WorldWideScience

Sample records for single-strand conformation analysis

  1. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  2. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  3. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  4. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  5. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  6. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  7. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  8. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  9. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  10. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  11. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  12. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  13. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  14. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  15. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  16. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  17. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  18. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  20. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  1. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  2. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  3. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  4. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  5. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  6. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  7. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  8. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  10. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  11. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  13. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  14. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  15. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  16. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  17. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  18. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  19. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  20. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  1. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  2. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  3. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  4. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  5. Analysis of major histocompatibility complex class II gene in water voles using capillary electrophoresis-single stranded conformation polymorphism

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Galan, M.; Charbonnel, N.; Cosson, J.-F.

    2005-01-01

    Roč. 5, č. 1 (2005), s. 173-176 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z6093917 Keywords : water vole * population genetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.219, year: 2005

  6. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  7. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  8. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  10. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  11. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  12. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  13. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  14. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  15. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  16. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  17. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  18. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  19. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  20. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  1. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  2. 40 CFR 93.154 - Conformity analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any Federal...

  3. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  4. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  5. 40 CFR 51.854 - Conformity analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 2 2010-07-01 2010-07-01 false Conformity analysis. 51.854 Section 51... FOR PREPARATION, ADOPTION, AND SUBMITTAL OF IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 51.854 Conformity analysis. Link to an...

  6. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  7. Molecular mechanics conformational analysis of tylosin

    Science.gov (United States)

    Ivanov, Petko M.

    1998-01-01

    The conformations of the 16-membered macrolide antibiotic tylosin were studied with molecular mechanics (AMBER∗ force field) including modelling of the effect of the solvent on the conformational preferences (GB/SA). A Monte Carlo conformational search procedure was used for finding the most probable low-energy conformations. The present study provides complementary data to recently reported analysis of the conformations of tylosin based on NMR techniques. A search for the low-energy conformations of protynolide, a 16-membered lactone containing the same aglycone as tylosin, was also carried out, and the results were compared with the observed conformation in the crystal as well as with the most probable conformations of the macrocyclic ring of tylosin. The dependence of the results on force field was also studied by utilizing the MM3 force field. Some particular conformations were computed with the semiempirical molecular orbital methods AM1 and PM3.

  8. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  9. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  10. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  11. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  12. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  13. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  14. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  15. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  16. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  18. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  19. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  20. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  1. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  2. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  4. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  5. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  7. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  8. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  9. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. NMR spectroscopy: a tool for conformational analysis

    Energy Technology Data Exchange (ETDEWEB)

    Tormena, Claudio F.; Cormanich, Rodrigo A.; Rittner, Roberto, E-mail: rittner@iqm.unicamp.br [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica. Lab. de Fisico-Quimica Organica; Freitas, Matheus P. [Universidade Federal de Lavras (UFLA), MG (Brazil). Dept. de Qumica

    2011-07-01

    The present review deals with the application of NMR data to the conformational analysis of simple organic compounds, together with other experimental methods like infrared spectroscopy and with theoretical calculations. Each sub-section describes the results for a group of compounds which belong to a given organic function like ketones, esters, etc. Studies of a single compound, even of special relevance, were excluded since the main goal of this review is to compare the results for a given function, where different substituents were used or small structural changes were introduced in the substrate, in an attempt to disclose their effects in the conformational equilibrium. Moreover, the huge amount of data available in the literature, on this research field, imposed some limitations which will be detailed in the Introduction, but it can be reminded in advance that these limitations include mostly the period when these results were published. (author)

  11. NMR spectroscopy: a tool for conformational analysis

    International Nuclear Information System (INIS)

    Tormena, Claudio F.; Cormanich, Rodrigo A.; Rittner, Roberto; Freitas, Matheus P.

    2011-01-01

    The present review deals with the application of NMR data to the conformational analysis of simple organic compounds, together with other experimental methods like infrared spectroscopy and with theoretical calculations. Each sub-section describes the results for a group of compounds which belong to a given organic function like ketones, esters, etc. Studies of a single compound, even of special relevance, were excluded since the main goal of this review is to compare the results for a given function, where different substituents were used or small structural changes were introduced in the substrate, in an attempt to disclose their effects in the conformational equilibrium. Moreover, the huge amount of data available in the literature, on this research field, imposed some limitations which will be detailed in the Introduction, but it can be reminded in advance that these limitations include mostly the period when these results were published. (author)

  12. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  13. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  14. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  15. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  16. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  17. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  18. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  19. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  1. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  2. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  3. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  4. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  5. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  6. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  7. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  8. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  9. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  10. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  11. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  12. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  13. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  14. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  15. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  16. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  17. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  18. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  19. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  20. Conformal polishing approach: Tool footprint analysis

    Directory of Open Access Journals (Sweden)

    José A Dieste

    2016-02-01

    Full Text Available Polishing process is one of the most critical manufacturing processes during a metal part production because it determines the final quality of the product. Free-form surface polishing is a handmade process with lots of rejected parts, scrap generation and time and energy consumption. Two different research lines are being developed: prediction models of the final surface quality parameters and an analysis of the amount of material removed depending on the polishing parameters to predict the tool footprint during the polishing task. This research lays the foundations for a future automatic conformal polishing system. It is based on rotational and translational tool with dry abrasive in the front mounted at the end of a robot. A tool to part concept is used, useful for large or heavy workpieces. Results are applied on different curved parts typically used in tooling industry, aeronautics or automotive. A mathematical model has been developed to predict the amount of material removed in function of polishing parameters. Model has been fitted for different abrasives and raw materials. Results have shown deviations under 20% that implies a reliable and controllable process. Smaller amount of material can be removed in controlled areas of a three-dimensional workpiece.

  1. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  2. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  3. Conformable Pressurized Structures : Design and Analysis

    NARCIS (Netherlands)

    Geuskens, F.J.J.M.M.

    2012-01-01

    There are many applications where volume needs to be pressurised within a geometrical space for which conventional pressure vessels do not provide suitable solutions. Applications are for example found in pressure cabins for Blended Wing Body Aircraft and conformable pressure vessels for an

  4. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  5. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  6. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  7. Synthesis and conformational analysis of naphthylnaphthoxazine derivatives

    Science.gov (United States)

    Tóth, Diána; Szatmári, István; Heydenreich, Matthias; Koch, Andreas; Kleinpeter, Erich; Fülöp, Ferenc

    2009-07-01

    Four new primary aminonaphthols ( 4, 5, 9 and 10) were synthesized from 1- or 2-naphthol and 1- or 2-naphthaldehyde via naphthoxazines in modified Mannich condensations. Simple ring-closure reactions of these aminonaphthols with paraformaldehyde, 4-nitrobenzaldehyde, phosgene or 4-chlorophenyl isothiocyanate led to new heterocyclic derivatives. In these transformations, either an sp 2 or an sp 3 carbon was inserted between the hydroxy and amino groups. The effects of substituents and the naphthyl ring on the conformation were investigated by means of NMR measurements, employing both dipolar and scalar couplings. The structures were confirmed by DFT quantum chemical calculations involving computed coupling constants, intramolecular distances between nuclei and the relative energies of the preferred conformers.

  8. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  9. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  10. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  11. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  12. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  13. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  14. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  15. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  16. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  17. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  19. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  20. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  1. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  3. Conformation analysis of trehalose. Molecular dynamics simulation and molecular mechanics

    International Nuclear Information System (INIS)

    Donnamaira, M.C.; Howard, E.I.; Grigera, J.R.

    1992-09-01

    Conformational analysis of the disaccharide trehalose is done by molecular dynamics and molecular mechanics. In spite of the different force fields used in each case, comparison between the molecular dynamics trajectories of the torsional angles of glycosidic linkage and energy conformational map shows a good agreement between both methods. By molecular dynamics it is observed a moderate mobility of the glycosidic linkage. The demands of computer time is comparable in both cases. (author). 6 refs, 4 figs

  4. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  5. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  6. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  7. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  8. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  9. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  10. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  11. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  12. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  13. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  15. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  16. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  17. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  18. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  19. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2013-01-01

    Roč. 61, Oct (2013), s. 448-452 ISSN 0141-8130 R&D Projects: GA ČR GAP208/10/0559 Institutional support: RVO:61388963 Keywords : metal ions * polyA * metal lized form * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  20. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  1. Using single strand conformational polymorphisms (SSCP) to identify Phytophthora species in Oregon forests affected by sudden oak death

    Science.gov (United States)

    E. Hansen; C. Hesse; P. Reeser; W. Sutton; L. Winton

    2006-01-01

    Phytophthora species are abundant in streams, widespread in soils and occasionally found in diseased plants in the tanoak forests of southwestern Oregon. It is time-consuming and expensive to identify hundreds of isolates to species using morphology or internal transribed spacer (ITS) sequencing. We modified a published Phytophthora...

  2. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  3. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  4. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  5. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  6. Conformational analysis and vibrational spectroscopic studies on dapsone

    Science.gov (United States)

    Ildiz, Gulce Ogruc; Akyuz, Sevim

    2012-11-01

    In this study, the theoretical conformation analysis of free dapsone has been performed by single point energy calculations at both semi-empirical PM3 and DFT/B3LYP-3-21G theory levels and three stable conformers were determined. Both the IR and Raman spectra of the molecule in solid phase have been recorded. The IR intensities and harmonic vibrational wavenumbers of each conformer were calculated by DFT method at B3LYP/6-31++G(d,p) theory level. For the fundamental characterization, the total energy distribution (TED) calculations of the vibrational modes were done using parallel quantum mechanic solution program (SQM) and the fundamental modes were assigned. The theoretical results are in agreement with the experimental ones.

  7. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  8. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  9. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  10. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  11. Sensing NADH conformation using phasor analysis on fluorescence spectra

    Science.gov (United States)

    Palo, Dylan; Maltas, Jeff; Risal, Laxmi; Urayama, Paul

    2017-11-01

    Phasor analysis on fluorescence signals is a sensitive approach for analyzing multicomponent systems. Initially developed for time-resolved measurements, a spectral version has been used for the rapid identification of regions during the spectral imaging of biological systems. Here we show that quantitative information regarding conformation can be obtained from phasor analysis of fluorescence spectrum shape. Methanol denaturation of NADH and NADH binding to various dehydrogenase proteins are used as model reactions. Thermodynamic constants are calculated and compared with previous studies based on more direct measures of conformation. Next, the quantitative monitoring of UV-excited autofluorescence spectrum shape during chemically-induced metabolic transitions is presented and discussed in terms of NADH-utilizing pathways. Results show how phasor analysis is useful in assessing two-state behavior, and in interpreting autofluorescence as emission from an ensemble of cellular NADH forms.

  12. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  13. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  14. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  15. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  16. Single-molecule analysis of lead(II)-binding aptamer conformational changes in an α-hemolysin nanopore, and sensitive detection of lead(II)

    International Nuclear Information System (INIS)

    Wang, Hai-Yan; Song, Ze-Yang; Zhang, Hui-Sheng; Chen, Si-Ping

    2016-01-01

    The α-hemolysin (αHL) nanopore is capable of analyzing DNA duplex and DNA aptamer as they can be electrophoretically driven into the vestibule from the cis entrance. The current study describes the competitive interaction induced by Pb 2+ that changes the secondary structure of DNA duplex in asymmetrical electrolyte solution. DNA duplex formed by the partial complementary DNA and DNA aptamer sequence produced unzipping blockages with the dwell unzipping time lasting 2.84 ± 0.7 ms. By cation-DNA interaction with Pb 2+ , the DNA duplex will unwind and then form Pb 2+ -stabilized-DNA aptamer, which will be captured and unfolded in vestibule. The pore conductance were reduced to 54 % and 94 % with mean dwell unfolding times of 165 ± 12 ms. The competitive behavior between Pb 2+ and single-strand DNA was further utilized to detect Pb 2+ in solution with a detection limit of 0.5 nM. This nanopore platform also provides a powerful tool for studying the cation-DNA interactions in DNA aptamer conformational changes. Thus, the results drawn from these studies provide insights into the applications of α-hemolysin nanopore as a molecular sieve to different DNA secondary structure in future application of nanopore analysis. (author)

  17. Bayesian conformational analysis of ring molecules through reversible jump MCMC

    DEFF Research Database (Denmark)

    Nolsøe, Kim; Kessler, Mathieu; Pérez, José

    2005-01-01

    In this paper we address the problem of classifying the conformations of mmembered rings using experimental observations obtained by crystal structure analysis. We formulate a model for the data generation mechanism that consists in a multidimensional mixture model. We perform inference...... for the proportions and the components in a Bayesian framework, implementing an MCMC Reversible Jumps Algorithm to obtain samples of the posterior distributions. The method is illustrated on a simulated data set and on real data corresponding to cyclo-octane structures....

  18. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  19. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  20. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  1. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  2. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  3. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  4. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  5. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  6. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  7. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  8. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  9. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  10. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  11. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  12. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  13. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  14. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  15. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  16. Chromatin Conformation Capture-Based Analysis of Nuclear Architecture.

    Science.gov (United States)

    Grob, Stefan; Grossniklaus, Ueli

    2017-01-01

    Nuclear organization and higher-order chromosome structure in interphase nuclei are thought to have important effects on fundamental biological processes, including chromosome condensation, replication, and transcription. Until recently, however, nuclear organization could only be analyzed microscopically. The development of chromatin conformation capture (3C)-based techniques now allows a detailed look at chromosomal architecture from the level of individual loci to the entire genome. Here we provide a robust Hi-C protocol, allowing the analysis of nuclear organization in nuclei from different wild-type and mutant plant tissues. This method is quantitative and provides a highly efficient and comprehensive way to study chromatin organization during plant development, in response to different environmental stimuli, and in mutants disrupting a variety of processes, including epigenetic pathways regulating gene expression.

  17. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  18. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  19. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  20. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  1. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  2. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  3. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  4. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  5. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  6. Identification of Serine Conformers by Matrix-Isolation IR Spectroscopy Aided by Near-Infrared Laser Induced Conformational Change, 2D Correlation Analysis, and Quantum Mechanical Anharmonic Computations

    Science.gov (United States)

    Najbauer, Eszter E.; Bazsó, Gábor; Apóstolo, Rui; Fausto, Rui; Biczysko, Malgorzata; Barone, Vincenzo; Tarczay, György

    2018-01-01

    The conformers of α-serine were investigated by matrix-isolation IR spectroscopy combined with NIR laser irradiation. This method, aided by 2D correlation analysis, enabled unambiguously grouping the spectral lines to individual conformers. On the basis of comparison of at least nine experimentally observed vibrational transitions of each conformer with empirically scaled (SQM) and anharmonic (GVPT2) computed IR spectra, 6 conformers were identified. In addition, the presence of at least one more conformer in Ar matrix was proved, and a short-lived conformer with a half-live of (3.7±0.5)·103 s in N2 matrix was generated by NIR irradiation. The analysis of the NIR laser induced conversions revealed that the excitation of the stretching overtone of both the side-chain and the carboxylic OH groups can effectively promote conformational changes, but remarkably different paths were observed for the two kinds of excitations. PMID:26201050

  7. Conformational analysis for some nonclassical antagonists of histamine H3 receptor

    Science.gov (United States)

    Borota, Ana; Mracec, Maria; Rad, Ramona; Ostopovici, Liliana; Mracec, Mircea

    A conformational search in vacuum for a series of 1,3-substituted pyrrolidine derivatives has been performed using the AMBER, AM1, PM3, and MNDO methods. Conformational analysis of the pyrrolidine ligands suggests that these compounds could have many conformers that populate the low-energy minima on the potential energy surface (PES). The conformational space occupied by the ligands is large and, in vacuum, the rotation barriers of different flexible bonds have energies between 0.5 and thousands of kcal/mol. By optimization, most conformers have energy barriers of 0-5 kcal/mol; thus, they could interconvert easily to obtain better interactions in the receptor active site. Optimized conformers having energy barriers of >5 kcal/mol display bad geometries with very large bond lengths and deformed rings. Shapes and heights of rotation barriers obtained through COSMO-AM1 single-point calculations in water are similar to those obtained from single-point calculations in vacuum. However, in water the energy barriers are lower, allowing most conformers to convert in other low-energy conformers. The best conformers in vacuum and in water are different: the gas phase best conformer has a helical shape, while the best conformer in water has an extended shape.

  8. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  9. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  10. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  11. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  12. Conformational analysis of lignin models; Analise conformacional de modelos de lignina

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Helio F. dos [Juiz de Fora Univ., MG (Brazil). Dept. de Quimica]. E-mail: helius@quimica.ufjf.br

    2001-08-01

    The conformational equilibrium for two 5,5' biphenyl lignin models have been analyzed using a quantum mechanical semiempirical method. The gas phase and solution structures are discussed based on the NMR and X-ray experimental data. The results obtained showed that the observed conformations are solvent-dependent, being the geometries and the thermodynamic properties correlated with the experimental information. This study shows how a systematic theoretical conformational analysis can help to understand chemical processes at a molecular level. (author)

  13. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  14. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  15. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  16. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  17. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  18. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  19. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  20. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  1. Conformational analysis of phloroglucinols from hypericum Brasiliense by using x-ray diffraction and molecular modeling

    Energy Technology Data Exchange (ETDEWEB)

    Leal, Katia Z.; Lindgren, Eric B.; Correa, Arthur L., E-mail: kzleal@uol.com.b [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Inst. de Quimica. Dept. de Fisico-Quimica; Yoneda, Julliane D. [Universidade Federal Fluminense (UFF), Volta Redonda, RJ (Brazil). Polo Universitario de Volta Redonda; Pinheiro, Carlos B. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Fisica; Franca, Hildegardo S. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Faculdade de Farmacia. Dept. de Tecnologia Farmaceutica

    2010-07-01

    In this work we intend to verify the applicability of a computational methodology to predict structural features of organic compounds with biological activity. We selected three phloroglucinols and compared their calculated conformational data with their X-ray crystallographic structure. The results showed that conformations obtained by conformational analysis with the AM1 method followed by geometry optimization by using the DFT B3LYP/6-31 G(d,p) basis set are in very good agreement with X-ray data, indicating that the methodology employed here seems to be a very useful tool in order to predict the conformational preference for this class of compounds. (author)

  2. Variable-temperature NMR and conformational analysis of Oenothein B

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Suzana C.; Carvalho, Ariadne G.; Fortes, Gilmara A.C.; Ferri, Pedro H.; Oliveira, Anselmo E. de, E-mail: suzana.quimica.ufg@hotmail.com [Universidade Federal de Goias (UFGO), Goiania, GO (Brazil). Instituto de Quimica

    2014-02-15

    Oenothein B is a dimeric hydrolyzable tannin with a wide range of biological activities, such as antitumour, anti-inflammatory and antiviral. Its nuclear magnetic resonance (NMR) at room temperature show duplications and broadening of signals. Experiments of 1D and 2D NMR at lower temperatures were useful for the complete NMR assignments of all hydrogens and carbons. The 3D structure of the most stable conformer was determined for the first time by nuclear Overhauser effect spectroscopy (NOESY) experiment (-20 deg C) and density functional theory (DFT)(B3LYP/6-31G)/ polarizable continuum model (PCM) quantum chemical calculations. The favoured conformation showed a highly compacted geometry and a lack of symmetry, in which the two valoneoyl groups showed distinct conformational parameters and stabilities. (author)

  3. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  4. Conformational analysis of starch derivatives by FTIR spectroscopy

    NARCIS (Netherlands)

    Bruijnes, C.; Bosman, R.; Bareman, P.; Besemer, A.

    1989-01-01

    Infrared spectroscopy appears to be a helpful tool for conformational analyses of starch derivatives. In this study spectral changes in the fmgerprint region between 1200 and 900 cm-1 are related to changes in tertiary structures of β-cyclodextrin and linear dextrin inclusion complexes, linear

  5. Improvement of the sensitivity and resolution of PCR-SSCP analysis ...

    Indian Academy of Sciences (India)

    Introduction. Polymerase chain reaction single-strand conformation poly- morphism (PCR-SSCP) is a widely utilized screening method for detection of mutations. In this method, the tar- get sequence of interest is amplified by PCR and separated as single-stranded molecules by electrophoresis in a nonde- naturing ...

  6. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  7. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  9. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  10. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  11. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  12. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  13. Conformational analysis of amide extractants by NMR in organic phase

    International Nuclear Information System (INIS)

    Berthon, C.

    1993-08-01

    This study deals with nuclear fuel reprocessing. We have essentially used NMR spectroscopy. We want to understand which kind of conformational parameters control selectivity and efficiency of amide extractant. The symmetric monoamides used are DOBA (C 3 H 7 CON (CH 2 CH(C 2 H 5 ) C 4 H 9 ) 2 ), DOiBA ((CH 3 ) 2 CCHON (CH 2 CH(C 2 H 5 )C 4 H 9 ) 2 ) and DOTA ((CH 3 ) 3 CCH 2 CON(CH 2 CH(C 2 H 5 )C 4 H 9 ) 2 ). Each gives two quasi equivalent conformers (cis and trans) in organic phases. The selected malonamide DMDBTDMA ((C 4 H 9 (CH 3 )NCO) 2 CHC 14 H 29 ) has four conformers because of its twice disymmetric amide functions. Weak interactions between monoamides which yield to dimer formation. The malonamide also gives dimers but forms aggregates too. Nitric acid extraction is due to the competitive formation of six species L, L 2 , L 2 (HNO 3 ), L(HNO 3 ), L(HNO 3 ) 2 , L(HNO 3 ) 3 (L: monoamide). Complexation between lanthanides (III) and monoamides yields to the stoichiometries L 3 Ln(NO 3 ) 3 and L 2 Ln(NO 3 ) 3 . Their ratio depend of steric hindrance on the carbonyl and the metal ionic radius. The same thing is observed of Pu 4+ and Th 4+ extraction in non acidic media. L 2 An(NO 3 ) 4 is the main stoichiometric except for the Th 4+ - DOBA system where the species (DOBA) 3 Th(NO 3 ) 4 appear. Exchange rates between the ligand and the complex are pointed out. The monoamide conformations obtained with lanthanide and plutonium nitrate can explain the difference in extracting power of this molecule between An 4+ and Ln 3+ . (author). 162 refs., 87 figs., 44 tabs., 7 annexes

  14. Conformational Analysis Of Starch Derivatives By FTIR Spectroscopy

    Science.gov (United States)

    Bruijnes, Chris; Bosman, Ron; Bareman, Peter; Besemer, Arie

    1989-12-01

    Infrared spectroscopy appears to be a helpful tool for conformational analyses of starch derivatives. In this study spectral changes in the fingerprint region between 1200 and 900 cm-1 are related to changes in tertiary structures of P-cyclodextrin and linear dextrin inclusion complexes, linear dextrin after removal of complexed agent and amorphous amylose. The assumed similarity between the structures of β-cyclodextrin and linear dextrin inclusion complexes is confirmed by the spectra.

  15. Conformational analysis of starch derivatives by FTIR spectroscopy

    OpenAIRE

    Bruijnes, C.; Bosman, R.; Bareman, P.; Besemer, A.

    1989-01-01

    Infrared spectroscopy appears to be a helpful tool for conformational analyses of starch derivatives. In this study spectral changes in the fmgerprint region between 1200 and 900 cm-1 are related to changes in tertiary structures of β-cyclodextrin and linear dextrin inclusion complexes, linear dextrin after removal of complexed agent and amorphous amylose. The assumed similarity between the structures of β-cyclodextrin and linear dextrin inclusion complexes is confirmed by the spectra.

  16. Conformal displays: human factor analysis of innovative landing aids

    Science.gov (United States)

    Schmerwitz, Sven; Lueken, Thomas; Doehler, Hans-Ullrich; Peinecke, Niklas; Ernst, Johannes M.; da Silva Rosa, David L.

    2017-05-01

    In the past couple of years, research on display content for helicopter operations headed in a new direction. The already reached goals could evolve into a paradigm change for information visualization. Technology advancements allow implementing three-dimensional and conformal content on a helmet-mounted see-through device. This superimposed imagery inherits the same optical flow as the environment. It is supposed to ease switching between display information and environmental cues. The concept is neither pathbreaking nor new, but it has not been successfully established in aviation yet. Nevertheless, there are certainly some advantages to expect-at least from perspective of a human-centered system design. Within the following pages, the next generation displays will be presented and discussed with a focus on human factors. Beginning with recalling some human factor related research facts, an experiment comparing the former two-dimensional research displays will be presented. Before introducing the DLR conformal symbol set and the three experiments about an innovative drift, indication related research activities toward conformal symbol sets will be addressed.

  17. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  18. Conformational Dynamics of apo-GlnBP Revealed by Experimental and Computational Analysis

    KAUST Repository

    Feng, Yitao

    2016-10-13

    The glutamine binding protein (GlnBP) binds l-glutamine and cooperates with its cognate transporters during glutamine uptake. Crystal structure analysis has revealed an open and a closed conformation for apo- and holo-GlnBP, respectively. However, the detailed conformational dynamics have remained unclear. Herein, we combined NMR spectroscopy, MD simulations, and single-molecule FRET techniques to decipher the conformational dynamics of apo-GlnBP. The NMR residual dipolar couplings of apo-GlnBP were in good agreement with a MD-derived structure ensemble consisting of four metastable states. The open and closed conformations are the two major states. This four-state model was further validated by smFRET experiments and suggests the conformational selection mechanism in ligand recognition of GlnBP. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

  19. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  20. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  1. A Rapid Analysis of Variations in Conformational Behavior during Dihydrofolate Reductase Catalysis.

    Science.gov (United States)

    Hughes, Robert L; Johnson, Luke A; Behiry, Enas M; Loveridge, E Joel; Allemann, Rudolf K

    2017-04-18

    Protein flexibility is central to enzyme catalysis, yet it remains challenging both to predict conformational behavior on the basis of analysis of amino acid sequence and protein structure and to provide the necessary breadth of experimental support to any such predictions. Here a generic and rapid procedure for identifying conformational changes during dihydrofolate reductase (DHFR) catalysis is described. Using DHFR from Escherichia coli (EcDHFR), selective side-chain 13 C labeling of methionine and tryptophan residues is shown to be sufficient to detect the closed-to-occluded conformational transition that follows the chemical step in the catalytic cycle, with clear chemical shift perturbations found for both methionine methyl and tryptophan indole groups. In contrast, no such perturbations are seen for the DHFR from the psychrophile Moritella profunda, where the equivalent conformational change is absent. Like EcDHFR, Salmonella enterica DHFR shows experimental evidence of a large-scale conformational change following hydride transfer that relies on conservation of a key hydrogen bonding interaction between the M20 and GH loops, directly comparable to the closed-to-occluded conformational change observed in EcDHFR. For the hyperthermophile Thermotoga maritima, no chemical shift perturbations were observed, suggesting that no major conformational change occurs during the catalytic cycle. In spite of their conserved tertiary structures, DHFRs display variations in conformational sampling that occurs concurrently with catalysis.

  2. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  3. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  4. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  5. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  6. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  7. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  8. Conformational analysis and circular dichroism of bilirubin, the yellow pigment of jaundice

    Science.gov (United States)

    Lightner, David A.; Person, Richard; Peterson, Blake; Puzicha, Gisbert; Pu, Yu-Ming; Bojadziev, Stefan

    1991-06-01

    Conformational analysis of (4Z, 15Z)-bilirubin-IX(alpha) by molecular mechanics computations reveals a global energy minimum folded conformation. Powerful added stabilization is achieved through intramolecular hydrogen bonding. Theoretical treatment of bilirubin as a molecular exciton predicts an intense bisignate circular dichroism spectrum for the folded conformation: (Delta) (epsilon) is congruent to 270 L (DOT) mole-1 (DOT) cm-1 for the $OM450 nm electronic transition(s). Synthesis of bilirubin analogs with propionic acid groups methylated at the (alpha) or (beta) position introduces an allosteric effect that allows for an optical resolution of the pigments, with enantiomers exhibiting the theoretically predicted circular dichroism.

  9. Development of 112 unique expressed sequence tags from chicken liver using an arbitrarily primed reserve transcriptase-polymerase chain reaction and single strand conformation gel purification method

    NARCIS (Netherlands)

    Carré, W.; Diot, C.; Fillon, V.; Crooijmans, R.P.M.A.; Lagarrique, S.; Morrisson, M.; Vignal, A.; Groenen, M.A.M.; Douai, M.

    2001-01-01

    In order to provide information on chicken genome expression, expressed sequence tags (ESTs) were developed from chicken liver RNAs using a method based on arbitrarily primed reverse transcription-polymerase chain reaction (RT-PCR) of total RNAs. The method is similar to differential display, using

  10. Hierarchical Conformational Analysis of Native Lysozyme Based on Sub-Millisecond Molecular Dynamics Simulations.

    Directory of Open Access Journals (Sweden)

    Kai Wang

    Full Text Available Hierarchical organization of free energy landscape (FEL for native globular proteins has been widely accepted by the biophysics community. However, FEL of native proteins is usually projected onto one or a few dimensions. Here we generated collectively 0.2 milli-second molecular dynamics simulation trajectories in explicit solvent for hen egg white lysozyme (HEWL, and carried out detailed conformational analysis based on backbone torsional degrees of freedom (DOF. Our results demonstrated that at micro-second and coarser temporal resolutions, FEL of HEWL exhibits hub-like topology with crystal structures occupying the dominant structural ensemble that serves as the hub of conformational transitions. However, at 100 ns and finer temporal resolutions, conformational substates of HEWL exhibit network-like topology, crystal structures are associated with kinetic traps that are important but not dominant ensembles. Backbone torsional state transitions on time scales ranging from nanoseconds to beyond microseconds were found to be associated with various types of molecular interactions. Even at nanoseconds temporal resolution, the number of conformational substates that are of statistical significance is quite limited. These observations suggest that detailed analysis of conformational substates at multiple temporal resolutions is both important and feasible. Transition state ensembles among various conformational substates at microsecond temporal resolution were observed to be considerably disordered. Life times of these transition state ensembles are found to be nearly independent of the time scales of the participating torsional DOFs.

  11. ConfBuster: Open-Source Tools for Macrocycle Conformational Search and Analysis

    Directory of Open Access Journals (Sweden)

    Xavier Barbeau

    2018-01-01

    Full Text Available Macrocycles are cyclic macromolecules that have gained an increased interest in drug development. To our knowledge, the current bioinformatics tools that are available to investigate and predict macrocycles 3D conformations are limited in their availability. In this paper, we introduce ConfBuster, a suite of tools written in Python with the goal of sampling the lower energy conformations of macrocycles. The suite also includes tools for the analysis and visualisation of the conformational search results. Coordinate sets of single molecules in MOL2 or PDB format are required as input, and a set of lower energy conformation coordinates is returned as output, as well as PyMOL script and graphics for results analysis. In addition to Python and the optional R programming languages with freely available packages, the tools require Open Babel and PyMOL to work properly. For several examples, ConfBuster found macrocycle conformations that are within few tenths of Å of the experimental structures in minutes. To our knowledge, this is the only open-source tools for macrocycle conformational search available to the scientific community

  12. Theoretical studies on the molecular structure, conformational preferences, topological and vibrational analysis of allicin

    Science.gov (United States)

    Durlak, Piotr; Berski, Sławomir; Latajka, Zdzisław

    2016-01-01

    The molecular structure, conformational preferences, topological and vibrational analysis of allicin has been investigated at two different approaches. Calculations have been carried out on static (DFT and MP2) levels with an assortment of Dunning's basis sets and dynamic CPMD simulations. In this both case within the isolated molecule approximation. The results point out that at least twenty different conformers coexist on the PES as confirmed by the flexible character of this molecule. The topological analysis of ELF showed very similar nature of the Ssbnd S and Ssbnd O bonds. The infrared spectrum has been calculated, and a comparative vibrational analysis has been performed.

  13. [3.3]Dithia-bridged cyclophanes featuring a thienothiophene ring : synthesis, structures and conformational analysis

    NARCIS (Netherlands)

    Mashraqui, Sabir H.; Sanghvikar, Yogesh; Ghadhigaonkar, Shailesh; Kumar, Sukeerthi; Meetsma, Auke; Dau, Elise Tran Huu

    2009-01-01

    The synthesis of [3.3]dithia-bridgedcyclophanes 7, 9 and 11 incorporating a fused heterocycle, thieno[2,3-b] thiophene is described. The structures are established by H-1 NMR analysis and, in the case of 11, also by single crystal X-ray crystallography. Conformational analysis by variable

  14. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  15. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  16. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  17. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  18. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  19. Deciphering the shape and deformation of secondary structures through local conformation analysis

    Directory of Open Access Journals (Sweden)

    Camproux Anne-Claude

    2011-02-01

    Full Text Available Abstract Background Protein deformation has been extensively analysed through global methods based on RMSD, torsion angles and Principal Components Analysis calculations. Here we use a local approach, able to distinguish among the different backbone conformations within loops, α-helices and β-strands, to address the question of secondary structures' shape variation within proteins and deformation at interface upon complexation. Results Using a structural alphabet, we translated the 3 D structures of large sets of protein-protein complexes into sequences of structural letters. The shape of the secondary structures can be assessed by the structural letters that modeled them in the structural sequences. The distribution analysis of the structural letters in the three protein compartments (surface, core and interface reveals that secondary structures tend to adopt preferential conformations that differ among the compartments. The local description of secondary structures highlights that curved conformations are preferred on the surface while straight ones are preferred in the core. Interfaces display a mixture of local conformations either preferred in core or surface. The analysis of the structural letters transition occurring between protein-bound and unbound conformations shows that the deformation of secondary structure is tightly linked to the compartment preference of the local conformations. Conclusion The conformation of secondary structures can be further analysed and detailed thanks to a structural alphabet which allows a better description of protein surface, core and interface in terms of secondary structures' shape and deformation. Induced-fit modification tendencies described here should be valuable information to identify and characterize regions under strong structural constraints for functional reasons.

  20. Improvement of the sensitivity and resolution of PCR-SSCP analysis ...

    Indian Academy of Sciences (India)

    25-dihydroxyvitamin D3) re- ceptor (VDR) to ... C for 5 min. After amplifi- cation, PCR product was purified with low-melting agarose. Keywords. single-strand conformation polymorphism; mutation screening; primer; PCR. Journal of Genetics ...

  1. Conformational analysis of some 4‧-substituted 2-(phenylselanyl)- 2-(methoxy)- acetophenones

    Science.gov (United States)

    Traesel, Henrique J.; Olivato, Paulo R.; Valença, J.; Rodrigues, Daniel N. S.; Zukerman-Schpector, Julio; Colle, Maurizio Dal

    2018-04-01

    A conformational study of some 4‧-substituited 2-(phenylselanyl)-2-(methoxy)-acetophenones (OMe 1, H 2, and Cl 3) was performed using IR carbonyl stretching band analysis supported by NBO and PCM calculations at the B3LYP/6-31 + G (d,p) level for 1-3 and using X-ray diffraction for 1 and 2. The computational results indicated the existence of three stable conformers for the series (c2, c3, and c1 in order of decreasing stability), whose relative abundance changes with solvent permittivity. The experimental trend observed for the components of the triplet carbonyl band in all solvents matches well with computational results and thus allows for their assignment to distinct conformers. The relative population of the c1 conformer increases in more polar solvents, becoming the most stable conformer in the highest permittivity solvent, acetonitrile, as indicated by IR spectra and PCM calculations. These findings are related to the quasi parallel geometry assumed by the Cδ+ = Oδ- and Cδ+-Oδ- dipoles, which favour stronger solvation. NBO analysis shows that the sum of the energies (ΣE) of the relevant orbital interactions stabilizes the c3 conformer of 1-3 slightly, likely due to the minor contribution of the LPO5→σ*C3sbnd Se10 interaction. However, only the c1 conformer is significantly destabilized by the Oδ-(1)CO … Oδ-(5)OMe short contact electrostatic repulsion, which is also responsible for its highest νCO frequency. In addition, the LPO5→ σ*C2sbnd C3 orbital interaction accounts for the lowest νCO frequency of c3 conformer. X-ray single crystal analysis of compounds 1 and 2 indicates that in the solid state they assume the least stable c1 conformation found in the gas phase. Molecules of these compounds are stabilized in the crystal through a series of Csbnd H⋯O and Csbnd H … π intermolecular interactions.

  2. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  4. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  5. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  6. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  7. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  8. DFT molecular modeling and NMR conformational analysis of a new longipinenetriolone diester

    Science.gov (United States)

    Cerda-García-Rojas, Carlos M.; Guerra-Ramírez, Diana; Román-Marín, Luisa U.; Hernández-Hernández, Juan D.; Joseph-Nathan, Pedro

    2006-05-01

    The structure and conformational behavior of the new natural compound (4 R,5 S,7 S,8 R,9 S,10 R,11 R)-longipin-2-en-7,8,9-triol-1-one 7-angelate-9-isovalerate (1) isolated from Stevia eupatoria, were studied by molecular modeling and NMR spectroscopy. A Monte Carlo search followed by DFT calculations at the B3LYP/6-31G* level provided the theoretical conformations of the sesquiterpene framework, which were in full agreement with results derived from the 1H- 1H coupling constant analysis.

  9. Supramolecular chemical shift reagents inducing conformational transitions: NMR analysis of carbohydrate homooligomer mixtures

    DEFF Research Database (Denmark)

    Beeren, Sophie; Meier, Sebastian

    2015-01-01

    We introduce the concept of supramolecular chemical shift reagents as a tool to improve signal resolution for the NMR analysis of homooligomers. Non-covalent interactions with the shift reagent can constrain otherwise flexible analytes inducing a conformational transition that results in signal s...

  10. 77 FR 47621 - Appalachian Gateway Project; Notice of Availability of Draft General Conformity Analysis

    Science.gov (United States)

    2012-08-09

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP10-448-000] Appalachian Gateway Project; Notice of Availability of Draft General Conformity Analysis In accordance with the... (GCD) for the Appalachian Gateway Project (Project) to assess the potential air quality impacts...

  11. Conformational analysis of capsaicin using 13C, 15N MAS NMR, GIAO DFT and GA calculations

    Science.gov (United States)

    Siudem, Paweł; Paradowska, Katarzyna; Bukowicki, Jarosław

    2017-10-01

    Capsaicin produced by plants from genus Capsicum exerts multiple pharmacological effects and has found applications in food and pharmaceutical industry. The alkaloid was studied by a combined approach: solid-state NMR, GA conformational search and GIAO DFT methods. The 13C CPMAS NMR spectra were recorded using variable contact time and dipolar dephasing experiments. The results of cross-polarization (CP) kinetics, such as TCP values and long T1ρH (100-200 ms), indicated that the capsaicin molecule is fairly mobile, especially at the end of the aliphatic chain. The15N MAS NMR spectrum showed one narrow signal at -255 ppm. Genetic algorithm (GA) search with multi modal optimization was used to find low-energy conformations of capsaicin. Theoretical GIAO DFT calculations were performed using different basis sets to characterize five selected conformations. 13C CPMAS NMR was used as a validation method and the experimental chemical shifts were compared with those calculated for selected stable conformers. Conformational analysis suggests that the side chain can be bent or extended. A comparison of the experimental and the calculated chemical shifts indicates that solid capsaicin does not have the same structure as those established by PWXRD.

  12. Investigation and conformational analysis of fluorinated nucleoside antibiotics targeting siderophore biosynthesis.

    Science.gov (United States)

    Dawadi, Surendra; Viswanathan, Kishore; Boshoff, Helena I; Barry, Clifton E; Aldrich, Courtney C

    2015-05-15

    Antibiotic resistance represents one of the greatest threats to public health. The adenylation inhibitor 5'-O-[N-(salicyl)sulfamoyl]adenosine (SAL-AMS) is the archetype for a new class of nucleoside antibiotics that target iron acquisition in pathogenic microorganisms and is especially effective against Mycobacterium tuberculosis, the causative agent of tuberculosis. Strategic incorporation of fluorine at the 2' and 3' positions of the nucleoside was performed by direct fluorination to enhance activity and improve drug disposition properties. The resulting SAL-AMS analogues were comprehensively assessed for biochemical potency, whole-cell antitubercular activity, and in vivo pharmacokinetic parameters. Conformational analysis suggested a strong preference of fluorinated sugar rings for either a 2'-endo, 3'-exo (South), or a 3'-endo,2'-exo (North) conformation. The structure-activity relationships revealed a strong conformational bias for the C3'-endo conformation to maintain potent biochemical and whole-cell activity, whereas improved pharmacokinetic properties were associated with the C2'-endo conformation.

  13. Robust design and analysis of a conformal expansion nozzle with inverse-design idea

    Directory of Open Access Journals (Sweden)

    Wenbiao GAN

    2018-01-01

    Full Text Available This paper examines robust optimization design and analysis of a conformal expansion nozzle of flying wing Unmanned Aerial Vehicle (UAV with the inverse-design idea. In view of flow features and stealth constraints, the inverse-design idea is described and the uncertainty-based robust design model is presented. A robust design system employs this model to combine deterministic optimization and robust optimization and is applied into design of a conformal expansion nozzle. The results indicate that design optimization can conform to the anticipation of the inverse-design idea and significantly improve the aerodynamic performance that meet the requirement of 6σ. The present method is a feasible nozzle design strategy that integrates robust optimization and inverse-design.

  14. Conjugates of 1'-Aminoferrocene-1-carboxylic Acid and Proline: Synthesis, Conformational Analysis and Biological Evaluation

    Directory of Open Access Journals (Sweden)

    Monika Kovačević

    2014-08-01

    Full Text Available Our previous studies showed that alteration of dipeptides Y-Fca-Ala-OMe (III into Y-Ala-Fca-OMe (IV (Y = Ac, Boc; Fca = 1'-aminoferrocene-1-carboxylic acid significantly influenced their conformational space. The novel bioconjugates Y-Fca-Pro-OMe (1, Y = Ac; 2, Y = Boc and Y-Pro-Fca-OMe (3, Y = Boc; 4, Y = Ac have been prepared in order to investigate the influence of proline, a well-known turn-inducer, on the conformational properties of small organometallic peptides with an exchanged constituent amino acid sequences. For this purpose, peptides 1–4 were subjected to detailed spectroscopic analysis (IR, NMR, CD spectroscopy in solution. The conformation of peptide 3 in the solid state was determined. Furthermore, the ability of the prepared conjugates to inhibit the growth of estrogen receptor-responsive MCF-7 mammary carcinoma cells and HeLa cervical carcinoma cells was tested.

  15. Characterizing protein conformations by correlation analysis of coarse-grained contact matrices

    Science.gov (United States)

    Lindsay, Richard J.; Siess, Jan; Lohry, David P.; McGee, Trevor S.; Ritchie, Jordan S.; Johnson, Quentin R.; Shen, Tongye

    2018-01-01

    We have developed a method to capture the essential conformational dynamics of folded biopolymers using statistical analysis of coarse-grained segment-segment contacts. Previously, the residue-residue contact analysis of simulation trajectories was successfully applied to the detection of conformational switching motions in biomolecular complexes. However, the application to large protein systems (larger than 1000 amino acid residues) is challenging using the description of residue contacts. Also, the residue-based method cannot be used to compare proteins with different sequences. To expand the scope of the method, we have tested several coarse-graining schemes that group a collection of consecutive residues into a segment. The definition of these segments may be derived from structural and sequence information, while the interaction strength of the coarse-grained segment-segment contacts is a function of the residue-residue contacts. We then perform covariance calculations on these coarse-grained contact matrices. We monitored how well the principal components of the contact matrices is preserved using various rendering functions. The new method was demonstrated to assist the reduction of the degrees of freedom for describing the conformation space, and it potentially allows for the analysis of a system that is approximately tenfold larger compared with the corresponding residue contact-based method. This method can also render a family of similar proteins into the same conformational space, and thus can be used to compare the structures of proteins with different sequences.

  16. Application of equilibrium binding model for analysis of conformational transitions in poly(rApoly(rU complexes with metal ions

    Directory of Open Access Journals (Sweden)

    Sorokin V. A.

    2010-09-01

    Full Text Available Aim. The study is aimed at generalization of the previous experimental results on the metal ion (Mg2+, Ni2+, Cd2+ effects on conformation transitions in poly(rA·poly(rU. The objective was to find out how the type of a metal ion-polynucleotide complex influences the phase transitions and to estimate the constants (K of ions binding to polymers of different structures. Methods. The K values were obtained upon theoretical and experimental transition temperature fitting by the least-square method with the root mean square deviation minimized through the procedure of the gradient descent in the multidimensional space. Results. Calcula- tions of diagrams with Mg2+ are shown to permit obtaining satisfactory results if concentration-independent, mean values of constants are used. For Ni2+ and Cd2+ the concentration dependence of K must be taken into account, especially for high ion contents at which compaction of single-stranded poly(rA emerges. It was revealed that the main factor responsible for the differences in diagrams with Ni2+ and Cd2+ is a significant distinction of their constants of binding to poly(rA and poly(rU. Conclusions. The model theory of equilibrium binding is capable to describe adequately conformation transitions in polynucleotides in the presence of metal ions.

  17. Conformational analysis of nine-membered cyclic acetals. Stereoelectronic effect in 2,4- and 3,5-benzodioxonine derivatives.

    Science.gov (United States)

    Migda, Wojciech; Rys, Barbara

    2006-07-21

    Conformations of the title compounds were examined using DFT calculations and NBO analysis in order to find the origins of their conformational preferences. The most stable conformations were TBC and TCBtype-1 for the 2,4- and 3,5-benzodioxonine derivatives, respectively. In both of these conformations the acetal moiety adopts the g+/-g+/- geometry. The NBO analysis yielded values of the stabilization energy associated with the stereoelectronic nO --> sigmaC-O* interactions that were highest for conformations other than the global minima. Conformers displaying the strongest interactions followed different patterns of atom arrangement within the acetal moiety, namely g+g-, and those in which one or both of the torsion angles within the C-O-C-O-C segment were close to 90 degrees . Steric repulsion caused by alkyl substituents at the anomeric carbon was found to influence the strength of the nO --> sigmaC-O* stabilization through modification of bond lengths and torsion angles. The adopted ground-state conformations result from accommodation of steric repulsions and stabilizing stereoelectronic interactions. It was shown that DFT calculations of conformational preferences of acetals together with GIAO prediction of 13C chemical shifts should be a useful methodology for studies on conformation and conformational equilibria of acetals in solution.

  18. Conformer generation with OMEGA: learning from the data set and the analysis of failures.

    Science.gov (United States)

    Hawkins, Paul C D; Nicholls, Anthony

    2012-11-26

    We recently published a high quality validation set for testing conformer generators, consisting of structures from both the PDB and the CSD (Hawkins, P. C. D. et al. J. Chem. Inf. Model. 2010, 50, 572.), and tested the performance of our conformer generator, OMEGA, on these sets. In the present publication, we focus on understanding the suitability of those data sets for validation and identifying and learning from OMEGA's failures. We compare, for the first time we are aware of, the coverage of the applicable property spaces between the validation data sets we used and the parent compound sets to determine if our data sets adequately sample these property spaces. We also introduce the concept of torsion fingerprinting and compare this method of dissimilation to the more traditional graph-centric diversification methods we used in our previous publication. To improve our ability to programmatically identify cases where the crystallographic conformation is not well reproduced computationally, we introduce a new metric to compare conformations, RMSTanimoto. This new metric is used alongside those from our previous publication to efficiently identify reproduction failures. We find RMSTanimoto to be particularly effective in identifying failures for the smallest molecules in our data sets. Analysis of the nature of these failures, particularly those for the CSD, sheds further light on the issue of strain in crystallographic structures. Some of the residual failure cases not resolved by simple changes in OMEGA's defaults present significant challenges to conformer generation engines like OMEGA and are a source of new avenues to further improve their performance, while others illustrate the pitfalls of validating against crystallographic ligand conformations, particularly those from the PDB.

  19. Analysis of non-conformity in continuous quality improvement in a Hospital Radiopharmacy Unit.

    Science.gov (United States)

    Martinez, T; Contreras, J F

    To perform an analysis of non-conformities (NC) registered between 2012 and 2015, as a part of the review process of the Quality Management System of our Radiopharmacy Unit. Non-conformities registered in the Radiopharmacy Unit in the period 2012-2015 are analyzed and sorted by their impact on the process (critical, major, and minor), cause/origin of the non-conformity, and nature of radiopharmaceutical (PET vs. SPECT). A decrease in the NC of 20% per year is observed, especially in PET radiopharmaceuticals. Non-conformities in SPECT make up about 62-84% of the total of the NC, mainly related to the high number of doses prepared and not administered, which is about 1.5-3% in the ratio of non-administered/administered per year. Analysis of the NC can be considered as a useful indicator in assessment of quality assurance, and in our particular case, the decrease in the registration of NC indicates effectiveness in the corrective and preventive actions implemented. Copyright © 2016 Elsevier España, S.L.U. y SEMNIM. All rights reserved.

  20. Chromosome Conformation Capture Carbon Copy (5C) in Budding Yeast.

    Science.gov (United States)

    Belton, Jon-Matthew; Dekker, Job

    2015-06-01

    Chromosome conformation capture carbon copy (5C) is a high-throughput method for detecting ligation products of interest in a chromosome conformation capture (3C) library. 5C uses ligation-mediated amplification (LMA) to generate carbon copies of 3C ligation product junctions using single-stranded oligonucleotide probes. This procedure produces a 5C library of short DNA molecules which represent the interactions between the corresponding restriction fragments. The 5C library can be amplified using universal primers containing the Illumina paired-end adaptor sequences for subsequent high-throughput sequencing. © 2015 Cold Spring Harbor Laboratory Press.

  1. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  2. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  3. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  4. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  5. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  6. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  7. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  8. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  9. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  10. Prospective analysis of ambiental and weather effects on conform displaying of fireworks

    Directory of Open Access Journals (Sweden)

    Jitea Ciprian

    2017-01-01

    Full Text Available The paper presents the results of research on theoretical and practical relating to establishing and analysis of effects of ambiental and weather effects on conform displaying of fireworks used to organizing fireworks. Scientific research highlighted in this article was conducted in the project no. PN 16 43 03 04, study conducted through Nucleu program entitled -„ Research on the influence of microclimate factors on parameters of the products, while testing the functioning of pyrotechnic articles”.

  11. Identification of Serine Conformers by Matrix-Isolation IR Spectroscopy Aided by Near-Infrared Laser-Induced Conformational Change, 2D Correlation Analysis, and Quantum Mechanical Anharmonic Computations.

    Science.gov (United States)

    Najbauer, Eszter E; Bazsó, Gábor; Apóstolo, Rui; Fausto, Rui; Biczysko, Malgorzata; Barone, Vincenzo; Tarczay, György

    2015-08-20

    The conformers of α-serine were investigated by matrix-isolation IR spectroscopy combined with NIR laser irradiation. This method, aided by 2D correlation analysis, enabled unambiguously grouping the spectral lines to individual conformers. On the basis of comparison of at least nine experimentally observed vibrational transitions of each conformer with empirically scaled (SQM) and anharmonic (GVPT2) computed IR spectra, six conformers were identified. In addition, the presence of at least one more conformer in Ar matrix was proved, and a short-lived conformer with a half-life of (3.7 ± 0.5) × 10(3) s in N2 matrix was generated by NIR irradiation. The analysis of the NIR laser-induced conversions revealed that the excitation of the stretching overtone of both the side chain and the carboxylic OH groups can effectively promote conformational changes, but remarkably different paths were observed for the two kinds of excitations.

  12. Single Molecule Cluster Analysis Identifies Signature Dynamic Conformations along the Splicing Pathway

    Science.gov (United States)

    Blanco, Mario R.; Martin, Joshua S.; Kahlscheuer, Matthew L.; Krishnan, Ramya; Abelson, John; Laederach, Alain; Walter, Nils G.

    2016-01-01

    The spliceosome is the dynamic RNA-protein machine responsible for faithfully splicing introns from precursor messenger RNAs (pre-mRNAs). Many of the dynamic processes required for the proper assembly, catalytic activation, and disassembly of the spliceosome as it acts on its pre-mRNA substrate remain poorly understood, a challenge that persists for many biomolecular machines. Here, we developed a fluorescence-based Single Molecule Cluster Analysis (SiMCAn) tool to dissect the manifold conformational dynamics of a pre-mRNA through the splicing cycle. By clustering common dynamic behaviors derived from selectively blocked splicing reactions, SiMCAn was able to identify signature conformations and dynamic behaviors of multiple ATP-dependent intermediates. In addition, it identified a conformation adopted late in splicing by a 3′ splice site mutant, invoking a mechanism for substrate proofreading. SiMCAn presents a novel framework for interpreting complex single molecule behaviors that should prove widely useful for the comprehensive analysis of a plethora of dynamic cellular machines. PMID:26414013

  13. Phenyl galactopyranosides – {sup 13}C CPMAS NMR and conformational analysis using genetic algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Wałejko, Piotr, E-mail: pwalejko@uwb.edu.pl [University of Bialystok, Institute of Chemistry, Pilsudskiego 11/4, 15-443 Bialystok (Poland); Paradowska, Katarzyna, E-mail: katarzyna.paradowska@wum.edu.pl [Medical University of Warsaw, Faculty of Pharmacy, Department of Physical Chemistry, Banacha 1, 02-097 Warsaw (Poland); Bukowicki, Jarosław [Medical University of Warsaw, Faculty of Pharmacy, Department of Physical Chemistry, Banacha 1, 02-097 Warsaw (Poland); Witkowski, Stanisław [University of Bialystok, Institute of Chemistry, Pilsudskiego 11/4, 15-443 Bialystok (Poland); Wawer, Iwona [Medical University of Warsaw, Faculty of Pharmacy, Department of Physical Chemistry, Banacha 1, 02-097 Warsaw (Poland)

    2015-08-18

    Highlights: • The structures of phenyl galactosides were studied by {sup 13}C CPMAS NMR. • The GAAGS method was used in conformational analysis of phenyl galactosides. • The rotation of the aglycone was investigated. • {sup 13}C CPMAS NMR supported by GIAO DFT calculations was used as a verification method. - Abstract: Structural analyses of four compounds (phenyl 2,3,4,6-tetra-O-acetyl-β-D-galactopyranoside (1), phenyl β-D-galactopyranoside (2), phenyl 2,3,4,6-tetra-O-acetyl-α-D-galactopyranoside (3) and phenyl α-D-galactopyranoside (4)) have been performed using solid-state {sup 13}C MAS NMR spectroscopy and theoretical methods. Conformational analysis involved grid search and genetic algorithm (GAAGS). Low-energy conformers found by GAAGS were further optimized by DFT and chemical shifts were calculated using GIAO/DFT approach. {sup 13}C CPMAS NMR chemical shift of carbon C2 is indicative of the glycoside torsional angle. Separated or merged resonances of C2 and C6 suggest free rotation of phenyl ring in the solid phase.

  14. Conformations of the HIV-1 protease: A crystal structure data set analysis.

    Science.gov (United States)

    Palese, Luigi Leonardo

    2017-11-01

    The HIV protease is an important drug target for HIV/AIDS therapy, and its structure and function have been extensively investigated. This enzyme performs an essential role in viral maturation by processing specific cleavage sites in the Gag and Gag-Pol precursor polyproteins so as to release their mature forms. This 99 amino acid aspartic protease works as a homodimer, with the active site localized in a central cavity capped by two flexible flap regions. The dimer presents closed or open conformations, which are involved in the substrate binding and release. Here the results of the analysis of a HIV-1 protease data set containing 552 dimer structures are reported. Different dimensionality reduction methods have been used in order to get information from this multidimensional database. Most of the structures in the data set belong to two conformational clusters. An interesting observation that comes from the analysis of these data is that some protease sequences are localized preferentially in specific areas of the conformational landscape of this protein. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  16. On the analysis and comparison of conformer-specific essential dynamics upon ligand binding to a protein

    International Nuclear Information System (INIS)

    Grosso, Marcos; Kalstein, Adrian; Parisi, Gustavo; Fernandez-Alberti, Sebastian; Roitberg, Adrian E.

    2015-01-01

    The native state of a protein consists of an equilibrium of conformational states on an energy landscape rather than existing as a single static state. The co-existence of conformers with different ligand-affinities in a dynamical equilibrium is the basis for the conformational selection model for ligand binding. In this context, the development of theoretical methods that allow us to analyze not only the structural changes but also changes in the fluctuation patterns between conformers will contribute to elucidate the differential properties acquired upon ligand binding. Molecular dynamics simulations can provide the required information to explore these features. Its use in combination with subsequent essential dynamics analysis allows separating large concerted conformational rearrangements from irrelevant fluctuations. We present a novel procedure to define the size and composition of essential dynamics subspaces associated with ligand-bound and ligand-free conformations. These definitions allow us to compare essential dynamics subspaces between different conformers. Our procedure attempts to emphasize the main similarities and differences between the different essential dynamics in an unbiased way. Essential dynamics subspaces associated to conformational transitions can also be analyzed. As a test case, we study the glutaminase interacting protein (GIP), composed of a single PDZ domain. Both GIP ligand-free state and glutaminase L peptide-bound states are analyzed. Our findings concerning the relative changes in the flexibility pattern upon binding are in good agreement with experimental Nuclear Magnetic Resonance data

  17. On the analysis and comparison of conformer-specific essential dynamics upon ligand binding to a protein

    Science.gov (United States)

    Grosso, Marcos; Kalstein, Adrian; Parisi, Gustavo; Roitberg, Adrian E.; Fernandez-Alberti, Sebastian

    2015-06-01

    The native state of a protein consists of an equilibrium of conformational states on an energy landscape rather than existing as a single static state. The co-existence of conformers with different ligand-affinities in a dynamical equilibrium is the basis for the conformational selection model for ligand binding. In this context, the development of theoretical methods that allow us to analyze not only the structural changes but also changes in the fluctuation patterns between conformers will contribute to elucidate the differential properties acquired upon ligand binding. Molecular dynamics simulations can provide the required information to explore these features. Its use in combination with subsequent essential dynamics analysis allows separating large concerted conformational rearrangements from irrelevant fluctuations. We present a novel procedure to define the size and composition of essential dynamics subspaces associated with ligand-bound and ligand-free conformations. These definitions allow us to compare essential dynamics subspaces between different conformers. Our procedure attempts to emphasize the main similarities and differences between the different essential dynamics in an unbiased way. Essential dynamics subspaces associated to conformational transitions can also be analyzed. As a test case, we study the glutaminase interacting protein (GIP), composed of a single PDZ domain. Both GIP ligand-free state and glutaminase L peptide-bound states are analyzed. Our findings concerning the relative changes in the flexibility pattern upon binding are in good agreement with experimental Nuclear Magnetic Resonance data.

  18. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  19. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola.

    Science.gov (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da

    2016-06-02

    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  20. Hampton Roads, Virginia eight-hour ozone maintenance area transportation conformity analysis : 2030 long range transportation plan and FY 09-12 transportation improvement program, draft executive summary.

    Science.gov (United States)

    2010-05-01

    This report presents the regional conformity analysis and recommendation for a finding of conformity for the Hampton Roads 2030 Long Range Transportation Plan (LRTP, or "Plan") and associated Fiscal Year (FY) 2009-2012 Transportation Improvement Prog...

  1. Hampton Roads, Virginia eight-hour ozone maintenance area transportation conformity analysis : 2030 long range transportation plan and FY 09-12 transportation improvement program, draft report.

    Science.gov (United States)

    2010-05-01

    This report presents the regional conformity analysis and recommendation for a finding : of conformity for the Hampton Roads 2030 Long Range Transportation Plan (LRTP, or : "Plan") and associated Fiscal Year (FY) 2009-2012 Transportation Improvement ...

  2. Programmed Switching of Single Polymer Conformation on DNA Origami

    DEFF Research Database (Denmark)

    Krissanaprasit, Abhichart; Madsen, Mikael; Knudsen, Jakob Bach

    2016-01-01

    ) by DNA hybridization directed by single-stranded guiding strands and ssDNA tracks extending from the origami surface and polymer handle. We demonstrate switching of a conjugated organic polymer conformation between left- and right-turned conformations of the polymer on DNA origami based on toehold......-mediated strand displacement. The switching is observed by atomic force microscopy and by Förster resonance energy transfer between the polymer and two different organic dyes positioned in close proximity to the respective patterns. Using this method, the polymer conformation can be switched six times...... successively. This controlled nanomechanical switching of conjugated organic polymer conformation demonstrates unique control of the shape of a single polymer molecule, and it may constitute a new component for the development of reconfigurable nanophotonic and nanoelectronic devices....

  3. Ionic interactions and the global conformations of the hammerhead ribozyme

    DEFF Research Database (Denmark)

    Bassi, G S; Møllegaard, N E; Murchie, A I

    1995-01-01

    Here we investigate the global conformation of the hammerhead ribozyme. Electrophoretic studies demonstrate that the structure is folded in response to the concentration and type of ions present. Folding based on colinear alignment of arms II and III is suggested, with a variable angle subtended ......-line attack of the 2'-hydroxyl group, with a bound metal ion playing an integral role in the chemistry.......Here we investigate the global conformation of the hammerhead ribozyme. Electrophoretic studies demonstrate that the structure is folded in response to the concentration and type of ions present. Folding based on colinear alignment of arms II and III is suggested, with a variable angle subtended...... by the remaining helix I. In the probable active conformation, a small angle is subtended between helices I and II. Using uranyl photocleavage, an ion binding site has been detected in the long single-stranded region. The folded conformation could generate a preactivation of the scissile bond to permit in...

  4. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  5. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  6. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  7. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  8. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  9. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  10. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  11. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  12. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  13. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Theoretical NMR and conformational analysis of solvated oximes for organophosphates-inhibited acetylcholinesterase reactivation

    Science.gov (United States)

    da Silva, Jorge Alberto Valle; Modesto-Costa, Lucas; de Koning, Martijn C.; Borges, Itamar; França, Tanos Celmar Costa

    2018-01-01

    In this work, quaternary and non-quaternary oximes designed to bind at the peripheral site of acetylcholinesterase previously inhibited by organophosphates were investigated theoretically. Some of those oximes have a large number of degrees of freedom, thus requiring an accurate method to obtain molecular geometries. For this reason, the density functional theory (DFT) was employed to refine their molecular geometries after conformational analysis and to compare their 1H and 13C nuclear magnetic resonance (NMR) theoretical signals in gas-phase and in solvent. A good agreement with experimental data was achieved and the same theoretical approach was employed to obtain the geometries in water environment for further studies.

  15. [Conformational analysis of tachykinins. III. C-terminal fragment Asx-Xaa-Phe-Yaa-Gly-Leu-Met-NH2].

    Science.gov (United States)

    Avanov, A Ia

    1991-07-01

    Theoretical conformational analysis of C-terminal fragments of tachykinin peptides with a common amino acid sequence Asx-Xaa-Phe-Yaa-Gly-Leu-Met-NH2 suggested the conformational states to be independent of the nature of Xaa and Yaa residues. It is shown that among plausible spatial forms of the C-terminal fragments an alpha-helix with the hydrophobic coat consisted of identically oriented side chains is energetically the most stable structure. The preference of this conformation for tachykinins functioning is discussed.

  16. Analysis of conformational variations of the cricoid cartilages in Thoroughbred horses using computed tomography.

    Science.gov (United States)

    Dahlberg, J A; Valdes-Martinez, A; Boston, R C; Parente, E J

    2011-03-01

    Loss of arytenoid abduction is a common post operative complication of laryngoplasty without a definitive cause. It has been a clinical impression during laryngoplasty surgery that there is great conformational variability along the caudal edge of the Thoroughbred cricoid cartilage that could impact post operative retention of suture position. A change in suture position would probably lead to some loss of abduction. Defining any structural variability of the cricoid would be an initial step in determining whether this variability could impact on the retention of suture position. Anatomical variations in the larynx of Thoroughbred horses may be detected and measured using objective analysis and computed tomography. Larynges were harvested from 15 mature Thoroughbred horses. Helical CT scans were performed on each specimen. Three independent observers performed a series of measurements on 2D and 3D reconstruction images using digital software. Measurements included the lateral cricoid angle, the caudal cricoid prominences, the distance to the cricoid slope, the angle of the cricoarytenoid joints (CAJ), the cricoid thickness and the suture angle. Mean, standard deviation, coefficient of variation and linear regression analysis were performed among all observers and all measurements. Notable conformational differences were evident on the 3D reconstructions. The highest degree of variability was found in 3 measurements: the distance to the lateral cricoid slope, the lateral cricoid angle and the cricoid thickness. A larger left CAJ angle directly and significantly correlated with a larger suture angle. There are notable conformational differences among cricoid specimens in the Thoroughbred larynx. The morphometric differences identified may impact on optimal prosthesis placement and long-term retention. Since a larger lateral cricoid angle may facilitate abduction loss secondary to a displaced and loosened suture, alternative techniques for suture placement may be of

  17. QSAR study and conformational analysis of 4-arylthiazolylhydrazones derived from 1-indanones with anti-Trypanosoma cruzi activity.

    Science.gov (United States)

    Noguera, Guido J; Fabian, Lucas E; Lombardo, Elisa; Finkielsztein, Liliana

    2015-10-12

    A set of 4-arylthiazolylhydrazones derived from 1-indanones (TZHs) previously synthesized and assayed against Trypanosoma cruzi, the causative agent of Chagas disease, were explored in terms of conformational analysis. We found that TZHs can adopt four minimum energy conformations: cis (A, B and C) and trans. The possible bioactive conformation was selected by a 3D-QSAR model. Different molecular parameters were calculated to produce QSAR second-generation models. These QSAR results are discussed in conjunction with conformational analysis from molecular modeling studies. The main factor to determine the activity of the compounds was the partial charge at the N(3) atom (qN3). The predictive ability of the QSAR equations proposed was experimentally validated. The QSAR models developed in this study will be helpful to design novel potent TZHs. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Spectral analysis and quantum chemical studies of chair and twist-boat conformers of cycloheximide in gas and solution phases

    Science.gov (United States)

    Tokatli, A.; Ucun, F.; Sütçü, K.; Osmanoğlu, Y. E.; Osmanoğlu, Ş.

    2018-02-01

    In this study the conformational behavior of cycloheximide in the gas and solution (CHCl3) phases has theoretically been investigated by spectroscopic and quantum chemical properties using density functional theory (wB97X-D) method with 6-31++G(d,p) basis set, for the first time. The calculated IR results reveal that in the ground state the molecule exits as a mixture of the chair and twist-boat conformers in the gas phase, while the calculated NMR results reveal that it only exits as the chair conformer in the solution phase. In order to obtain the contributions coming from intramolecular interactions to the stability of the conformers in the gas and solution phases, the quantum theory of atoms in molecules (QTAIM), noncovalent interactions (NCI) method, and natural bond orbital analysis (NBO) have been employed. The QTAIM and NCI methods indicated that by intramolecular interactions with bond critical point (BCP) the twist-boat conformer is more stabilized than the chair conformer, while by steric interactions it is more destabilized. Considering that these interactions balance each other, the stabilities of the conformers are understood to be dictated by the van der Waals interactions. The NBO analyses show that the hyperconjugative and steric effects play an important role in the stabilization in the gas and solution phases. Furthermore, to get a better understanding of the chemical behavior of this important antibiotic drug we have evaluated and, commented the global and local reactivity descriptors of the both conformers. Finally, the EPR analysis of γ-irradiated cycloheximide has been done. The comparison of the experimental and calculated data have showed the inducement of a radical structure of (CH2)2ĊCH2 in the molecule. The experimental EPR spectrum has also confirmed that the molecule simultaneously exists in the chair and twist-boat conformers in the solid phase.

  19. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  20. Long-range carbon-proton spin-spin coupling constants in conformational analysis

    International Nuclear Information System (INIS)

    Spoormaker, T.

    1979-01-01

    The author has collected a reliable set of data on long range 13 C- 1 H coupling constants in aliphatic compounds and developed the use of long range 13 C- 1 H coupling constants as a tool in the conformational analysis of aliphatic compounds. An empirical determination of the torsion angle dependence of the vicinal 13 C- 1 H coupling constant for model compounds is described and the dependence of long range 13 C- 1 H coupling constants on the electronegativity of substituents attached to the coupling pathway reported for the monohalogen substituted ethanes and propanes. The electronegativity dependence of the vicinal 13 C- 1 H coupling was studied in monosubstituted propanes whose substituents are elements from the first row of the periodic table and it is shown that the vicinal 13 C- 1 H coupling constant in aliphatic systems is a constitutive property. The geminal 13 C- 1 H coupling constants in ethyl, isopropyl and tert-butyl compounds, which have been substituted by an element of the first row of the periodic table or a haline atom, are reported and the influence of electronegative substituents on the vicinal 13 C- 1 H coupling constants in the individual rotamers of 13 CH 3 -C(X)H-C(Y)H- 1 H fragments discussed. The application of long range 13 C- 1 H coupling constants to the conformational analysis of CMP-N-Acetylneuraminic acid and 2,6-dichloro-1,4-oxathiane is described. (Auth.)

  1. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  2. Model analysis of molecular conformations in terms of weak interactions between non bonded atoms

    International Nuclear Information System (INIS)

    Lombardi, E.

    1988-01-01

    The aim of the present paper is to establish a reliable basis for the evaluation of stable conformations and rotational barriers for molecules, with possible applications to systems of biological interest. It is proceeded in two steps: first, the effect of chemical environment on orbitals of a given atom is studied for diatomic units, adopting a valence-bond approach and considering, as prototypes, the two simplest series of diatomic molecules with one valence electron each, i.e. the alkali diatomics and the alkali hydrides. In the model, the orbital of the hydrogen atom by a simple (''1S'') gaussian function, the valence orbital of an alkali atom by a function (r 2 -a 2 ) times a simple gaussian (''2S'' gaussian). Dissociation energies D e and equilibrium distances R e are calculated using a scanning procedure. Agreement with experiment is quantitative for the alkali diatomics. For alkali hydrides, good agreement is obtained only if validity of a rule β e R e =constant, for the two atoms separately, is postulated; β e is the characteristic parameter of a ''1S'' gaussian (hydrogen) or a ''2S'' gaussian (alkali atom) function. In a second step, the authors assume validity of the same rule in conformational analysis for any single bonded A-B molecule with A=C, O, N, P, Si, Ge and B=H, or a halogen atom. Gauge β e values for H, F and C are obtained by fitting experimental rotational barriers in C 2 H 6 , C 2 F 6 and C 3 H 8 . Stable conformation of, and barriers to rotation in, ethane-like rotors are determined, applying first-order exchange perturbation theory, in terms of two- and many-center exchange interactions in cluster of non-bonded atoms. Some 60 molecules are analyzed. Agreement with experiments is strikngly good except for a few systematic deviation. Reasons for such discrepancies are discussed

  3. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen

    2005-01-01

    Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed...

  4. Analysis of Rectangular Folded-Waveguide Millimeter-Wave Slow-wave Structures using Conformal Transformations

    Science.gov (United States)

    Sumathy, M.; Vinoy, K. J.; Datta, S. K.

    2009-03-01

    An analysis of rectangular folded-waveguide slow-wave structure was developed using conformal mapping technique through Schwarz’s polygon transformation and closed form expressions for the lumped capacitance and inductance per period of the slow-wave structure were derived in terms of the physical dimensions of the structure, incorporating the effects of the beam hole in the lumped parameters. The lumped parameters were subsequently interpreted for obtaining the dispersion and interaction impedance characteristics of the structure. The analysis was benchmarked for two typical millimeter-wave structures, one operating in Ka-band and the other operating in Q-band, against measurement and 3D electromagnetic modeling using MAFIA.

  5. p53 gene analysis in childhood B non - Hodgkin's lymphoma

    Directory of Open Access Journals (Sweden)

    Claudete Esteves Nogueira Pinto Klumb

    Full Text Available CONTEXT: Mutations or deletions in the tumor-suppressor gene p53 are among the commonest genetic changes found in human neoplasms including breast, lung and bowel cancers. In hematological malignancies, p53 is most often mutated in Burkitt's lymphoma, with p53 mutations present in 30 to 40% of tumor samples and in 70% of cell lines. OBJECTIVE: To analyze the p53 gene alterations in child patients with B non-Hodgkin's lymphoma. DESIGN: Descriptive study. SETTING: Tertiary oncology care center. PARTICIPANTS: The study investigated 12 patients with childhood B non-Hodgkin's lymphoma (Burkitt's lymphoma. Screening for p53 mutations was done by polymerase chain reaction - single strand conformational polymorphism (PCR-SSCP analysis of exon 5 to 8/9 of the gene. RESULTS: Abnormal polymerase chain reaction - single strand conformational polymorphism migration pattern was observed in 4 patients (33.3%, one on exon 6 and three on exon 7. Positive cases included 2 patients who died from disease. CONCLUSION: These preliminary results suggest that p53 mutations are quite frequent in children with Burkitt's lymphoma and may play a role in lymphoma genesis or disease progression.

  6. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  7. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  8. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  9. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Temporin A and its retro-analogues: synthesis, conformational analysis and antimicrobial activities.

    Science.gov (United States)

    Kamysz, Wojciech; Mickiewicz, Beata; Rodziewicz-Motowidło, Sylwia; Greber, Katarzyna; Okrój, Marcin

    2006-08-01

    Temporin A (TA) is a hydrophobic peptide isolated from the skin of the European red frog Rana temporaria. Strong antimicrobial activity against gram-positive cocci and Candida, as well as its small molecular weight (10-13 aa residues), makes TA an interesting antimicrobial compound. However, its synthesis is rather problematic. Here, the synthesis of two retro-analogues of TA--retro-TA and (6-1)(7-13)-TA--is reported. The synthesis of retro-TA was performed without any problems, while during the synthesis of (6-1)(7-13)-TA problems similar to those encountered during the synthesis of TA were faced. Antimicrobial assays showed minimal inhibitory concentration (MIC) values of retro-TA to be, in most cases, only one dilution higher than those of original TA, but still remained relatively low. An analysis of the circular dichroism spectra of the peptides shows that TA and (6-1)(7-13)-TA adopt an alpha-helical structure in a hydrophobic environment, while retro-TA forms mainly unordered conformation under both hydrophobic and hydrophilic conditions. One can postulate that differences in conformation of the peptide chain might be responsible for the lower antimicrobial activity of retro-TA as compared to that of the parent molecule. In any case, retro-TA can be interesting owing to its simple and nonproblematic synthesis. Copyright (c) 2006 European Peptide Society and John Wiley & Sons, Ltd.

  12. Solvates of the antifungal drug griseofulvin: structural, thermochemical and conformational analysis.

    Science.gov (United States)

    Aitipamula, Srinivasulu; Chow, Pui Shan; Tan, Reginald B H

    2014-02-01

    Four solvates of an antifungal drug, griseofulvin (GF), were discovered. All the solvates were characterized by differential scanning calorimetry, thermogravimetric analysis, and their crystal structures were determined by single-crystal X-ray diffraction. The solvents that form the solvates are acetonitrile, nitromethane and nitroethane (2:1 and 1:1). It was found that all the solvates lose the solvent molecules from the crystal lattice between 343 and 383 K, and that the melting point of the desolvated materials matched the melting point of the solvent-free GF (493 K). The conformation of the GF molecule in solvent-free form was found to be significantly different from the conformations found in the solvates. Solution stability studies revealed that the GF-acetonitrile solvate transforms to GF and that GF-nitroethane (1:1) solvate transforms to GF-nitroethane (2:1) solvate. On the other hand, GF-nitromethane and GF-nitroethane (2:1) solvates were found to be stable in solution. Our results highlight the importance of the co-crystallization technique in the pharmaceutical drug development; it not only expands the solid form diversity but also creates new avenues for unraveling novel solvates.

  13. Conformational analysis of glutamic acid: a density functional approach using implicit continuum solvent model.

    Science.gov (United States)

    Turan, Başak; Selçuki, Cenk

    2014-09-01

    Amino acids are constituents of proteins and enzymes which take part almost in all metabolic reactions. Glutamic acid, with an ability to form a negatively charged side chain, plays a major role in intra and intermolecular interactions of proteins, peptides, and enzymes. An exhaustive conformational analysis has been performed for all eight possible forms at B3LYP/cc-pVTZ level. All possible neutral, zwitterionic, protonated, and deprotonated forms of glutamic acid structures have been investigated in solution by using polarizable continuum model mimicking water as the solvent. Nine families based on the dihedral angles have been classified for eight glutamic acid forms. The electrostatic effects included in the solvent model usually stabilize the charged forms more. However, the stability of the zwitterionic form has been underestimated due to the lack of hydrogen bonding between the solute and solvent; therefore, it is observed that compact neutral glutamic acid structures are more stable in solution than they are in vacuum. Our calculations have shown that among all eight possible forms, some are not stable in solution and are immediately converted to other more stable forms. Comparison of isoelectronic glutamic acid forms indicated that one of the structures among possible zwitterionic and anionic forms may dominate over the other possible forms. Additional investigations using explicit solvent models are necessary to determine the stability of charged forms of glutamic acid in solution as our results clearly indicate that hydrogen bonding and its type have a major role in the structure and energy of conformers.

  14. Potent oxazoline analog of apratoxin C: Synthesis, biological evaluation, and conformational analysis.

    Science.gov (United States)

    Yoshida, Masahito; Onda, Yuichi; Masuda, Yuichi; Doi, Takayuki

    2016-11-04

    In this research, the synthesis, biological evaluation, and conformational analysis of an apratoxin C oxazoline analog (3) have been demonstrated. The preparation of synthetic key intermediate 9 was achieved using an improved strategy that involves commercially available 3-methylglutaric anhydride (12), an enzymatic enantioselective alcoholysis, and a diastereoselective reduction. The Pro-Dtrina (3,7-dihydroxy-2,5,8-trimethylnonanoic acid) moiety 8 was successfully synthesized in a similar manner as our previously reported synthesis of apratoxin C (1). The cyclization precursor 5 was formed after the coupling of Pro-Dtrina 8 with a known tetrapeptide 7 to afford a linear peptide 6, the formation of an oxazoline, and the removal of the protecting groups. Finally, the macrolactamization of 5 with O-(7-aza-1H-benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU)/N,N-diisopropylethylamine (DIEA) furnished an apratoxin C oxazoline analog (3), which exhibited a potent cytotoxicity against HeLa cells (IC50 value of 22 nM) that was comparable with the cytotoxicity of apratoxin C (1) (IC50 value of 4.2 nM). Conformational analyses of 1 and 3 through NMR experiments showed that oxazoline analog 3 formed a tertiary structure that was similar to the apratoxin C (1) structure in CD3 CN, which provided a probable explanation for their comparable cytotoxicities. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 404-414, 2016. © 2015 Wiley Periodicals, Inc.

  15. A Co-Association Network Analysis of the Genetic Determination of Pig Conformation, Growth and Fatness

    Science.gov (United States)

    Puig-Oliveras, Anna; Ballester, Maria; Corominas, Jordi; Revilla, Manuel; Estellé, Jordi; Fernández, Ana I.; Ramayo-Caldas, Yuliaxis; Folch, Josep M.

    2014-01-01

    Background Several QTLs have been identified for major economically relevant traits in livestock, such as growth and meat quality, revealing the complex genetic architecture of these traits. The use of network approaches considering the interactions of multiple molecules and traits provides useful insights into the molecular underpinnings of complex traits. Here, a network based methodology, named Association Weight Matrix, was applied to study gene interactions and pathways affecting pig conformation, growth and fatness traits. Results The co-association network analysis underpinned three transcription factors, PPARγ, ELF1, and PRDM16 involved in mesoderm tissue differentiation. Fifty-four genes in the network belonged to growth-related ontologies and 46 of them were common with a similar study for growth in cattle supporting our results. The functional analysis uncovered the lipid metabolism and the corticotrophin and gonadotrophin release hormone pathways among the most important pathways influencing these traits. Our results suggest that the genes and pathways here identified are important determining either the total body weight of the animal and the fat content. For instance, a switch in the mesoderm tissue differentiation may determinate the age-related preferred pathways being in the puberty stage those related with the miogenic and osteogenic lineages; on the contrary, in the maturity stage cells may be more prone to the adipocyte fate. Hence, our results demonstrate that an integrative genomic co-association analysis is a powerful approach for identifying new connections and interactions among genes. Conclusions This work provides insights about pathways and key regulators which may be important determining the animal growth, conformation and body proportions and fatness traits. Molecular information concerning genes and pathways here described may be crucial for the improvement of genetic breeding programs applied to pork meat production. PMID:25503799

  16. A co-association network analysis of the genetic determination of pig conformation, growth and fatness.

    Directory of Open Access Journals (Sweden)

    Anna Puig-Oliveras

    Full Text Available Several QTLs have been identified for major economically relevant traits in livestock, such as growth and meat quality, revealing the complex genetic architecture of these traits. The use of network approaches considering the interactions of multiple molecules and traits provides useful insights into the molecular underpinnings of complex traits. Here, a network based methodology, named Association Weight Matrix, was applied to study gene interactions and pathways affecting pig conformation, growth and fatness traits.The co-association network analysis underpinned three transcription factors, PPARγ, ELF1, and PRDM16 involved in mesoderm tissue differentiation. Fifty-four genes in the network belonged to growth-related ontologies and 46 of them were common with a similar study for growth in cattle supporting our results. The functional analysis uncovered the lipid metabolism and the corticotrophin and gonadotrophin release hormone pathways among the most important pathways influencing these traits. Our results suggest that the genes and pathways here identified are important determining either the total body weight of the animal and the fat content. For instance, a switch in the mesoderm tissue differentiation may determinate the age-related preferred pathways being in the puberty stage those related with the miogenic and osteogenic lineages; on the contrary, in the maturity stage cells may be more prone to the adipocyte fate. Hence, our results demonstrate that an integrative genomic co-association analysis is a powerful approach for identifying new connections and interactions among genes.This work provides insights about pathways and key regulators which may be important determining the animal growth, conformation and body proportions and fatness traits. Molecular information concerning genes and pathways here described may be crucial for the improvement of genetic breeding programs applied to pork meat production.

  17. Molecular dynamics analysis of conformational change of paramyxovirus F protein during the initial steps of membrane fusion

    International Nuclear Information System (INIS)

    Martín-García, Fernando; Mendieta-Moreno, Jesús Ignacio; Mendieta, Jesús; Gómez-Puertas, Paulino

    2012-01-01

    Highlights: ► Initial conformational change of paramyxovirus F protein is caused only by mechanical forces. ► HRA region undergoes a structural change from a beta + alpha conformation to an extended coil and then to an all-alpha conformation. ► HRS domains of F protein form three single α-helices prior to generation of the coiled coil. -- Abstract: The fusion of paramyxovirus to the cell membrane is mediated by fusion protein (F protein) present in the virus envelope, which undergoes a dramatic conformational change during the process. Unlike hemagglutinin in orthomyxovirus, this change is not mediated by an alteration of environmental pH, and its cause remains unknown. Steered molecular dynamics analysis leads us to suggest that the conformational modification is mediated only by stretching mechanical forces once the transmembrane fusion peptide of the protein is anchored to the cell membrane. Such elongating forces will generate major secondary structure rearrangement in the heptad repeat A region of the F protein; from β-sheet conformation to an elongated coil and then spontaneously to an α-helix. In addition, it is proposed that the heptad repeat A region adopts a final three-helix coiled coil and that this structure appears after the formation of individual helices in each monomer.

  18. Ionic interactions and the global conformations of the hammerhead ribozyme

    DEFF Research Database (Denmark)

    Bassi, G S; Møllegaard, N E; Murchie, A I

    1995-01-01

    Here we investigate the global conformation of the hammerhead ribozyme. Electrophoretic studies demonstrate that the structure is folded in response to the concentration and type of ions present. Folding based on colinear alignment of arms II and III is suggested, with a variable angle subtended......-line attack of the 2'-hydroxyl group, with a bound metal ion playing an integral role in the chemistry....... by the remaining helix I. In the probable active conformation, a small angle is subtended between helices I and II. Using uranyl photocleavage, an ion binding site has been detected in the long single-stranded region. The folded conformation could generate a preactivation of the scissile bond to permit in...

  19. a Combined Molecular Dynamics and NMR Spectroscopic Protocol for the Conformational Analysis of Oligosaccharides.

    Science.gov (United States)

    Varma, Vikram

    A combined experimental and theoretical protocol for the conformational analysis of oligosaccharides is presented. Three disaccharides, methyl alpha - scD-mannopyranosyl-(1 to 3)-alpha- scD-mannopyranoside, methyl beta- scD-galactopyranosyl-(1 to 4)-beta- scD-glucopyranoside, and propyl beta- scD-2-acetamido -2-deoxy glucopyranosyl-(1 to 3)- alpha- scL-rhamnopyranoside, are used to evaluate a protocol for conformational analysis that makes use of molecular dynamics calculations with the CHARMM force field. Dynamics trajectories computed in vacuo and in water are used to calculate time-averaged NMR parameters such as spin-lattice relaxation times (T_1 ), Nuclear Overhauser Enhancements (NOE), and heteronuclear spin-spin coupling constants (^3J _{rm CH}). The calculated NMR parameters are then compared to experimental values and used to evaluate the computational procedure. The energetically accessible conformations are effectively sampled by the simulations. The method has been extended to the conformational analysis of higher-order oligosaccharides corresponding to the cell-wall polysaccharide of the Streptococcus Group A, and the Shigella flexneri Y O-antigen. The Streptococcus Group A cell-wall polysaccharide is comprised of a backbone of rhamnopyranosyl units connected by alternating alpha- scL-(1 to 3) and alpha- scL -(1 to 2) linkages, to which are attached N-acetyl-beta- scD-glucosamine ( beta- scD-GlcpNAc) residues at the 3 positions of the rhamnose backbone.rm A&rm B^'qquad A^'& rm Bqquad Acr[{-alpha}{-}L{-}Rha {it p}{-}(1to2){-alpha }{-}L{-}Rha{it p} {-}(1to3){-alpha}{ -}L{-}Rha{it p}-(1to2) -alpha-L-Rha{it p}{-}(1 to3){-alpha}{-}L{- }Rha{it p}{-}cr&uparrow(1 to3)&uparrow(1to3)crbeta {-}D{-}&rm Glc{it p }NAcqquadbeta{-}D{-}& rm Glc{it p}NAccr&rm C ^'&rm C] A branched trisaccharide (A^' -(C)B), a tetrasaccharide (A^' -(C)B-A), a pentasaccharide (C^' -B^'-A ^'-(C)B), and two hexasaccharides (C^'-B^ '-A^' -(C)B-A) and (A-(C^')B ^'-A^' -(C)B), have been chosen

  20. Analysis of conformational flexibility of loop 110-120 of protein tyrosine phosphatase 1B.

    Science.gov (United States)

    Tanchuk, V Yu; Tanin, V O; Vovk, A I

    2013-01-01

    Conformations of the catalytic center of protein tyrosine phosphatase 1B (PTP1B) and surrounding loops are known to be important in catalysis and inhibition of the enzyme. There were 98 conformations from 88 PDB files representing PTP1B with different ligands which were analyzed to investigate the details of loop 110-120 movement and mobility of separate residues. The differences were identified by a special software tool which performs multiple comparisons of selected parts of PDB files. The conformations were divided into 6 clusters. It was found that the loop formed by residues 110-120 can be characterized by four main conformations. Predominantly, the loop 110-120 adopts the main conformation and keeps it during WPD loop movement. Three other conformations appear to be stabilized in case of closed WPD loop and seem to be favorable for PTP1B with subunit structure.

  1. Single molecule FRET data analysis procedures for FRET efficiency determination: probing the conformations of nucleic acid structures.

    Science.gov (United States)

    Krüger, Asger Christian; Birkedal, Victoria

    2013-11-01

    Single molecule FRET microscopy is an attractive technique for studying structural dynamics and conformational diversity of nucleic acid structures. Some of its strengths are that it can follow structural changes on a fast time scale and identify conformation distributions arising from dynamic or static population heterogeneity. Here, we give a description of the experiment and data analysis procedures of this method and detail what parameters are needed for FRET efficiency calculation. Using single molecule FRET data obtained on G-quadruplex DNA structures that exhibit large conformation diversity, we illustrate that the shape of the FRET distribution changes depending on what parameters are included in the data analysis procedure. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  3. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  4. Adhesion and friction in polymer films on solid substrates: conformal sites analysis and corresponding surface measurements.

    Science.gov (United States)

    An, Rong; Huang, Liangliang; Mineart, Kenneth P; Dong, Yihui; Spontak, Richard J; Gubbins, Keith E

    2017-05-21

    In this work, we present a statistical mechanical analysis to elucidate the molecular-level factors responsible for the static and dynamic properties of polymer films. This analysis, which we term conformal sites theory, establishes that three dimensionless parameters play important roles in determining differences from bulk behavior for thin polymer films near to surfaces: a microscopic wetting parameter, α wx , defined as the ratio of polymer-substrate interaction to polymer-polymer interaction; a dimensionless film thickness, H*; and dimensionless temperature, T*. The parameter α wx introduced here provides a more fundamental measure of wetting than previous metrics, since it is defined in terms of intermolecular forces and the atomic structure of the substrate, and so is valid at the nanoscale for gas, liquid or solid films. To test this theoretical analysis, we also report atomic force microscopy measurements of the friction coefficient (μ), adhesion force (F A ) and glass transition temperature (T g ) for thin films of two polymers, poly(methyl methacrylate) (PMMA) and polystyrene (PS), on two planar substrates, graphite and silica. Both the friction coefficient and the glass transition temperature are found to increase as the film thickness decreases, and this increase is more pronounced for the graphite than for the silica surface. The adhesion force is also greater for the graphite surface. The larger effects encountered for the graphite surface are attributed to the fact that the microscopic wetting parameter, α wx , is larger for graphite than for silica, indicating stronger attraction of polymer chains to the graphite surface.

  5. Comparative analysis of dose-volume histograms between 3D conformal and conventional non-conformal radiotherapy planning for prostate cancer

    International Nuclear Information System (INIS)

    Feitosa, Silvia Moreira; Giordani, Adelmo Jose; Dias, Rodrigo Sousa; Segreto, Helena Regina Comodo; Segreto, Roberto Araujo

    2009-01-01

    Objective: The present study was aimed at comparing conformal and non-conformal radiotherapy plans designed for patients with prostate cancer, by analyzing radiation doses in target volumes and organs at risk. Materials and methods: Radiotherapy plans for 40 patients with prostate cancer were analyzed. Conformal, conformal isocentric and non-conformal plans utilizing the source-surface distance were simulated for each of the patients for comparison of radiation dose in target volumes and organs at risk. For comparison purposes, dose-volume histograms for target volumes and organs at risk were analyzed. Results: Median doses were significantly lower in the conformal planning, with 25%, 40% and 60% volumes in the rectum and 30% and 60% in the bladder. The median doses were significantly lower in the conformal planning analyzing the right and left coxofemoral joints. Maximum, mean and median doses in the clinical target volume and in the planned target volume were significantly higher in the conformal planning. Conclusion: The present study has demonstrated that the conformal radiotherapy planning for prostate cancer allows the delivery of higher doses to the target volume and lower doses to adjacent healthy tissues. (author)

  6. Employing conformational analysis in the molecular modeling of agrochemicals: insights on QSAR parameters of 2,4-D

    Directory of Open Access Journals (Sweden)

    Matheus Puggina de Freitas

    2013-12-01

    Full Text Available A common practice to compute ligand conformations of compounds with various degrees of freedom to be used in molecular modeling (QSAR and docking studies is to perform a conformational distribution based on repeated random sampling, such as Monte-Carlo methods. Further calculations are often required. This short review describes some methods used for conformational analysis and the implications of using selected conformations in QSAR. A case study is developed for 2,4-dichlorophenoxyacetic acid (2,4-D, a widely used herbicide which binds to TIR1 ubiquitin ligase enzyme. The use of such an approach and semi-empirical calculations did not achieve all possible minima for 2,4-D. In addition, the conformations and respective energies obtained by the semi-empirical AM1 method do not match the calculated trends obtained by a high level DFT method. Similar findings were obtained for the carboxylate anion, which is the bioactive form. Finally, the crystal bioactive structure of 2,4-D was not found as a minimum when using Monte-Carlo/AM1 and is similarly populated with another conformer in implicit water solution according to optimization at the B3LYP/aug-cc-pVDZ level. Therefore, quantitative structure-activity relationship (QSAR methods based on three dimensional chemical structures are not fundamental to provide predictive models for 2,4-D congeners as TIR1 ubiquitin ligase ligands, since they do not necessarily reflect the bioactive conformation of this molecule. This probably extends to other systems.

  7. Conformal House

    DEFF Research Database (Denmark)

    Ryttov, Thomas; Sannino, Francesco

    2010-01-01

    fixed point. As a consistency check we recover the previously investigated conformal windows bounds when restricting to a single matter representation. The earlier conformal windows can be imagined to be part now of the new conformal house. We predict the nonperturbative anomalous dimensions...... at the infrared fixed points. We further investigate the effects of adding mass terms to the condensates on the conformal house chiral dynamics and construct the simplest instanton induced effective Lagrangian terms....

  8. Investigations of the conformation of DNA, native or alterated by irradiation, with ultraviolet radiation

    International Nuclear Information System (INIS)

    Zierenberg, B.

    1971-01-01

    An extension of the range of scattering angles in the direction of smaller angles (up to delta = 12 0 ) made it possible to successfully use the light scattering methods for the determination of DNA molecular weights >= 3 x 10 6 . In order to determine the conformation of native DNA in solution, different molecular weights were prepared by ultrasonic degradation. According to their hyperchromicity, these preparations are practically native. When native DNA in solution is irradiated with UV light of the wavelength lambda = 313 nm, two different photoreactions may occur: a) double and single strand breaks leading to degradation of the DNA molecule, and b) dimerisation of neighbouring thymine bases. The two reactions are independent of each other. In the presence of acetophenone as photosensitizer, the reaction type a) is greater by a factor 4 (in terms of single-strand breaks), while the reaction type b) is greater by a factor 16. The number of thymidine dimers per single strand break amounts to 100 for photosensitized reactions and to 25 for non-photosensitized reactions. The number of single strand breaks in terms of the quantum flux of 1 μ Einstein absorbed by the DNA is greater by a factor 3 during irradiation with UV light lambda = 254 nm as compared to the wavelength lambda = 313 nm. At this wavelength, DNA degradation starts at absorption energies as low as >= 2 x 10 7 erg/cm 3 . Light scattering and measurements with DNA containing thymidine dimers indicated neither a change in the total conformation nor a noticeable change in the microstructure. The hyperchromicity of the DNA was also unchanged. From these experimental results, it is concluded that the double helix of DNA is essentially stable to thymidine dimerisation. (orig./MG) [de

  9. Neural signatures of social conformity: A coordinate-based activation likelihood estimation meta-analysis of functional brain imaging studies.

    Science.gov (United States)

    Wu, Haiyan; Luo, Yi; Feng, Chunliang

    2016-12-01

    People often align their behaviors with group opinions, known as social conformity. Many neuroscience studies have explored the neuropsychological mechanisms underlying social conformity. Here we employed a coordinate-based meta-analysis on neuroimaging studies of social conformity with the purpose to reveal the convergence of the underlying neural architecture. We identified a convergence of reported activation foci in regions associated with normative decision-making, including ventral striatum (VS), dorsal posterior medial frontal cortex (dorsal pMFC), and anterior insula (AI). Specifically, consistent deactivation of VS and activation of dorsal pMFC and AI are identified when people's responses deviate from group opinions. In addition, the deviation-related responses in dorsal pMFC predict people's conforming behavioral adjustments. These are consistent with current models that disagreement with others might evoke "error" signals, cognitive imbalance, and/or aversive feelings, which are plausibly detected in these brain regions as control signals to facilitate subsequent conforming behaviors. Finally, group opinions result in altered neural correlates of valuation, manifested as stronger responses of VS to stimuli endorsed than disliked by others. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Conformation Analysis of T1 Lipase on Alcohols Solvent using Molecular Dynamics Simulation

    Science.gov (United States)

    Putri, A. M.; Sumaryada, T.; Wahyudi, S. T.

    2017-07-01

    Biodiesel usually is produced commercially via a transesterification reaction of vegetable oil with alcohol and alkali catalyst. The alkali catalyst has some drawbacks, such as the soap formation during the reaction. T1 Lipase enzyme had been known as a thermostable biocatalyst which is able to produce biodiesel through a cleaner process. In this paper the performance of T1 lipase enzyme as catalyst for transesterification reaction in pure ethanol, methanol, and water solvents were studied using a Molecular Dynamics (MD) Simulation at temperature of 300 K for 10 nanoseconds. The results have shown that in general the conformation of T1 lipase enzyme in methanol is more dynamics as shown by the value of root mean square deviation (RMSD), root mean squared fluctuation (RMSF), and radius of gyration. The highest solvent accessible surface area (SASA) total was also found in methanol due to the contribution of non-polar amino acid in the interior of the protein. Analysis of MD simulation has also revealed that the enzyme structure tend to be more rigid in ethanol environment. The analysis of electrostatic interactions have shown that Glu359-Arg270 salt-bridge pair might hold the key of thermostability of T1 lipase enzyme as shown by its strong and stable binding in all three solvents.

  11. Vibrational spectroscopy and principal component analysis for conformational study of virus nucleic acids

    Science.gov (United States)

    Dovbeshko, G. I.; Repnytska, O. P.; Pererva, T.; Miruta, A.; Kosenkov, D.

    2004-07-01

    Conformation analysis of mutated DNA-bacteriophages (PLys-23, P23-2, P47- the numbers have been assigned by T. Pererva) induced by MS2 virus incorporated in Ecoli AB 259 Hfr 3000 has been done. Surface enhanced infrared absorption (SEIRA) spectroscopy and principal component analysis has been applied for solving this problem. The nucleic acids isolated from the mutated phages had a form of double stranded DNA with different modifications. The nucleic acid from phage P47 was undergone the structural rearrangement in the most degree. The shape and position ofthe fine structure of the Phosphate asymmetrical band at 1071cm-1 as well as the stretching OH vibration at 3370-3390 cm-1 has indicated to the appearance ofadditional OH-groups. The Z-form feature has been found in the base vibration region (1694 cm-1) and the sugar region (932 cm-1). A supposition about modification of structure of DNA by Z-fragments for P47 phage has been proposed. The P23-2 and PLys-23 phages have showed the numerous minor structural changes also. On the basis of SEIRA spectra we have determined the characteristic parameters of the marker bands of nucleic acid used for construction of principal components. Contribution of different spectral parameters of nucleic acids to principal components has been estimated.

  12. Conformational Analysis of the DFG-Out Kinase Motif and Biochemical Profiling of Structurally Validated Type II Inhibitors

    Science.gov (United States)

    2015-01-01

    Structural coverage of the human kinome has been steadily increasing over time. The structures provide valuable insights into the molecular basis of kinase function and also provide a foundation for understanding the mechanisms of kinase inhibitors. There are a large number of kinase structures in the PDB for which the Asp and Phe of the DFG motif on the activation loop swap positions, resulting in the formation of a new allosteric pocket. We refer to these structures as “classical DFG-out” conformations in order to distinguish them from conformations that have also been referred to as DFG-out in the literature but that do not have a fully formed allosteric pocket. We have completed a structural analysis of almost 200 small molecule inhibitors bound to classical DFG-out conformations; we find that they are recognized by both type I and type II inhibitors. In contrast, we find that nonclassical DFG-out conformations strongly select against type II inhibitors because these structures have not formed a large enough allosteric pocket to accommodate this type of binding mode. In the course of this study we discovered that the number of structurally validated type II inhibitors that can be found in the PDB and that are also represented in publicly available biochemical profiling studies of kinase inhibitors is very small. We have obtained new profiling results for several additional structurally validated type II inhibitors identified through our conformational analysis. Although the available profiling data for type II inhibitors is still much smaller than for type I inhibitors, a comparison of the two data sets supports the conclusion that type II inhibitors are more selective than type I. We comment on the possible contribution of the DFG-in to DFG-out conformational reorganization to the selectivity. PMID:25478866

  13. The new proposal for harmonised rules for the online sales of tangible goods: conformity, lack of conformity and remedies: in-depth analysis

    NARCIS (Netherlands)

    Smits, Jan

    2016-01-01

    Upon request by the JURI Committee, this paper evaluates the European Commission proposal of 9 December 2015 harmonizing certain civil law contractual rules for Online Shopping. The directive's approach concerning conformity, lack of conformity and remedies is analized. It also examines the question

  14. SNP analysis of the inter-alpha-trypsin inhibitor family heavy chain-related protein (IHRP gene by a fluorescence-adapted SSCP method

    Directory of Open Access Journals (Sweden)

    Taniyama Matsuo

    2002-07-01

    Full Text Available Abstract Background Single-nucleotide polymorphisms (SNPs are considered to be useful polymorphic markers for genetic studies of polygenic traits. Single-stranded conformational polymorphism (SSCP analysis has been widely applied to detect SNPs, including point mutations in cancer and congenital diseases. In this study, we describe an application of the fluorescent labeling of PCR fragments using a fluorescent-adapted primer for SSCP analysis as a novel method. Methods Single-nucleotide polymorphisms (SNPs of the inter-alpha-trypsin inhibitor family heavy chain-related protein (IHRP gene were analyzed using a fluorescence-adapted SSCP method. The method was constructed from two procedures: 1 a fluorescent labeling reaction of PCR fragments using fluorescence-adapted primers in a single tube, and 2 electrophoresis on a non-denaturing polyacrylamide gel. Results This method was more economical and convenient than the single-stranded conformational polymorphism (SSCP methods previously reported in the detection of the labeled fragments obtained. In this study, eight SNPs of the IHRP gene were detected by the fluorescence-adapted SSCP. One of the SNPs was a new SNP resulting in an amino acid substitution, while the other SNPs have already been reported in the public databases. Six SNPs of the IHRP were associated with two haplotypes. Conclusions The fluorescence-adapted SSCP was useful for detecting and genotyping SNPs.

  15. Comment on "Conformational analysis of small organic molecules using NOE and RDC data: A discussion of strychnine and α-methylene-γ-butyrolactone"

    Science.gov (United States)

    Khodov, I. A.; Kiselev, M. G.; Efimov, S. V.; Klochkov, V. V.

    2016-05-01

    In a recent paper published in this journal, Kolmer et al. [1] reported an experimental approach for conformational analysis of small organic molecules using NOE and RDC techniques. The authors obtained information on conformation of strychnine and α-methylene-γ-butyrolactone molecules. In addition, possible sources of error in the measurement and analysis process and ideas of how to exclude them were discussed.

  16. Conformational analysis of Epac activation using amide hydrogen/deuterium exchange mass spectrometry.

    Science.gov (United States)

    Brock, Melissa; Fan, Fenghui; Mei, Fang C; Li, Sheng; Gessner, Christopher; Woods, Virgil L; Cheng, Xiaodong

    2007-11-02

    Exchange proteins directly activated by cAMP (Epac) play important roles in mediating the effects of cAMP through the activation of downstream small GTPases, Rap. To delineate the mechanism of Epac activation, we probed the conformation and structural dynamics of Epac using amide hydrogen/deuterium exchange and structural modeling. Our studies show that cAMP induces significant conformational changes that lead to a spatial rearrangement of the regulatory components of Epac and allows the exposure of the catalytic core for effector binding without imposing significant conformational change on the catalytic core. Homology modeling and comparative structural analyses of the cAMP binding domains of Epac and cAMP-dependent protein kinase (PKA) lead to a model of Epac activation, in which Epac and PKA activation by cAMP employs the same underlying principle, although the detailed structural and conformational changes associated with Epac and PKA activation are significantly different.

  17. Complete Relaxation and Conformational Exchange Matrix (CORCEMA) Analysis of NOESY Spectra of Interacting Systems; Two-Dimensional Transferred NOESY

    Science.gov (United States)

    Moseley, H. N. B.; Curto, E. V.; Krishna, N. R.

    1995-09-01

    A very general procedure entitled complete relaxation and conformational exchange matrix (CORCEMA) analysis has been developed to analyze the 2D-NOESY spectra of interacting systems undergoing multistate conformational exchange. This is an extension of earlier work from this laboratory on the methodological treatment of multistate conformational exchange [Krishna et al., Biopolymers19, 2003 (1980)] and the theory of transferred NOESY for finite exchange off-rates [Lee and Krishna, J. Magn. Reson.98, 36 (1992)]. The current theory is based on generalized rate matrices for relaxation and conformational exchange, The CORCEMA algorithm explicitly incorporates intermolecular dipolar cross relaxation between the molecules when they are complexed. It permits an analysis of NOESY intensities for the intra- as well as intermolecular contacts between the interacting molecules under a variety of binding conditions, Its application is illustrated on two examples of transferred NOESY simulations: (1) a two-state system involving a ligand and an enzyme forming a ligand-enzyme complex, and (2) a three-state system in which the ligand-enzyme complex can undergo a conformational transition from an "open state" to a "closed state," and can include conformational changes in both the complexed ligand and the complexed enzyme, such as hinge-bending motions, Simplifying expressions for generalized matrix analyses are derived for three limiting cases of the three-state system, This three-state example is illustrated using a hypothetical model of the hinge-bending motion in a thermolysin-inhibitor complex. It is shown that: (1) The neglect of cross relaxation between the interacting species in their complexed forms can lead to misleading conclusions on the "bound" conformation of the ligand. (2) If protein-mediated spin diffusion is dominant, caution is needed in analyses based on initial slopes alone due to one‧s inability to identify the exact range of the initial growth curve under

  18. Synthetic Methods for Ester Bond Formation and Conformational Analysis of Ester-Containing Carbohydrates

    Science.gov (United States)

    Hackbusch, Sven

    This dissertation encompasses work related to synthetic methods for the formation of ester linkages in organic compounds, as well as the investigation of the conformational influence of the ester functional group on the flexibility of inter-saccharide linkages, specifically, and the solution phase structure of ester-containing carbohydrate derivatives, in general. Stereoselective reactions are an important part of the field of asymmetric synthesis and an understanding of their underlying mechanistic principles is essential for rational method development. Here, the exploration of a diastereoselective O-acylation reaction on a trans-2-substituted cyclohexanol scaffold is presented, along with possible reasons for the observed reversal of stereoselectivity dependent on the presence or absence of an achiral amine catalyst. In particular, this work establishes a structure-activity relationship with regard to the trans-2-substituent and its role as a chiral auxiliary in the reversal of diastereoselectivity. In the second part, the synthesis of various ester-linked carbohydrate derivatives, and their conformational analysis is presented. Using multidimensional NMR experiments and computational methods, the compounds' solution-phase structures were established and the effect of the ester functional group on the molecules' flexibility and three-dimensional (3D) structure was investigated and compared to ether or glycosidic linkages. To aid in this, a novel Karplus equation for the C(sp2)OCH angle in ester-linked carbohydrates was developed on the basis of a model ester-linked carbohydrate. This equation describes the sinusoidal relationship between the C(sp2)OCH dihedral angle and the corresponding 3JCH coupling constant that can be determined from a J-HMBC NMR experiment. The insights from this research will be useful in describing the 3D structure of naturally occurring and lab-made ester-linked derivatives of carbohydrates, as well as guiding the de novo-design of

  19. Analysis of the population of the Old Kladruby horse in point of the body conformation

    Directory of Open Access Journals (Sweden)

    Eva Sobotková

    2006-01-01

    Full Text Available The objective of the present study was a detailed analysis of the body conformation of the Old Kladruby horse in the Stud Farm Kladruby. We applied 26 body dimensions, 9 angles of extremity joints and 12 hippo-metrical indices of 167 breeding horses to analyse the population according to the colouration (grey, black, lines (9 lines, sex (stallions and mares and age categories (4 classes. The resulting measures were analysed statistically by means of a linear model with fixed effects (GLM. Most of the statistical highly significant differences were differences detected between stallions and mares and between the Old Kladruby grey and black horses. The stallions have a significantly longer profile of the head (by more than 1 cm and width of the cheeks. The mares have a highly significantly larger chest (longer by 2.9 cm, more deeply by 3.3 cm, width of coxae and angles of the shoulder and knee joints. The black horses have highly significantly longer profile of the head (by more than 2.5 cm and width of cheeks, longer the blade-bone and significantly longer the pelvis (by 2.3 cm. The grey horses have highly significantly shorter arm and forearm, longer metacarpus, pastern and shinbone. The differences between age categories are highly significant by heights of body, girth and by hippo-metrical indices. The differences among the lines of the same colouration are minimal. Only white line Rudolfo is significantly small sized and the least compact.

  20. Raman spectroscopic analysis of Lactobacillus rhamnosus GG in response to dehydration reveals DNA conformation changes.

    Science.gov (United States)

    Myintzu Hlaing, Mya; Wood, Bayden; McNaughton, Don; Ying, DanYan; Augustin, Mary Ann

    2017-04-01

    Dehydration of bacterial cells elicits cellular stress responses in bacteria. Microencapsulation has been used to protect cells against the environmental stress. In this study, Confocal Raman Spectroscopy was used to examine DNA changes in the chemical composition of non-encapsulated and microencapsulated Lactobacillus rhamnosus GG and the reversibility of these changes upon freeze drying and rehydration. The viability of cells upon freeze drying was also enumerated using culture methods and membrane integrity was measured using BacLight Live/Dead staining. Raman analyses show changes in the spectral features associated with various biochemical compounds, which are interpreted as the result of detrimental freeze drying effects on the bacterial cells. Specifically, analyses based on Principal Components Analysis (PCA) of Raman spectra, confirm that microencapsulation protects cells from environmental stress. The results also reveal a B- to A-like DNA conformation change in dormant cells that provided insights into the extent of reversibility of this transition upon rehydration. The extent of this reversibility is less in non-encapsulated than in microencapsulated cells. These findings indicate the potential application of Raman spectroscopy in rapid sensing of microbial dehydration stress responses. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Late rectal toxicity after conformal radiotherapy of prostate cancer (I): multivariate analysis and dose-response

    International Nuclear Information System (INIS)

    Skwarchuk, Mark W.; Jackson, Andrew; Zelefsky, Michael J.; Venkatraman, Ennapadam S.; Cowen, Didier M.; Levegruen, Sabine; Burman, Chandra M.; Fuks, Zvi; Leibel, Steven A.; Ling, C. Clifton

    2000-01-01

    Purpose: The purpose of this paper is to use the outcome of a dose escalation protocol for three-dimensional conformal radiation therapy (3D-CRT) of prostate cancer to study the dose-response for late rectal toxicity and to identify anatomic, dosimetric, and clinical factors that correlate with late rectal bleeding in multivariate analysis. Methods and Materials: Seven hundred forty-three patients with T1c-T3 prostate cancer were treated with 3D-CRT with prescribed doses of 64.8 to 81.0 Gy. The 5-year actuarial rate of late rectal toxicity was assessed using Kaplan-Meier statistics. A retrospective dosimetric analysis was performed for patients treated to 70.2 Gy (52 patients) or 75.6 Gy (119 patients) who either exhibited late rectal bleeding (RTOG Grade 2/3) within 30 months after treatment (i.e., 70.2 Gy--13 patients, 75.6 Gy--36 patients) or were nonbleeding for at least 30 months (i.e., 70.2 Gy--39 patients, 75.6 Gy--83 patients). Univariate and multivariate logistic regression was performed to correlate late rectal bleeding with several anatomic, dosimetric, and clinical variables. Results: A dose response for ≥ Grade 2 late rectal toxicity was observed. By multivariate analysis, the following factors were significantly correlated with ≥ Grade 2 late rectal bleeding for patients prescribed 70.2 Gy: 1) enclosure of the outer rectal contour by the 50% isodose on the isocenter slice (i.e., Iso50) (p max (p max

  2. Conformational stability of calreticulin

    DEFF Research Database (Denmark)

    Jørgensen, C.S.; Trandum, C.; Larsen, N.

    2005-01-01

    The conformational stability of calreticulin was investigated. Apparent unfolding temperatures (T-m) increased from 31 degrees C at pH 5 to 51 degrees C at pH 9, but electrophoretic analysis revealed that calreticulin oligomerized instead of unfolding. Structural analyses showed that the single C......-terminal a-helix was of major importance to the conformational stability of calreticulin....

  3. Conformational stability of calreticulin

    DEFF Research Database (Denmark)

    Jørgensen, Charlotte S; Trandum, Christa; Larsen, Nanna Brink

    2005-01-01

    The conformational stability of calreticulin was investigated. Apparent unfolding temperatures (Tm) increased from 31 degrees C at pH 5 to 51 degrees C at pH 9, but electrophoretic analysis revealed that calreticulin oligomerized instead of unfolding. Structural analyses showed that the single C......-terminal alpha-helix was of major importance to the conformational stability of calreticulin....

  4. Transportation Conformity

    Science.gov (United States)

    This section provides information on: current laws, regulations and guidance, policy and technical guidance, project-level conformity, general information, contacts and training, adequacy review of SIP submissions

  5. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  6. Conformational analysis of Infectious bursal disease virus (IBDV derived cell penetrating peptide (CPP analogs

    Directory of Open Access Journals (Sweden)

    Vinay G. Joshi

    2013-12-01

    Full Text Available Aim: This study was designed to develop peptide analogs of Infectious Bursal Disease (IBD virus VP5 protein segment having cell penetrating ability to improve their interaction with cargo molecule (Nucleic acid without affecting the backbone conformation. Materials and Methods: IBDV VP5 protein segment designated as RATH peptide were synthesized using solid phase peptide synthesis and their solution conformation was elucidated using CD spectroscopy in polar (water and apolar (TFE solvents. Cell penetrating ability of RATH-CONH2 was observed using FITC labeled peptide internalization in to HeLa cells under fluorescent microscopy. The efficacy of RATH analog interactions with nucleic acids was evaluated using FITC labeled oligonucleotides by fluorescence spectroscopy and plasmid constructs in gel retardation assay. Results: CD spectra of RATH analogs in water and apolar trifluroethanol (TFE helped to compare their secondary structures which were almost similar with dominant beta conformations suggesting successful induction of positive charge in the analogs without affecting back bone conformation of CPP designed. Cell penetrating ability of RATH CONH2 in HeLa cell was more than 90%. The fluorescence spectroscopy and plasmid constructs in gel retardation assay demonstrated successful interaction of amide analogs with nucleic acid. Conclusion: Intentional changes made in IBDV derived peptide RATH COOH to RATH CONH2 did not showed major changes in backbone conformation and such modifications may help to improve the cationic charge in most CPPs to interact with nucleic acid. [Vet World 2013; 6(6.000: 307-312

  7. Conformational analysis of g protein-coupled receptor signaling by hydrogen/deuterium exchange mass spectrometry.

    Science.gov (United States)

    Li, Sheng; Lee, Su Youn; Chung, Ka Young

    2015-01-01

    Conformational change and protein-protein interactions are two major mechanisms of membrane protein signal transduction, including G protein-coupled receptors (GPCRs). Upon agonist binding, GPCRs change conformation, resulting in interaction with downstream signaling molecules such as G proteins. To understand the precise signaling mechanism, studies have investigated the structural mechanism of GPCR signaling using X-ray crystallography, nuclear magnetic resonance (NMR), or electron paramagnetic resonance. In addition to these techniques, hydrogen/deuterium exchange mass spectrometry (HDX-MS) has recently been used in GPCR studies. HDX-MS measures the rate at which peptide amide hydrogens exchange with deuterium in the solvent. Exposed or flexible regions have higher exchange rates and excluded or ordered regions have lower exchange rates. Therefore, HDX-MS is a useful tool for studying protein-protein interfaces and conformational changes after protein activation or protein-protein interactions. Although HDX-MS does not give high-resolution structures, it analyzes protein conformations that are difficult to study with X-ray crystallography or NMR. Furthermore, conformational information from HDX-MS can help in the crystallization of X-ray crystallography by suggesting highly flexible regions. Interactions between GPCRs and downstream signaling molecules are not easily analyzed by X-ray crystallography or NMR because of the large size of the GPCR-signaling molecule complexes, hydrophobicity, and flexibility of GPCRs. HDX-MS could be useful for analyzing the conformational mechanism of GPCR signaling. In this chapter, we discuss details of HDX-MS for analyzing GPCRs using the β2AR-G protein complex as a model system. © 2015 Elsevier Inc. All rights reserved.

  8. Sequence and Conformational Analysis of Peptide-Polymer Bioconjugates by Multidimensional Mass Spectrometry.

    Science.gov (United States)

    Sallam, Sahar; Dolog, Ivan; Paik, Bradford A; Jia, Xinqiao; Kiick, Kristi L; Wesdemiotis, Chrys

    2018-03-19

    The sequence and helical content of two alanine-rich peptides (AQK18 and GpAQK18, Gp: L-propargylglycine) and their conjugates with poly(ethylene glycol) (PEG) have been investigated by multidimensional mass spectrometry (MS), encompassing electrospray ionization (ESI) or matrix-assisted laser desorption/ionization (MALDI) interfaced with tandem mass spectrometry (MS 2 ) fragmentation and shape-sensitive separation via ion mobility mass spectrometry (IM-MS). The composition, sequence, and molecular weight distribution of the peptides and bioconjugates were identified by MS and MS 2 experiments, which also confirmed the attachment of PEG at the C-terminus of the peptides. ESI coupled with IM-MS revealed the existence of random coil and α-helical conformers for the peptides in the gas phase. More importantly, the proportion of the helical conformation increased substantially after PEG attachment, suggesting that conjugation adds stability to this conformer. The conformational assemblies detected in the gas phase were largely formed in solution, as corroborated by independent circular dichroism (CD) experiments. The collision cross-sections (rotationally averaged forward moving arears) of the random coil and helical conformers of the peptides and their PEG conjugates were simulated for comparison with the experimental values deduced by IM-MS in order to confirm the identity of the observed architectures and understand the stabilizing effect of the polymer chain. C-terminal PEGylation is shown to increase the positive charge density and to solvate intra-molecular positive charges at the conjugation site, thereby enhancing the stability of α-helices, preserving their conformation, and increasing helical propensity.

  9. Analysis of the Conformally Flat Approximation for Binary Neutron Star Initial Conditions

    Directory of Open Access Journals (Sweden)

    In-Saeng Suh

    2017-01-01

    Full Text Available The spatially conformally flat approximation (CFA is a viable method to deduce initial conditions for the subsequent evolution of binary neutron stars employing the full Einstein equations. Here we analyze the viability of the CFA for the general relativistic hydrodynamic initial conditions of binary neutron stars. We illustrate the stability of the conformally flat condition on the hydrodynamics by numerically evolving ~100 quasicircular orbits. We illustrate the use of this approximation for orbiting neutron stars in the quasicircular orbit approximation to demonstrate the equation of state dependence of these initial conditions and how they might affect the emergent gravitational wave frequency as the stars approach the innermost stable circular orbit.

  10. Workers’ Conformism

    Directory of Open Access Journals (Sweden)

    Nikolay Ivantchev

    2013-10-01

    Full Text Available Conformism was studied among 46 workers with different kinds of occupations by means of two modified scales measuring conformity by Santor, Messervey, and Kusumakar (2000 – scale for perceived peer pressure and scale for conformism in antisocial situations. The hypothesis of the study that workers’ conformism is expressed in a medium degree was confirmed partly. More than a half of the workers conform in a medium degree for taking risk, and for the use of alcohol and drugs, and for sexual relationships. More than a half of the respondents conform in a small degree for anti-social activities (like a theft. The workers were more inclined to conform for risk taking (10.9%, then – for the use of alcohol, drugs and for sexual relationships (8.7%, and in the lowest degree – for anti-social activities (6.5%. The workers who were inclined for the use of alcohol and drugs tended also to conform for anti-social activities.

  11. Conformational analysis of single perfluoroalkyl chains by single-molecule real-time transmission electron microscopic imaging.

    Science.gov (United States)

    Harano, Koji; Takenaga, Shinya; Okada, Satoshi; Niimi, Yoshiko; Yoshikai, Naohiko; Isobe, Hiroyuki; Suenaga, Kazu; Kataura, Hiromichi; Koshino, Masanori; Nakamura, Eiichi

    2014-01-08

    Whereas a statistical average of molecular ensembles has been the conventional source of information on molecular structures, atomic resolution movies of single organic molecules obtained by single-molecule real-time transmission electron microscopy have recently emerged as a new tool to study the time evolution of the structures of individual molecules. The present work describes a proof-of-principle study of the determination of the conformation of each C-C bond in single perfluoroalkyl fullerene molecules encapsulated in a single-walled carbon nanotube (CNT) as well as those attached to the outer surface of a carbon nanohorn (CNH). Analysis of 82 individual molecules in CNTs under a 120 kV electron beam indicated that 6% of the CF2-CF2 bonds and about 20% of the CH2-CH2 bonds in the corresponding hydrocarbon analogue are in the gauche conformation. This comparison qualitatively matches the known conformational data based on time- and molecular-average as determined for ensembles. The transmission electron microscopy images also showed that the molecules entered the CNTs predominantly in one orientation. The molecules attached on a CNH surface moved more freely and exhibited more diverse conformation than those in a CNT, suggesting the potential applicability of this method for the determination of the dynamic shape of flexible molecules and of detailed conformations. We observed little sign of any decomposition of the specimen molecules, at least up to 10(7) e·nm(-2) (electrons/nm(2)) at 120 kV acceleration voltage. Decomposition of CNHs under irradiation with a 300 kV electron beam was suppressed by cooling to 77 K, suggesting that the decomposition is a chemical process. Several lines of evidence suggest that the graphitic substrate and the attached molecules are very cold.

  12. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.

    2017-01-01

    Roč. 148, č. 11 (2017), s. 2011-2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  13. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.

    2017-01-01

    Roč. 148, č. 11 (2017), s. 2011- 2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  14. Vibrational and electronic circular dichroism as powerful tools for the conformational analysis of cationic antimicrobial peptides

    Czech Academy of Sciences Publication Activity Database

    Kocourková, L.; Novotná, P.; Šťovíčková-Habartová, L.; Čujová, Sabína; Čeřovský, Václav; Urbanová, M.; Setnička, V.

    2016-01-01

    Roč. 147, č. 8 (2016), s. 1439-1445 ISSN 0026-9247 Institutional support: RVO:61388963 Keywords : conformation * circular dichroism * antimicrobial peptides * liposomes * infrared spectroscopy Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.282, year: 2016

  15. Analysis of all dimensionful parameters relevant in gravitational dressing of conformal theories

    CERN Document Server

    Dorn, H

    1992-01-01

    Starting from a covariant and background independent definition of normal ordered vertex operators we give an alternative derivation of the KPZ relation between conformal dimensions and their gravitational dressed partners. With our method we are able to study for arbitrary genus the dependence of N-point functions on all dimensionful parameters. Implications for the interpretation of gravitational dressed dimensions are discussed.

  16. Traffic Data for Integrated Project-Level PM2.5 Conformity Analysis.

    Science.gov (United States)

    2014-08-01

    As required by the U.S. Environmental Protection Agency (EPA), the MOVES model is the mandatory emission : tool for new PM hot-spot analyses for project-level conformity determinations that began after December 20, 2012. : Localized traffic data inpu...

  17. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  18. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  19. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  20. Conformational analysis, UV-VIS, MESP, NLO and NMR studies of 6-methoxy-1,2,3,4-tetrahydronaphthalene.

    Science.gov (United States)

    Arivazhagan, M; Kavitha, R; Subhasini, V P

    2014-07-15

    The detailed HF and B3LYP/6-311++G(d,p) comparative studies on the complete FT-IR and FT-Raman spectra of 6-methoxy-1,2,3,4-tetrahydronaphthalene [MTHN] have been studied. In view of the special properties and uses, the present investigation has been undertaken to provide a satisfactorily vibrational analysis of 6-methoxy-1,2,3,4-tetrahydronaphthalene. Therefore, a thorough Raman, IR, molecular electrostatic potential (MESP), non-linear optical (NLO) properties, UV-VIS, HOMO-LUMO and NMR spectroscopic investigation are reported complemented by B3LYP theoretical predictions with basis set 6-311++G(d,p) to provide novel insight on vibrational assignments and conformational stability of MTHN. Potential energy surface scans (PES) of the CH3 group are undertaken to shed light on the rather complicated conformational interchanges in the compound under investigation. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Conformal Infinity

    Directory of Open Access Journals (Sweden)

    Frauendiener Jörg

    2004-01-01

    Full Text Available The notion of conformal infinity has a long history within the research in Einstein's theory of gravity. Today, 'conformal infinity' is related to almost all other branches of research in general relativity, from quantisation procedures to abstract mathematical issues to numerical applications. This review article attempts to show how this concept gradually and inevitably evolved from physical issues, namely the need to understand gravitational radiation and isolated systems within the theory of gravitation, and how it lends itself very naturally to the solution of radiation problems in numerical relativity. The fundamental concept of null-infinity is introduced. Friedrich's regular conformal field equations are presented and various initial value problems for them are discussed. Finally, it is shown that the conformal field equations provide a very powerful method within numerical relativity to study global problems such as gravitational wave propagation and detection.

  2. Conformal Infinity

    Directory of Open Access Journals (Sweden)

    Frauendiener Jörg

    2000-08-01

    Full Text Available The notion of conformal infinity has a long history within the research in Einstein's theory of gravity. Today, ``conformal infinity'' is related with almost all other branches of research in general relativity, from quantisation procedures to abstract mathematical issues to numerical applications. This review article attempts to show how this concept gradually and inevitably evolved out of physical issues, namely the need to understand gravitational radiation and isolated systems within the theory of gravitation and how it lends itself very naturally to solve radiation problems in numerical relativity. The fundamental concept of null-infinity is introduced. Friedrich's regular conformal field equations are presented and various initial value problems for them are discussed. Finally, it is shown that the conformal field equations provide a very powerful method within numerical relativity to study global problems such as gravitational wave propagation and detection.

  3. General Conformity

    Science.gov (United States)

    The General Conformity requirements ensure that the actions taken by federal agencies in nonattainment and maintenance areas do not interfere with a state’s plans to meet national standards for air quality.

  4. Conformity evaluation

    International Nuclear Information System (INIS)

    2010-01-01

    The conformity assessment activities involve the IRD's actions related to the CNEN regulatory processing for licensing and control of nuclear and radioactive facilities in the country. They include regulatory inspections of radiation protection

  5. Polarization and Segregation through Conformity Pressure and Voluntary Migration: Simulation Analysis of Co-Evolutionary Dynamics

    Directory of Open Access Journals (Sweden)

    Dai Zusai

    2017-11-01

    Full Text Available While conformity pressures people to assimilate in a community, an individual occasionally migrates among communities when the individual feels discomfort. These two factors cause segregation and cultural diversity within communities in the society. By embedding a migration dynamic into Kuran and Sandholm’s model (2008 of preference evolution, we build an agent-based model to see how the variance of preferences in the entire society quantitatively changes over time. We find from the Monte-Carlo simulations that, while preferences assimilate within a community, self-selected migrations enlarge the diversity of preferences over communities in the society. We further study how the arrival rate of migration opportunities and the degree of conformity pressures affect the variance of preferences.

  6. Conformational analysis of a synthetic fish kisspeptin 1 peptide in membrane mimicking environments.

    Science.gov (United States)

    Thakuria, Dimpal; Shahi, Neetu; Singh, Atul Kumar; Khangembam, Victoria Chanu; Singh, Arvind Kumar; Kumar, Satish

    2017-01-01

    Kisspeptin 1 is a neuropeptide hormone of the RFamide family, which act as an upstream regulator of brain-pituitary-gonad (BPG) axis in most vertebrates including teleosts. In the present study, a 16 amino acid long putative mature bioactive peptide (kiss 1) from preprokisspeptin 1 of golden mahseer, Tor putitora (Hamilton, 1822), was synthesized and characterized using an integrated (experimental and in silico) approach. The far-UV circular dichroism (CD) spectrum of this peptide was evaluated both in aqueous and membrane mimicking solvents (TFE, HFIP and Dioxane). The results indicate that kiss 1 peptide adopted helical, turn and β conformations in membrane like environments. The near-UV CD spectroscopy was also carried out to examine the tertiary packing around aromatic residues of kiss 1 peptide and the peptide-membrane complex. The kiss 1 peptide exhibited little signal in water, but a prominent negative band was observed at around 275 nm when membrane mimetic solution was added. The observed ordered conformations of kiss 1 peptide in the different solvents indicated its potential biological activity which could enhance the secretion of gonadotropin-releasing hormone (GnRH) at BPG axis. The conformational information generated from the present study reinforces the application prospects of bioactive synthetic peptide analogs of kisspeptin 1 in improving the reproductive performances of important cultivable fish species.

  7. Rapid identification of cyst (Heterodera spp., Globodera spp.) and root-knot (Meloidogyne spp.) nematodes on the basis of ITS2 sequence variation detected by PCR-single-strand conformational polymorphism (PCR-SSCP) in cultures and field samples

    NARCIS (Netherlands)

    Clapp, J.P.; Van der Stoel, C.D.; Van der Putten, W.H.

    2000-01-01

    Cyst and root-knot nematodes show high levels of gross morphological similarity. This presents difficulties for the study of their ecology in natural ecosystems. In this study, cyst and root-knot nematode species, as well as some ectoparasitic nematode species, were identified using the second

  8. Rotational Spectrum and Conformational Analysis of N-Methyl-2-Aminoethanol: Insights into the Shape of Adrenergic Neurotransmitters

    Directory of Open Access Journals (Sweden)

    Camilla Calabrese

    2018-02-01

    Full Text Available We describe an experimental and quantum chemical study for the accurate determination of the conformational space of small molecular systems governed by intramolecular non-covalent interactions. The model systems investigated belong to the biological relevant aminoalcohol's family, and include 2-amino-1-phenylethanol, 2-methylamino-1-phenylethanol, noradrenaline, adrenaline 2-aminoethanol, and N-methyl-2-aminoethanol. For the latter molecule, the rotational spectrum in the 6–18 and 59.6–74.4 GHz ranges was recorded in the isolated conditions of a free jet expansion. Based on the analysis of the rotational spectra, two different conformational species and 11 isotopologues were observed and their spectroscopic constants, including 14N-nuclear hyperfine coupling constants and methyl internal rotation barriers, were determined. From the experimental data a structural determination was performed, which was also used to benchmark accurate quantum chemical calculations on the whole conformational space. Atom in molecules and non-covalent interactions theories allowed the characterization of the position of the intramolecular non-covalent interactions and the energies involved, highlighting the subtle balance responsible of the stabilization of all the molecular systems.

  9. Conformational Analysis, Molecular Structure and Solid State Simulation of the Antiviral Drug Acyclovir (Zovirax Using Density Functional Theory Methods

    Directory of Open Access Journals (Sweden)

    Margarita Clara Alvarez-Ros

    2014-06-01

    Full Text Available The five tautomers of the drug acyclovir (ACV were determined and optimised at the MP2 and B3LYP quantum chemical levels of theory. The stability of the tautomers was correlated with different parameters. On the most stable tautomer N1 was carried out a comprehensive conformational analysis, and the whole conformational parameters (R, β, Φ, φ1, φ2, φ3, φ4, φ5 were studied as well as the NBO Natural atomic charges. The calculations were carried out with full relaxation of all geometrical parameters. The search located at least 78 stable structures within 8.5 kcal/mol electronic energy range of the global minimum, and classified in two groups according to the positive or negative value of the torsional angle j1. In the nitrogen atoms and in the O2' and O5' oxygen atoms of the most stable conformer appear a higher reactivity than in the natural nucleoside deoxyguanosine. The solid state was simulated through a dimer and tetramer forms and the structural parameters were compared with the X-ray crystal data available. Several general conclusions were emphasized.

  10. High dose conformal radiotherapy with rotational multi-leaf collimator for glioblastoma multiforme: treatment results and multivariate analysis

    International Nuclear Information System (INIS)

    Nakagawa, K.; Sakata, K.; Karasawa, K.; Onogi, Y.; Terahara, A.; Hasezawa, K.; Sasaki, Y.; Akanuma, A.

    1996-01-01

    Purpose: Survival of patients with glioblastoma multiforme is extremely poor. Although this tumor is clearly radiation resistant, there is evidence of a dose response relationship. The purpose of the study is to evaluate the impact of higher dose delivered with the rotational multi-leaf collimator (MLC) conformal radiation therapy. Methods and Materials: From 1984 to 1995, 35 consecutive cases with histologically confirmed glioblastoma multiforme in the brain were treated using the rotational multi-leaf collimator conformal therapy which is a combined continuous gantry rotation and MLC movement. There were 23 males and 12 females with a median age of 45.3 years (12 to 73 years). Mean Karnofsky performance score was 78 (30-100). Mean tumor volume at the time of diagnosis was 104 cc (8-800 cc). All cases underwent surgical intervention prior to radiation therapy (biopsy only in one, partial resection in 13, and subtotal resection in 18, and gross total resection in three). Residual tumor volume ranged from 0 cc to 567 cc with an average of 35 cc. Radiation dose was 60 to 80 Gy (mean 68.3 Gy) in 21 cases before 1992 and 90 Gy in 14 cases after 1992, with an overall mean dose of 77 Gy. Before 1992, the rotational multi-leaf collimator conformal therapy was combined with whole brain radiation of 30 Gy, whereas the latter was replaced by a generous field rotational conformal therapy after 1992. Dose fall-off proportional to the target volume was achieved using three-dimensional treatment planning in all cases. Biweekly intravenous administration of ACNU and Vincristin was combined. Results: As for radiation toxicity, only one case developed and died of late brain edema four months after the completion of therapy with 90 Gy. The one-year, three-year, and five-year survival rates were 64 %, 36 %, and 21 % respectively, with a 50 % survival time of 17 months. Two survived more than five years. Univariate analysis showed initial tumor volume, residual tumor volume, and

  11. Clinical application of 3-D conformal radiotherapy for carcinoma of the ethmoid sinus: 1. Comparative analysis between conventional 2-D and 3-D conformal plans

    Energy Technology Data Exchange (ETDEWEB)

    Lee, S. W.; Kim, G. E.; Keum, K. C.; Park, H. C.; Cho, J. H.; Han, S. U.; Lee, K. K.; Suh, C. O.; Hong, W. P.; Park, I. Y. [Yonsei Univ., Seoul (Korea, Republic of). Coll. of Medicine

    1997-12-01

    This is study of whether 3-D conformal radiotherapy for carcinomas of the ethmoid sinus were better than those treated with conventional 2-D plan. The 3-D conformal treatment plans were compared with conventional 2-D plans in 4 patients with malignancy of the ethmoid sinus. Isodose distribution , dose statistics, and dose volume histogram of the planning target volume were used to evaluate differences between 2-D and 3-D plans. In addition, the risk of radiation exposure of surrounding normal critical organs are evaluated by means of point dose calculation and dose volume histogram. 3-D conformal treatment plans for each patient that the better tumor coverages by the planning target volume with improved dose homogeneity, compared to 2-D conventional treatment plans in the same patient. On the other hand, the radiation dose distributions to the surrounding normal tissue organs, such as the orbit and optic nerves are not significantly reduced with our technique, but a substantial sparing in the brain stem and optic chiasm for each patient. Our findings represented the potential advantage of 3-D treatment planning for dose homogeneity as well as sparing of the normal tissue surrounding the tumor. However, further investigational studies are required to define the clinical benefit. (author).

  12. Conformational analysis of monoamides complexed with plutonium nitrate in organic phase

    Energy Technology Data Exchange (ETDEWEB)

    Berthon, C. [CEA Centre d`Etudes de la Vallee du Rhone, 30 - Marcoule (France). Dept. des Procedes de Retraitement; Chachaty, C. [CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France). Dept. de Recherche sur l`Etat Condense, les Atomes et les Molecules

    1993-10-01

    Pu(IV) is extracted from nitric acid aqueous solutions by N,N-dialkylamides but lanthanides (III) are not. Three monoamides are examined: N,N -bis(2-ethylhexyl)- butanamide, N,N -bis(2-ethylhexyl)-2methyl-propanamide and N,N -bis(2-ethylhexyl)-3,3dimethyl butanamide. Stoichiometry of the complex is determined by the organic phase saturation method. Steric hindrance of alkyl chains is pointed out. Conformation is determined by NMR study of {sup 13}C. The oxygen-metal distance (which agree with IR results) and the angle values may explain the difference in extracting power for Ac and Ln complexes.

  13. Conformational analysis and vibrational circular dichroism study of a chiral metallocene catalyst

    Science.gov (United States)

    Merten, Christian; Amkreutz, Marc; Hartwig, Andreas

    2010-04-01

    Metallocene complexes are an important type of catalysts for several applications. In the present work, the Ziegler-Natta-catalyst dichloro[( S, S)-ethylenebis(4,5,6,7-tetrahydro-1-indenyl)] zirconium(IV) is investigated using vibrational circular dichroism (VCD) spectroscopy and density functional theory (DFT) calculations. Furthermore the influence of a different central ion as well as different counterions is examined theoretically. From the comparison of the experimental and calculated VCD spectra, it is concluded that the metal ion acts as a placeholder whose function is just to keep the conformation of the ligand in a chiral shape.

  14. Conformational Analysis of Proteins in Highly Concentrated Solutions by Dialysis-Coupled Hydrogen/Deuterium Exchange Mass Spectrometry

    DEFF Research Database (Denmark)

    Houde, Damian; Esmail Nazari, Zeinab; Bou-Assaf, George M

    2016-01-01

    for these phenomena can be due to short range electrostatic and/or hydrophobic protein-protein interactions. Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a useful tool for investigating protein conformation, dynamics, and interactions. However, "traditional" continuous dilution labeling HDX......-MS experiments have limited utility for the direct analysis of solutions with high concentrations of protein. Here, we present a dialysis-based HDX-MS (di-HDX-MS) method as an alternative HDX-MS labeling format, which takes advantage of passive dialysis rather than the classic dilution workflow. We applied...

  15. Synthesis and conformational analysis of a simplified inositol-model of the Streptococcus pneumoniae 19F capsular polysaccharide repeating unit.

    Science.gov (United States)

    Catelani, Giorgio; D'Andrea, Felicia; Guazzelli, Lorenzo; Griselli, Alessio; Testi, Nicola; Chiacchio, Maria Assunta; Legnani, Laura; Toma, Lucio

    2017-04-18

    Carbohydrate mimics have been studied for a long time as useful sugar substitutes, both in the investigation of biological events and in the treatment of sugar-related diseases. Here we report further evaluation of the capabilities of inositols as carbohydrate substitutes. The conformational features of an inositol-model of a simplified repeating unit corresponding to the capsular polysaccharide of Streptococcus pneumoniae 19F has been evaluated by computational analysis, and compared to the native repeating unit. The inositol mimic was synthesized, and its experimental spectroscopic data allowed for verification of the theoretical results. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Plastocyanin conformation: an analysis of its near ultraviolet absorption and circular dichroic spectra

    International Nuclear Information System (INIS)

    Draheim, J.E.; Anderson, G.P.; Duane, J.W.; Gross, E.L.

    1986-01-01

    The near-ultraviolet absorption and circular dichroic spectra of plastocyanin are dependent upon the redox state, solution pH, and ammonium sulfate concentration. This dependency was observed in plastocyanin isolated from spinach, poplar, and lettuce. Removal of the copper atom also perturbed the near-ultraviolet spectra. Upon reduction there are increases in both extinction and ellipticity at 252 nm. Further increases at 252 nm were observed upon formation of apo plastocyanin eliminating charge transfer transitions as the cause. The spectral changes in the near-ultraviolet imply a flexible tertiary conformation for plastocyanin. There are at least two charge transfer transitions at ∼295-340 nm. One of these transitions is sensitive to low pH's and is attributed to the His 87 copper ligand. The redox state dependent changes observed in the near-ultraviolet spectra of plastocyanin are attenuated either by decreasing the pH to 5 or by increasing the ammonium sulfate concentration to 2.7 M. This attenuation cannot be easily explained by simple charge screening. Hydrophobic interactions probably play an important role in this phenomenon. The pH and redox state dependent conformational changes may play an important role in regulating electron transport

  17. Conformational analysis of the EPR spectra of cyclohexenyl radical and some of its alkyl derivatives

    International Nuclear Information System (INIS)

    de Tannoux, N.M.

    1975-01-01

    Electron paramagnetic resonance spectra have been obtained for radicals produced by x-irradiation of cyclohexene and various alkyl-substituted cyclohexenes trapped in an adamantane matrix. Temperature variations of these spectra permits determination of the enthalpy and entropy of activation for interconversion between the conformations. For cyclohexenyl radical, the enthalpy of activation is 6.81 +- 0.58 kcal/mole and the entropy of activation is -0.04 +- 2.38 e.u. Methyl substitution on C 1 gives a radical with activation parameters similar to the parent radical. Methyl groups attached to C 5 increase the activation parameters significantly. On the basis of these observations, it is suggested the cyclohexenyl radicals exist in two conformations of the same energy which are of the ''envelope'' type, with C 1 , C 2 , C 3 , C 4 , and C 6 coplanar. A model involving a planar transition state for the interconversion process is proposed which accounts for most of the experimental results

  18. Conformational analysis of small organic molecules using NOE and RDC data: A discussion of strychnine and α-methylene-γ-butyrolactone

    Science.gov (United States)

    Kolmer, Andreas; Edwards, Luke J.; Kuprov, Ilya; Thiele, Christina M.

    2015-12-01

    To understand the properties and/or reactivity of an organic molecule, an understanding of its three-dimensional structure is necessary. Simultaneous determination of configuration and conformation often poses a daunting challenge. Thus, the more information accessible for a given molecule, the better. Additionally to 3J-couplings, two sources of information, quantitative NOE and more recently also RDCs, are used for conformational analysis by NMR spectroscopy. In this paper, we compare these sources of conformational information in two molecules: the configurationally well-characterized strychnine 1, and the only recently configurationally and conformationally characterized α -methylene- γ -butyrolactone 2. We discuss possible sources of error in the measurement and analysis process, and how to exclude them. By this means, we are able to bolster the previously proposed flexibility for these two molecules.

  19. Rapid Conformational Analysis of Protein Drugs in Formulation by Hydrogen/Deuterium Exchange Mass Spectrometry (HDX-MS)

    DEFF Research Database (Denmark)

    Esmail Nazari, Zeinab; van de Weert, Marco; Bou-Assaf, George

    2016-01-01

    Hydrogen Deuterium Exchange coupled to Mass Spectrometry (HDX-MS) has become an established method for analysis of protein higher-order structure. Here, we use HDX-MS methodology based on manual Solid-Phase Extraction (SPE) to allow fast and simplified conformational analysis of proteins under...... pharmaceutically relevant formulation conditions. Of significant practical utility, the methodology allows global HDX-MS analyses to be performed without refrigeration or external cooling of the setup. In Mode 1, we used DMSO-containing solvents for SPE, allowing the HDX-MS analysis to be performed at acceptable...... in formulation, using an internal HDX reference peptide (P7I) to control for any sample-to-sample variations in back exchange. Advantages of the methodology include low sample use, optimized excipient removal using multiple solvents, and fast data acquisition. Our results indicate that the SPE-HDX-MS system can...

  20. Euphorbia dendroides Latex as a Source of Jatrophane Esters: Isolation, Structural Analysis, Conformational Study, and Anti-CHIKV Activity.

    Science.gov (United States)

    Esposito, Mélissa; Nothias, Louis-Félix; Nedev, Hirsto; Gallard, Jean-François; Leyssen, Pieter; Retailleau, Pascal; Costa, Jean; Roussi, Fanny; Iorga, Bogdan I; Paolini, Julien; Litaudon, Marc

    2016-11-23

    An efficient process was used to isolate six new jatrophane esters, euphodendroidins J (3), K (5), L (6), M, (8), N (10), and O (11), along with seven known diterpenoid esters, namely, euphodendroidins A (4), B (9), E (1), and F (2), jatrophane ester (7), and 3α-hydroxyterracinolides G and B (12 and 13), and terracinolides J and C (14 and 15) from the latex of Euphorbia dendroides. Their 2D structures and relative configurations were established by extensive NMR spectroscopic analysis. The absolute configurations of compounds 1, 11, and 15 were determined by X-ray diffraction analysis. Euphodendroidin F (2) was obtained in 18% yield from the diterpenoid ester-enriched extract after two consecutive flash chromatography steps, making it an interesting starting material for chemical synthesis. Euphodendroidins K and L (5 and 6) showed an unprecedented NMR spectroscopic behavior, which was investigated by variable-temperature NMR experiments and molecular modeling. The structure-conformation relationships study of compounds 1, 5, and 6, using DFT-NMR calculations, indicated the prominent role of the acylation pattern in governing the conformational behavior of these jatrophane esters. The antiviral activity of compounds 1-15 was evaluated against Chikungunya virus (CHIKV) replication.

  1. Structure and conformational analysis of spiroketals from 6-O-methyl-9(E-hydroxyiminoerythronolide A

    Directory of Open Access Journals (Sweden)

    Ana Čikoš

    2015-08-01

    Full Text Available Three novel spiroketals were prepared by a one-pot transformation of 6-O-methyl-9(E-hydroxyiminoerythronolide A. We present the formation of a [4.5]spiroketal moiety within the macrolide lactone ring, but also the unexpected formation of a 10-C=11-C double bond and spontaneous change of stereochemistry at position 8-C. As a result, a thermodynamically stable structure was obtained. The structures of two new diastereomeric, unsaturated spiroketals, their configurations and conformations, were determined by means of NMR spectroscopy and molecular modelling. The reaction kinetics and mechanistic aspects of this transformation are discussed. These rearrangements provide a facile synthesis of novel macrolide scaffolds.

  2. Comparative analysis of different process simulation settings of a micro injection molded part featuring conformal cooling

    DEFF Research Database (Denmark)

    Marhöfer, David Maximilian; Tosello, Guido; Islam, Aminul

    2015-01-01

    Process simulations are applied in all fields of engineering in order to support and optimize the design and quality of products and their manufacturing processes. Micro injection molding is not an exception in this regard. Simulations enable to investigate the process and the part quality....... In the reported work, process simulations using Autodesk Moldflow Insight 2015® are applied to a micro mechanical part to be fabricated by micro injection molding and with over-all dimensions of 12.0 × 3.0 × 0.8 mm³ and micro features (micro hole, diameter of 580 μm, and sharp radii down to 100 μm). Three...... of the implementation of the actual mold block, conventional cooling, and conformal cooling. In the comparison, characteristic quality criteria for injection molding are studied, such as the filling behavior of the cavity, the injection pressure, the temperature distribution, and the resulting part warpage...

  3. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen

    2005-01-01

    denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed......Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... in a denaturation bubble are shown to involve an interesting competition of time scales, varying between kinetic blocking of protein binding up to full binding protein-induced denaturation of the DNA. We will also address the potential to use DNA physics for the design of nanosensors. Finally, we report recent...

  4. Citronellal assumes a folded conformation in solution due to dispersion interactions: A joint NMR-DFT analysis

    Science.gov (United States)

    Nardini, Viviani; Dias, Luis Gustavo; Palaretti, Vinicius; da Silva, Gil Valdo José

    2018-04-01

    Citronellal, an acyclic monoterpenoid, is a small molecule suitable for systematic scanning of its conformational geometric parameters in solution or in the gas phase. We have studied the conformational distribution of citronellal by correlating its structure and theoretical chemical shifts with nuclear magnetic resonance data. Interestingly, folded conformations were the most relevant, as confirmed by NOE experiments. We concluded that the conformational distribution is due to intramolecular dispersion interactions.

  5. Solid-state nuclear magnetic resonance analysis of the conformation of an inhibitor bound to thermolysin.

    Science.gov (United States)

    Beusen, D D; McDowell, L M; Slomczynska, U; Schaefer, J

    1995-07-07

    A number of structural experimental methods are available to determine the receptor-bound conformation of ligands as part of the process of rational drug design, including X-ray diffraction and solution-state NMR. Not all receptor/ligand systems are amenable to these types of analyses due to difficulties in sample preparation or inherent limitations of the methods. Rotational echo double-resonance (REDOR) NMR is a solid-state, magic angle-spinning technique that measures the dipolar coupling between specifically labeled nuclei and enables the determination of internuclear distance. In previous studies of helical peptides, we have verified the ability of REDOR NMR to measure distances accurately and precisely. In this study we use REDOR and double REDOR to measure distances between backbone atoms in a phosphonamidate transition-state inhibitor bound to thermolysin. The 31P-13C', 31P-15N, and 31P-13C alpha distances (3.61 +/- 0.10, 3.89 +/- 0.12, and 5.37 +/- 0.13 A, respectively) measured in a complex of Cbz-GlyP-[1-13C]Leu-[15N,2-13C]Ala and the enzyme are consistent with those observed by X-ray diffraction in other comparable thermolysin/inhibitor complexes (average values of 3.58 +/- 0.04, 3.91 +/- 0.13, and 5.17 +/- 0.18 A, respectively). These results demonstrate that REDOR NMR is a viable alternative to more traditional methods such as X-ray diffraction, transferred NOESY, and isotope-edited NOESY for characterizing the receptor-bound conformation of ligands.

  6. Conformational analysis of isolated domains of Helicobacter pylori CagA.

    Directory of Open Access Journals (Sweden)

    Amanda P Woon

    Full Text Available The CagA protein of Helicobacter pylori is associated with increased virulence and gastric cancer risk. CagA is translocated into the host cell by a H. pylori type IV secretion system via mechanisms that are poorly understood. Translocated CagA interacts with numerous host factors, altering a variety of host signalling pathways. The recently determined crystal structure of C-terminally-truncated CagA indicated the presence of two domains: the smaller, flexible N-terminal domain and the larger, middle domain. In this study, we have investigated the conformation, oligomeric state and stability of the N-terminal, middle and glutamate-proline-isoleucine-tyrosine-alanine (EPIYA-repeats domains. All three domains are monomeric, suggesting that the multimerisation of CagA observed in infected cells is likely to be mediated not by CagA itself but by its interacting partners. The middle and the C-terminal domains, but not the N-terminal domain, are capable of refolding spontaneously upon heat denaturation, lending support to the hypothesis that unfolded CagA is threaded C-terminus first through the type IV secretion channel with its N-terminal domain, which likely requires interactions with other domains to refold, being threaded last. Our findings also revealed that the C-terminal EPIYA-repeats domain of CagA exists in an intrinsically disordered premolten globule state with regions in PPII conformation--a feature that is shared by many scaffold proteins that bind multiple protein components of signalling pathways. Taken together, these results provide a deeper understanding of the physicochemical properties of CagA that underpin its complex cellular and oncogenic functions.

  7. X-ray structure of the pestivirus NS3 helicase and its conformation in solution.

    Science.gov (United States)

    Tortorici, M Alejandra; Duquerroy, Stéphane; Kwok, Jane; Vonrhein, Clemens; Perez, Javier; Lamp, Benjamin; Bricogne, Gerard; Rümenapf, Till; Vachette, Patrice; Rey, Félix A

    2015-04-01

    Pestiviruses form a genus in the Flaviviridae family of small enveloped viruses with a positive-sense single-stranded RNA genome. Viral replication in this family requires the activity of a superfamily 2 RNA helicase contained in the C-terminal domain of nonstructural protein 3 (NS3). NS3 features two conserved RecA-like domains (D1 and D2) with ATPase activity, plus a third domain (D3) that is important for unwinding nucleic acid duplexes. We report here the X-ray structure of the pestivirus NS3 helicase domain (pNS3h) at a 2.5-Å resolution. The structure deviates significantly from that of NS3 of other genera in the Flaviviridae family in D3, as it contains two important insertions that result in a narrower nucleic acid binding groove. We also show that mutations in pNS3h that rescue viruses from which the core protein is deleted map to D3, suggesting that this domain may be involved in interactions that facilitate particle assembly. Finally, structural comparisons of the enzyme in different crystalline environments, together with the findings of small-angle X-ray-scattering studies in solution, show that D2 is mobile with respect to the rest of the enzyme, oscillating between closed and open conformations. Binding of a nonhydrolyzable ATP analog locks pNS3h in a conformation that is more compact than the closest apo-form in our crystals. Together, our results provide new insight and bring up new questions about pNS3h function during pestivirus replication. Although pestivirus infections impose an important toll on the livestock industry worldwide, little information is available about the nonstructural proteins essential for viral replication, such as the NS3 helicase. We provide here a comparative structural and functional analysis of pNS3h with respect to its orthologs in other viruses of the same family, the flaviviruses and hepatitis C virus. Our studies reveal differences in the nucleic acid binding groove that could have implications for understanding the

  8. Conformality lost

    International Nuclear Information System (INIS)

    Kaplan, David B.; Lee, Jong-Wan; Son, Dam T.; Stephanov, Mikhail A.

    2009-01-01

    We consider zero-temperature transitions from conformal to nonconformal phases in quantum theories. We argue that there are three generic mechanisms for the loss of conformality in any number of dimensions: (i) fixed point goes to zero coupling, (ii) fixed point runs off to infinite coupling, or (iii) an IR fixed point annihilates with a UV fixed point and they both disappear into the complex plane. We give both relativistic and nonrelativistic examples of the last case in various dimensions and show that the critical behavior of the mass gap behaves similarly to the correlation length in the finite temperature Berezinskii-Kosterlitz-Thouless (BKT) phase transition in two dimensions, ξ∼exp(c/|T-T c | 1/2 ). We speculate that the chiral phase transition in QCD at large number of fermion flavors belongs to this universality class, and attempt to identify the UV fixed point that annihilates with the Banks-Zaks fixed point at the lower end of the conformal window.

  9. ANALYSIS OF CONFORMATION TRAITS OF THE SLOVENIAN COLD-BLOODED HORSE

    Directory of Open Access Journals (Sweden)

    Mojca Simčič

    2015-09-01

    Full Text Available Slovenian Cold-Blooded horse is an autochthonous horse breed in Slovenia, traditionally reared in the North-Eastern and Northern parts of Slovenia. Today the breed is widespread all over the country. Breeding program for the Slovenian Cold-Blooded horse was accepted 2005 when the Association of Slovenian Cold-Blooded Horse Breeders was established, too. The aim of the study was to analyse conformation and gaits traits of the Slovenian Cold-Blooded horse. Likewise, we tried to evaluate fixed effect, affecting the included traits. Data were collected during the classifications of Slovenian Cold-Blooded horse performed from 1996 to 2011. In this study, 1920 horses were included, 52 of which were stallions and 1868 mares. The scoring system included 8 measured and 10 scored traits. Data were analysed by GLM procedure of statistical package SAS/STAT considering sex, age at scoring and birth year as fixed effects. Stallions of Slovenian Cold-Blooded horses were on the average 152.4±0.56 cm high at withers (stick, while mares were 151.22±0.11 cm. Body length (stallions 163.95±1.48 cm; mares 164.28±0.17 cm was on the average larger than the height at wither thus indicating the rectangular body frame.

  10. The structure of DLP12 endolysin exhibiting alternate loop conformation and comparative analysis with other endolysins.

    Science.gov (United States)

    Babu, Kesavan; Arulandu, Arockiasamy; Sankaran, Krishnaswamy

    2017-11-27

    The lytic enzyme, endolysin, is encoded by bacteriophages (phages) to destroy the peptidoglycan layer of host bacterial cells. The release of phage progenies to start the new infection cycle is dependent on the cell lysis event. Endolysin encoded by DLP12 cryptic prophage is a SAR endolysin which is retained by the bacterium presumably due to the benefit it confers. The structure of DLP12 endolysin (Id: 4ZPU) determined at 2.4 Å resolution is presented here. The DLP12 endolysin structure shows a modular nature and is organized into distinct structural regions. One of the monomers has the loops at the active site in a different conformation. This has led to a suggestion of depicting possibly active and inactive state of DLP12 endolysin. Comparison of DLP12 endolysin structure and sequence with those of related endolysins shows the core three-dimensional fold is similar and the catalytic triad geometry is highly conserved despite the sequence differences. Features essential for T4 lysozyme structure and function such as the distance between catalytic groups, salt bridge and presence of nucleophilic water are conserved in DLP12 endolysin and other endolysins analyzed. © 2017 Wiley Periodicals, Inc.

  11. Single-Molecule Analysis of Protein Large-Amplitude Conformational Transitions

    Science.gov (United States)

    Yang, Haw

    2011-03-01

    Proteins have evolved to harness thermal fluctuations, rather than frustrated by them, to carry out chemical transformations and mechanical work. What are, then, the operation and design principles of protein machines? To frame the problem in a tractable way, several basic questions have been formulated to guide the experimental design: (a) How many conformational states can a protein sample on the functionally important timescale? (b) What are the inter-conversion rates between states? (c) How do ligand binding or interactions with other proteins modulate the motions? (d) What are the structural basis of flexibility and its underlying molecular mechanics? Guided by this framework, we have studied protein tyrosine phosphatase B, PtpB, from M. tuberculosis (a virulence factor of tuberculosis and a potential drug target) and adenylate kinase, AK, from E. coli (a ubiquitous energy-balancing enzyme in cells). These domain movements have been followed in real time on their respective catalytic timescales using high-resolution single-molecule Förster resonance energy transfer (FRET) spectroscopy. It is shown quantitatively that both PtpB and AK are capable of dynamically sampling two distinct states that correlate well with those observed by x-ray crystallography. Integrating these microscopic dynamics into macroscopic kinetics allows us to place the experimentally measured free-energy landscape in the context of enzymatic turnovers.

  12. Longitudinal analysis of quality of life in patients receiving conformal radiation therapy for prostate cancer

    International Nuclear Information System (INIS)

    Geinitz, Hans; Thamm, Reinhard; Scholz, Christian; Heinrich, Christine; Prause, Nina; Kerndl, Simone; Molls, Michael; Zimmermann, Frank B.; Keller, Monika; Busch, Raymonde

    2010-01-01

    Purpose: To prospectively assess quality of life (QoL) in patients receiving conformal radiation therapy (CRT) for prostate cancer. Patients and Methods: 78 men with definitive CRT for prostate cancer were entered into the study. Patients were assessed before CRT, at 40 and 60 Gy, and 2, 12 and 24 months after the end of treatment. QoL was assessed using the EORTC Quality of Life Questionnaire C30 and the prostate module PR25. Changes in mean QoL scores with time of ≥ 10 points were considered clinically relevant. Results: Global QoL did not change statistically significant during CRT and was slightly above baseline levels during follow-up. CRT had a statistically significant negative short-term impact on role functioning, fatigue, and PR25 urinary symptoms. The scores recovered within 2 months to 1 year after CRT. Emotional functioning and social functioning scores slightly increased during and after CRT. Role functioning decreased by > 10 points at 60 Gy and urinary symptoms decreased by > 10 points at 40 and 60 Gy. All other differences were < 10 points. A high number of concomitant diseases and having no children were negative pretreatment predictors for long-term global QoL. Conclusion: Definitive CRT for prostate cancer does not compromise global QoL during therapy and up to 2 years after treatment. It has a limited negative effect on role functioning, urinary symptoms and, to a lesser extent, on fatigue with restitution within 2 months to 1 year after treatment. (orig.)

  13. Longitudinal analysis of quality of life in patients receiving conformal radiation therapy for prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Geinitz, Hans; Thamm, Reinhard; Scholz, Christian; Heinrich, Christine; Prause, Nina; Kerndl, Simone; Molls, Michael; Zimmermann, Frank B. [Dept. of Radiotherapy and Radiooncology, Technische Univ. Muenchen (Germany); Keller, Monika [Psychooncology Section, Dept. of Psychosomatic and General Clinical Medicine, Univ. Hospital, Heidelberg (Germany); Busch, Raymonde [Inst. of Medical Statistics and Epidemiology, Technische Univ. Muenchen (Germany)

    2010-01-15

    Purpose: To prospectively assess quality of life (QoL) in patients receiving conformal radiation therapy (CRT) for prostate cancer. Patients and Methods: 78 men with definitive CRT for prostate cancer were entered into the study. Patients were assessed before CRT, at 40 and 60 Gy, and 2, 12 and 24 months after the end of treatment. QoL was assessed using the EORTC Quality of Life Questionnaire C30 and the prostate module PR25. Changes in mean QoL scores with time of {>=} 10 points were considered clinically relevant. Results: Global QoL did not change statistically significant during CRT and was slightly above baseline levels during follow-up. CRT had a statistically significant negative short-term impact on role functioning, fatigue, and PR25 urinary symptoms. The scores recovered within 2 months to 1 year after CRT. Emotional functioning and social functioning scores slightly increased during and after CRT. Role functioning decreased by > 10 points at 60 Gy and urinary symptoms decreased by > 10 points at 40 and 60 Gy. All other differences were < 10 points. A high number of concomitant diseases and having no children were negative pretreatment predictors for long-term global QoL. Conclusion: Definitive CRT for prostate cancer does not compromise global QoL during therapy and up to 2 years after treatment. It has a limited negative effect on role functioning, urinary symptoms and, to a lesser extent, on fatigue with restitution within 2 months to 1 year after treatment. (orig.)

  14. Structural analysis of prolyl oligopeptidases using molecular docking and dynamics: insights into conformational changes and ligand binding.

    Directory of Open Access Journals (Sweden)

    Swati Kaushik

    Full Text Available Prolyl oligopeptidase (POP is considered as an important pharmaceutical target for the treatment of numerous diseases. Despite enormous studies on various aspects of POPs structure and function still some of the questions are intriguing like conformational dynamics of the protein and interplay between ligand entry/egress. Here, we have used molecular modeling and docking based approaches to unravel questions like differences in ligand binding affinities in three POP species (porcine, human and A. thaliana. Despite high sequence and structural similarity, they possess different affinities for the ligands. Interestingly, human POP was found to be more specific, selective and incapable of binding to a few planar ligands which showed extrapolation of porcine POP in human context is more complicated. Possible routes for substrate entry and product egress were also investigated by detailed analyses of molecular dynamics (MD simulations for the three proteins. Trajectory analysis of bound and unbound forms of three species showed differences in conformational dynamics, especially variations in β-propeller pore size, which was found to be hidden by five lysine residues present on blades one and seven. During simulation, β-propeller pore size was increased by ∼2 Å in porcine ligand-bound form which might act as a passage for smaller product movement as free energy barrier was reduced, while there were no significant changes in human and A. thaliana POPs. We also suggest that these differences in pore size could lead to fundamental differences in mode of product egress among three species. This analysis also showed some functionally important residues which can be used further for in vitro mutagenesis and inhibitor design. This study can help us in better understanding of the etiology of POPs in several neurodegenerative diseases.

  15. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang

    2014-07-01

    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  16. Synthesis, conformational analysis, and biological activity of C-thioribonucleosides related to tiazofurin.

    Science.gov (United States)

    Franchetti, P; Marchetti, S; Cappellacci, L; Jayaram, H N; Yalowitz, J A; Goldstein, B M; Barascut, J L; Dukhan, D; Imbach, J L; Grifantini, M

    2000-04-06

    The syntheses of furanthiofurin [5beta-D-(4'-thioribofuranosyl)furan-3-carboxamide, 1] and thiophenthiofurin [5beta-D-(4'-thioribofuranosyl)thiophene-3-carboxamide, 2], two C-thioribonucleoside analogues of tiazofurin, are described. Direct trifluoroacetic acid-catalyzed C-glycosylation of ethyl furan-3-carboxylate with 1-O-acetyl-2,3,5-tri-O-benzyl-4-thio-D-ribofuranose gave 2- and 5-glycosylated regioisomers, as a mixture of alpha and beta anomers. Ethyl 5-(2,3,5-tri-O-benzyl)-beta-D-(4'-thioribofuranosyl)furan-3-carboxylate (6beta) was debenzylated and then converted into the corresponding amide (furanthiofurin) by reaction with ammonium hydroxide. A similar C-glycosylation of ethyl thiophene-3-carboxylate with 1,2,3,5-tetra-O-acetyl-4-thio-D-ribofuranose catalyzed by stannic chloride afforded an anomeric mixture of 2- and 5-glycosylated regioisomers. Deacetylation of ethyl 5-(2,3,5-tri-O-acetyl)-beta-D-(4'-thioribofuranosyl)thiophene-3-carboxylate (13beta) with methanolic ammonia and treatment of the ethyl ester with ammonium hydroxide gave thiophenthiofurin. The glycosylation site and anomeric configuration were established by (1)H NMR spectroscopy. Thiophenthiofurin was found to be cytotoxic in vitro toward human myelogenous leukemia K562, albeit 39-fold less than thiophenfurin, while furanthiofurin proved to be inactive. K562 cells incubated with thiophenthiofurin resulted in inhibition of inosine 5'-monophosphate dehydrogenase (IMPDH) and an increase in IMP pools with a concurrent decrease in GTP levels. From computational studies it was deduced that, among the C-nucleoside analogues of tiazofurin, activity requires an electrophilic sulfur adjacent to the C-glycosidic bond and an energetically favorable conformer around chi = 0 degrees. Among these, the more constrained (least flexible) compounds (tiazofurin and thiophenfurin) are more active than the less constrained thiophenthiofurin. Those compounds which contain a nucleophilic oxygen in place of the

  17. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

    2016-09-15

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  18. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  19. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  1. Ensemble perspective for catalytic promiscuity: calorimetric analysis of the active site conformational landscape of a detoxification enzyme.

    Science.gov (United States)

    Honaker, Matthew T; Acchione, Mauro; Sumida, John P; Atkins, William M

    2011-12-09

    Enzymological paradigms have shifted recently to acknowledge the biological importance of catalytic promiscuity. However, catalytic promiscuity is a poorly understood property, and no thermodynamic treatment has described the conformational landscape of promiscuous versus substrate-specific enzymes. Here, two structurally similar glutathione transferase (GST, glutathione S-transferase) isoforms with high specificity or high promiscuity are compared. Differential scanning calorimetry (DSC) indicates a reversible low temperature transition for the promiscuous GSTA1-1 that is not observed with substrate-specific GSTA4-4. This transition is assigned to rearrangement of the C terminus at the active site of GSTA1-1 based on the effects of ligands and mutations. Near-UV and far-UV circular dichroism indicate that this transition is due to repacking of tertiary contacts with the remainder of the subunit, rather than "unfolding" of the C terminus per se. Analysis of the DSC data using a modified Landau theory indicates that the local conformational landscape of the active site of GSTA1-1 is smooth, with barrierless transitions between states. The partition function of the C-terminal states is a broad unimodal distribution at all temperatures within this DSC transition. In contrast, the remainder of the GSTA1-1 subunit and the GSTA4-4 protein exhibit folded and unfolded macrostates with a significant energy barrier separating them. Their partition function includes a sharp unimodal distribution of states only at temperatures that yield either folded or unfolded macrostates. At intermediate temperatures the partition function includes a bimodal distribution. The barrierless rearrangement of the GSTA1-1 active site within a local smooth energy landscape suggests a thermodynamic basis for catalytic promiscuity.

  2. Effective Application of Bicelles for Conformational Analysis of G Protein-Coupled Receptors by Hydrogen/Deuterium Exchange Mass Spectrometry

    Science.gov (United States)

    Duc, Nguyen Minh; Du, Yang; Thorsen, Thor S.; Lee, Su Youn; Zhang, Cheng; Kato, Hideaki; Kobilka, Brian K.; Chung, Ka Young

    2015-05-01

    G protein-coupled receptors (GPCRs) have important roles in physiology and pathology, and 40% of drugs currently on the market target GPCRs for the treatment of various diseases. Because of their therapeutic importance, the structural mechanism of GPCR signaling is of great interest in the field of drug discovery. Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a useful tool for analyzing ligand binding sites, the protein-protein interaction interface, and conformational changes of proteins. However, its application to GPCRs has been limited for various reasons, including the hydrophobic nature of GPCRs and the use of detergents in their preparation. In the present study, we tested the application of bicelles as a means of solubilizing GPCRs for HDX-MS studies. GPCRs (e.g., β2-adrenergic receptor [β2AR], μ-opioid receptor, and protease-activated receptor 1) solubilized in bicelles produced better sequence coverage (greater than 90%) than GPCRs solubilized in n-dodecyl-β-D-maltopyranoside (DDM), suggesting that bicelles are a more effective method of solubilization for HDX-MS studies. The HDX-MS profile of β2AR in bicelles showed that transmembrane domains (TMs) undergo lower deuterium uptake than intracellular or extracellular regions, which is consistent with the fact that the TMs are highly ordered and embedded in bicelles. The overall HDX-MS profiles of β2AR solubilized in bicelles and in DDM were similar except for intracellular loop 3. Interestingly, we detected EX1 kinetics, an important phenomenon in protein dynamics, at the C-terminus of TM6 in β2AR. In conclusion, we suggest the application of bicelles as a useful method for solubilizing GPCRs for conformational analysis by HDX-MS.

  3. Making Diversity Conform? An Intersectional, Longitudinal Analysis of LGBT-Specific Mainstream Media Advertisements.

    Science.gov (United States)

    Nölke, Ana-Isabel

    2018-01-01

    This study introduces an intersectional analysis of explicit LGBT portrayals in mainstream advertising between 2009 and 2015. The analysis provides insights into the (in)visibility of the LGBT community over a period of significant social change. It finds that although the number of explicit representations of LGBT characters has risen dramatically, 230 out of 240 intersections of sexuality, class, age, and race remain invisible. In using a new ad format-human interest ads-advertisers move away from hypersexualization, toward real individuals' stories of love and families. Nonetheless, the analysis highlights how the erasure of multiply marginalized groups in mainstream advertising continues to perpetuate a heteronormative, domesticized version of "gayness" and discusses the adverse effects that lie herein. It is proposed that non-LGBT consumers are the underlying target group of LGBT-explicit advertising, causing non-target market effects that alienate large parts of the LGBT community despite their overt inclusion.

  4. Glycogen storage disease type Ia : recent experience with mutation analysis, a summary of mutations reported in the literature and a newly developed diagnostic flowchart

    NARCIS (Netherlands)

    Rake, JP; ten Berge, AM; Visser, G; Verlind, E; Niezen-Koning, KE; Buys, CHCM; Smit, GPA; Scheffer, H

    We studied the glucose-6-phosphatase (G6Pase) gene of 30 unrelated glycogen storage disease type Ia (GSD Ia) patients using single strand conformation, polymorphism (SSCP) prior to automated sequencing of exons revealing an aberrant SSCP pattern. In all patients we could identify mutations on both

  5. Cloning of a human insulin-stimulated protein kinase (ISPK-1) gene and analysis of coding regions and mRNA levels of the ISPK-1 and the protein phosphatase-1 genes in muscle from NIDDM patients

    DEFF Research Database (Denmark)

    Bjørbaek, C; Vik, T A; Echwald, S M

    1995-01-01

    of the PP1 genes: two in PP1 alpha at codons 90 and 255; one in PP1 beta at codon 67; and three in PP1 gamma at codons 11,269, and 273, respectively. All were, however, silent single nucleotide substitutions. SSCP analysis of the ISPK-1 gene identified one silent polymorphism at codon 266 and one amino acid...... with non-insulin-dependent diabetes mellitus (NIDDM). The human ISPK-1 cDNA was cloned from T-cell leukemia and placental cDNA libraries and mapped to the short arm of the human X chromosome. Single-strand conformation polymorphism (SSCP) analysis identified a total of six variations in the coding regions...

  6. Optical fiber smart sensor for conformity analysis of Brazilian gasoline; Sensor inteligente a fibra otica para analise da conformidade da gosolina brasileira

    Energy Technology Data Exchange (ETDEWEB)

    Possetti, Gustavo R.C.; Camilotti, Emmanuelle; Arruda, Lucia V.R. de; Muller, Marcia; Fabris, Jose L. [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil); Cocco, Lilian C.; Yamamoto, Carlos I. [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil); Falate, Rosane [Universidade Estadual de Ponta Grossa (UEPG), PR (Brazil)

    2008-07-01

    The conventional techniques employed to monitor the gasoline quality are expensive, time-consuming and demands on specialized workers to its execution. A study about the applicability of a long period grating, a fiber optic device, as an auxiliary tool for the analysis of Brazilian gasoline conformity is presented in this work. The long period grating spectral response was measured with the device immersed in samples of gasoline A with different proportions of hydrated ethyl alcohol fuel. A resolution of 0.23 % was obtained for the concentrations range of commercial interest, between 20 % and 40 %. The device performance was also tested with a set of conform and non-conform gasoline C samples. The device spectral response for these samples, as well as the samples densities and the conformity status were employed to train and to validate an artificial neural network with radial base function. The obtained results show that fiber optic sensors supervised by artificial neural networks can constitute systems for smart measurement with high applicability in the analyses of gasoline conformity, reducing costs and time related to conventional tests. (author)

  7. Conformational Analysis of Proteins in Highly Concentrated Solutions by Dialysis-Coupled Hydrogen/Deuterium Exchange Mass Spectrometry

    Science.gov (United States)

    Houde, Damian; Nazari, Zeinab E.; Bou-Assaf, George M.; Weiskopf, Andrew S.; Rand, Kasper D.

    2016-04-01

    When highly concentrated, an antibody solution can exhibit unusual behaviors, which can lead to unwanted properties, such as increased levels of protein aggregation and unusually high viscosity. Molecular modeling, along with many indirect biophysical measurements, has suggested that the cause for these phenomena can be due to short range electrostatic and/or hydrophobic protein-protein interactions. Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a useful tool for investigating protein conformation, dynamics, and interactions. However, "traditional" continuous dilution labeling HDX-MS experiments have limited utility for the direct analysis of solutions with high concentrations of protein. Here, we present a dialysis-based HDX-MS (di-HDX-MS) method as an alternative HDX-MS labeling format, which takes advantage of passive dialysis rather than the classic dilution workflow. We applied this approach to a highly concentrated antibody solution without dilution or significant sample manipulation, prior to analysis. Such a method could pave the way for a deeper understanding of the unusual behavior of proteins at high concentrations, which is highly relevant for development of biopharmaceuticals in industry.

  8. Infrared and Raman Spectroscopy of Eugenol, Isoeugenol, and Methyl Eugenol: Conformational Analysis and Vibrational Assignments from Density Functional Theory Calculations of the Anharmonic Fundamentals.

    Science.gov (United States)

    Chowdhry, Babur Z; Ryall, John P; Dines, Trevor J; Mendham, Andrew P

    2015-11-19

    IR and Raman spectra of eugenol, isoeugenol and methyl eugenol have been obtained in the liquid phase. Vibrational spectroscopic results are discussed in relation to computed structures and spectra of the low energy conformations of these molecules obtained from DFT calculations at the B3LYP/cc-pVTZ level. Although computed differences in vibrational spectra for the different conformers were generally small, close examination, in conjunction with the experimental spectra, enabled conformational analysis of all three molecules. Anharmonic contributions to computed vibrational spectra were obtained from calculations of cubic and quartic force constants at the B3LYP/DZ level. This permitted the determination of the anharmonic fundamentals for comparison with the experimental IR and Raman band positions, leading to an excellent fit between calculated and experimental spectra. Band assignments were obtained in terms of potential energy distributions (ped's).

  9. Mutation analysis of peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1) and relationships of identified amino acid polymorphisms to Type II diabetes mellitus

    DEFF Research Database (Denmark)

    Ek, J; Andersen, G; Urhammer, S A

    2001-01-01

    single strand conformational polymorphism analysis followed by nucleotide sequencing. Identified variants were genotyped in an association study comprising 483 Type II diabetic patients and 216 glucose-tolerant control subjects. A replication study was done in an additional 201 Type II diabetic patients...... and 293 glucose-tolerant subjects. Furthermore, a potential interaction between the Pro12Ala polymorphism of PPAR-gamma2 and the PGC-1 Gly482Ser variant on risk of Type II diabetes was investigated. RESULTS: A total of seven variants (Ser74Leu, IVS2 + 52C-->A, Thr394Thr, Asp475Asp, Gly482Ser, Thr528Thr.......0007). No interaction between this variant and the Pro12Ala polymorphism of PPAR-gamma2 was observed. CONCLUSION/INTERPRETATION: A widespread Gly482Ser polymorphism of PGC-1 is associated with a 1.34 genotype relative risk of Type II diabetes....

  10. Non-conformable, partial and conformable transposition

    DEFF Research Database (Denmark)

    König, Thomas; Mäder, Lars Kai

    2013-01-01

    Although member states are obliged to transpose directives into domestic law in a conformable manner and receive considerable time for their transposition activities, we identify three levels of transposition outcomes for EU directives: conformable, partially conformable and non-conformable...... and the Commission regarding a directive’s outcome, play a much more strategic role than has to date acknowledged in the transposition literature. Whereas disagreement of a member state delays conformable transposition, it speeds up non-conformable transposition. Disagreement of the Commission only prolongs...

  11. Analysis of deterioration of rocky material which conform the sculptured serpents of the Tenayuca pyramid

    International Nuclear Information System (INIS)

    Mendoza A, D.; Martinez C, G.; Rodriguez L, V.

    2004-01-01

    This work presents the results about the characterization of rocky materials samples proceeding from heads of snakes that adorn the pyramid of Tenayuca, Mexico. Analysis of these samples, that show deterioration presence was performance through Scanning Electron Microscopy (SEM), Energy Dispersive X-ray Spectroscopy (EDS) and X-ray Diffraction (XRD). Several morphological structures such as granular, tubular, acicular growths and fibers were observed, some of they could be associate to salt migration. It was possible to identify different crystalline phases associated with albite (NaAlSi 3 O 8 ), anorthite [(Ca,Na)(Si,Al) 4 O 8 ], ferroactinolite [(Ca,Na,K) 2 Fe 5 Si 8 O 22 (OH) 2 ], gypsum (CaSO 4 2H 2 O), quartz (SiO 2 ) and thenardite (Na 2 SO 4 ). (Author) 10 refs., 2 tabs., 12 figs

  12. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  13. Permit to Work System Conformity Analysis based on the System Standard Criteria in an Oil and Gas Extraction Company

    Directory of Open Access Journals (Sweden)

    A. Ghahramani

    2007-04-01

    Full Text Available Background and Aims   Permit to work (PTW system as an operational control methods, is an accepted system for control of maintenance activities hazards in chemical industries. The main objective of this study was degree of conformity analysis between existing situation of PTW system and audit criteria.     Methods   In this cross - sectional study, PTW system was audited in an oil and gas extracting   industry by checklist.     Results   Major nonconformities include outdating of system legal and regulation, non existence of permit for majority of dangerous activities, unidentified training needs, incomplete  identification and risk assessment of maintenance hazards before doing them, unspecified   inspection and survey frequencies during works and nonexistence of scheduled auditing for the system.     Conclusion   PTW audit results showed that there is a noticeable gap between audit criteria and  audit evidences. So that the examined system had nonconformities in all of the checklist sections; system, training and competency, permit, coordination and monitoring.  

  14. A conformational NMR analysis of methymycin aglycones: complete and unambiguous assignments of stereochemically diverse glycosylated methymycin analogs by 1D and 2D NMR techniques and molecular modeling.

    Science.gov (United States)

    Akhmedov, Novruz G; Gannett, Peter M; Wu, Bulan; Cummings, Matthew M; Train, Brian C

    2013-03-01

    The (1)H and (13)C NMR spectra of 10-deoxymethynolide (1), 8.9-dihydro-10-deoxymethynolide (2) and its glycosylated derivatives (3-9) were analyzed using gradient-selected NMR techniques, including 1D TOCSY, gCOSY, 1D NOESY (DPFGSENOE), NOESY, gHMBC, gHSQC and gHSQC-TOCSY. The NMR spectral parameters (chemical shifts and coupling constants) of 1-9 were determined by iterative analysis. For the first time, complete and unambiguous assignment of the (1)H NMR spectrum of 10-deoxymethynolide (1) has been achieved in CDCl(3), CD(3)OD and C(6)D(6) solvents. The (1)H NMR spectrum of 8,9-dihydro-10-deoxymethynolide (2) was recorded in CDCl(3), (CD(3))(2)CO and CD(3)OD solutions to determine the conformation. NMR-based conformational analysis of 1 and 2 in conjugation with molecular modeling concluded that the 12-membered ring of the macrolactones may predominantly exist in a single stable conformation in all solvents examined. In all cases, a change in solvent caused only small changes in chemical shifts and coupling constants, suggesting that all glycosylated methymycin analogs exist with similar conformations of the aglycone ring in solution. Copyright © 2013 John Wiley & Sons, Ltd.

  15. Insight into microtubule destabilization mechanism of 3,4,5-trimethoxyphenyl indanone derivatives using molecular dynamics simulation and conformational modes analysis

    Science.gov (United States)

    Tripathi, Shubhandra; Srivastava, Gaurava; Singh, Aastha; Prakasham, A. P.; Negi, Arvind S.; Sharma, Ashok

    2018-03-01

    Colchicine site inhibitors are microtubule destabilizers having promising role in cancer therapeutics. In the current study, four such indanone derivatives (t1, t9, t14 and t17) with 3,4,5-trimethoxyphenyl fragment (ring A) and showing significant microtubule destabilization property have been explored. The interaction mechanism and conformational modes triggered by binding of these indanone derivatives and combretastatin at colchicine binding site (CBS) of αβ-tubulin dimer were studied using molecular dynamics (MD) simulation, principle component analysis and free energy landscape analysis. In the MD results, t1 showed binding similar to colchicine interacting in the deep hydrophobic core at the CBS. While t9, t14 and t17 showed binding conformation similar to combretastatin, with ring A superficially binding at the CBS. Results demonstrated that ring A played a vital role in binding via hydrophobic interactions and got anchored between the S8 and S9 sheets, H8 helix and T7 loop at the CBS. Conformational modes study revealed that twisting and bending conformational motions (as found in the apo system) were nearly absent in the ligand bound systems. Absence of twisting motion might causes loss of lateral contacts in microtubule, thus promoting microtubule destabilization. This study provides detailed account of microtubule destabilization mechanism by indanone ligands and combretastatin, and would be helpful for designing microtubule destabilizers with higher activity.

  16. Photon-counting single-molecule spectroscopy for studying conformational dynamics and macromolecular interactions

    Energy Technology Data Exchange (ETDEWEB)

    Laurence, Ted Alfred [Univ. of California, Berkeley, CA (United States)

    2002-01-01

    Single-molecule methods have the potential to provide information about conformational dynamics and molecular interactions that cannot be obtained by other methods. Removal of ensemble averaging provides several benefits, including the ability to detect heterogeneous populations and the ability to observe asynchronous reactions. Single-molecule diffusion methodologies using fluorescence resonance energy transfer (FRET) are developed to monitor conformational dynamics while minimizing perturbations introduced by interactions between molecules and surfaces. These methods are used to perform studies of the folding of Chymotrypsin Inhibitor 2, a small, single-domain protein, and of single-stranded DNA (ssDNA) homopolymers. Confocal microscopy is used in combination with sensitive detectors to detect bursts of photons from fluorescently labeled biomolecules as they diffuse through the focal volume. These bursts are analyzed to extract fluorescence resonance energy transfer (FRET) efficiency. Advances in data acquisition and analysis techniques that are providing a more complete picture of the accessible molecular information are discussed. Photon Arrival-time Interval Distribution (PAID) analysis is a new method for monitoring macromolecular interactions by fluorescence detection with simultaneous determination of coincidence, brightness, diffusion time, and occupancy (proportional to concentration) of fluorescently-labeled molecules undergoing diffusion in a confocal detection volume. This method is based on recording the time of arrival of all detected photons, and then plotting the two-dimensional histogram of photon pairs, where one axis is the time interval between each pair of photons 1 and 2, and the second axis is the number of other photons detected in the time interval between photons 1 and 2. PAID is related to Fluorescence Correlation Spectroscopy (FCS) by a collapse of this histogram onto the time interval axis. PAID extends auto- and cross-correlation FCS

  17. Photon-counting single-molecule spectroscopy for studying conformational dynamics and macromolecular interactions

    International Nuclear Information System (INIS)

    Laurence, Ted Alfred

    2002-01-01

    Single-molecule methods have the potential to provide information about conformational dynamics and molecular interactions that cannot be obtained by other methods. Removal of ensemble averaging provides several benefits, including the ability to detect heterogeneous populations and the ability to observe asynchronous reactions. Single-molecule diffusion methodologies using fluorescence resonance energy transfer (FRET) are developed to monitor conformational dynamics while minimizing perturbations introduced by interactions between molecules and surfaces. These methods are used to perform studies of the folding of Chymotrypsin Inhibitor 2, a small, single-domain protein, and of single-stranded DNA (ssDNA) homopolymers. Confocal microscopy is used in combination with sensitive detectors to detect bursts of photons from fluorescently labeled biomolecules as they diffuse through the focal volume. These bursts are analyzed to extract fluorescence resonance energy transfer (FRET) efficiency. Advances in data acquisition and analysis techniques that are providing a more complete picture of the accessible molecular information are discussed. Photon Arrival-time Interval Distribution (PAID) analysis is a new method for monitoring macromolecular interactions by fluorescence detection with simultaneous determination of coincidence, brightness, diffusion time, and occupancy (proportional to concentration) of fluorescently-labeled molecules undergoing diffusion in a confocal detection volume. This method is based on recording the time of arrival of all detected photons, and then plotting the two-dimensional histogram of photon pairs, where one axis is the time interval between each pair of photons 1 and 2, and the second axis is the number of other photons detected in the time interval between photons 1 and 2. PAID is related to Fluorescence Correlation Spectroscopy (FCS) by a collapse of this histogram onto the time interval axis. PAID extends auto- and cross-correlation FCS

  18. Conformation of amine-modified DNA: 2-aminofluorene- and 2-(acetylamino)fluorene-modified deoxydinucleoside monophosphates with all possible nearest neighbors. A comparison of search and optimization methods.

    Science.gov (United States)

    Shapiro, R; Sidawi, D; Miao, Y S; Hingerty, B E; Schmidt, K E; Moskowitz, J; Broyde, S

    1994-01-01

    Although a significant part of the replication fork exists as single-stranded DNA, little is known about the effect of carcinogens and mutagens on single-strand conformation. Large-scale conformational searches with potential energy minimization, using the torsion angle space molecular mechanics program DUPLEX, were employed to explore the conformation of all 16 deoxydinucleoside monophosphates bearing 2-aminofluorene (AF) or 2-(acetylamino)fluorene (AAF) modification on guanine. We have thus examined the effect of 3' versus 5' modification, the presence or absence of the acetyl group, and the effect of four different neighbors in each case. The principal effect of the acetyl group appeared to be the destabilization of anti (and, to a lesser degree, borderline anti) conformations for modified guanine. This mattered little in the 5'-substituted dimers, where one conformational type predominated in the low-energy structures for the adducts of both AAF and AF: It was right-handed, with syn-guanine, imperfect base-base stacking, and fluorene to 3'-sugar contacts. Greater divergence was seen in the 3'-substituted series. The AAF-substituted 3'-adducts primarily displayed good base-fluorene stacking, with syn-guanine in contact with the 5'-sugar. The AF-substituted 3'-adducts displayed a variety of structures which included base-base and carcinogen-base stacked forms. Two novel forms were encountered [global minima for d(ApG-AF) and d(GpG-AF)], whose unusual structures suggest mutagenic capability. In order to address the multiple minimum problem, we conducted our searches of conformation space using two alternative optimization methods that also employ differing search strategies. We used the Powell algorithm, BOTM, with starting conformations that are selected combinations of rotamers, and the method of simulated annealing (SA), with random or arbitrary starting conformations. While both approaches were effective in defining the most important structures, SA was more

  19. Lyman NTCP model analysis of radiation-induced liver disease in hypofractionated conformal radiotherapy for primary liver carcinoma

    International Nuclear Information System (INIS)

    Xu Zhiyong; Zhu Yi; Zhao Jiaodong; Fu Xiaolong; Jiang Guoliang; Liang Shixiong; Zhu Xiaodong

    2006-01-01

    Objective: To identify the factors associated with radiation-induced liver disease (RILD) and to describe the probability of RILD using the Lyman normal tissue complication(NTCP) model for primary liver carcinoma(PLC) treated with hypofractionated conformal therapy (CRT). Methods: A total of 109 PLC patients treated with hypofractionated CRT were prospectively followed according to the Child-Pugh classification for liver cirrhosis, 93 patients in class A and 16 in class B. The mean dose of radiation to the isocenter was (53.5±5.5) Gy, fractions of (4.8±0.5) Gy, with interfraction interval of 48 hours and irradiation 3 times per week. Maximal likelihood analysis yielded the best estimates of parameters of the Lyman NTCP model for all patients; Child-Pugh A and Child-Pugh B patients, respectively. Results: Of all the patients, 17 developed RILD (17/109), 8 in Child-Pugh A (8/93) and 9 in Child-Pugh B (9/16). By multivariate analysis, only the Child-Pugh Grade of liver cirrhosis was the independent factor (P=0.000) associated with the developing of BILD. The best estimates of the NTCP parameters for all 109 patients were n=1.1, m=0.35 and TD 50 (1)=38.5 Gy. The n, m, TD 50 (1) estimated from patients with Child-Pugh A was 1.1, 0.28, 40.5 Gy, respectively, compared with 0.7, 0.43, 23 Gy respectively, for patients with Child-Pugh B. Conclusions: Primary liver cancer patients who possess Child-Pugh B cirrhosis would present a significantly greater susceptibility to RILD after hypofractionated CRT than patients with Child-Pugh A cirrhosis. The predominant risk factor for developing RILD is the severity of hepatic cirrhosis in the liver of PLC patients. (authors)

  20. Separation and identification of DNA-carcinogen adduct conformers by polyacrylamide gel electrophoresis with laser-induced fluorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Marsch, G.A.; Jankowiak, R.; Farhat, J.H.; Small, G.J. (Ames Lab., IA (United States) Iowa State Univ., Ames (United States))

    1992-12-01

    The authors have developed a separation protocol utilizing high-resolution polyacrylamide gel electrophoresis (PAGE) to isolate stable anti-benzo[a]pyrene diol epoxide adducts of oligodeoxynucleotides. Both enantiomers produced multiple adduct species. The distribution of adduct types could be quantitated by densitometry of autoradiograms or Cerenkov counting of eluted oligomers modified by anti-BPDE isomers. Laser-induced fluorescence (LIF) spectra of eluted adducts at 4.2 K (fluorescence line-narrowing spectroscopy) and 77 K revealed that bands corresponded to pure conformers of pyrene chromophore. Carcinogen-modified oligodeoxynucleotides were single-stranded, but there were often considerable stacking interactions between the pyrenyl residues and the oligonucleotide bases, indicating that electrophoresed oligomers were single-stranded but in a native, versus random-coil conformation. The ability to identify and quantitate adducts by PAGE-LIF, coupled with the high resolution and sensitivity of both techniques, makes PAGE and LIF in tandem a potentially powerful tool in the study of chemical carcinogenesis or other ligand-DNA interactions. 43 refs., 7 figs., 1 tab.

  1. Harmony of spinning conformal blocks

    Energy Technology Data Exchange (ETDEWEB)

    Schomerus, Volker [DESY Hamburg, Theory Group,Notkestraße 85, 22607 Hamburg (Germany); Sobko, Evgeny [Nordita and Stockholm University,Roslagstullsbacken 23, SE-106 91 Stockholm (Sweden); Isachenkov, Mikhail [Department of Particle Physics and Astrophysics, Weizmann Institute of Science,Rehovot 7610001 (Israel)

    2017-03-15

    Conformal blocks for correlation functions of tensor operators play an increasingly important role for the conformal bootstrap programme. We develop a universal approach to such spinning blocks through the harmonic analysis of certain bundles over a coset of the conformal group. The resulting Casimir equations are given by a matrix version of the Calogero-Sutherland Hamiltonian that describes the scattering of interacting spinning particles in a 1-dimensional external potential. The approach is illustrated in several examples including fermionic seed blocks in 3D CFT where they take a very simple form.

  2. Harmony of spinning conformal blocks

    Energy Technology Data Exchange (ETDEWEB)

    Schomerus, Volker [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany). Theory Group; Sobko, Evgeny [Stockholm Univ. (Sweden); Nordita, Stockholm (Sweden); Isachenkov, Mikhail [Weizmann Institute of Science, Rehovoth (Israel). Dept. of Particle Physics and Astrophysics

    2016-12-07

    Conformal blocks for correlation functions of tensor operators play an increasingly important role for the conformal bootstrap programme. We develop a universal approach to such spinning blocks through the harmonic analysis of certain bundles over a coset of the conformal group. The resulting Casimir equations are given by a matrix version of the Calogero-Sutherland Hamiltonian that describes the scattering of interacting spinning particles in a 1-dimensional external potential. The approach is illustrated in several examples including fermionic seed blocks in 3D CFT where they take a very simple form.

  3. Motuporamines, anti-invasion and anti-angiogenic alkaloids from the marine sponge Xestospongia exigua (Kirkpatrick): isolation, structure elucidation, analogue synthesis, and conformational analysis.

    Science.gov (United States)

    Williams, David E; Craig, Kyle S; Patrick, Brian; McHardy, Lianne M; van Soest, Rob; Roberge, Michel; Andersen, Raymond J

    2002-01-11

    Extracts of the sponge Xestospongia exigua collected in Papua New Guinea were positive in a new assay for anti-invasion activity. Bioassay-guided fractionation led to the identification of the three known motuporamines A (1), B (2), and C (3) along with the new motuporamines D (4), E (5), and F (6) and a mixture of G, H, and I (15). Motuporamines A (1), B (2), and C (3) and the mixture of G, H, and I (15) were responsible for the anti-invasion activity of the crude extract. Motuporamine C (3) has also been found to be anti-angiogenic. A series of analogues of the motuporamines have been synthesized and evaluated for anti-invasive activity. These SAR results revealed that a saturated 15-membered cyclic amine fused to the natural motuporamine diamine side chain (13) represented the optimal structure for anti-invasive activity in this family. Single-crystal X-ray diffraction analysis of one of the analogues 20 showed that in the solid state its 16-membered macrocyclic amine fragment adopted the [4444] quadrangular conformation predicted by calculations to be the lowest energy conformation for the corresponding cycloalkane, cyclohexadecane. These data along with literature X-ray data and conformational analysis for derivatives of azacyclotridecane have been used as precedents for predicting the lowest energy ring conformations of other motuporamines. The SAR data from the natural and synthetic motuporamines have been combined with the conformational analyses to provide an outline of the functionality and shape required for activity in this family of alkaloids and to design a new analogue 49 that showed good anti-invasion activity.

  4. Application of two-dimensional NMR spectroscopy and molecular dynamics simulations to the conformational analysis of oligosaccharides corresponding to the cell-wall polysaccharide of Streptococcus group A.

    Science.gov (United States)

    Kreis, U C; Varma, V; Pinto, B M

    1995-06-01

    This paper describes the use of a protocol for conformational analysis of oligosaccharide structures related to the cell-wall polysaccharide of Streptococcus group A. The polysaccharide features a branched structure with an L-rhamnopyranose (Rhap) backbone consisting of alternating alpha-(1-->2) and alpha-(1-->3) links and D-N-acetylglucosamine (GlcpNAc) residues beta-(1-->3)-connected to alternating rhamnose rings: [formula: see text] Oligomers consisting of three to six residues have been synthesized and nuclear magnetic resonance (NMR) assignments have been made. The protocol for conformational analysis of the solution structure of these oligosaccharides involves experimental and theoretical methods. Two-dimensional NMR spectroscopy methods (TOCSY, ROESY and NOESY) are utilized to obtain chemical shift data and proton-proton distances. These distances are used as constraints in 100 ps molecular dynamics simulations in water using QUANTA and CHARMm. In addition, the dynamics simulations are performed without constraints. ROE build-up curves are computed from the averaged structures of the molecular dynamics simulations using the CROSREL program and compared with the experimental curves. Thus, a refinement of the initial structure may be obtained. The alpha-(1-->2) and the beta-(1-->3) links are unambiguously defined by the observed ROE cross peaks between the A-B',A'-B and C-B,C'-B' residues, respectively. The branch-point of the trisaccharide CBA' is conformationally well-defined. Assignment of the conformation of the B-A linkage (alpha-(1-->3)) was problematic due to TOCSY relay, but could be solved by NOESY and T-ROESY techniques. A conformational model for the polysaccharide is proposed.

  5. Thermodynamic Analysis of the Conformational Transition in Aqueous Solutions of Isotactic and Atactic Poly(Methacrylic Acid and the Hydrophobic Effect

    Directory of Open Access Journals (Sweden)

    Ksenija Kogej

    2016-04-01

    Full Text Available The affinity of amphiphilic compounds for water is important in various processes, e.g., in conformational transitions of biopolymers, protein folding/unfolding, partitioning of drugs in the living systems, and many others. Herein, we study the conformational transition of two isomer forms of poly(methacrylic acid (PMA, isotactic (iPMA and atactic (aPMA, in water. These isomers are chemically equivalent and differ only in the arrangement of functional groups along the chain. A complete thermodynamic analysis of the transition of the PMA chains from the compact to the extended form (comprising the conformational transition in water in the presence of three alkali chlorides is conducted by determining the free energy, enthalpy, and entropy changes of the process as a function of temperature, and therefrom also the heat capacity change. The heat capacity change of the transition is positive (+20 J/K mol for aPMA and negative (−50 J/K mol for iPMA. This result suggests a different affinity of PMA isomers for water. The conformational transition of iPMA is parallel to the transfer of polar solutes into water, whereas that of aPMA agrees with the transfer of nonpolar solutes into water.

  6. Comparison of conformal and intensity modulated radiation therapy techniques for treatment of pelvic tumors. Analysis of acute toxicity

    International Nuclear Information System (INIS)

    Ferrigno, Robson; Santos, Adriana; Martins, Lidiane C; Weltman, Eduardo; Chen, Michael J; Sakuraba, Roberto; Lopes, Cleverson P; Cruz, José C

    2010-01-01

    This retrospective analysis reports on the comparative outcome of acute gastrointestinal (GI) and genitourinary (GU) toxicities between conformal radiation therapy (CRT) and intensity modulated radiation therapy (IMRT) techniques in the treatment of patients with pelvic tumors. From January 2002 to December 2008, 69 patients with pelvic tumors underwent whole pelvic CRT and 65 underwent whole pelvic IMRT to treat pelvic lymph nodes and primary tumor regions. Total dose to the whole pelvis ranged from 50 to 50.4 Gy in 25 to 28 daily fractions. Chemotherapy (CT) regimen, when employed, was based upon primary tumor. Acute GI and GU toxicities were graded by RTOG/EORTC acute radiation morbidity criteria. Absence of GI symptoms during radiotherapy (grade 0) was more frequently observed in the IMRT group (43.1% versus 8.7; p < 0.001) and medication for diarrhea (Grade 2) was more frequently used in the CRT group (65.2% versus 38.5%; p = 0.002). Acute GI grade 1 and 3 side effects incidence was similar in both groups (18.5% versus 18.8%; p = 0.95 and 0% versus 7.2%; p = 0.058, respectively). Incidence of GU toxicity was similar in both groups (grade 0: 61.5% versus 66.6%, p = 0.54; grade 1: 20% versus 8.7%, p = 0.06; grade 2: 18.5% versus 23.5%, p = 0.50 and grade 3: 0% versus 1.5%, p > 0.99). This comparative case series shows less grade 2 acute GI toxicity in patients treated with whole pelvic IMRT in comparison with those treated with CRT. Incidence of acute GU toxicity was similar in both groups

  7. Unveiling a novel transient druggable pocket in BACE-1 through molecular simulations: Conformational analysis and binding mode of multisite inhibitors

    Science.gov (United States)

    Di Pietro, Ornella; Laughton, Charles A.

    2017-01-01

    The critical role of BACE-1 in the formation of neurotoxic ß-amyloid peptides in the brain makes it an attractive target for an efficacious treatment of Alzheimer’s disease. However, the development of clinically useful BACE-1 inhibitors has proven to be extremely challenging. In this study we examine the binding mode of a novel potent inhibitor (compound 1, with IC50 80 nM) designed by synergistic combination of two fragments—huprine and rhein—that individually are endowed with very low activity against BACE-1. Examination of crystal structures reveals no appropriate binding site large enough to accommodate 1. Therefore we have examined the conformational flexibility of BACE-1 through extended molecular dynamics simulations, paying attention to the highly flexible region shaped by loops 8–14, 154–169 and 307–318. The analysis of the protein dynamics, together with studies of pocket druggability, has allowed us to detect the transient formation of a secondary binding site, which contains Arg307 as a key residue for the interaction with small molecules, at the edge of the catalytic cleft. The formation of this druggable “floppy” pocket would enable the binding of multisite inhibitors targeting both catalytic and secondary sites. Molecular dynamics simulations of BACE-1 bound to huprine-rhein hybrid compounds support the feasibility of this hypothesis. The results provide a basis to explain the high inhibitory potency of the two enantiomeric forms of 1, together with the large dependence on the length of the oligomethylenic linker. Furthermore, the multisite hypothesis has allowed us to rationalize the inhibitory potency of a series of tacrine-chromene hybrid compounds, specifically regarding the apparent lack of sensitivity of the inhibition constant to the chemical modifications introduced in the chromene unit. Overall, these findings pave the way for the exploration of novel functionalities in the design of optimized BACE-1 multisite inhibitors

  8. Conformational analysis of benzoannulated nine-membered rings. Part 2. X-ray analysis and force-field calculations of 1,4,5,7-tetrahydro-3 H-2,6-benzodithionin and its derivatives

    Science.gov (United States)

    Rys, Barbara; Szneler, Edward; Grochowski, Jacek; Serda, Paweł; Duddeck, Helmut

    1992-09-01

    The conformations of 1,4,5,7-tetrahydro-3 H-2,6-benzodithionin-4-spiro-(1'-cyclobutane), -(3'-oxacylobutane) and -(cyclopentane) have been determined by X-ray analysis and are compared with previous low-temperature NMR results and with MM2 calculations. Significant changes in bond lengths and torsion angles of the nine-membered ring may be due to differences in intramolecular strain and molecular packing. X-ray data revealed conformational similarities in spite of different substituents. MM2 calculations have shown that the solid-state conformation is close to the most stable of the twelve minimum-energy conformations found for the parent compound without substituents.

  9. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne

    2012-01-01

    identified a putative surface motif in mtSSB that may recruit UNG1 to DNA-bound mtSSB. We suggest that the massive amount of mtSSB in mitochondria effectively prevents processing of uracil and other types of damaged bases to avoid introduction of nicks in single-stranded mtDNA formed during replication....... Local enrichment of UNG1 at DNA-bound mtSSB may furthermore facilitate rapid access to- and processing of the damage once the dsDNA conformation is restored. This could be of potential biological importance, since mitochondria have no or limited capacity for homologous recombination to process nicks...

  10. Benchmarking Commercial Conformer Ensemble Generators.

    Science.gov (United States)

    Friedrich, Nils-Ole; de Bruyn Kops, Christina; Flachsenberg, Florian; Sommer, Kai; Rarey, Matthias; Kirchmair, Johannes

    2017-11-27

    We assess and compare the performance of eight commercial conformer ensemble generators (ConfGen, ConfGenX, cxcalc, iCon, MOE LowModeMD, MOE Stochastic, MOE Conformation Import, and OMEGA) and one leading free algorithm, the distance geometry algorithm implemented in RDKit. The comparative study is based on a new version of the Platinum Diverse Dataset, a high-quality benchmarking dataset of 2859 protein-bound ligand conformations extracted from the PDB. Differences in the performance of commercial algorithms are much smaller than those observed for free algorithms in our previous study (J. Chem. Inf. 2017, 57, 529-539). For commercial algorithms, the median minimum root-mean-square deviations measured between protein-bound ligand conformations and ensembles of a maximum of 250 conformers are between 0.46 and 0.61 Å. Commercial conformer ensemble generators are characterized by their high robustness, with at least 99% of all input molecules successfully processed and few or even no substantial geometrical errors detectable in their output conformations. The RDKit distance geometry algorithm (with minimization enabled) appears to be a good free alternative since its performance is comparable to that of the midranked commercial algorithms. Based on a statistical analysis, we elaborate on which algorithms to use and how to parametrize them for best performance in different application scenarios.

  11. Monitoring Protein Conformation Changes as an Activating Step for Protein Interactions with Cross-linking/MS Analysis. / Chen, Zhuo; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri

    DEFF Research Database (Denmark)

    Rasmussen, Morten

    Monitoring protein conformation changes as an activating step for protein interactions with cross-linking/MS analysis. Chen, Zhou; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri.   Introduction Protein interactions often require conformational changes in proteins...

  12. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  13. The analysis of prognostic factors affecting post-radiation acute reaction after conformal radiotherapy for non-small cell lung cancer

    OpenAIRE

    Spych, Michał; Gottwald, Leszek; Klonowicz, Małgorzata; Biegała, Michał; Bibik, Robert; Fijuth, Jacek

    2010-01-01

    Introduction The aim was to evaluate the risk of acute side effects in the lung after 3-dimensional conformal radiotherapy (3D-CRT) in patients treated for non-small cell lung cancer (NSCLC). An attempt was made to single out clinical factors and factors related to treatment technique which may induce acute post-radiation pneumonitis. Material and methods The analysis concerned 34 consecutive patients who underwent radical radiation therapy for NSCLC. Intensity of early toxicity was evaluated...

  14. A chemometric analysis of ligand-induced changes in intrinsic fluorescence of folate binding protein indicates a link between altered conformational structure and physico-chemical characteristics

    DEFF Research Database (Denmark)

    Bruun, Susanne W; Holm, Jan; Hansen, Steen Ingemann

    2009-01-01

    Ligand binding alters the conformational structure and physico-chemical characteristics of bovine folate binding protein (FBP). For the purpose of achieving further information we analyzed ligand (folate and methotrexate)-induced changes in the fluorescence landscape of FBP. Fluorescence excitation...... of folate accords fairly well with the disappearance of strongly hydrophobic tryptophan residues from the solvent-exposed surface of FBP. The PARAFAC has thus proven useful to establish a hitherto unexplained link between parallel changes in conformational structure and physico-chemical characteristics...... of FBP induced by folate binding. Parameters for ligand binding derived from PARAFAC analysis of the fluorescence data were qualitatively and quantitatively similar to those obtained from binding of radiofolate to FBP. Herein, methotrexate exhibited a higher affinity for FBP than in competition...

  15. Conformational differences in protein disulfide linkages between normal hair and hair from subjects with trichothiodystrophy: a quantitative analysis by Raman microspectroscopy.

    Science.gov (United States)

    Schlücker, S; Liang, C; Strehle, K R; DiGiovanna, J J; Kraemer, K H; Levin, I W

    2006-08-15

    Raman spectra of normal hair shafts and hair shafts from patients exhibiting trichothiodystrophy (TTD) were obtained using line focus laser illumination. Because hair from TTD patients has a significant decrease in the content of the sulfur-containing amino acids in comparison to normal hair, the 550-500 cm(-1) disulfide stretching mode region of the Raman spectrum was examined in detail. A quantitative spectral analysis demonstrates significant increases in the two energetically less favored gauche-gauche-trans (g-g-t) and trans-gauche-trans (t-g-t) forms. These observations suggest that the increased amounts of these less stable disulfide conformers are contributing factors to or associated with the hair brittleness observed for this congenital disorder. Structure-spectra correlations for the three dominant disulfide conformers are confirmed by quantum chemical calculations using modern density functional theory (DFT). Copyright 2006 Wiley Periodicals, Inc.

  16. Conformance and Deviance

    DEFF Research Database (Denmark)

    Gjerdrum Pedersen, Esben Rahbek; Neergaard, Peter; Thusgaard Pedersen, Janni

    2013-01-01

    This paper analyses how large Danish companies are responding to new governmental regulation which requires them to report on corporate social responsibility (CSR). The paper is based on an analysis of 142 company annual reports required by the new Danish regulation regarding CSR reporting, plus ...... in CSR reporting practices. Finally, it is argued that non-conformance with the new regulatory requirements is not solely about conscious resistance but may also be caused by, for example, lack of awareness, resource limitations, misinterpretations, and practical difficulties....

  17. Conformational analysis of quinine and its pseudo enantiomer quinidine: a combined jet-cooled spectroscopy and vibrational circular dichroism study.

    Science.gov (United States)

    Sen, Ananya; Bouchet, Aude; Lepère, Valeria; Le Barbu-Debus, Katia; Scuderi, D; Piuzzi, F; Zehnacker-Rentien, A

    2012-08-16

    Laser-desorbed quinine and quinidine have been studied in the gas phase by combining supersonic expansion with laser spectroscopy, namely, laser-induced fluorescence (LIF), resonance-enhanced multiphoton ionization (REMPI), and IR-UV double resonance experiments. Density funtional theory (DFT) calculations have been done in conjunction with the experimental work. The first electronic transition of quinine and quinidine is of π-π* nature, and the studied molecules weakly fluoresce in the gas phase, in contrast to what was observed in solution (Qin, W. W.; et al. J. Phys. Chem. C2009, 113, 11790). The two pseudo enantiomers quinine and quinidine show limited differences in the gas phase; their main conformation is of open type as it is in solution. However, vibrational circular dichroism (VCD) experiments in solution show that additional conformers exist in condensed phase for quinidine, which are not observed for quinine. This difference in behavior between the two pseudo enantiomers is discussed.

  18. Methods Of Complex Analysis And Conformity Assessment Of Formation Of Regional Retail Networks To The Principles Of Sustainable Development

    OpenAIRE

    Zoryana Gerasymchuk; Victor Korsak

    2014-01-01

    The methodical approach to assessing of conformity of the formation of regional retail sales networks (RRSN) to the principles of sustainable development, which includes: selection of goals, objectives, directions and scorecard assessment of territorial retail network; calculation of integral indices of RRSN and socio-economic and environmental security in the region; calculation of the integral index of sustainability of RRSN; assessment of balance-imbalance of RRSN development and regional ...

  19. Difference spatial distribution function analysis of aqueous solutions. IV. Hydration structure changes of ethylene glycol solutions throughout conformational change process from gGg' to tGg' conformers.

    Science.gov (United States)

    Hata, T; Ono, Y

    2000-11-01

    Monte Carlo (MC) simulations were carried out for an infinitely dilute aqueous solution of two stable conformers (gGg' and tGg') and of three conformations between gGg' and tGg' conformers of ethylene glycol (EG) at 298K. Based on the spatial distribution function (SDF) goo(x,y,z), obtained from the MC simulation in the above conformations in liquid water, the high distribution of hydration water molecules could be divided into hydrogen acceptor (HA), hydrogen donor (HD), MIX (overlapped distribution of HA and HD), and hydrophobic hydration (HH) regions. The spatial orientations of hydrogen-bonded water molecules were found to be of a linear type with a triple-layer structure in the HA region and HA part (in the MIX region), and double-layer structures in the HD region and HD part (in the MIX region). In addition, it was apparent that the spatial orientations of these water molecules were of the linear type throughout the conformational change process from gGg' to tGg' conformers in liquid water. From the difference SDF (DSDF), deltagoo(x,y, z), between the SDFs of two conformations, we concluded that the distribution of hydration water molecules in the HA and HD parts of the MIX region are governed by the competition of internal hydrogen bonds between the hydrogen atom and two lone-pair electrons on the oxygen atom of an EG molecule.

  20. Elastic network model-based normal mode analysis reveals the conformational couplings in the tripartite AcrAB-TolC multidrug efflux complex.

    Science.gov (United States)

    Wang, Beibei; Weng, Jingwei; Fan, Kangnian; Wang, Wenning

    2011-10-01

    The AcrAB-TolC drug efflux system, energized by proton movement down the transmembrane electrochemical gradient, is responsible for the resistance of the organism to a wide range of drugs. Experimental data suggest functional roles of each part of the assembly, but the detailed working mechanism of this machinery remains elusive. We used elastic network-based normal mode analysis (NMA) to explore the conformational dynamics of the AcrAB-TolC complex. The intrinsic flexibilities of the pore domain in AcrB monomer conform to the previously proposed three-step functionally rotating mechanism for asymmetric AcrB trimer. Conformational couplings across monomers in the AcrB trimer were observed, and the coupling between the transmembrane domain and the other parts of AcrB are strengthened through trimeric assembly. In the tripartite AcrAB-TolC assembly obtained through molecular docking, concerted motions were observed not only at the direct contact interfaces between various components but also between distant parts of the whole complex. The presence of AcrA was shown to significantly strengthen the motional couplings between AcrB and TolC. Overall, NMA revealed an allosteric network in the AcAB-TolC efflux system, which provides hints to our understanding of its detailed working mechanism. Copyright © 2011 Wiley-Liss, Inc.

  1. Conformational Analysis of Indole Alkaloids Corynantheine and Dihydrocorynantheine by Dynamic 1H NMR Spectroscopy and Computational Methods: Steric Effects of Ethyl vs Vinyl Group

    DEFF Research Database (Denmark)

    Stærk, Dan; Norrby, Per-Ola; Jaroszewski, Jerzy W.

    2001-01-01

    ) = 60 +/- 6 kJ/mol and DeltaS(double dagger) = 24 +/- 6 J/mol(.)K, with DeltaG degrees = 1.3 kJ/mol at -45 degreesC. The difference in the exchange rates of the rotamers of corynantheine and dihydrocorynantheine (respectively, 350 s(-1) and 9 s(-1) at 0 degreesC) reflects the difference in the steric......H-1 NMR (400 MHz) spectra of the indole alkaloid dihydrocorynantheine recorded at room temperature show the presence of two conformers near coalescence. Low temperature H-1 NMR allowed characterization of the conformational equilibrium, which involves rotation of the 3-methoxypropenoate side chain....... Line-shape analysis yielded enthalpy of activation DeltaH(double dagger) = 71 +/- 6 kJ/mol, and entropy of activation DeltaS(double dagger) = 33 +/- 6 J/mol(.)K. The major and minor conformation contains the methyl ether group above and below the plane of the ring, respectively, as determined by low...

  2. Conformational analysis, spectroscopic study (FT-IR, FT-Raman, UV, 1H and 13C NMR), molecular orbital energy and NLO properties of 5-iodosalicylic acid.

    Science.gov (United States)

    Karaca, Caglar; Atac, Ahmet; Karabacak, Mehmet

    2015-02-05

    In this study, 5-iodosalicylic acid (5-ISA, C7H5IO3) is structurally characterized by FT-IR, FT-Raman, NMR and UV spectroscopies. There are eight conformers, Cn, n=1-8 for this molecule therefore the molecular geometry for these eight conformers in the ground state are calculated by using the ab-initio density functional theory (DFT) B3LYP method approach with the aug-cc-pVDZ-PP basis set for iodine and the aug-cc-pVDZ basis set for the other elements. The computational results identified that the most stable conformer of 5-ISA is the C1 form. The vibrational spectra are calculated DFT method invoking the same basis sets and fundamental vibrations are assigned on the basis of the total energy distribution (TED) of the vibrational modes, calculated with scaled quantum mechanics (SQM) method with PQS program. Total density of state (TDOS) and partial density of state (PDOS) and also overlap population density of state (COOP or OPDOS) diagrams analysis for C1 conformer were calculated using the same method. The energy and oscillator strength are calculated by time-dependent density functional theory (TD-DFT) results complement with the experimental findings. Besides, charge transfer occurring in the molecule between HOMO and LUMO energies, frontier energy gap, molecular electrostatic potential (MEP) are calculated and presented. The NMR chemical shifts ((1)H and (13)C) spectra are recorded and calculated using the gauge independent atomic orbital (GIAO) method. Mulliken atomic charges of the title molecule are also calculated, interpreted and compared with salicylic acid. The optimized bond lengths, bond angles and calculated NMR and UV, vibrational wavenumbers showed the best agreement with the experimental results. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Conformal Einstein spaces

    International Nuclear Information System (INIS)

    Kozameh, C.N.; Newman, E.T.; Tod, K.P.

    1985-01-01

    Conformal transformations in four-dimensional. In particular, a new set of two necessary and sufficient conditions for a space to be conformal to an Einstein space is presented. The first condition defines the class of spaces conformal to C spaces, whereas the last one (the vanishing of the Bach tensor) gives the particular subclass of C spaces which are conformally related to Einstein spaces. (author)

  4. Viscous conformal gauge theories

    DEFF Research Database (Denmark)

    Toniato, Arianna; Sannino, Francesco; Rischke, Dirk H.

    2017-01-01

    We present the conformal behavior of the shear viscosity-to-entropy density ratio and the fermion-number diffusion coefficient within the perturbative regime of the conformal window for gauge-fermion theories.......We present the conformal behavior of the shear viscosity-to-entropy density ratio and the fermion-number diffusion coefficient within the perturbative regime of the conformal window for gauge-fermion theories....

  5. Superspace conformal field theory

    International Nuclear Information System (INIS)

    Quella, Thomas

    2013-07-01

    Conformal sigma models and WZW models on coset superspaces provide important examples of logarithmic conformal field theories. They possess many applications to problems in string and condensed matter theory. We review recent results and developments, including the general construction of WZW models on type I supergroups, the classification of conformal sigma models and their embedding into string theory.

  6. Superspace conformal field theory

    Energy Technology Data Exchange (ETDEWEB)

    Quella, Thomas [Koeln Univ. (Germany). Inst. fuer Theoretische Physik; Schomerus, Volker [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2013-07-15

    Conformal sigma models and WZW models on coset superspaces provide important examples of logarithmic conformal field theories. They possess many applications to problems in string and condensed matter theory. We review recent results and developments, including the general construction of WZW models on type I supergroups, the classification of conformal sigma models and their embedding into string theory.

  7. Conformational stability, spectroscopic (FT-IR, FT-Raman and UV-Vis) analysis, NLO, NBO, FMO and Fukui function analysis of 4-hexylacetophenone by density functional theory.

    Science.gov (United States)

    Saravanan, S; Balachandran, V

    2015-03-05

    The experimental and theoretical study on the structures and vibrations of 4-hexylacetophenone (abbreviated as 4HAP) are presented. The FT-IR and FT-Raman spectra of the title compound have been recorded in the region 4000-400cm(-1) and 3500-100cm(-1) respectively. The molecular structures, vibrational wavenumbers, infrared intensities and Raman activities were calculated using DFT (B3LYP and LSDA) method with 6-311++G(d,p) basis set. The most stable conformer of 4HAP is identified from the computational results. The assignments of the vibrational spectra have been carried out with the aid of normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology (SQMEF). The linear polarizability (α) and the first hyperpolarizability (βtot) values of the investigated molecule have been computed using B3LYP and LSDA with 6-311++G(d,p) basis set. Stability of the molecule arising from hyper conjugative interaction and charge transfer delocalization has been analyzed using natural bond orbital (NBO) analysis. The molecule orbital contributions are studied by density of energy states (DOSs). UV-Vis spectrum and effects of solvents have been discussed effects of solvents have been discussed and the electronic properties such as HOMO and LUMO energies were determined by time-dependent TD-DFT approach. Fukui function and Mulliken analysis on atomic charges of the title compound have been calculated. Finally, electrophilic and nucleophilic descriptors of the title molecule have been calculated. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Individualized margins in 3D conformal radiotherapy planning for lung cancer: analysis of physiological movements and their dosimetric impacts.

    Science.gov (United States)

    Germain, François; Beaulieu, Luc; Fortin, André

    2008-01-01

    In conformal radiotherapy planning for lung cancer, respiratory movements are not taken into account when a single computed tomography (CT) scan is performed. This study examines tumor movements to design individualized margins to account for these movements and evaluates their dosimetric impacts on planning volume. Fifteen patients undergoing CT-based planning for radical radiotherapy for localized lung cancer formed the study cohort. A reference plan was constructed based on reference gross, clinical, and planning target volumes (rGTV, rCTV, and rPTV, respectively). The reference plans were compared with individualized plans using individualized margins obtained by using 5 serial CT scans to generate individualized target volumes (iGTV, iCTV, and iPTV). Three-dimensional conformal radiation therapy was used for plan generation using 6- and 23-MV photon beams. Ten plans for each patient were generated and dose-volume histograms (DVHs) were calculated. Comparisons of volumetric and dosimetric parameters were performed using paired Student t-tests. Relative to the rGTV, the total volume occupied by the superimposed GTVs increased progressively with each additional CT scans. With the use of all 5 scans, the average increase in GTV was 52.1%. For the plans with closest dosimetric coverage, target volume was smaller (iPTV/rPTV ratio 0.808) but lung irradiation was only slightly decreased. Reduction in the proportion of lung tissue that received 20 Gy or more outside the PTV (V20) was observed both for 6-MV plans (-0.73%) and 23-MV plans (-0.65%), with p = 0.02 and p = 0.04, respectively. In conformal RT planning for the treatment of lung cancer, the use of serial CT scans to evaluate respiratory motion and to generate individualized margins to account for these motions produced only a limited lung sparing advantage.

  9. Individualized Margins in 3D Conformal Radiotherapy Planning for Lung Cancer: Analysis of Physiological Movements and Their Dosimetric Impacts

    International Nuclear Information System (INIS)

    Germain, Francois; Beaulieu, Luc; Fortin, Andre

    2008-01-01

    In conformal radiotherapy planning for lung cancer, respiratory movements are not taken into account when a single computed tomography (CT) scan is performed. This study examines tumor movements to design individualized margins to account for these movements and evaluates their dosimetric impacts on planning volume. Fifteen patients undergoing CT-based planning for radical radiotherapy for localized lung cancer formed the study cohort. A reference plan was constructed based on reference gross, clinical, and planning target volumes (rGTV, rCTV, and rPTV, respectively). The reference plans were compared with individualized plans using individualized margins obtained by using 5 serial CT scans to generate individualized target volumes (iGTV, iCTV, and iPTV). Three-dimensional conformal radiation therapy was used for plan generation using 6- and 23-MV photon beams. Ten plans for each patient were generated and dose-volume histograms (DVHs) were calculated. Comparisons of volumetric and dosimetric parameters were performed using paired Student t-tests. Relative to the rGTV, the total volume occupied by the superimposed GTVs increased progressively with each additional CT scans. With the use of all 5 scans, the average increase in GTV was 52.1%. For the plans with closest dosimetric coverage, target volume was smaller (iPTV/rPTV ratio 0.808) but lung irradiation was only slightly decreased. Reduction in the proportion of lung tissue that received 20 Gy or more outside the PTV (V20) was observed both for 6-MV plans (-0.73%) and 23-MV plans (-0.65%), with p = 0.02 and p = 0.04, respectively. In conformal RT planning for the treatment of lung cancer, the use of serial CT scans to evaluate respiratory motion and to generate individualized margins to account for these motions produced only a limited lung sparing advantage

  10. Structural Analysis of Streptococcus pyogenes NADH Oxidase: Conformational Dynamics Involved in Formation of the C(4a)-Peroxyflavin Intermediate.

    Science.gov (United States)

    Wallen, Jamie R; Mallett, T Conn; Okuno, Takashi; Parsonage, Derek; Sakai, Hiroaki; Tsukihara, Tomitake; Claiborne, Al

    2015-11-17

    In probing the oxygen reactivity of an Enterococcus faecalis NADH oxidase (Nox; O2 → 2H2O) C42S mutant lacking the Cys42-sulfenic acid (Cys42-SOH) redox center, we provided direct evidence of a C(4a)-peroxyflavin intermediate in the oxidative half-reaction and also described a conformational or chemical change that is rate-limiting for full reoxidation of the homodimer. In this work, the Nox from Streptococcus pyogenes (SpyNox) has been expressed and crystallized, and the overoxidized wild-type [Cys44-SOH → Cys44-sulfinic acid (Cys44-SO2H)] and C44S mutant enzyme structures have been refined at 2.0 and 2.15 Å, respectively. We show that azide binds to the two-electron reduced wild-type (EH2) enzyme and to the mutant enzyme in solution, but with a significantly higher affinity for the mutant protein. The spectral course of the titration with the SpyNox EH2 form clearly indicates progressive displacement of the Cys44-S(-) → FAD charge-transfer interaction. An azide soak with C44S Nox crystals led to the structure of the complex, as refined at 2.10 Å. The active-site N3(-) ligand is proximal to the Ser44 and His11 side chains, and a significant shift in the Ser44 side chain also appears. This provides an attractive explanation for the azide-induced loss of charge-transfer absorbance seen with the wild-type EH2 form and also permits accommodation of a C(4a)-peroxyflavin structural model. The conformation of Ser44 and the associated helical element, and the resulting steric accommodation, appear to be linked to the conformational change described in the E. faecalis C42S Nox oxidative half-reaction.

  11. Vibrational circulardichroism and IR spectral analysis as a test of theoretical conformational modeling for a cyclic hexapeptide

    Czech Academy of Sciences Publication Activity Database

    Bouř, Petr; Kim, J.; Kapitán, Josef; Hammer, R. P.; Huang, R.; Wu, L.; Keiderling, T. A.

    2008-01-01

    Roč. 20, č. 10 (2008), s. 1104-1119 ISSN 0899-0042 R&D Projects: GA ČR GA203/06/0420; GA ČR GA202/07/0732; GA AV ČR IAA400550702 Grant - others:NSF(US) CHE-0316014; NSF(US) CHE-0718543 Institutional research plan: CEZ:AV0Z40550506 Keywords : vibrational circular dichroism * peptide * conformation * ab initio Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.212, year: 2008

  12. Neural-network analysis of the vibrational spectra of N-acetyl L-alanyl N '-methyl amide conformational states

    DEFF Research Database (Denmark)

    Bohr, Henrik; Frimand, Kenneth; Jalkanen, Karl J.

    2001-01-01

    Density-functional theory (DFT) calculations utilizing the Becke 3LYP hybrid functional have been carried out for N-acetyl L-alanine N'-methylamide and examined with respect to the effect of water on the structure, the vibrational frequencies, vibrational absorption (VA), vibrational circular...... dichroism (VCD), Raman spectra, and Raman optical activity (ROA) intensities. The large changes due to hydration in the structures, and the relative stability of the conformer, reflected in the VA, VCD, Raman spectra, and ROA spectra observed experimentally, are reproduced by the DFT calculations. A neural...

  13. Conformational changes in glycine tri- and hexapeptide

    DEFF Research Database (Denmark)

    Yakubovich, Alexander V.; Solov'yov, Ilia; Solov'yov, Andrey V.

    2006-01-01

    conformations and calculated the energy barriers for transitions between them. Using a thermodynamic approach, we have estimated the times of the characteristic transitions between these conformations. The results of our calculations have been compared with those obtained by other theoretical methods...... also investigated the influence of the secondary structure of polypeptide chains on the formation of the potential energy landscape. This analysis has been performed for the sheet and the helix conformations of chains of six amino acids....

  14. The introduction of hydrogen bond and hydrophobicity effects into the rotational isomeric states model for conformational analysis of unfolded peptides

    International Nuclear Information System (INIS)

    Engin, Ozge; Sayar, Mehmet; Erman, Burak

    2009-01-01

    Relative contributions of local and non-local interactions to the unfolded conformations of peptides are examined by using the rotational isomeric states model which is a Markov model based on pairwise interactions of torsion angles. The isomeric states of a residue are well described by the Ramachandran map of backbone torsion angles. The statistical weight matrices for the states are determined by molecular dynamics simulations applied to monopeptides and dipeptides. Conformational properties of tripeptides formed from combinations of alanine, valine, tyrosine and tryptophan are investigated based on the Markov model. Comparison with molecular dynamics simulation results on these tripeptides identifies the sequence-distant long-range interactions that are missing in the Markov model. These are essentially the hydrogen bond and hydrophobic interactions that are obtained between the first and the third residue of a tripeptide. A systematic correction is proposed for incorporating these long-range interactions into the rotational isomeric states model. Preliminary results suggest that the Markov assumption can be improved significantly by renormalizing the statistical weight matrices to include the effects of the long-range correlations

  15. Deoxyfluoro-D-trehalose (FDTre) analogues as potential PET probes for imaging mycobacterial infection: rapid synthesis and purification, conformational analysis, and uptake by mycobacteria

    Science.gov (United States)

    Rundell, Sarah R.; Wagar, Zachary L.; Meints, Lisa M.; Olson, Claire D.; O’Neill, Mara K.; Piligian, Brent F.; Poston, Anne W.; Hood, Robin J.; Woodruff, Peter J.

    2016-01-01

    Mycobacterium tuberculosis, the etiological agent of human tuberculosis, requires the non-mammalian disaccharide trehalose for growth and virulence. Recently, detectable trehalose analogues have gained attention as probes for studying trehalose metabolism and as potential diagnostic imaging agents for mycobacterial infections. Of particular interest are deoxy-[18F]fluoro-D-trehalose (18F-FDTre) analogues, which have been suggested as possible positron emission tomography (PET) probes for in vivo imaging of M. tuberculosis infection. Here, we report progress toward this objective, including the synthesis and conformational analysis of four non-radioactive deoxy-[19F]fluoro-D-trehalose (19F-FDTre) analogues, as well as evaluation of their uptake by M. smegmatis. The rapid synthesis and purification of several 19F-FDTre analogues was accomplished in high yield using a one-step chemoenzymatic method. Conformational analysis of the 19F-FDTre analogues using NMR and molecular modeling methods showed that fluorine substitution had a negligible effect on the conformation of the native disaccharide, suggesting that fluorinated analogues may be successfully recognized and processed by trehalose metabolic machinery in mycobacteria. To test this hypothesis and to evaluate a possible route for delivery of FDTre probes specifically to mycobacteria, we showed that 19F-FDTre analogues are actively imported into M. smegmatis via the trehalose-specific transporter SugABC-LpqY. Finally, to demonstrate the applicability of these results to the efficient preparation and use of short-lived 18F-FDTre PET radiotracers, we carried out 19F-FDTre synthesis, purification, and administration to M. smegmatis in 1 hour. PMID:27560008

  16. Operator algebras and conformal field theory

    International Nuclear Information System (INIS)

    Gabbiani, F.; Froehlich, J.

    1993-01-01

    We define and study two-dimensional, chiral conformal field theory by the methods of algebraic field theory. We start by characterizing the vacuum sectors of such theories and show that, under very general hypotheses, their algebras of local observables are isomorphic to the unique hyperfinite type III 1 factor. The conformal net determined by the algebras of local observables is proven to satisfy Haag duality. The representation of the Moebius group (and presumably of the entire Virasoro algebra) on the vacuum sector of a conformal field theory is uniquely determined by the Tomita-Takesaki modular operators associated with its vacuum state and its conformal net. We then develop the theory of Mebius covariant representations of a conformal net, using methods of Doplicher, Haag and Roberts. We apply our results to the representation theory of loop groups. Our analysis is motivated by the desire to find a 'background-independent' formulation of conformal field theories. (orig.)

  17. A Framework for Online Conformance Checking

    DEFF Research Database (Denmark)

    Burattin, Andrea; Carmona, Josep

    2017-01-01

    Conformance checking – a branch of process mining – focuses on establishing to what extent actual executions of a process are in line with the expected behavior of a reference model. Current conformancechecking techniques only allow for a-posteriori analysis: the amount of (non-)conformant behavior...... is quantified after the completion of the process instance. In this paper we propose a framework for online conformance checking: not only do we quantify (non-)conformant behavior as the execution is running, we also restrict the computation to constant time complexity per event analyzed, thus enabling...

  18. Analysis of Conformational Stability of Abnormal Prion Protein Aggregates across the Spectrum of Creutzfeldt-Jakob Disease Prions

    Science.gov (United States)

    Cescatti, Maura; Saverioni, Daniela; Capellari, Sabina; Tagliavini, Fabrizio; Kitamoto, Tetsuyuki; Ironside, James; Giese, Armin

    2016-01-01

    ABSTRACT The wide phenotypic variability of prion diseases is thought to depend on the interaction of a host genotype with prion strains that have self-perpetuating biological properties enciphered in distinct conformations of the misfolded prion protein PrPSc. This concept is largely based on indirect approaches studying the effect of proteases or denaturing agents on the physicochemical properties of PrPSc aggregates. Furthermore, most data come from studies on rodent-adapted prion strains, making current understanding of the molecular basis of strains and phenotypic variability in naturally occurring diseases, especially in humans, more limited. To fill this gap, we studied the effects of guanidine hydrochloride (GdnHCl) and heating on PrPSc aggregates extracted from 60 sporadic Creutzfeldt-Jakob disease (CJD) and 6 variant CJD brains. While denaturation curves obtained after exposure of PrPSc to increasing GdnHCl concentrations showed similar profiles among the 7 CJD types analyzed, PrPSc exposure to increasing temperature revealed significantly different and type-specific responses. In particular, MM1 and VV2, the most prevalent and fast-replicating CJD types, showed stable and highly resistant PrPSc aggregates, whereas VV1, a rare and slowly propagating type, revealed unstable aggregates that easily dissolved at low temperature. Taken together, our results indicate that the molecular interactions mediating the aggregation state of PrPSc, possibly enciphering strain diversity, are differently targeted by GdnHCl, temperature, and proteases. Furthermore, the detected positive correlation between the thermostability of PrPSc aggregates and disease transmission efficiency makes inconsistent the proposed hypothesis that a decrease in conformational stability of prions results in an increase in their replication efficiency. IMPORTANCE Prion strains are defined as infectious isolates propagating distinctive phenotypic traits after transmission to syngeneic hosts

  19. Conformal symmetry and holographic cosmology

    NARCIS (Netherlands)

    Bzowski, A.W.

    2013-01-01

    This thesis presents a novel approach to cosmology using gauge/gravity duality. Analysis of the implications of conformal invariance in field theories leads to quantitative cosmological predictions which are in agreement with current data. Furthermore, holographic cosmology extends the theory of

  20. Conformal geometry and quasiregular mappings

    CERN Document Server

    Vuorinen, Matti

    1988-01-01

    This book is an introduction to the theory of spatial quasiregular mappings intended for the uninitiated reader. At the same time the book also addresses specialists in classical analysis and, in particular, geometric function theory. The text leads the reader to the frontier of current research and covers some most recent developments in the subject, previously scatterd through the literature. A major role in this monograph is played by certain conformal invariants which are solutions of extremal problems related to extremal lengths of curve families. These invariants are then applied to prove sharp distortion theorems for quasiregular mappings. One of these extremal problems of conformal geometry generalizes a classical two-dimensional problem of O. Teichmüller. The novel feature of the exposition is the way in which conformal invariants are applied and the sharp results obtained should be of considerable interest even in the two-dimensional particular case. This book combines the features of a textbook an...

  1. Re-emergence of an orphan therapeutic target for the treatment of resistant prostate cancer - a thorough conformational and binding analysis for ROR-γ protein.

    Science.gov (United States)

    Ndagi, Umar; Mhlongo, Ndumiso N; Soliman, Mahmoud E

    2018-02-01

    Recent studies have linked a deadly form of prostate cancer known as metastatic castration-resistant prostate cancer to retinoic acid-related orphan-receptor gamma (ROR-γ). Most of these studies continued to place ROR-γ as orphan because of unidentifiable inhibitor. Recently identified inhibitors of ROR-γ and their therapeutic potential were evaluated, among which inhibitor XY018 was the potent. However, molecular understanding of the conformational features of XY018-ROR-γ complex is still elusive. Herein, molecular dynamics simulations were conducted on HC9-ROR-γ and XY018-ROR-γ complexes to understand their conformational features at molecular level and the influence of XY018 binding on the dynamics of ROR-γ with the aid of post-dynamic analytical tools. These include; principal component analysis, radius of gyration, binding free energy calculation (MM/GBSA), per-residue fluctuation and hydrogen bond occupancy. Findings from this study revealed that (1) hydrophobic packing contributes significantly to binding free energy, (2) Ile136 and Leu60 exhibited high hydrogen-bond occupancy in XY018-ROR-γ and HC9-ROR-γ, respectively, (3) XY018-ROR-γ displayed a relatively high loop region residue fluctuation compared to HC9-ROR-γ, (4) electrostatic interactions are a potential binding force in XY018-ROR-γ complex compared to HC9-ROR-γ, (5) XY018-ROR-γ assumes a rigid conformation which is highlighted by a decrease in residual fluctuation, (6) XY018 could potentially induce pseudoporphyria, nephritis and interstitial nephritis but potentially safe in renal failure. This study could serve as a base line for the design of new potential ROR-γ inhibitors.

  2. SU-F-T-103: Analysis of Hepatitis B Virus Reactivation After Conformal Radiotherapy in Patients with Hepatocellular Carcinoma Using the Lyman NTCP Model

    Energy Technology Data Exchange (ETDEWEB)

    Li, Z; Li, B [Laboratory of Image Science and Technology, Southeast University (China); Department of Radiation Oncology, Shandong Cancer Hospital, Shandong Academy of Medical Sciences (China); Huang, W; Li, H [Department of Radiation Oncology, Shandong Cancer Hospital, Shandong Academy of Medical Sciences (China)

    2016-06-15

    Purpose: The aim of this research was to investigate the feasibility of Lyman-Kutcher-Burman (LKB) normal tissue complication probability (NTCP) model in analyzing hepatitis B virus (HBV) reactivation in patients receiving conformal radiotherapy for patients with hepatocellular carcinoma (HCC). Methods: Between June 2009 and June 2012, 108 HBV-related HCC patients (90 were specifically selected and 18 patients were excluded) treated with conformal RT at three centers were enrolled in this retrospective study. They were all diagnosed as HCC by pathology or cytology. All 90 patients were followed up to September 2013 with a median follow-up time of 25.2 months. The parameters (TD50 (1), n, and m) of the modified LKB NTCP model were derived using maximum likelihood estimation. Bootstrap and leave-one-out were employed to test the generalizability of the results for use in a general population. Results: The incidences of complications in the study population were as follows: radiation-induced liver diseases (RILD) were 17.6%, HBV reactivation was 24.8%, and HBV reactivation-induced hepatitis was 22.7%, respectively. In multivariate analysis, the NTCP (p<0.001), and V20 were associated with HBV reactivation. TD50 (1), m and n were 42.9Gy (95% CI) (38.2–46.8), 0.14 (0.12–0.15) and 0.30 (0.2–0.33), respectively, for HBV reactivation. Bootstrap and leave-one-out results showed that the HBV parameter fits were extremely robust. Conclusion: A modified LKB NTCP model has been established to predict HBV reactivation for patients with HCC receiving conformal RT. The finding derives parameters set to predict potential endpoints of HBV reactivation.

  3. SU-F-T-103: Analysis of Hepatitis B Virus Reactivation After Conformal Radiotherapy in Patients with Hepatocellular Carcinoma Using the Lyman NTCP Model

    International Nuclear Information System (INIS)

    Li, Z; Li, B; Huang, W; Li, H

    2016-01-01

    Purpose: The aim of this research was to investigate the feasibility of Lyman-Kutcher-Burman (LKB) normal tissue complication probability (NTCP) model in analyzing hepatitis B virus (HBV) reactivation in patients receiving conformal radiotherapy for patients with hepatocellular carcinoma (HCC). Methods: Between June 2009 and June 2012, 108 HBV-related HCC patients (90 were specifically selected and 18 patients were excluded) treated with conformal RT at three centers were enrolled in this retrospective study. They were all diagnosed as HCC by pathology or cytology. All 90 patients were followed up to September 2013 with a median follow-up time of 25.2 months. The parameters (TD50 (1), n, and m) of the modified LKB NTCP model were derived using maximum likelihood estimation. Bootstrap and leave-one-out were employed to test the generalizability of the results for use in a general population. Results: The incidences of complications in the study population were as follows: radiation-induced liver diseases (RILD) were 17.6%, HBV reactivation was 24.8%, and HBV reactivation-induced hepatitis was 22.7%, respectively. In multivariate analysis, the NTCP (p<0.001), and V20 were associated with HBV reactivation. TD50 (1), m and n were 42.9Gy (95% CI) (38.2–46.8), 0.14 (0.12–0.15) and 0.30 (0.2–0.33), respectively, for HBV reactivation. Bootstrap and leave-one-out results showed that the HBV parameter fits were extremely robust. Conclusion: A modified LKB NTCP model has been established to predict HBV reactivation for patients with HCC receiving conformal RT. The finding derives parameters set to predict potential endpoints of HBV reactivation.

  4. Ribose-modified nucleosides as ligands for adenosine receptors: synthesis, conformational analysis, and biological evaluation of 1'-C-methyl adenosine analogues.

    Science.gov (United States)

    Cappellacci, Loredana; Barboni, Grazia; Palmieri, Micaela; Pasqualini, Michela; Grifantini, Mario; Costa, Barbara; Martini, Claudia; Franchetti, Palmarisa

    2002-03-14

    1'-C-Methyl analogues of adenosine and selective adenosine A(1) receptor agonists, such as N-[(1R)-1-methyl-2-phenylethyl]adenosine ((R)-PIA) and N(6)-cyclopentyladenosine, were synthesized to further investigate the subdomain that binds the ribose moiety. Binding affinities of these new compounds at A(1) and A(2A) receptors in rat brain membranes and at A(3) in rat testis membranes were determined and compared. It was found that the 1'-C-methyl modification in adenosine resulted in a decrease of affinity, particularly at A(1) and A(2A) receptors. When this modification was combined with N(6) substitutions with groups that induce high potency and selectivity at A(1) receptors, the high affinity was in part restored and the selectivity was increased. The most potent compound proved to be the 1'-C-methyl analogue of (R)-PIA with a K(i) of 23 nM for the displacement of [(3)H]CHA binding from rat brain A(1) receptors and a > 435-fold selectivity over A(2A) receptors. In functional assays, these compounds inhibited forskolin-stimulated adenylate cyclase with IC(50) values ranging from 0.065 to 3.4 microM, acting as full agonists. Conformational analysis based on vicinal protonminus signproton J-coupling constants and molecular mechanics calculations using the MM2 force field proved that the methyl group on C1' in adenosine has a pronounced impact on the furanose conformation by driving its conformational equilibrium toward the north, gamma+, syn form.

  5. Genotyping human papillomavirus type 16 isolates from persistently infected promiscuous individuals and cervical neoplasia patients

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); L. Juffermans (Leon); L. Schrauwen (Lianne); M. Burger; G.J.J. van Doornum (Gerard); W.G.V. Quint (Wim)

    1995-01-01

    textabstractNucleotide sequence variation in the noncoding region of the genome of human papillomavirus type 16 (HPV16) was determined by direct sequencing and single-strand conformation polymorphism analysis of DNA fragments amplified by PCR. Individuals of diverse

  6. Anharmonic vibrational analysis of s-trans and s-cis conformers of acryloyl fluoride using numerical-analytic Van Vleck operator perturbation theory

    Science.gov (United States)

    Krasnoshchekov, Sergey V.; Craig, Norman C.; Koroleva, Lidiya A.; Stepanov, Nikolay F.

    2018-01-01

    A new gas-phase infrared (IR) spectrum of acryloyl fluoride (ACRF, CH2dbnd CHsbnd CFdbnd O) with a resolution of 0.1 cm- 1 in the range 4000-450 cm- 1 was measured. Theoretical ab initio molecular structures, full quartic potential energy surfaces (PES), and cubic surfaces of dipole moments and polarizability tensor components (electro-optical properties, EOP) of the s-trans and s-cis conformers of the ACRF were calculated by the second-order Møller-Plesset electronic perturbation theory with a correlation consistent Dunning triple-ζ basis set. The numerical-analytic implementation of the second-order operator canonical Van Vleck perturbation theory was employed for predicting anharmonic IR and Raman scattering (RS) spectra of ACRF. To improve the anharmonic predictions, harmonic frequencies were replaced by their counterparts evaluated with the higher-level CCSD(T)/cc-pVTZ model, to form a ;hybrid; PES. The original operator representation of the Hamiltonian is analytically reduced to a quasi-diagonal form, integrated in the harmonic oscillator basis and diagonalized to account for strong resonance couplings. Double canonical transformations of EOP expansions enabled prediction of integral intensities of both fundamental and multi-quanta transitions in IR/RS spectra. Enhanced band shape analysis reinforced the assignments. A thorough interpretation of the new IR experimental spectra and existing matrix-isolation literature data for the mixture of two conformers of ACRF was accomplished, and a number of assignments clarified.

  7. Investigation of the spatial structure of des-Gly9-[Arg8]vasopressin by the methods of two-dimensional NMR spectroscopy and theoretical conformational analysis

    International Nuclear Information System (INIS)

    Shenderovich, M.D.; Sekatsis, I.P.; Liepin'sh, E.E.; Nikiforovich, G.V.; Papsuevich, O.S.

    1986-01-01

    An assignment of the 1 H NMR signals of des-Gly 9 -[Arg 8 ]vasopressin in dimethyl sulfoxide has been made by 2D spectroscopy. The SSCCs and temperature coefficients Δδ/Δ T have been obtained for the amide protons and the system of NOE cross-peaks in the two-dimensional NOESY spectrum has been analyzed. The most important information on the spatial structure of des-Gly 9 -[Arg 8 ]vasopressin is given by the low value of the temperature coefficient Δδ/Δ T of the Asn 5 amide proton and the NOE between the α-protons of Cys 1 and Cys 6 . It is assumed that the screening of the NH proton of the Asn 5 residue from the solvent is connected with a β-bend of the backbone in the 2-5 sequence, and the distance between the C/sup α/H atoms of the Cys 1 and Cys 6 residues does not exceed 4 A. Bearing these limitations in mind, a theoretical conformational analysis of the molecule has been made. The group of low-energy conformations of the backbone obtained has been compared with the complete set of NMR characteristics

  8. Conformal mapping for multiple terminals

    Science.gov (United States)

    Wang, Weimin; Ma, Wenying; Wang, Qiang; Ren, Hao

    2016-11-01

    Conformal mapping is an important mathematical tool that can be used to solve various physical and engineering problems in many fields, including electrostatics, fluid mechanics, classical mechanics, and transformation optics. It is an accurate and convenient way to solve problems involving two terminals. However, when faced with problems involving three or more terminals, which are more common in practical applications, existing conformal mapping methods apply assumptions or approximations. A general exact method does not exist for a structure with an arbitrary number of terminals. This study presents a conformal mapping method for multiple terminals. Through an accurate analysis of boundary conditions, additional terminals or boundaries are folded into the inner part of a mapped region. The method is applied to several typical situations, and the calculation process is described for two examples of an electrostatic actuator with three electrodes and of a light beam splitter with three ports. Compared with previously reported results, the solutions for the two examples based on our method are more precise and general. The proposed method is helpful in promoting the application of conformal mapping in analysis of practical problems.

  9. Spectra and structure of organophosphorus compounds—XXVIII. Vibrational and conformational analysis of dimethylmethoxyphosphine and some isotopically substituted derivatives

    Science.gov (United States)

    van der Veken, B. J.; Little, T. S.; Li, Y. S.; Harris, M. E.; Durig, J. R.

    The i.r. spectra (3600-50 cm -1) of the gaseous and solid states, and the Raman spectra (3600-10 cm -1) of the gaseous, liquid and solid states of (CH 3) 2POCH 3, (CH 3) 2POCD 3, (CD 3) 2POCH 3 and (CD 3) 2POCD 3 have been recorded. Thirty-five of the 36 normal modes have been assigned and the asymmetric torsion has been observed as a broad weak feature centered at 106 cm -1 in the far i.r. spectrum of gaseous (CH 3) 2POCH 3. A comparison of the vibrational spectra obtained for the fluid phases with those obtained for the amorphous and annealed solids indicates the existence of a second conformer present in a small amount in the gas phase but becoming more abundant in the liquid phase and the only remaining rotamer in the annealed solid. Asymmetric top i.r. band contour simulation provides evidence that the dominating species in the gas phase is one in which the methoxy methyl group is oriented approximately 60° ( gauche) away from the lone pair of electrons on the phosphorus atom. The rotamer which remains in the spectra of the annealed solid has been assigned to a structure in which the lone pair on the phosphorus atom is oriented trans to the methoxy methyl group. These results are compared to similar data obtained for methoxy phosphoryl compounds and discussed in terms of both canonical molecular orbital and VSEPR thoery.

  10. Binding analysis of carbon nanoparticles to human immunoglobulin G: Elucidation of the cytotoxicity of CNPs and perturbation of immunoglobulin conformations

    Science.gov (United States)

    Zhang, Shengrui; Yang, Haitao; Ji, Xiaohui; Wang, Qin

    2016-02-01

    The chemical compositions, sizes and fluorescent properties of synthesized carbon nanoparticles (CNPs) were characterized. Escherichia coli (E. coli) cells were used as a model to study the cytotoxicity of CNPs, and the results of the cellular uptake of CNPs yielded excellent results: the CNPs demonstrated good biocompatibility and were non-toxic to the growth of the E. coli cells. Moreover, to assess the potential toxicity of CNPs to human health, the binding behavior of CNPs with human immunoglobulin G (HIgG) was examined by fluorescence quenching spectroscopy, synchronous fluorescence spectroscopy and circular dichroism spectroscopy under physiological conditions. The fluorescence quenching constants and parameters for the interaction at different temperatures had been calculated according to Scatchard. The thermodynamic parameters, such as enthalpy change (ΔH), entropy change (ΔS) and free energy change (ΔG), were calculated, and the results indicated strong static quenching and showed that van der Waals forces, hydrogen bonds and hydrophobic interactions were the predominant intermolecular forces stabilizing the CNP-HIgG complex. Synchronous fluorescence and circular dichroism spectra provided information regarding the conformational alteration of HIgG in the presence of CNPs. These findings help to characterize the interactions between CNPs and HIgG, which may clarify the potential risks and undesirable health effects of CNPs, as well as the related cellular trafficking and systemic translocation.

  11. Synthesis, Molecular and Crystal Structure Analysis of 1-(4-Methylbenzenesulfonylindole-3-carbaldehyde and DFT Investigation of Its Rotational Conformers

    Directory of Open Access Journals (Sweden)

    Julio Zukerman-Schpector

    2014-02-01

    Full Text Available Two independent molecules that differ in terms of rotation about the central S-N bond comprise the asymmetric unit of the title compound 1. The molecules have a V-shape with the dihedral angles between the fused ring system and benzene ring being 79.08(6° and 72.83(5°, respectively. The packing is mostly driven by p···p interactions occurring between the tolyl ring of one molecule and the C6 ring of the indole fused ring system of the other. DFT and IRC calculations for these and related 1-(arylsulfonylindole molecules showed that the rotational barrier about the S-N bond between conformers is within the 2.5–5.5 kcal/mol range. Crystal data for C16H13NO3S (1: Mr = 299.33, space group Pna21, a = 19.6152(4 Å, b = 11.2736(4 Å, c = 12.6334(3 Å, V = 2793.67(13 Å3, Z = 8, Z' = 2, R = 0.034.

  12. Conformational analysis and global warming potentials of 1,1,1,3,3,3-hexafluoro-2-propanol from absorption spectroscopy

    Science.gov (United States)

    Godin, Paul J.; Le Bris, Karine; Strong, Kimberly

    2017-12-01

    Absorption cross-sections of 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) were derived from Fourier transform infrared spectra recorded from 530 to 3400 cm-1 with a resolution of 0.1 cm-1 over a temperature range of 300-362 K. These results were compared to previously published experimental measurements made at room temperature and to a theoretical spectrum from density functional theory (DFT) calculations. Good agreement is found between the experimentally derived results, DFT calculations, and previously published data. The only temperature dependence observed was in the amplitude of some of the absorption peaks due to the changing ratio of the stable conformations of HFIP. This temperature dependence does not result in a significant trend in integrated band strength as a function of temperature. The average value for integrated band strength is found to be (2.649 ± 0.065)x10-16 cm molecule-1 for HFIP over the spectral range of 595 to 3010 cm-1. Radiative efficiency (RE) and the global warming potential (GWP) for HFIP were also derived. A RE of 0.293 ± 0.059 Wm-2ppbv-1 is derived, which leads to a GWP100 of 188 in the range of 530 to 3000 cm-1. The DFT calculation is linearly adjusted to match the experimental spectrum. Using this adjusted DFT spectrum to expand the range below 530 to 0 cm-1 , increases the RE to 0.317 ± 0.063 Wm-2ppbv-1 and the GWP100 to 203.

  13. Conformational analysis of a Chlamydia-specific disaccharide {alpha}-Kdo-(2{sup {yields}}8)-{alpha}-Kdo-(2{sup {yields}}O)-allyl in aqueous solution and bound to a monoclonal antibody: Observation of intermolecular transfer NOEs

    Energy Technology Data Exchange (ETDEWEB)

    Sokolowski, Tobias; Haselhorst, Thomas; Scheffler, Karoline [Medizinische Universitaet, Institut fuer Chemie (Germany); Weisemann, Ruediger [Bruker Analytik GmbH, Silberstreifen (Germany); Kosma, Paul [Institut fuer Chemie der Universitaet fuer Bodenkultur Wien (Austria); Brade, Helmut; Brade, Lore [Forschungszentrum Borstel, Zentrum fuer Medizin und Biowissenschaften Parkallee 22 (Germany); Peters, Thomas [Medizinische Universitaet, Institut fuer Chemie (Germany)

    1998-07-15

    The disaccharide {alpha}-Kdo-(2{sup {yields}}8)-{alpha}-Kdo (Kdo: 3-deoxy-d-manno-oct-2-ulosonic acid) represents a genus-specific epitope of the lipopolysaccharide of the obligate intracellular human pathogen Chlamydia. The conformation of the synthetically derived disaccharide {alpha}-Kdo-(2{sup {yields}}8)-{alpha}-Kdo-(2{sup {yields}}O)-allyl was studied in aqueous solution, and complexed to a monoclonal antibody S25-2. Various NMR experiments based on the detection of NOEs (or transfer NOEs) and ROEs (or transfer ROEs) were performed. A major problem was the extensive overlap of almost all {sup 1}H NMR signals of {alpha}-Kdo-(2{sup {yields}}8)-{alpha}-Kdo-(2{sup {yields}}O)-allyl. To overcome this difficulty, HMQC-NOESY and HMQC-trNOESY experiments were employed. Spin diffusion effects were identified using trROESY experiments, QUIET-trNOESY experiments and MINSY experiments. It was found that protein protons contribute to the observed spin diffusion effects. At 800 MHz, intermolecular trNOEs were observed between ligand protons and aromatic protons in the antibody binding site. From NMR experiments and Metropolis Monte Carlo simulations, it was concluded that {alpha}-Kdo-(2{sup {yields}}8)-{alpha}-Kdo-(2{sup {yields}}O)-allyl in aqueous solution exists as a complex conformational mixture. Upon binding to the monoclonal antibody S25-2, only a limited range of conformations is available to {alpha}-Kdo-(2{sup {yields}}8)-{alpha}-Kdo-(2{sup {yields}}O)-allyl. These possible bound conformations were derived from a distance geometry analysis using transfer NOEs as experimental constraints. It is clear that a conformation is selected which lies within a part of the conformational space that is highly populated in solution. This conformational space also includes the conformation found in the crystal structure. Our results provide a basis for modeling studies of the antibody-disaccharide complex.

  14. A 1:1 pharmaceutical cocrystal of myricetin in combination with uncommon piracetam conformer: X-ray single crystal analysis and mechanochemical synthesis

    Science.gov (United States)

    Sowa, Michał; Ślepokura, Katarzyna; Matczak-Jon, Ewa

    2014-01-01

    Combination of two Active Pharmaceutical Ingredients, myricetin and piracetam, yields a 1:1 cocrystal characterized by X-ray single-crystal and powder diffraction, Raman spectroscopy, 1H NMR, thermal analysis (DSC and TG-DTA) methods. Constituents of the cocrystalline phase were also investigated in terms of Hirshfeld surfaces. Compounds in their neutral forms cocrystallize in the Pna21 space group of orthorhombic system. Notably, piracetam adopts an uncommon conformation, not encountered in its cocrystals previously described. In the crystal lattice, a three-dimensional hydrogen-bonded network is observed, including formation of a 2D molecular scaffolding motif. A scale-up procedure is readily available with use of solvent-drop grinding method, in which application of a variety of common solvents leads to formation of the cocrystal, as confirmed by XRPD and Raman spectroscopy.

  15. Conformal invariance in supergravity

    International Nuclear Information System (INIS)

    Bergshoeff, E.A.

    1983-01-01

    In this thesis the author explains the role of conformal invariance in supergravity. He presents the complete structure of extended conformal supergravity for N <= 4. The outline of this work is as follows. In chapter 2 he briefly summarizes the essential properties of supersymmetry and supergravity and indicates the use of conformal invariance in supergravity. The idea that the introduction of additional symmetry transformations can make clear the structure of a field theory is not reserved to supergravity only. By means of some simple examples it is shown in chapter 3 how one can always introduce additional gauge transformations in a theory of massive vector fields. Moreover it is shown how the gauge invariant formulation sometimes explains the quantum mechanical properties of the theory. In chapter 4 the author defines the conformal transformations and summarizes their main properties. He explains how these conformal transformations can be used to analyse the structure of gravity. The supersymmetric extension of these results is discussed in chapter 5. Here he describes as an example how N=1 supergravity can be reformulated in a conformally-invariant way. He also shows that beyond N=1 the gauge fields of the superconformal symmetries do not constitute an off-shell field representation of extended conformal supergravity. Therefore, in chapter 6, a systematic method to construct the off-shell formulation of all extended conformal supergravity theories with N <= 4 is developed. As an example he uses this method to construct N=1 conformal supergravity. Finally, in chapter 7 N=4 conformal supergravity is discussed. (Auth.)

  16. Disorder and order in unfolded and disordered peptides and proteins: a view derived from tripeptide conformational analysis. II. Tripeptides with short side chains populating asx and β-type like turn conformations.

    Science.gov (United States)

    Rybka, Karin; Toal, Siobhan E; Verbaro, Daniel J; Mathieu, Daniel; Schwalbe, Harald; Schweitzer-Stenner, Reinhard

    2013-06-01

    In the preceding paper, we found that ensembles of tripeptides with long or bulky chains can include up to 20% of various turns. Here, we determine the structural and thermodynamic characteristics of GxG peptides with short polar and/or ionizable central residues (D, N, C), whose conformational distributions exhibit higher than average percentage (>20%) of turn conformations. To probe the side-chain conformations of these peptides, we determined the (3)J(H(α),H(β)) coupling constants and derived the population of three rotamers with χ1 -angles of -60°, 180° and 60°, which were correlated with residue propensities by DFT-calculations. For protonated GDG, the rotamer distribution provides additional evidence for asx-turns. A comparison of vibrational spectra and NMR coupling constants of protonated GDG, ionized GDG, and the protonated aspartic acid dipeptide revealed that side chain protonation increases the pPII content at the expense of turn populations. The charged terminal groups, however, have negligible influence on the conformational properties of the central residue. Like protonated GDG, cationic GCG samples asx-turns to a significant extent. The temperature dependence of the UVCD spectra and (3)J(H(N)H(α)) constants suggest that the turn populations of GDG and GNG are practically temperature-independent, indicating enthalpic and entropic stabilization. The temperature-independent J-coupling and UVCD spectra of GNG require a three-state model. Our results indicate that short side chains with hydrogen bonding capability in GxG segments of proteins may serve as hinge regions for establishing compact structures of unfolded proteins and peptides. Copyright © 2012 Wiley Periodicals, Inc.

  17. Role of non-equilibrium conformations on driven polymer translocation.

    Science.gov (United States)

    Katkar, H H; Muthukumar, M

    2018-01-14

    One of the major theoretical methods in understanding polymer translocation through a nanopore is the Fokker-Planck formalism based on the assumption of quasi-equilibrium of polymer conformations. The criterion for applicability of the quasi-equilibrium approximation for polymer translocation is that the average translocation time per Kuhn segment, ⟨τ⟩/N K , is longer than the relaxation time τ 0 of the polymer. Toward an understanding of conditions that would satisfy this criterion, we have performed coarse-grained three dimensional Langevin dynamics and multi-particle collision dynamics simulations. We have studied the role of initial conformations of a polyelectrolyte chain (which were artificially generated with a flow field) on the kinetics of its translocation across a nanopore under the action of an externally applied transmembrane voltage V (in the absence of the initial flow field). Stretched (out-of-equilibrium) polyelectrolyte chain conformations are deliberately and systematically generated and used as initial conformations in translocation simulations. Independent simulations are performed to study the relaxation behavior of these stretched chains, and a comparison is made between the relaxation time scale and the mean translocation time (⟨τ⟩). For such artificially stretched initial states, ⟨τ⟩/N K equilibrium approximation. Nevertheless, we observe a scaling of ⟨τ⟩ ∼ 1/V over the entire range of chain stretching studied, in agreement with the predictions of the Fokker-Planck model. On the other hand, for realistic situations where the initial artificially imposed flow field is absent, a comparison of experimental data reported in the literature with the theory of polyelectrolyte dynamics reveals that the Zimm relaxation time (τ Zimm ) is shorter than the mean translocation time for several polymers including single stranded DNA (ssDNA), double stranded DNA (dsDNA), and synthetic polymers. Even when these data are rescaled

  18. Conformal expansions and renormalons

    Energy Technology Data Exchange (ETDEWEB)

    Rathsman, J.

    2000-02-07

    The coefficients in perturbative expansions in gauge theories are factorially increasing, predominantly due to renormalons. This type of factorial increase is not expected in conformal theories. In QCD conformal relations between observables can be defined in the presence of a perturbative infrared fixed-point. Using the Banks-Zaks expansion the authors study the effect of the large-order behavior of the perturbative series on the conformal coefficients. The authors find that in general these coefficients become factorially increasing. However, when the factorial behavior genuinely originates in a renormalon integral, as implied by a postulated skeleton expansion, it does not affect the conformal coefficients. As a consequence, the conformal coefficients will indeed be free of renormalon divergence, in accordance with previous observations concerning the smallness of these coefficients for specific observables. The authors further show that the correspondence of the BLM method with the skeleton expansion implies a unique scale-setting procedure. The BLM coefficients can be interpreted as the conformal coefficients in the series relating the fixed-point value of the observable with that of the skeleton effective charge. Through the skeleton expansion the relevance of renormalon-free conformal coefficients extends to real-world QCD.

  19. The analysis of prognostic factors affecting post-radiation acute reaction after conformal radiotherapy for non-small cell lung cancer.

    Science.gov (United States)

    Spych, Michał; Gottwald, Leszek; Klonowicz, Małgorzata; Biegała, Michał; Bibik, Robert; Fijuth, Jacek

    2010-10-01

    The aim was to evaluate the risk of acute side effects in the lung after 3-dimensional conformal radiotherapy (3D-CRT) in patients treated for non-small cell lung cancer (NSCLC). An attempt was made to single out clinical factors and factors related to treatment technique which may induce acute post-radiation pneumonitis. The analysis concerned 34 consecutive patients who underwent radical radiation therapy for NSCLC. Intensity of early toxicity was evaluated using modified RTOG/EORTC toxicity score. The endpoint for this analysis was the occurrence of radiation pneumonitis of grade 2 or higher. Factors related to treatment techniques were included in the statistical analysis. Fifty-three percent of patients included in the study suffered from acute post-radiation pneumonitis. The results of the study revealed the existence of lung tissue sensitivity to low doses of ionizing radiation. The multivariate analysis showed that total lung volume receiving a low dose of 10 Gy increased the risk of post-radiation pneumonitis (p = 0.01). Acute post-radiation pneumonitis was a relevant clinical problem in patients who underwent radical radiotherapy for non-small cell lung cancer. The lung volume receiving a dose of 10 Gy was the most important dosimetric factor which influenced the post-radiation acute pneumonitis.

  20. Ligand induced change of β2 adrenergic receptor from active to inactive conformation and its implication for the closed/open state of the water channel: insight from molecular dynamics simulation, free energy calculation and Markov state model analysis.

    Science.gov (United States)

    Bai, Qifeng; Pérez-Sánchez, Horacio; Zhang, Yang; Shao, Yonghua; Shi, Danfeng; Liu, Huanxiang; Yao, Xiaojun

    2014-08-14

    The reported crystal structures of β2 adrenergic receptor (β2AR) reveal that the open and closed states of the water channel are correlated with the inactive and active conformations of β2AR. However, more details about the process by which the water channel states are affected by the active to inactive conformational change of β2AR remain illusive. In this work, molecular dynamics simulations are performed to study the dynamical inactive and active conformational change of β2AR induced by inverse agonist ICI 118,551. Markov state model analysis and free energy calculation are employed to explore the open and close states of the water channel. The simulation results show that inverse agonist ICI 118,551 can induce water channel opening during the conformational transition of β2AR. Markov state model (MSM) analysis proves that the energy contour can be divided into seven states. States S1, S2 and S5, which represent the active conformation of β2AR, show that the water channel is in the closed state, while states S4 and S6, which correspond to the intermediate state conformation of β2AR, indicate the water channel opens gradually. State S7, which represents the inactive structure of β2AR, corresponds to the full open state of the water channel. The opening mechanism of the water channel is involved in the ligand-induced conformational change of β2AR. These results can provide useful information for understanding the opening mechanism of the water channel and will be useful for the rational design of potent inverse agonists of β2AR.