fuortes, L.; Haufroid, V.; Hemminki, K.; Vodicka, P.

    2005-01-01

    1-SO-adenine DNA adducts, DNA single-strand breaks (SBs), chromosomal aberrations (CAs), mutant frequency (MF) at the HPRT gene, and immune parameters (hematological and of humoral immunity) were studied in styrene-exposed human subjects and controls. Results were correlated with genetic polymorphisms in DNA repair genes (XPD, exon 23, XPG, exon 15, XPC, exon 15, XRCC1, exon 10, XRCC3, exon 7) and cell cycle gene cyclin D1. Results for biomarkers of genotoxicity after stratification for the different DNA repair genetic polymorphisms showed that the polymorphism in exon 23 of the XPD gene modulates levels of chromosomal and DNA damage, HPRT MF, and moderately affects DNA adduct levels. The highest levels of biomarkers were associated with the wild-type homozygous AA genotype. The exposed individuals with the wild-type GG genotype for XRCC1 gene exhibited the lowest CA frequencies, compared to those with an A allele (P < 0.05). Cyclin D1 polymorphism seems to modulate the number of leukocytes and lymphocytes in the analyzed subjects. The number of eosinophiles was positively associated with XPD variant C allele and negatively with XRCC1 variant A allele (P < 0.05) and XPC variant C allele (P < 0.05). Immunoglobulin IgA was positively associated with an XRCC3 variant T allele (P < 0.01) and negatively with XPC variant C allele (P < 0.05). Both C3- and C4-complement components were lower in individuals with XRCC3 CT (P < 0.05) and TT genotypes (P < 0.01). Adhesion molecules sL-selectin and sICAM-1 were associated with XPC genotype (P < 0.05). Individual susceptibility may be reflected in genotoxic and immunotoxic responses to environmental and occupational exposures to xenobiotics

  3. Conformance and Deviance

    DEFF Research Database (Denmark)

    Gjerdrum Pedersen, Esben Rahbek; Neergaard, Peter; Thusgaard Pedersen, Janni

    2013-01-01

    This paper analyses how large Danish companies are responding to new governmental regulation which requires them to report on corporate social responsibility (CSR). The paper is based on an analysis of 142 company annual reports required by the new Danish regulation regarding CSR reporting, plus ...... in CSR reporting practices. Finally, it is argued that non-conformance with the new regulatory requirements is not solely about conscious resistance but may also be caused by, for example, lack of awareness, resource limitations, misinterpretations, and practical difficulties....

  4. Classical extended conformal symmetries

    International Nuclear Information System (INIS)

    Viswanathan, R.

    1990-02-01

    Extensions of the Virasoro algebra are constructed as Poisson brackets of higher spin fields which appear as coefficient fields in certain covariant derivative operators of order N. These differential operators are constructed so as to be covariant under reparametrizations on fields of definite conformal dimension. Factorization of such an N-th order operator in terms of first order operators, together with the inclusion of a spin one U(1) current, is shown to lead to a two-parameter W-algebra. One of these parameters plays the role of interpolating between W-algebras based on different Lie algebras of the same rank. (author). 11 refs

  5. Hot Conformal Gauge Theories

    DEFF Research Database (Denmark)

    Mojaza, Matin; Pica, Claudio; Sannino, Francesco

    2010-01-01

    We compute the nonzero temperature free energy up to the order g^6 \\ln(1/g) in the coupling constant for vector like SU(N) gauge theories featuring matter transforming according to different representations of the underlying gauge group. The number of matter fields, i.e. flavors, is arranged...... of flavors. Surprisingly this number, if computed to the order g^2, agrees with previous predictions for the lower boundary of the conformal window for nonsupersymmetric gauge theories. The higher order results tend to predict a higher number of critical flavors. These are universal properties, i...

  6. Sparse networks of directly coupled, polymorphic, and functional side chains in allosteric proteins.

    Science.gov (United States)

    Soltan Ghoraie, Laleh; Burkowski, Forbes; Zhu, Mu

    2015-03-01

    Recent studies have highlighted the role of coupled side-chain fluctuations alone in the allosteric behavior of proteins. Moreover, examination of X-ray crystallography data has recently revealed new information about the prevalence of alternate side-chain conformations (conformational polymorphism), and attempts have been made to uncover the hidden alternate conformations from X-ray data. Hence, new computational approaches are required that consider the polymorphic nature of the side chains, and incorporate the effects of this phenomenon in the study of information transmission and functional interactions of residues in a molecule. These studies can provide a more accurate understanding of the allosteric behavior. In this article, we first present a novel approach to generate an ensemble of conformations and an efficient computational method to extract direct couplings of side chains in allosteric proteins, and provide sparse network representations of the couplings. We take the side-chain conformational polymorphism into account, and show that by studying the intrinsic dynamics of an inactive structure, we are able to construct a network of functionally crucial residues. Second, we show that the proposed method is capable of providing a magnified view of the coupled and conformationally polymorphic residues. This model reveals couplings between the alternate conformations of a coupled residue pair. To the best of our knowledge, this is the first computational method for extracting networks of side chains' alternate conformations. Such networks help in providing a detailed image of side-chain dynamics in functionally important and conformationally polymorphic sites, such as binding and/or allosteric sites. © 2014 Wiley Periodicals, Inc.

  7. Supergravitational conformal Galileons

    Science.gov (United States)

    Deen, Rehan; Ovrut, Burt

    2017-08-01

    The worldvolume actions of 3+1 dimensional bosonic branes embedded in a five-dimensional bulk space can lead to important effective field theories, such as the DBI conformal Galileons, and may, when the Null Energy Condition is violated, play an essential role in cosmological theories of the early universe. These include Galileon Genesis and "bouncing" cosmology, where a pre-Big Bang contracting phase bounces smoothly to the presently observed expanding universe. Perhaps the most natural arena for such branes to arise is within the context of superstring and M -theory vacua. Here, not only are branes required for the consistency of the theory, but, in many cases, the exact spectrum of particle physics occurs at low energy. However, such theories have the additional constraint that they must be N = 1 supersymmetric. This motivates us to compute the worldvolume actions of N = 1 supersymmetric three-branes, first in flat superspace and then to generalize them to N = 1 supergravitation. In this paper, for simplicity, we begin the process, not within the context of a superstring vacuum but, rather, for the conformal Galileons arising on a co-dimension one brane embedded in a maximally symmetric AdS 5 bulk space. We proceed to N = 1 supersymmetrize the associated worldvolume theory and then generalize the results to N = 1 supergravity, opening the door to possible new cosmological scenarios

  8. Dimensional reduction for conformal blocks

    Science.gov (United States)

    Hogervorst, Matthijs

    2016-09-01

    We consider the dimensional reduction of a CFT, breaking multiplets of the d-dimensional conformal group SO( d + 1 , 1) up into multiplets of SO( d, 1). This leads to an expansion of d-dimensional conformal blocks in terms of blocks in d - 1 dimensions. In particular, we obtain a formula for 3 d conformal blocks as an infinite sum over 2 F 1 hypergeometric functions with closed-form coefficients.

  9. Polymorphous computing fabric

    Science.gov (United States)

    Wolinski, Christophe Czeslaw [Los Alamos, NM; Gokhale, Maya B [Los Alamos, NM; McCabe, Kevin Peter [Los Alamos, NM

    2011-01-18

    Fabric-based computing systems and methods are disclosed. A fabric-based computing system can include a polymorphous computing fabric that can be customized on a per application basis and a host processor in communication with said polymorphous computing fabric. The polymorphous computing fabric includes a cellular architecture that can be highly parameterized to enable a customized synthesis of fabric instances for a variety of enhanced application performances thereof. A global memory concept can also be included that provides the host processor random access to all variables and instructions associated with the polymorphous computing fabric.

  10. Reflections on Conformal Spectra

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    We use modular invariance and crossing symmetry of conformal field theory to reveal approximate reflection symmetries in the spectral decompositions of the partition function in two dimensions in the limit of large central charge and of the four-point function in any dimension in the limit of large scaling dimensions Δ0 of external operators. We use these symmetries to motivate universal upper bounds on the spectrum and the operator product expansion coefficients, which we then derive by independent techniques. Some of the bounds for four-point functions are valid for finite Δ0 as well as for large Δ0. We discuss a similar symmetry in a large spacetime dimension limit. Finally, we comment on the analogue of the Cardy formula and sparse light spectrum condition for the four-point function. (based on 1510.08772 with Kim & Ooguri). This seminar will be given via videolink

  11. Instantons in conformal gravity

    International Nuclear Information System (INIS)

    Strominger, A.; Horowitz, G.T.; Perry, M.J.

    1984-01-01

    Fe study extrema of the general conformally invariant action: Ssub(c)=∫1/sub(α) 2 Csup(abcd)Csub(abcd)+γRsup(abcd*)Rsup(*)sub(abcd)+iTHETARsup(abcd)*Rsub(abcd). We find the first examples in four dimensions of asymptotically euclidean gravitational instantons. These have arbitrary Euler number and Hirzebruch signature. Some of these instantons represent tunneling between zero-curvature vacua that are not related by small gauge transformations. Others represent tunneling between flat space and topologically non-trivial zero-energy initial data. A general formula for the one-loop determinant is derived in terms of the renormalization group invariant masses, the volume of space-time, the Euler number and the Hirzebruch signature. (orig.)

  12. Conformal Aspects of QCD

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, S

    2003-11-19

    Theoretical and phenomenological evidence is now accumulating that the QCD coupling becomes constant at small virtuality; i.e., {alpha}{sub s}(Q{sup 2}) develops an infrared fixed point in contradiction to the usual assumption of singular growth in the infrared. For example, the hadronic decays of the {tau} lepton can be used to determine the effective charge {alpha}{sub {tau}}(m{sub {tau}{prime}}{sup 2}) for a hypothetical {tau}-lepton with mass in the range 0 < m{sub {tau}{prime}} < m{sub {tau}}. The {tau} decay data at low mass scales indicates that the effective charge freezes at a value of s = m{sub {tau}{prime}}{sup 2} of order 1 GeV{sup 2} with a magnitude {alpha}{sub {tau}} {approx} 0.9 {+-} 0.1. The near-constant behavior of effective couplings suggests that QCD can be approximated as a conformal theory even at relatively small momentum transfer and why there are no significant running coupling corrections to quark counting rules for exclusive processes. The AdS/CFT correspondence of large N{sub c} supergravity theory in higher-dimensional anti-de Sitter space with supersymmetric QCD in 4-dimensional space-time also has interesting implications for hadron phenomenology in the conformal limit, including an all-orders demonstration of counting rules for exclusive processes and light-front wavefunctions. The utility of light-front quantization and light-front Fock wavefunctions for analyzing nonperturbative QCD and representing the dynamics of QCD bound states is also discussed.

  13. Discongruence of Mhc and cytochrome b phylogeographical patterns in Myodes glareolus (Rodentia: Cricetidae)

    OpenAIRE

    Malé, P.-J. G.; Martin, J.-F.; Galan, M.; Deffontaine, V.; Bryja, J.; Cosson, J.-F.; Michaux, Johan; Charbonnel, N.

    2012-01-01

    In the present study, a phylogeographical approach was developed to analyse the influence of selection and history on a major histocompatibility complex (Mhc) class II gene polymorphism in European bank vole (Myodes glareolus) populations. We focused on exon 2 of the Dqa gene because it is highly variable in a large array of species and appears to evolve under pathogen-mediated selection in several rodent species. Using single-strand conformation polymorphism analysis and sequencing technique...

  14. On Associative Conformal Algebras of Linear Growth

    OpenAIRE

    Retakh, Alexander

    2000-01-01

    Lie conformal algebras appear in the theory of vertex algebras. Their relation is similar to that of Lie algebras and their universal enveloping algebras. Associative conformal algebras play a role in conformal representation theory. We introduce the notions of conformal identity and unital associative conformal algebras and classify finitely generated simple unital associative conformal algebras of linear growth. These are precisely the complete algebras of conformal endomorphisms of finite ...

  15. Replacement between conformity and counter-conformity in consumption decisions.

    Science.gov (United States)

    Chou, Ting-Jui; Chang, En-Chung; Dai, Qi; Wong, Veronica

    2013-02-01

    This study assessed, in a Chinese context, how self-esteem interacts with perceived similarity and uniqueness to yield cognitive dissonance, and whether the dissonance leads to self-reported conformity or counter-conformity behavior. Participants were 408 respondents from 4 major Chinese cities (M age = 33.0 yr., SD = 4.3; 48% men). Self-perceptions of uniqueness, similarity, cognitive dissonance, self-esteem and need to behave in conformity or counter-conformity were measured. A theoretical model was assessed in four situations, relating the ratings of self-esteem and perceived similarity/uniqueness to the way other people at a wedding were dressed, and the resultant cognitive dissonance and conformity/ counter-conformity behavior. Regardless of high or low self-esteem, all participants reported cognitive dissonance when they were told that they were dressed extremely similarly to or extremely differently from the other people attending the wedding. However, the conforming/counter-conforming strategies used by participants to resolve the cognitive dissonance differed. When encountering dissonance induced by the perceived extreme uniqueness of dress, participants with low self-esteem tended to say they would dress next time so as to conform with the way others were dressed, while those with high self-esteem indicated they would continue their counter-conformity in attire. When encountering dissonance induced by the perceived extreme similarity to others, both those with high and low self-esteem tended to say they would dress in an unorthodox manner to surprise other people in the future.

  16. Typing polymorphic recursion

    OpenAIRE

    Figueiredo, Lucília Camarão de; Camarão, Carlos

    2001-01-01

    This paper discusses some advantages of supporting polymorphic recursión in programming languages and describes a decidable type inference algorithm for typing polymorphic and possibly mutually recursive definitions, using Haskell to provide an executable high level specification of the algorithm.

  17. Classical Virasoro irregular conformal block

    Science.gov (United States)

    Rim, Chaiho; Zhang, Hong

    2015-07-01

    Virasoro irregular conformal block with arbitrary rank is obtained for the classical limit or equivalently Nekrasov-Shatashvili limit using the beta-deformed irregular matrix model (Penner-type matrix model for the irregular conformal block). The same result is derived using the generalized Mathieu equation which is equivalent to the loop equation of the irregular matrix model.

  18. Classical Virasoro irregular conformal block

    Energy Technology Data Exchange (ETDEWEB)

    Rim, Chaiho; Zhang, Hong [Department of Physics and Center for Quantum Spacetime (CQUeST), Sogang University,Seoul 121-742 (Korea, Republic of)

    2015-07-30

    Virasoro irregular conformal block with arbitrary rank is obtained for the classical limit or equivalently Nekrasov-Shatashvili limit using the beta-deformed irregular matrix model (Penner-type matrix model for the irregular conformal block). The same result is derived using the generalized Mathieu equation which is equivalent to the loop equation of the irregular matrix model.

  19. Counselor Identity: Conformity or Distinction?

    Science.gov (United States)

    McLaughlin, Jerry E.; Boettcher, Kathryn

    2009-01-01

    The authors explore 3 debates in other disciplines similar to counseling's identity debate in order to learn about common themes and outcomes. Conformity, distinction, and cohesion emerged as common themes. They conclude that counselors should retain their distinctive, humanistic approach rather than conforming to the dominant, medical approach.

  20. Conformal gravity and time

    Science.gov (United States)

    Hazboun, Jeffrey Shafiq

    2014-10-01

    Cartan geometry provides a rich formalism from which to look at various geometrically motivated extensions to general relativity. In this manuscript, we start by motivating reasons to extend the theory of general relativity. We then introduce the reader to our technique, called the quotient manifold method, for extending the geometry of spacetime. We will specifically look at the class of theories formed from the various quotients of the conformal group. Starting with the conformal symmetries of Euclidean space, we construct a manifold where time manifests as a part of the geometry. Though there is no matter present in the geome- try studied here, geometric terms analogous to dark energy and dark matter appear when we write down the Einstein tensor. Specifically, the quotient of the conformal group of Euclidean four-space by its Weyl subgroup results in a geometry possessing many of the properties of relativistic phase space, including both a natural symplectic form and nondegenerate Killing metric. We show the general solution possesses orthogonal Lagrangian submanifolds, with the induced metric and the spin connection on the submanifolds necessarily Lorentzian, despite the Euclidean starting point. By examining the structure equations of the biconformal space in an orthonormal frame adapted to its phase space properties, we also find two new tensor fields exist in this geometry, not present in Riemannian geometry. The first is a combination of the Weyl vector with the scale factor on the metric, and determines the time-like directions on the submanifolds. The second comes from the components of the spin connection, symmetric with respect to the new metric. Though this field comes from the spin connection, it transforms ho- mogeneously. Finally, we show in the absence of Cartan curvature or sources, the configuration space has geometric terms equivalent to a perfect fluid and a cosmological constant. We complete the analysis of this homogeneous space by

  1. Recursion Relations for Conformal Blocks

    CERN Document Server

    Penedones, João; Yamazaki, Masahito

    2016-09-12

    In the context of conformal field theories in general space-time dimension, we find all the possible singularities of the conformal blocks as functions of the scaling dimension $\\Delta$ of the exchanged operator. In particular, we argue, using representation theory of parabolic Verma modules, that in odd spacetime dimension the singularities are only simple poles. We discuss how to use this information to write recursion relations that determine the conformal blocks. We first recover the recursion relation introduced in 1307.6856 for conformal blocks of external scalar operators. We then generalize this recursion relation for the conformal blocks associated to the four point function of three scalar and one vector operator. Finally we specialize to the case in which the vector operator is a conserved current.

  2. Projectors, shadows, and conformal blocks

    Energy Technology Data Exchange (ETDEWEB)

    Simmons-Duffin, David [Jefferson Physical Laboratory, Harvard University,Cambridge, MA 02138 (United States)

    2014-04-24

    We introduce a method for computing conformal blocks of operators in arbitrary Lorentz representations in any spacetime dimension, making it possible to apply bootstrap techniques to operators with spin. The key idea is to implement the “shadow formalism' of Ferrara, Gatto, Grillo, and Parisi in a setting where conformal invariance is manifest. Conformal blocks in d-dimensions can be expressed as integrals over the projective null-cone in the “embedding space' ℝ{sup d+1,1}. Taking care with their analytic structure, these integrals can be evaluated in great generality, reducing the computation of conformal blocks to a bookkeeping exercise. To facilitate calculations in four-dimensional CFTs, we introduce techniques for writing down conformally-invariant correlators using auxiliary twistor variables, and demonstrate their use in some simple examples.

  3. Conformal solids and holography

    Science.gov (United States)

    Esposito, A.; Garcia-Saenz, S.; Nicolis, A.; Penco, R.

    2017-12-01

    We argue that a SO( d) magnetic monopole in an asymptotically AdS space-time is dual to a d-dimensional strongly coupled system in a solid state. In light of this, it would be remiss of us not to dub such a field configuration solidon. In the presence of mixed boundary conditions, a solidon spontaneously breaks translations (among many other symmetries) and gives rise to Goldstone excitations on the boundary — the phonons of the solid. We derive the quadratic action for the boundary phonons in the probe limit and show that, when the mixed boundary conditions preserve conformal symmetry, the longitudinal and transverse sound speeds are related to each other as expected from effective field theory arguments. We then include backreaction and calculate the free energy of the solidon for a particular choice of mixed boundary conditions, corresponding to a relevant multi-trace deformation of the boundary theory. We find such free energy to be lower than that of thermal AdS. This suggests that our solidon undergoes a solid-to-liquid first order phase transition by melting into a Schwarzschild-AdS black hole as the temperature is raised.

  4. Imaging of conformational changes

    Energy Technology Data Exchange (ETDEWEB)

    Michl, Josef [Univ. of Colorado, Boulder, CO (United States)

    2016-03-13

    Control of intramolecular conformational change in a small number of molecules or even a single one by an application of an outside electric field defined by potentials on nearby metal or dielectric surfaces has potential applications in both 3-D and 2-D nanotechnology. Specifically, the synthesis, characterization, and understanding of designed solids with controlled built-in internal rotational motion of a dipole promises a new class of materials with intrinsic dielectric, ferroelectric, optical and optoelectronic properties not found in nature. Controlled rotational motion is of great interest due to its expected utility in phenomena as diverse as transport, current flow in molecular junctions, diffusion in microfluidic channels, and rotary motion in molecular machines. A direct time-resolved observation of the dynamics of motion on ps or ns time scale in a single molecule would be highly interesting but is also very difficult and has yet to be accomplished. Much can be learned from an easier but still challenging comparison of directly observed initial and final orientational states of a single molecule, which is the basis of this project. The project also impacts the understanding of surface-enhanced Raman spectroscopy (SERS) and single-molecule spectroscopic detection, as well as the synthesis of solid-state materials with tailored properties from designed precursors.

  5. Intensity modulated conformal radiotherapy

    International Nuclear Information System (INIS)

    Noel, Georges; Moty-Monnereau, Celine; Meyer, Aurelia; David, Pauline; Pages, Frederique; Muller, Felix; Lee-Robin, Sun Hae; David, Denis Jean

    2006-12-01

    This publication reports the assessment of intensity-modulated conformal radiotherapy (IMCR). This assessment is based on a literature survey which focussed on indications, efficiency and safety on the short term, on the risk of radio-induced cancer on the long term, on the role in the therapeutic strategy, on the conditions of execution, on the impact on morbidity-mortality and life quality, on the impact on the health system and on public health policies and program. This assessment is also based on the opinion of a group of experts regarding the technical benefit of IMCR, its indications depending on the cancer type, safety in terms of radio-induced cancers, and conditions of execution. Before this assessment, the report thus indicates indications for which the use of IMCR can be considered as sufficient or not determined. It also proposes a technical description of IMCR and helical tomo-therapy, discusses the use of this technique for various pathologies or tumours, analyses the present situation of care in France, and comments the identification of this technique in foreign classifications

  6. X-ray structure of the pestivirus NS3 helicase and its conformation in solution.

    Science.gov (United States)

    Tortorici, M Alejandra; Duquerroy, Stéphane; Kwok, Jane; Vonrhein, Clemens; Perez, Javier; Lamp, Benjamin; Bricogne, Gerard; Rümenapf, Till; Vachette, Patrice; Rey, Félix A

    2015-04-01

    Pestiviruses form a genus in the Flaviviridae family of small enveloped viruses with a positive-sense single-stranded RNA genome. Viral replication in this family requires the activity of a superfamily 2 RNA helicase contained in the C-terminal domain of nonstructural protein 3 (NS3). NS3 features two conserved RecA-like domains (D1 and D2) with ATPase activity, plus a third domain (D3) that is important for unwinding nucleic acid duplexes. We report here the X-ray structure of the pestivirus NS3 helicase domain (pNS3h) at a 2.5-Å resolution. The structure deviates significantly from that of NS3 of other genera in the Flaviviridae family in D3, as it contains two important insertions that result in a narrower nucleic acid binding groove. We also show that mutations in pNS3h that rescue viruses from which the core protein is deleted map to D3, suggesting that this domain may be involved in interactions that facilitate particle assembly. Finally, structural comparisons of the enzyme in different crystalline environments, together with the findings of small-angle X-ray-scattering studies in solution, show that D2 is mobile with respect to the rest of the enzyme, oscillating between closed and open conformations. Binding of a nonhydrolyzable ATP analog locks pNS3h in a conformation that is more compact than the closest apo-form in our crystals. Together, our results provide new insight and bring up new questions about pNS3h function during pestivirus replication. Although pestivirus infections impose an important toll on the livestock industry worldwide, little information is available about the nonstructural proteins essential for viral replication, such as the NS3 helicase. We provide here a comparative structural and functional analysis of pNS3h with respect to its orthologs in other viruses of the same family, the flaviviruses and hepatitis C virus. Our studies reveal differences in the nucleic acid binding groove that could have implications for understanding the

  7. Effects of conformism on the cultural evolution of social behaviour.

    Directory of Open Access Journals (Sweden)

    Lucas Molleman

    Full Text Available Models of cultural evolution study how the distribution of cultural traits changes over time. The dynamics of cultural evolution strongly depends on the way these traits are transmitted between individuals by social learning. Two prominent forms of social learning are payoff-based learning (imitating others that have higher payoffs and conformist learning (imitating locally common behaviours. How payoff-based and conformist learning affect the cultural evolution of cooperation is currently a matter of lively debate, but few studies systematically analyse the interplay of these forms of social learning. Here we perform such a study by investigating how the interaction of payoff-based and conformist learning affects the outcome of cultural evolution in three social contexts. First, we develop a simple argument that provides insights into how the outcome of cultural evolution will change when more and more conformist learning is added to payoff-based learning. In a social dilemma (e.g. a Prisoner's Dilemma, conformism can turn cooperation into a stable equilibrium; in an evasion game (e.g. a Hawk-Dove game or a Snowdrift game conformism tends to destabilize the polymorphic equilibrium; and in a coordination game (e.g. a Stag Hunt game, conformism changes the basin of attraction of the two equilibria. Second, we analyse a stochastic event-based model, revealing that conformism increases the speed of cultural evolution towards pure equilibria. Individual-based simulations as well as the analysis of the diffusion approximation of the stochastic model by and large confirm our findings. Third, we investigate the effect of an increasing degree of conformism on cultural group selection in a group-structured population. We conclude that, in contrast to statements in the literature, conformism hinders rather than promotes the evolution of cooperation.

  8. Benchmarking Commercial Conformer Ensemble Generators.

    Science.gov (United States)

    Friedrich, Nils-Ole; de Bruyn Kops, Christina; Flachsenberg, Florian; Sommer, Kai; Rarey, Matthias; Kirchmair, Johannes

    2017-11-27

    We assess and compare the performance of eight commercial conformer ensemble generators (ConfGen, ConfGenX, cxcalc, iCon, MOE LowModeMD, MOE Stochastic, MOE Conformation Import, and OMEGA) and one leading free algorithm, the distance geometry algorithm implemented in RDKit. The comparative study is based on a new version of the Platinum Diverse Dataset, a high-quality benchmarking dataset of 2859 protein-bound ligand conformations extracted from the PDB. Differences in the performance of commercial algorithms are much smaller than those observed for free algorithms in our previous study (J. Chem. Inf. 2017, 57, 529-539). For commercial algorithms, the median minimum root-mean-square deviations measured between protein-bound ligand conformations and ensembles of a maximum of 250 conformers are between 0.46 and 0.61 Å. Commercial conformer ensemble generators are characterized by their high robustness, with at least 99% of all input molecules successfully processed and few or even no substantial geometrical errors detectable in their output conformations. The RDKit distance geometry algorithm (with minimization enabled) appears to be a good free alternative since its performance is comparable to that of the midranked commercial algorithms. Based on a statistical analysis, we elaborate on which algorithms to use and how to parametrize them for best performance in different application scenarios.

  9. Conformal Lorentz geometry revisited

    Science.gov (United States)

    Teleman, Kostake

    1996-02-01

    The group U(2,2) and its subgroup SU(2,2) were considered by Penrose in his study of the conformal compactification M of the Minkowski space M [R. Penrose and W. Rindler, Spinors and Space-Time (Cambridge University, Cambridge, 1986) and R. O. Wells, Jr., Bull. Am. Math. Soc. I, 2 (1979)]. The standard representation of SU(2,2) in C4 and in M are the corner stones of twistor theory, which was created by Penrose to the double purpose of obtaining new solutions of Einstein equations and new insights on gravitational radiation. We think that other representations of SU(2,2) or U(2,2) could also bring some information in relativity [see also, Barut O. Asjim, in Noncompact Lie Groups and some of their Applications, edited by E. A. Tanner and R. Wilson (Kluwer Academic, Dordrecht, 1994), p. 103] and, accordingly, we propose an extension of Penrose twistor program. In this paper we deal with a new U(2,2)-space, which we denote by W. We show first that the SU(2,2)-space M introduced by Penrose is isomorphic to U(2), endowed with an action of SU(2,2) given by non-Abelian homographic transformations. These transformations keep invariant the equation det(u-v)=0, characterizing the pairs (u,v)∈U(2)×U(2) such that ``u lies on the light-cone of v.'' By definition, our space W consists of all pairs (u,v)∈U(2)×U(2) satisfying the condition det(u-v)≠0. The starting point of this article is the observation that W carries an SU(2,2)-invariant pseudo-Riemannian metric L:=Tr[(u-v)-1u˙ ×(u-v)-1v˙], of signature (4,4). (W,L) is in fact an irreducible symmetric space in Cartan's sense, which is isomorphic to the quotient SO(2,4)/S[O(1,1)×O(1,3)]. As an irreducible symmetric space, it is an 8-dimensional Einstein space, whose Ricci tensor is proportional to the metric tensor. We study the geodesic paths of this space giving the general solutions in terms of initial data and studying the constants of motion. In particular we determine the geodesic paths which exhibit two periods

  10. CARD15 single nucleotide polymorphisms 8, 12 and 13 are not increased in ethnic Danes with sarcoidosis

    DEFF Research Database (Denmark)

    Milman, Nils; Nielsen, Ole Haagen; Hviid, Thomas Vauvert F

    2007-01-01

    and SNP13, respectively, were performed by capillary electrophoresis single-strand confirmation polymorphism in 53 patients with histologically verified sarcoidosis and in 103 healthy controls. RESULTS: The frequencies of CARD15 mutations in sarcoidosis patients were: SNP8, 4/106 chromosomes (3.8%); SNP12...... with Crohn's disease. OBJECTIVES: To evaluate whether ethnic Danes with sarcoidosis have an increased frequency of CARD15 mutations compared to healthy control subjects. METHODS: Genotyping for CARD15 mutations R702W, G908R, and L1007fsinsC, also designated single nucleotide polymorphism (SNP) SNP8, SNP12......, 2/106 chromosomes (1.9%); SNP13, 2/106 chromosomes (1.9%); SNP8+SNP12+SNP13, 8/106 chromosomes (7.6%). All 8 patients were heterozygous. The frequencies in controls were: SNP8, 9/206 chromosomes (4.4%); SNP12, 2/206 chromosomes (1.0%); SNP13, 4/206 chromosomes (1.9%); SNP8+SNP12+SNP13, 15...

  11. Harmony of spinning conformal blocks

    Energy Technology Data Exchange (ETDEWEB)

    Schomerus, Volker [DESY Hamburg, Theory Group,Notkestraße 85, 22607 Hamburg (Germany); Sobko, Evgeny [Nordita and Stockholm University,Roslagstullsbacken 23, SE-106 91 Stockholm (Sweden); Isachenkov, Mikhail [Department of Particle Physics and Astrophysics, Weizmann Institute of Science,Rehovot 7610001 (Israel)

    2017-03-15

    Conformal blocks for correlation functions of tensor operators play an increasingly important role for the conformal bootstrap programme. We develop a universal approach to such spinning blocks through the harmonic analysis of certain bundles over a coset of the conformal group. The resulting Casimir equations are given by a matrix version of the Calogero-Sutherland Hamiltonian that describes the scattering of interacting spinning particles in a 1-dimensional external potential. The approach is illustrated in several examples including fermionic seed blocks in 3D CFT where they take a very simple form.

  12. Harmony of spinning conformal blocks

    Energy Technology Data Exchange (ETDEWEB)

    Schomerus, Volker [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany). Theory Group; Sobko, Evgeny [Stockholm Univ. (Sweden); Nordita, Stockholm (Sweden); Isachenkov, Mikhail [Weizmann Institute of Science, Rehovoth (Israel). Dept. of Particle Physics and Astrophysics

    2016-12-07

    Conformal blocks for correlation functions of tensor operators play an increasingly important role for the conformal bootstrap programme. We develop a universal approach to such spinning blocks through the harmonic analysis of certain bundles over a coset of the conformal group. The resulting Casimir equations are given by a matrix version of the Calogero-Sutherland Hamiltonian that describes the scattering of interacting spinning particles in a 1-dimensional external potential. The approach is illustrated in several examples including fermionic seed blocks in 3D CFT where they take a very simple form.

  13. Projectors, Shadows, and Conformal Blocks

    OpenAIRE

    Simmons-Duffin, David

    2012-01-01

    We introduce a method for computing conformal blocks of operators in arbitrary Lorentz representations in any spacetime dimension, making it possible to apply bootstrap techniques to operators with spin. The key idea is to implement the “shadow formalism” of Ferrara, Gatto, Grillo, and Parisi in a setting where conformal invariance is manifest. Conformal blocks in d -dimensions can be expressed as integrals over the projective null-cone in the “embedding space” $ \\mathbb{R} $ d +1,1 . Taking ...

  14. Generation of Hypertension-Associated STK39 Polymorphism Knockin Cell Lines With the Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System.

    Science.gov (United States)

    Mandai, Shintaro; Mori, Takayasu; Sohara, Eisei; Rai, Tatemitsu; Uchida, Shinichi

    2015-12-01

    Previous genome-wide association studies identified serine threonine kinase 39 (STK39), encoding STE20/SPS1-related proline/alanine-rich kinase, as one of a limited number of hypertension susceptibility genes. A recent meta-analysis confirmed the association of STK39 intronic polymorphism rs3754777 with essential hypertension, among previously reported hypertension-associated STK39 polymorphisms. However, the biochemical function of this polymorphism in the mechanism responsible for hypertension is yet to be clarified. We generated rs3754777G>A knockin human cell lines with clustered regularly interspaced short palindromic repeats-mediated genome engineering. Homozygous (A/A) and heterozygous (G/A) knockin human embryonic kidney cell lines were generated using a double nickase, single-guide RNAs targeting STK39 intron 5 around single-nucleotide polymorphism, and a 100-bp donor single-stranded DNA oligonucleotide. Reverse transcription polymerase chain reaction with sequencing analyses revealed the identical STK39 transcripts among the wild-type and both knockin cell lines. Quantitative reverse transcription polymerase chain reaction showed increased STK39 mRNA expression, and immunoblot analysis revealed increases in total and phosphorylated STE20/SPS1-related proline/alanine-rich kinase with increased phosphorylated Na-K-Cl cotransporter isoform 1 in both knockin cell lines. The largest increases in these molecules were observed in the homozygous cell line. These findings indicated that this intronic polymorphism increases STK39 transcription, leading to activation of the STE20/SPS1-related proline/alanine-rich kinase-solute carrier family 12A signaling cascade. Increased interactions between STE20/SPS1-related proline/alanine-rich kinase and the target cation-chloride cotransporters may be responsible for hypertension susceptibility in individuals with this polymorphism. © 2015 American Heart Association, Inc.

  15. Higher-derivative generalization of conformal mechanics

    Science.gov (United States)

    Baranovsky, Oleg

    2017-08-01

    Higher-derivative analogs of multidimensional conformal particle and many-body conformal mechanics are constructed. Their Newton-Hooke counterparts are derived by applying appropriate coordinate transformations.

  16. Radial Coordinates for Conformal Blocks

    CERN Document Server

    Hogervorst, Matthijs

    2013-01-01

    We develop the theory of conformal blocks in CFT_d expressing them as power series with Gegenbauer polynomial coefficients. Such series have a clear physical meaning when the conformal block is analyzed in radial quantization: individual terms describe contributions of descendants of a given spin. Convergence of these series can be optimized by a judicious choice of the radial quantization origin. We argue that the best choice is to insert the operators symmetrically. We analyze in detail the resulting "rho-series" and show that it converges much more rapidly than for the commonly used variable z. We discuss how these conformal block representations can be used in the conformal bootstrap. In particular, we use them to derive analytically some bootstrap bounds whose existence was previously found numerically.

  17. Steady states in conformal theories

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    A novel conjecture regarding the steady state behavior of conformal field theories placed between two heat baths will be presented. Some verification of the conjecture will be provided in the context of fluid dynamics and holography.

  18. Some Progress in Conformal Geometry

    Directory of Open Access Journals (Sweden)

    Sun-Yung A. Chang

    2007-12-01

    Full Text Available This is a survey paper of our current research on the theory of partial differential equations in conformal geometry. Our intention is to describe some of our current works in a rather brief and expository fashion. We are not giving a comprehensive survey on the subject and references cited here are not intended to be complete. We introduce a bubble tree structure to study the degeneration of a class of Yamabe metrics on Bach flat manifolds satisfying some global conformal bounds on compact manifolds of dimension 4. As applications, we establish a gap theorem, a finiteness theorem for diffeomorphism type for this class, and diameter bound of the $sigma_2$-metrics in a class of conformal 4-manifolds. For conformally compact Einstein metrics we introduce an eigenfunction compactification. As a consequence we obtain some topological constraints in terms of renormalized volumes.

  19. National Automated Conformity Inspection Process -

    Data.gov (United States)

    Department of Transportation — The National Automated Conformity Inspection Process (NACIP) Application is intended to expedite the workflow process as it pertains to the FAA Form 81 0-10 Request...

  20. Conformity Adequacy Review: Region 5

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the conformity SIP adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 5 (IL, IN, MI, OH, WI) is provided here.

  1. Inverse bootstrapping conformal field theories

    Science.gov (United States)

    Li, Wenliang

    2018-01-01

    We propose a novel approach to study conformal field theories (CFTs) in general dimensions. In the conformal bootstrap program, one usually searches for consistent CFT data that satisfy crossing symmetry. In the new method, we reverse the logic and interpret manifestly crossing-symmetric functions as generating functions of conformal data. Physical CFTs can be obtained by scanning the space of crossing-symmetric functions. By truncating the fusion rules, we are able to concentrate on the low-lying operators and derive some approximate relations for their conformal data. It turns out that the free scalar theory, the 2d minimal model CFTs, the ϕ 4 Wilson-Fisher CFT, the Lee-Yang CFTs and the Ising CFTs are consistent with the universal relations from the minimal fusion rule ϕ 1 × ϕ 1 = I + ϕ 2 + T , where ϕ 1 , ϕ 2 are scalar operators, I is the identity operator and T is the stress tensor.

  2. Aspect of the conformal invariance

    International Nuclear Information System (INIS)

    Bauer, M.

    1990-11-01

    This thesis is about the study of several physical and mathematical aspects of critical phenomena at two dimensions. These phenomena have remarkable symmetry properties in the coordonnates changes keeping the angles. They are named conformal theories

  3. Naturality in conformal field theory

    International Nuclear Information System (INIS)

    Moore, G.; Seiberg, N.

    1989-01-01

    We discuss constraints on the operator product coefficients in diagonal and nondiagonal rational conformal field theories. Nondiagonal modular invariants always arise from automorphisms of the fusion rule algebra or from extensions of the chiral algebra. Moreover, when the chiral algebra has been maximally extended a strong form of the naturality principle of field theory can be proven for rational conformal field theory: operator product coefficients vanish if and only if the corresponding fusion rules vanish; that is, if and only if the vanishing can be understood in terms of a symmetry. We illustrate these ideas with several examples. We also generalize our ideas about rational conformal field theories to a larger class of theories: 'quasi-rational conformal field theories' and we explore some of their properties. (orig.)

  4. Polymorphic equilibrium responsive thermal and mechanical stimuli in light-emitting crystals of N-methylaminonaphthyridine.

    Science.gov (United States)

    Harada, Naomi; Abe, Yuichiro; Karasawa, Satoru; Koga, Noboru

    2012-12-21

    Crystal polymorphs of 1,8-naphthyridine derivative, being anti and syn conformers, show a reversible transformation from anti to syn by heating and from syn to anti by grinding with the alteration of emittance intensity, and notably, thermal transformation from anti to syn conformer took place in single-crystal-to-single-crystal (SC-to-SC) form, which was confirmed by a single crystal X-ray crystallography.

  5. Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

    Science.gov (United States)

    Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

    2018-02-01

    Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

  6. Application of equilibrium binding model for analysis of conformational transitions in poly(rApoly(rU complexes with metal ions

    Directory of Open Access Journals (Sweden)

    Sorokin V. A.

    2010-09-01

    Full Text Available Aim. The study is aimed at generalization of the previous experimental results on the metal ion (Mg2+, Ni2+, Cd2+ effects on conformation transitions in poly(rA·poly(rU. The objective was to find out how the type of a metal ion-polynucleotide complex influences the phase transitions and to estimate the constants (K of ions binding to polymers of different structures. Methods. The K values were obtained upon theoretical and experimental transition temperature fitting by the least-square method with the root mean square deviation minimized through the procedure of the gradient descent in the multidimensional space. Results. Calcula- tions of diagrams with Mg2+ are shown to permit obtaining satisfactory results if concentration-independent, mean values of constants are used. For Ni2+ and Cd2+ the concentration dependence of K must be taken into account, especially for high ion contents at which compaction of single-stranded poly(rA emerges. It was revealed that the main factor responsible for the differences in diagrams with Ni2+ and Cd2+ is a significant distinction of their constants of binding to poly(rA and poly(rU. Conclusions. The model theory of equilibrium binding is capable to describe adequately conformation transitions in polynucleotides in the presence of metal ions.

  7. Quantum Conformal Algebras and Closed Conformal Field Theory

    CERN Document Server

    Anselmi, D

    1999-01-01

    We investigate the quantum conformal algebras of N=2 and N=1 supersymmetric gauge theories. Phenomena occurring at strong coupling are analysed using the Nachtmann theorem and very general, model-independent, arguments. The results lead us to introduce a novel class of conformal field theories, identified by a closed quantum conformal algebra. We conjecture that they are the exact solution to the strongly coupled large-N_c limit of the open conformal field theories. We study the basic properties of closed conformal field theory and work out the operator product expansion of the conserved current multiplet T. The OPE structure is uniquely determined by two central charges, c and a. The multiplet T does not contain just the stress-tensor, but also R-currents and finite mass operators. For this reason, the ratio c/a is different from 1. On the other hand, an open algebra contains an infinite tower of non-conserved currents, organized in pairs and singlets with respect to renormalization mixing. T mixes with a se...

  8. Conformation of hindered piperidines: Spectroscopic evidence for ...

    Indian Academy of Sciences (India)

    Administrator

    The preferred conformations of both the isomeric forms of nitrosamines were determined by comparison of ... found to possess pharmacological activity and form an essential part of the molecular structure of important drugs. 1 ... chair conformation. The relative preference among the various conformers in the conformational ...

  9. 40 CFR 93.154 - Conformity analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any Federal...

  10. Nature vs. nurture in human sociality: multi-level genomic analyses of social conformity.

    Science.gov (United States)

    Chen, Biqing; Zhu, Zijian; Wang, Yingying; Ding, Xiaohu; Guo, Xiaobo; He, Mingguang; Fang, Wan; Zhou, Qin; Zhou, Shanbi; Lei, Han; Huang, Ailong; Chen, Tingmei; Ni, Dongsheng; Gu, Yuping; Liu, Jianing; Rao, Yi

    2018-02-26

    Social conformity is fundamental to human societies and has been studied for more than six decades, but our understanding of its mechanisms remains limited. Individual differences in conformity have been attributed to social and cultural environmental influences, but not to genes. Here we demonstrate a genetic contribution to conformity after analyzing 1,140 twins and single-nucleotide polymorphism (SNP)-based studies of 2,130 young adults. A two-step genome-wide association study (GWAS) revealed replicable associations in 9 genomic loci, and a meta-analysis of three GWAS with a sample size of ~2,600 further confirmed one locus, corresponding to the NAV3 (Neuron Navigator 3) gene which encodes a protein important for axon outgrowth and guidance. Further multi-level (haplotype, gene, pathway) GWAS strongly associated genes including NAV3, PTPRD (protein tyrosine phosphatase receptor type D), ARL10 (ADP ribosylation factor-like GTPase 10), and CTNND2 (catenin delta 2), with conformity. Magnetic resonance imaging of 64 subjects shows correlation of activation or structural features of brain regions with the SNPs of these genes, supporting their functional significance. Our results suggest potential moderate genetic influence on conformity, implicate several specific genetic elements in conformity and will facilitate further research on cellular and molecular mechanisms underlying human conformity.

  11. Logarithmic exotic conformal Galilean algebras

    Energy Technology Data Exchange (ETDEWEB)

    Henkel, Malte, E-mail: Malte.henkel@univ-lorraine.fr [Groupe de Physique Statistique, Institut Jean Lamour (CNRS UMR 7198), Université de Lorraine Nancy, B.P. 70239, F-54506 Vandoeuvre-lès-Nancy Cedex (France); Hosseiny, Ali, E-mail: al_hosseiny@sbu.ac.ir [Department of Physics, Shahid Beheshti University, G.C. Evin, Tehran 19839 (Iran, Islamic Republic of); School of Particles and Accelerators, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Rouhani, Shahin, E-mail: rouhani@ipm.ir [Department of Physics, Sharif University of Technology, P.O. Box 11165-9161, Tehran (Iran, Islamic Republic of); School of Particles and Accelerators, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of)

    2014-02-15

    Logarithmic representations of the conformal Galilean algebra (CGA) and the Exotic Conformal Galilean algebra (ECGA) are constructed. This can be achieved by non-decomposable representations of the scaling dimensions or the rapidity indices, specific to conformal Galilean algebras. Logarithmic representations of the non-exotic CGA lead to the expected constraints on scaling dimensions and rapidities and also on the logarithmic contributions in the co-variant two-point functions. On the other hand, the ECGA admits several distinct situations which are distinguished by different sets of constraints and distinct scaling forms of the two-point functions. Two distinct realisations for the spatial rotations are identified as well. This is the first concrete example of a reducible, but non-decomposable representation, without logarithmic terms. Such cases had been anticipated before.

  12. Conformal geometry and quasiregular mappings

    CERN Document Server

    Vuorinen, Matti

    1988-01-01

    This book is an introduction to the theory of spatial quasiregular mappings intended for the uninitiated reader. At the same time the book also addresses specialists in classical analysis and, in particular, geometric function theory. The text leads the reader to the frontier of current research and covers some most recent developments in the subject, previously scatterd through the literature. A major role in this monograph is played by certain conformal invariants which are solutions of extremal problems related to extremal lengths of curve families. These invariants are then applied to prove sharp distortion theorems for quasiregular mappings. One of these extremal problems of conformal geometry generalizes a classical two-dimensional problem of O. Teichmüller. The novel feature of the exposition is the way in which conformal invariants are applied and the sharp results obtained should be of considerable interest even in the two-dimensional particular case. This book combines the features of a textbook an...

  13. Epigenetic dominance of prion conformers.

    Directory of Open Access Journals (Sweden)

    Eri Saijo

    2013-10-01

    Full Text Available Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A at (OvPrP-A136 infected with SSBP/1 scrapie prions propagated a relatively stable (S prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V at 136 (OvPrP-V136 infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U, diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to

  14. SUSY Unparticle and Conformal Sequestering

    Energy Technology Data Exchange (ETDEWEB)

    Nakayama, Yu; Nakayama, Yu

    2007-07-17

    We investigate unparticle physics with supersymmetry (SUSY). The SUSY breaking effects due to the gravity mediation induce soft masses for the SUSY unparticles and hence break the conformal invariance. The unparticle physics observable in near future experiments is only consistent if the SUSY breakingeffects from the hidden sector to the standard model sector are dominated by the gauge mediation, or if the SUSY breaking effects to the unparticle sector are sufficiently sequestered. We argue that the natural realization of the latter possibility is the conformal sequestering scenario.

  15. Molecular mechanics conformational analysis of tylosin

    Science.gov (United States)

    Ivanov, Petko M.

    1998-01-01

    The conformations of the 16-membered macrolide antibiotic tylosin were studied with molecular mechanics (AMBER∗ force field) including modelling of the effect of the solvent on the conformational preferences (GB/SA). A Monte Carlo conformational search procedure was used for finding the most probable low-energy conformations. The present study provides complementary data to recently reported analysis of the conformations of tylosin based on NMR techniques. A search for the low-energy conformations of protynolide, a 16-membered lactone containing the same aglycone as tylosin, was also carried out, and the results were compared with the observed conformation in the crystal as well as with the most probable conformations of the macrocyclic ring of tylosin. The dependence of the results on force field was also studied by utilizing the MM3 force field. Some particular conformations were computed with the semiempirical molecular orbital methods AM1 and PM3.

  16. Conformal mapping for multiple terminals

    Science.gov (United States)

    Wang, Weimin; Ma, Wenying; Wang, Qiang; Ren, Hao

    2016-11-01

    Conformal mapping is an important mathematical tool that can be used to solve various physical and engineering problems in many fields, including electrostatics, fluid mechanics, classical mechanics, and transformation optics. It is an accurate and convenient way to solve problems involving two terminals. However, when faced with problems involving three or more terminals, which are more common in practical applications, existing conformal mapping methods apply assumptions or approximations. A general exact method does not exist for a structure with an arbitrary number of terminals. This study presents a conformal mapping method for multiple terminals. Through an accurate analysis of boundary conditions, additional terminals or boundaries are folded into the inner part of a mapped region. The method is applied to several typical situations, and the calculation process is described for two examples of an electrostatic actuator with three electrodes and of a light beam splitter with three ports. Compared with previously reported results, the solutions for the two examples based on our method are more precise and general. The proposed method is helpful in promoting the application of conformal mapping in analysis of practical problems.

  17. Supertwistor connection and conformal supergravity

    International Nuclear Information System (INIS)

    Merkulov, S.A.

    1985-01-01

    Supersymmetry expansion of the geometry of local twistors is suggested. Definition of the space of local supertwistors is given and its differential geometry is formulated. Variational principles are discussed, and it is shown that corresponding Euler-Lagrange equations also coincide and result in superzero equations of N=1 conformal supergravitation, which generalize Bach equations

  18. Exceptional and Spinorial Conformal Windows

    DEFF Research Database (Denmark)

    Mojaza, Matin; Pica, Claudio; Ryttov, Thomas

    2012-01-01

    We study the conformal window of gauge theories containing fermionic matter fields, where the gauge group is any of the exceptional groups with the fermions transforming according to the fundamental and adjoint representations and the orthogonal groups where the fermions transform according...

  19. Anomalous Dimensions of Conformal Baryons

    DEFF Research Database (Denmark)

    Pica, Claudio; Sannino, Francesco

    2016-01-01

    We determine the anomalous dimensions of baryon operators for the three color theory as function of the number of massless flavours within the conformal window to the maximum known order in perturbation theory. We show that the anomalous dimension of the baryon is controllably small, within...

  20. Conformal symmetry and holographic cosmology

    NARCIS (Netherlands)

    Bzowski, A.W.

    2013-01-01

    This thesis presents a novel approach to cosmology using gauge/gravity duality. Analysis of the implications of conformal invariance in field theories leads to quantitative cosmological predictions which are in agreement with current data. Furthermore, holographic cosmology extends the theory of

  1. Conformational properties of DNA containing (CCA)n and (TGG)n trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Zemánek, Michal; Kypr, Jaroslav; Vorlíčková, Michaela

    2005-01-01

    Roč. 36, - (2005), s. 23-32 ISSN 0141-8130. [Študentská vedecká konferencia. Bratislava, 9.03.2003-10.03.2003] R&D Projects: GA MZd(CZ) NM7634; GA AV ČR(CZ) IAA4004201 Institutional research plan: CEZ:AV0Z50040507 Keywords : DNA conformational properties * length polymorphism * microsatellite sequences Subject RIV: BO - Biophysics Impact factor: 1.684, year: 2005

  2. Teaching polymorphism early

    DEFF Research Database (Denmark)

    2005-01-01

    Is it possible to teach dynamic polymorphism early? What techniques could facilitate teaching it in Java. This panel will bring together people who have considered this question and attempted to implement it in various ways, some more completely than others. It will also give participants...

  3. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...

  4. Polymorphs of Pridopidine Hydrochloride

    DEFF Research Database (Denmark)

    Zimmermann, A.; Frostrup, B.; Bond, A. D.

    2012-01-01

    Pridopidine hydrochloride (Huntexil, Neuro-Search A/S, Ballerup, Denmark) is a dopaminergic stabilizer, currently in development for the treatment of motor symptoms associated with Huntington's disease. In this study, two polymorphic forms are characterized, forms I and II. The crystal structures...

  5. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    use

    2011-12-21

    Dec 21, 2011 ... innate immunity against pathogen infection and bridge the innate and adaptive immunity. It had been shown that in mammals, TLR7 could be an important recognizing receptor of the single-stranded RNA viruses and activated the innate immune responses through a signal transduction pathway (Kadowaki ...

  6. Análise da tendência temporal de dano renal agudo entre pacientes graves conforme polimorfi smos I/D e -262A > T da enzima conversora da angiotensina Temporal trends in acute renal dysfunction among critically ill patients according to I/D and -262A > T ACE polymorphisms

    Directory of Open Access Journals (Sweden)

    José Alberto Rodrigues Pedroso

    2010-06-01

    their development. Recent studies correlate the susceptibility to organ dysfunction in critically ill patients with genetic inheritance. Many of them consider ACE gene could be a possible candidate to elucidate a genetic predisposition or a genetic risk factor. We aimed to examine the effects of I/D and -262A > T ACE polymorphisms in the renal function in severely ill southern Brazilians patients. A multi-organic worldwide known failure score, the SOFA (sequential organ failure assessment, was used to determine the basal health state at first day (ICU admission. Considering admission SOFA score and trend of renal function (measured by daily renal SOFA scores, with daily measure of serum creatinine and diuresis, we hypothesize that ACE polymorphisms could influence in the trend of renal function in ICU patients. A total of 153 critically ill adult patients (79 men were included in this study. We monitored the patients daily during their entire ICU and post-ICU (hospital stay (measured from the ICU admission day to a maximum of 224 days. We observed progression to renal failure (SOFA scores 3 and 4 in first seven days of ICU stay and need for dialysis. The general genotypic frequencies in our sample were II = 0.17; ID = 0.46; DD = 0.37 and AA = 0.30; AT = 0.55; TT = 0.15, and the allelic frequencies were I = 0.40; D = 0.60 and A = 0.56; T = 0.44. This is the first study to verify the influence of I/D and -262A > T ACE polymorphisms in acute renal dysfunction among critically ill patients. No significant association was found between genotypes or allele frequencies and the trend of the renal function. The I/D and -262A > T ACE polymorphisms have no significant impact on the trend of renal function during the first week of ICU stay, neither any influence in mortality in critically ill patients.

  7. Photon-counting single-molecule spectroscopy for studying conformational dynamics and macromolecular interactions

    Energy Technology Data Exchange (ETDEWEB)

    Laurence, Ted Alfred [Univ. of California, Berkeley, CA (United States)

    2002-01-01

    Single-molecule methods have the potential to provide information about conformational dynamics and molecular interactions that cannot be obtained by other methods. Removal of ensemble averaging provides several benefits, including the ability to detect heterogeneous populations and the ability to observe asynchronous reactions. Single-molecule diffusion methodologies using fluorescence resonance energy transfer (FRET) are developed to monitor conformational dynamics while minimizing perturbations introduced by interactions between molecules and surfaces. These methods are used to perform studies of the folding of Chymotrypsin Inhibitor 2, a small, single-domain protein, and of single-stranded DNA (ssDNA) homopolymers. Confocal microscopy is used in combination with sensitive detectors to detect bursts of photons from fluorescently labeled biomolecules as they diffuse through the focal volume. These bursts are analyzed to extract fluorescence resonance energy transfer (FRET) efficiency. Advances in data acquisition and analysis techniques that are providing a more complete picture of the accessible molecular information are discussed. Photon Arrival-time Interval Distribution (PAID) analysis is a new method for monitoring macromolecular interactions by fluorescence detection with simultaneous determination of coincidence, brightness, diffusion time, and occupancy (proportional to concentration) of fluorescently-labeled molecules undergoing diffusion in a confocal detection volume. This method is based on recording the time of arrival of all detected photons, and then plotting the two-dimensional histogram of photon pairs, where one axis is the time interval between each pair of photons 1 and 2, and the second axis is the number of other photons detected in the time interval between photons 1 and 2. PAID is related to Fluorescence Correlation Spectroscopy (FCS) by a collapse of this histogram onto the time interval axis. PAID extends auto- and cross-correlation FCS

  8. Photon-counting single-molecule spectroscopy for studying conformational dynamics and macromolecular interactions

    International Nuclear Information System (INIS)

    Laurence, Ted Alfred

    2002-01-01

    Single-molecule methods have the potential to provide information about conformational dynamics and molecular interactions that cannot be obtained by other methods. Removal of ensemble averaging provides several benefits, including the ability to detect heterogeneous populations and the ability to observe asynchronous reactions. Single-molecule diffusion methodologies using fluorescence resonance energy transfer (FRET) are developed to monitor conformational dynamics while minimizing perturbations introduced by interactions between molecules and surfaces. These methods are used to perform studies of the folding of Chymotrypsin Inhibitor 2, a small, single-domain protein, and of single-stranded DNA (ssDNA) homopolymers. Confocal microscopy is used in combination with sensitive detectors to detect bursts of photons from fluorescently labeled biomolecules as they diffuse through the focal volume. These bursts are analyzed to extract fluorescence resonance energy transfer (FRET) efficiency. Advances in data acquisition and analysis techniques that are providing a more complete picture of the accessible molecular information are discussed. Photon Arrival-time Interval Distribution (PAID) analysis is a new method for monitoring macromolecular interactions by fluorescence detection with simultaneous determination of coincidence, brightness, diffusion time, and occupancy (proportional to concentration) of fluorescently-labeled molecules undergoing diffusion in a confocal detection volume. This method is based on recording the time of arrival of all detected photons, and then plotting the two-dimensional histogram of photon pairs, where one axis is the time interval between each pair of photons 1 and 2, and the second axis is the number of other photons detected in the time interval between photons 1 and 2. PAID is related to Fluorescence Correlation Spectroscopy (FCS) by a collapse of this histogram onto the time interval axis. PAID extends auto- and cross-correlation FCS

  9. Conformal invariance in the quantum field theory

    International Nuclear Information System (INIS)

    Kurak, V.

    1975-09-01

    Basic features concerning the present knowledge of conformal symmetry are illustrated in a simple model. Composite field dimensions of this model are computed and related to the conformal group. (author) [pt

  10. Alteration of p53 gene in ovarian carcinoma: clinicopathological correlation and prognostic significance.

    OpenAIRE

    Niwa, K.; Itoh, M.; Murase, T.; Morishita, S.; Itoh, N.; Mori, H.; Tamaya, T.

    1994-01-01

    Inactivation of the tumour-suppressor gene p53 has been demonstrated in a variety of human tumours. We extracted DNA from paraffin-embedded tissues of 67 ovarian carcinoma samples (54 primary tumours, seven metastases and six tumours obtained after chemotherapy), and analysed allelic losses and mutations of the p53 gene using single-strand conformation polymorphism (SSCP) analysis of DNA fragments amplified by a polymerase chain reaction (PCR). Allelic loss was observed in 24 of 32 informativ...

  11. Advances in research on and diagnosis and treatment of achondroplasia in China

    OpenAIRE

    Wang, Yao; Liu, Zeying; Liu, Zhenxing; Zhao, Heng; Zhou, Xiaoyan; Cui, Yazhou; Han, Jinxiang

    2013-01-01

    Achondroplasia is a rare autosomal dominant genetic disease. Research on achondroplasia in China, however, has received little emphasis. Around 80–90% of cases of neonatal achondroplasia result from mutations in fibroblast growth factor receptor 3 (FGFR3) according to polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). Recently, genetic research on achondroplasia in China made a major breakthrough by revealing two novel mutations located on the FGFR3 gene, thus helpi...

  12. The Conformational Behaviour of Glucosamine

    Science.gov (United States)

    Peña, Isabel; Kolesniková, Lucie; Cabezas, Carlos; Bermúdez, Celina; Berdakin, Matías; Simao, Alcides; Alonso, José L.

    2014-06-01

    A laser ablation method has been successfully used to vaporize the bioactive amino monosaccharide D-glucosamine. Three cyclic α-4C1 pyranose forms have been identified using a combination of CP-FTMW and LA-MB-FTMW spectroscopy. Stereoelectronic hyperconjugative factors, like those associated with anomeric or gauche effects, as well as the cooperative OH\\cdotsO, OH\\cdotsN and NH\\cdotsO chains, extended along the entire molecule, are the main factors driving the conformational behavior. All observed conformers exhibit a counter-clockwise arrangement (cc) of the network of intramolecular hydrogen bonds. The results are compared with those recently obtained for D-glucose. J. L. Alonso, M. A. Lozoya, I. Peña, J. C. López, C. Cabezas, S. Mata, S. Blanco, Chem. Sci. 2014, 5, 515.

  13. Conformal methods in general relativity

    CERN Document Server

    Valiente Kroon, Juan A

    2016-01-01

    This book offers a systematic exposition of conformal methods and how they can be used to study the global properties of solutions to the equations of Einstein's theory of gravity. It shows that combining these ideas with differential geometry can elucidate the existence and stability of the basic solutions of the theory. Introducing the differential geometric, spinorial and PDE background required to gain a deep understanding of conformal methods, this text provides an accessible account of key results in mathematical relativity over the last thirty years, including the stability of de Sitter and Minkowski spacetimes. For graduate students and researchers, this self-contained account includes useful visual models to help the reader grasp abstract concepts and a list of further reading, making this the perfect reference companion on the topic.

  14. Conformal group actions and Segal's cosmology

    International Nuclear Information System (INIS)

    Werth, J.-E.

    1984-01-01

    A mathematical description of Segal's cosmological model in the framework of conformal group actions is presented. The relation between conformal and causal group actions on time-orientable Lorentzian manifolds is analysed and several examples are discussed. A criterion for the conformality of a map between Lorentzian manifolds is given. The results are applied to Segal's 'conformal compactification' of Minkowski space. Furthermore, the 'unitary formulation' of Segal's cosmology is regarded. (Author) [pt

  15. Holographic multiverse and conformal invariance

    Energy Technology Data Exchange (ETDEWEB)

    Garriga, Jaume [Departament de Física Fonamental i Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès 1, 08193 Barcelona (Spain); Vilenkin, Alexander, E-mail: jaume.garriga@ub.edu, E-mail: vilenkin@cosmos.phy.tufts.edu [Institute of Cosmology, Department of Physics and Astronomy, Tufts University, 212 College Ave., Medford, MA 02155 (United States)

    2009-11-01

    We consider a holographic description of the inflationary multiverse, according to which the wave function of the universe is interpreted as the generating functional for a lower dimensional Euclidean theory. We analyze a simple model where transitions between inflationary vacua occur through bubble nucleation, and the inflating part of spacetime consists of de Sitter regions separated by thin bubble walls. In this model, we present some evidence that the dual theory is conformally invariant in the UV.

  16. Integrability of conformal fishnet theory

    Science.gov (United States)

    Gromov, Nikolay; Kazakov, Vladimir; Korchemsky, Gregory; Negro, Stefano; Sizov, Grigory

    2018-01-01

    We study integrability of fishnet-type Feynman graphs arising in planar four-dimensional bi-scalar chiral theory recently proposed in arXiv:1512.06704 as a special double scaling limit of gamma-deformed N = 4 SYM theory. We show that the transfer matrix "building" the fishnet graphs emerges from the R-matrix of non-compact conformal SU(2 , 2) Heisenberg spin chain with spins belonging to principal series representations of the four-dimensional conformal group. We demonstrate explicitly a relationship between this integrable spin chain and the Quantum Spectral Curve (QSC) of N = 4 SYM. Using QSC and spin chain methods, we construct Baxter equation for Q-functions of the conformal spin chain needed for computation of the anomalous dimensions of operators of the type tr( ϕ 1 J ) where ϕ 1 is one of the two scalars of the theory. For J = 3 we derive from QSC a quantization condition that fixes the relevant solution of Baxter equation. The scaling dimensions of the operators only receive contributions from wheel-like graphs. We develop integrability techniques to compute the divergent part of these graphs and use it to present the weak coupling expansion of dimensions to very high orders. Then we apply our exact equations to calculate the anomalous dimensions with J = 3 to practically unlimited precision at any coupling. These equations also describe an infinite tower of local conformal operators all carrying the same charge J = 3. The method should be applicable for any J and, in principle, to any local operators of bi-scalar theory. We show that at strong coupling the scaling dimensions can be derived from semiclassical quantization of finite gap solutions describing an integrable system of noncompact SU(2 , 2) spins. This bears similarities with the classical strings arising in the strongly coupled limit of N = 4 SYM.

  17. Objective interpretation as conforming interpretation

    Directory of Open Access Journals (Sweden)

    Lidka Rodak

    2011-12-01

    Full Text Available The practical discourse willingly uses the formula of “objective interpretation”, with no regards to its controversial nature that has been discussed in literature.The main aim of the article is to investigate what “objective interpretation” could mean and how it could be understood in the practical discourse, focusing on the understanding offered by judicature.The thesis of the article is that objective interpretation, as identified with textualists’ position, is not possible to uphold, and should be rather linked with conforming interpretation. And what this actually implies is that it is not the virtue of certainty and predictability – which are usually associated with objectivity- but coherence that makes the foundation of applicability of objectivity in law.What could be observed from the analyses, is that both the phenomenon of conforming interpretation and objective interpretation play the role of arguments in the interpretive discourse, arguments that provide justification that interpretation is not arbitrary or subjective. With regards to the important part of the ideology of legal application which is the conviction that decisions should be taken on the basis of law in order to exclude arbitrariness, objective interpretation could be read as a question “what kind of authority “supports” certain interpretation”? that is almost never free of judicial creativity and judicial activism.One can say that, objective and conforming interpretation are just another arguments used in legal discourse.

  18. Limit Cycles and Conformal Invariance

    CERN Document Server

    Fortin, Jean-Francois; Stergiou, Andreas

    2013-01-01

    There is a widely held belief that conformal field theories (CFTs) require zero beta functions. Nevertheless, the work of Jack and Osborn implies that the beta functions are not actually the quantites that decide conformality, but until recently no such behavior had been exhibited. Our recent work has led to the discovery of CFTs with nonzero beta functions, more precisely CFTs that live on recurrent trajectories, e.g., limit cycles, of the beta-function vector field. To demonstrate this we study the S function of Jack and Osborn. We use Weyl consistency conditions to show that it vanishes at fixed points and agrees with the generator Q of limit cycles on them. Moreover, we compute S to third order in perturbation theory, and explicitly verify that it agrees with our previous determinations of Q. A byproduct of our analysis is that, in perturbation theory, unitarity and scale invariance imply conformal invariance in four-dimensional quantum field theories. Finally, we study some properties of these new, "cycl...

  19. Conformational kinetics of aliphatic tails

    Science.gov (United States)

    Ferrarini, Alberta; Moro, Giorgio; Nordio, Pier Luigi

    The master equation describing the random walk between sites identified with the stable conformers of a chain molecule, represents the extension to the time domain of the Rotational Isomeric State model. The asymptotic analysis of the multidimensional diffusion equation in the continuous torsional variables subjected to the configurational potential, provides a rigorous justification for the discrete models, and it supplies, without resorting to phenomenological parameters, molecular definitions of the kinetic rates for the conformational transitions occurring at each segment of the chain. The coupling between the torsional variables is fully taken into account, giving rise to cooperative effects. A complete calculation of the specific correlation functions which describe the time evolution of the angular functions probed by N.M.R. and dielectric relaxation measurements, has been performed for alkyl chains attached to a massive core. The resulting behaviour has been compared with the decay of trans and gauche populations of specific bonds, expressed in terms of suitable correlation functions whose time integrals lead quite naturally to the definition of effective kinetic constants for the conformational transitions.

  20. Electrophysiological precursors of social conformity

    Science.gov (United States)

    Rieskamp, Jörg; Tugin, Sergey; Ossadtchi, Alexey; Krutitskaya, Janina; Klucharev, Vasily

    2013-01-01

    Humans often change their beliefs or behavior due to the behavior or opinions of others. This study explored, with the use of human event-related potentials (ERPs), whether social conformity is based on a general performance-monitoring mechanism. We tested the hypothesis that conflicts with a normative group opinion evoke a feedback-related negativity (FRN) often associated with performance monitoring and subsequent adjustment of behavior. The experimental results show that individual judgments of facial attractiveness were adjusted in line with a normative group opinion. A mismatch between individual and group opinions triggered a frontocentral negative deflection with the maximum at 200 ms, similar to FRN. Overall, a conflict with a normative group opinion triggered a cascade of neuronal responses: from an earlier FRN response reflecting a conflict with the normative opinion to a later ERP component (peaking at 380 ms) reflecting a conforming behavioral adjustment. These results add to the growing literature on neuronal mechanisms of social influence by disentangling the conflict-monitoring signal in response to the perceived violation of social norms and the neural signal of a conforming behavioral adjustment. PMID:22683703