Side-Specific Reward Memories in Honeybees

Science.gov (United States)

Gil, Mariana; Menzel, Randolf; De Marco, Rodrigo J.

2009-01-01

We report a hitherto unknown form of side-specific learning in honeybees. We trained bees individually by coupling gustatory and mechanical stimulation of each antenna with either increasing or decreasing volumes of sucrose solution offered to the animal's proboscis along successive learning trials. Next, we examined their proboscis extension…

Incorporating single-side sparing in models for predicting parotid dose sparing in head and neck IMRT

International Nuclear Information System (INIS)

Yuan, Lulin; Wu, Q. Jackie; Yin, Fang-Fang; Yoo, David; Jiang, Yuliang; Ge, Yaorong

2014-01-01

Purpose: Sparing of single-side parotid gland is a common practice in head-and-neck (HN) intensity modulated radiation therapy (IMRT) planning. It is a special case of dose sparing tradeoff between different organs-at-risk. The authors describe an improved mathematical model for predicting achievable dose sparing in parotid glands in HN IMRT planning that incorporates single-side sparing considerations based on patient anatomy and learning from prior plan data. Methods: Among 68 HN cases analyzed retrospectively, 35 cases had physician prescribed single-side parotid sparing preferences. The single-side sparing model was trained with cases which had single-side sparing preferences, while the standard model was trained with the remainder of cases. A receiver operating characteristics (ROC) analysis was performed to determine the best criterion that separates the two case groups using the physician's single-side sparing prescription as ground truth. The final predictive model (combined model) takes into account the single-side sparing by switching between the standard and single-side sparing models according to the single-side sparing criterion. The models were tested with 20 additional cases. The significance of the improvement of prediction accuracy by the combined model over the standard model was evaluated using the Wilcoxon rank-sum test. Results: Using the ROC analysis, the best single-side sparing criterion is (1) the predicted median dose of one parotid is higher than 24 Gy; and (2) that of the other is higher than 7 Gy. This criterion gives a true positive rate of 0.82 and a false positive rate of 0.19, respectively. For the bilateral sparing cases, the combined and the standard models performed equally well, with the median of the prediction errors for parotid median dose being 0.34 Gy by both models (p = 0.81). For the single-side sparing cases, the standard model overestimates the median dose by 7.8 Gy on average, while the predictions by the combined

Cochlear implantation for single-sided deafness and tinnitus suppression.

Science.gov (United States)

Holder, Jourdan T; O'Connell, Brendan; Hedley-Williams, Andrea; Wanna, George

To quantify the potential effectiveness of cochlear implantation for tinnitus suppression in patients with single-sided deafness using the Tinnitus Handicap Inventory. The study included 12 patients with unilateral tinnitus who were undergoing cochlear implantation for single-sided deafness. The Tinnitus Handicap Inventory was administered at the patient's cochlear implant candidacy evaluation appointment prior to implantation and every cochlear implant follow-up appointment, except activation, following implantation. Patient demographics and speech recognition scores were also retrospectively recorded using the electronic medical record. A significant reduction was found when comparing Tinnitus Handicap Inventory score preoperatively (61.2±27.5) to the Tinnitus Handicap Inventory score after three months of cochlear implant use (24.6±28.2, p=0.004) and the Tinnitus Handicap Inventory score beyond 6months of CI use (13.3±18.9, p=0.008). Further, 45% of patients reported total tinnitus suppression. Mean CNC word recognition score improved from 2.9% (SD 9.4) pre-operatively to 40.8% (SD 31.7) by 6months post-activation, which was significantly improved from pre-operative scores (p=0.008). The present data is in agreement with previously published studies that have shown an improvement in tinnitus following cochlear implantation for the large majority of patients with single-sided deafness. Copyright © 2017 Elsevier Inc. All rights reserved.

Mechanism of replication of ultraviolet-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli. Implications for SOS mutagenesis

International Nuclear Information System (INIS)

Livneh, Z.

1986-01-01

Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed

Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

Science.gov (United States)

Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

2001-08-15

Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

Directory of Open Access Journals (Sweden)

Claudia Huber

Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

Specific single-cell isolation and genomic amplification of uncultured microorganisms

DEFF Research Database (Denmark)

Kvist, Thomas; Ahring, Birgitte Kiær; Lasken, R.S.

2007-01-01

We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group-specific pri......We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group......-specific primers in combination with a terminal restriction fragment length polymorphism profile. Intact cells were extracted from the environmental sample, and fluorescent in situ hybridization probing with Cy3-labeled probes designed from the clone library was subsequently used to detect the organisms...... of interest. Single cells with a bright fluorescent signal were isolated using a micromanipulator and the genome of the single isolated cells served as a template for multiple displacement amplification (MDA) using the Phi29 DNA polymerase. The generated MDA product was afterwards used for 16S rRNA gene...

Chemical fidelity of an RNA polymerase ribozyme

DEFF Research Database (Denmark)

Attwater, J.; Tagami, S.; Kimoto, M.

2013-01-01

for function. Here we have explored the chemical fidelity, i.e. substrate selectivity and specificity for both single and multiple catalytic steps of the Z RNA polymerase ribozyme-a modern day analogue of the primordial RNA replicase. Using a wide range of nucleotide analogues and ionic conditions, we observe......The emergence of catalytically active RNA enzymes (ribozymes) is widely believed to have been an important transition in the origin of life. In the context of a likely heterogeneous chemical environment, substrate specificity and selectivity of these primordial enzymes would have been critical...

Single-Sided Natural Ventilation through a Velux Roof Window

DEFF Research Database (Denmark)

Li, Zhigang; Nielsen, Peter Vilhelm; Fransson, J.

2004-01-01

This paper investigates the single-sided natural ventilation through a VELUX centre pivot roof window under natural weather conditions. The aim of the investigation is to develop an empirical formulation for air flow rate through a roof window based on CFD and tracer gas decay measurement methods...

Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

Science.gov (United States)

Pierce, Kenneth E; Wangh, Lawrence J

2007-01-01

Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

Investigation of specific interactions between T7 promoter and T7 RNA polymerase by force spectroscopy using atomic force microscope.

Science.gov (United States)

Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong

2018-01-11

The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Single side damage simulations and detection in beam-like structures

International Nuclear Information System (INIS)

Zhou, Yun-Lai; Perera, R; Wahab, M Abdel; Maia, N; Sampaio, R; Figueiredo, E

2015-01-01

Beam-like structures are the most common components in real engineering, while single side damage is often encountered. In this study, a numerical analysis of single side damage in a free-free beam is analysed with three different finite element models; namely solid, shell and beam models for demonstrating their performance in simulating real structures. Similar to experiment, damage is introduced into one side of the beam, and natural frequencies are extracted from the simulations and compared with experimental and analytical results. Mode shapes are also analysed with modal assurance criterion. The results from simulations reveal a good performance of the three models in extracting natural frequencies, and solid model performs better than shell while shell model performs better than beam model under intact state. For damaged states, the natural frequencies captured from solid model show more sensitivity to damage severity than shell model and shell model performs similar to the beam model in distinguishing damage. The main contribution of this paper is to perform a comparison between three finite element models and experimental data as well as analytical solutions. The finite element results show a relatively well performance. (paper)

Calculation methods for single-sided natural ventilation - simplified or detailed?

DEFF Research Database (Denmark)

Larsen, Tine Steen; Plesner, Christoffer; Leprince, Valérie

2016-01-01

A great energy saving potential lies within increased use of natural ventilation, not only during summer and midseason periods, where it is mainly used today, but also during winter periods, where the outdoor air holds a great cooling potential for ventilative cooling if draft problems can...... be handled. This paper presents a newly developed simplified calculation method for single-sided natural ventilation, which is proposed for the revised standard FprEN 16798-7 (earlier EN 15242:2007) for design of ventilative cooling. The aim for predicting ventilative cooling is to find the most suitable......, while maintaining an acceptable correlation with measurements on average and the authors consider the simplified calculation method well suited for the use in standards such as FprEN 16798-7 for the ventilative cooling effects from single-sided natural ventilation The comparison of different design...

Replication of UV-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli: evidence for bypass of pyrimidine photodimers

International Nuclear Information System (INIS)

Livneh, Z.

1986-01-01

Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC 2.7.7.6) and DNA polymerase III holoenzyme (EC 2.7.7.7) in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins

Single-sided magnetic resonance profiling in biological and materials science.

Science.gov (United States)

Danieli, Ernesto; Blümich, Bernhard

2013-04-01

Single-sided NMR was inspired by the oil industry that strived to improve the performance of well-logging tools to measure the properties of fluids confined downhole. This unconventional way of implementing NMR, in which stray magnetic and radio frequency fields are used to recover information of arbitrarily large objects placed outside the magnet, motivated the development of handheld NMR sensors. These devices have moved the technique to different scientific disciplines. The current work gives a review of the most relevant magnets and methodologies developed to generate NMR information from spatially localized regions of samples placed in close proximity to the sensors. When carried out systematically, such measurements lead to 'single-sided depth profiles' or one-dimensional images. This paper presents recent and most relevant applications as well as future perspectives of this growing branch of MRI. Copyright © 2012 Elsevier Inc. All rights reserved.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

Science.gov (United States)

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

International Nuclear Information System (INIS)

Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.

1988-01-01

The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

How to switch the motor on: RNA polymerase initiation steps at the single-molecule level

NARCIS (Netherlands)

Marchetti, M.; Malinowska, A.; Heller, I.; Wuite, G. J. L.

RNA polymerase (RNAP) is the central motor of gene expression since it governs the process of transcription. In prokaryotes, this holoenzyme is formed by the RNAP core and a sigma factor. After approaching and binding the specific promoter site on the DNA, the holoenzyme-promoter complex undergoes

α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

Directory of Open Access Journals (Sweden)

Olivier Martínez

Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

Science.gov (United States)

Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

2018-05-01

Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

Structure and function of DNA polymerase μ

International Nuclear Information System (INIS)

Matsumoto, Takuro; Maezawa, So

2013-01-01

DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

Nanomedicinal products: a survey on specific toxicity and side effects

Directory of Open Access Journals (Sweden)

Brand W

2017-08-01

Full Text Available Walter Brand,1,* Cornelle W Noorlander,1,* Christina Giannakou,2,3 Wim H De Jong,2 Myrna W Kooi,1 Margriet VDZ Park,2 Rob J Vandebriel,2 Irene EM Bosselaers,4 Joep HG Scholl,5 Robert E Geertsma2 1Centre for Safety of Substances and Products, 2Centre for Health Protection, National Institute for Public Health and the Environment (RIVM, Bilthoven, 3Department of Toxicogenomics, Maastricht University, Maastricht, 4Section Pharmacology, Toxicology and Pharmacokinetics, Medicines Evaluation Board (CBG-MEB, Utrecht, 5Research & Analysis Department, Netherlands Pharmacovigilance Centre Lareb, ‘s-Hertogenbosch, the Netherlands *These authors contributed equally to this work Abstract: Due to their specific properties and pharmacokinetics, nanomedicinal products (NMPs may present different toxicity and side effects compared to non-nanoformulated, conventional medicines. To facilitate the safety assessment of NMPs, we aimed to gain insight into toxic effects specific for NMPs by systematically analyzing the available toxicity data on approved NMPs in the European Union. In addition, by comparing five sets of products with the same active pharmaceutical ingredient (API in a conventional formulation versus a nanoformulation, we aimed to identify any side effects specific for the nano aspect of NMPs. The objective was to investigate whether specific toxicity could be related to certain structural types of NMPs and whether a nanoformulation of an API altered the nature of side effects of the product in humans compared to a conventional formulation. The survey of toxicity data did not reveal nanospecific toxicity that could be related to certain types of structures of NMPs, other than those reported previously in relation to accumulation of iron nanoparticles (NPs. However, given the limited data for some of the product groups or toxicological end points in the analysis, conclusions with regard to (a lack of potential nanomedicine-specific effects need to be

Cochlear implant effectiveness in postlingual single-sided deaf individuals: what's the point?

Science.gov (United States)

Finke, Mareike; Bönitz, Hanna; Lyxell, Björn; Illg, Angelika

2017-06-01

By extending the indication criteria for cochlear implants (CI), the population of CI candidates increased in age, as well as range and type of hearing loss. This qualitative study identified factors that contributed to seek CI treatment in single-sided deaf individuals and gained insights how single-sided deafness (SSD) and hearing with a CI affect their lives. An open-ended questionnaire and a standardised inventory (IOI-HA) were used. Qualitative data reflecting the reasons to seek CI treatment and the individual experiences after CI switch-on were collected. A total of 19 postlingually deafened single-sided deaf CI users. Participants use their CI daily and stated that their life satisfaction increased since CI activation. The analysis of the qualitative data revealed four core categories: sound localisation, tinnitus and noise sensitivity, fear to lose the second ear and quality of life. Our results show how strongly and diversely quality of hearing and quality of life is affected by acquired SSD and improved after CI activation. Our data suggest that the fear of hearing loss (HL) on the normal hearing (NH) ear is an important but so far neglected reason to seek treatment with a CI in individuals with postlingual SSD.

DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

Directory of Open Access Journals (Sweden)

Cheng-Yao eChen

2014-06-01

Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

Energy Technology Data Exchange (ETDEWEB)

Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

2009-07-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

International Nuclear Information System (INIS)

Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

2009-01-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus.

Science.gov (United States)

De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M

1999-08-06

Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.

The essential DNA polymerases δ and ε are involved in repair of UV-damaged DNA in the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Halas, A.; Policinska, Z.; Baranowska, H.; Jachymczyk, W.J.

1999-01-01

We have studied the ability of yeast DNA polymerases to carry out repair of lesions caused by UV irradiation in Saccharomyces cerevisiae. By the analysis of postirradiation relative molecular mass changes in cellular DNA of different DNA polymerases mutant strains, it was established that mutations in DNA polymerases δ and ε showed accumulation of single-strand breaks indicating defective repair. Mutations in other DNA polymerase genes exhibited no defects in DNA repair. Thus, the data obtained suggest that DNA polymerases δ and ε are both necessary for DNA replication and for repair of lesions caused by UV irradiation. The results are discussed in the light of current concepts concerning the specificity of DNA polymerases in DNA repair. (author)

Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

Science.gov (United States)

Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

2013-06-01

Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

Analytical and numerical study concerning the behaviour of single-sided bonded patch repairs

Directory of Open Access Journals (Sweden)

Gheorghi OPATCHI

2011-06-01

Full Text Available Adhesive bonded joints are used in the assembling of structural parts, especially of those which are made from dissimilar materials. Lightweight fibre reinforced polymer composites and other adhesive bonded components represent a major proportion of a modern aircraft. Bonded patch repair technology has been widely used to repair cracked thin-walled structures to extend their service life, because a correctly executed repair significantly enhances the structural performance.In practice, the single-sided bonded patch repair is the most used because a good solution like the double-sided repair may not be an option if the access to the structure is only available from one side.This paper presents a relatively simple and effective design procedure for the single strapped bonded joints. Also, the influence of various geometrical parameters of the joint is evaluated. The analytical development is validated based on nonlinear finite element analyses.

A single-sided representation for the homogeneous Green's function of a unified scalar wave equation.

Science.gov (United States)

Wapenaar, Kees

2017-06-01

A unified scalar wave equation is formulated, which covers three-dimensional (3D) acoustic waves, 2D horizontally-polarised shear waves, 2D transverse-electric EM waves, 2D transverse-magnetic EM waves, 3D quantum-mechanical waves and 2D flexural waves. The homogeneous Green's function of this wave equation is a combination of the causal Green's function and its time-reversal, such that their singularities at the source position cancel each other. A classical representation expresses this homogeneous Green's function as a closed boundary integral. This representation finds applications in holographic imaging, time-reversed wave propagation and Green's function retrieval by cross correlation. The main drawback of the classical representation in those applications is that it requires access to a closed boundary around the medium of interest, whereas in many practical situations the medium can be accessed from one side only. Therefore, a single-sided representation is derived for the homogeneous Green's function of the unified scalar wave equation. Like the classical representation, this single-sided representation fully accounts for multiple scattering. The single-sided representation has the same applications as the classical representation, but unlike the classical representation it is applicable in situations where the medium of interest is accessible from one side only.

Truck side guard specifications : recommended standard

Science.gov (United States)

2016-09-01

This document is intended to be used by (1) public or private medium/heavy-duty truck fleets considering adding side guards; (2) jurisdictions or customers that require side guards through policy or procurement; (3) manufacturers of side guards; and ...

Right Ear Advantage of Speech Audiometry in Single-sided Deafness.

Science.gov (United States)

Wettstein, Vincent G; Probst, Rudolf

2018-04-01

Postlingual single-sided deafness (SSD) is defined as normal hearing in one ear and severely impaired hearing in the other ear. A right ear advantage and dominance of the left hemisphere are well established findings in individuals with normal hearing and speech processing. Therefore, it seems plausible that a right ear advantage would exist in patients with SSD. The audiometric database was searched to identify patients with SSD. Results from the German monosyllabic Freiburg word test and four-syllabic number test in quiet were evaluated. Results of right-sided SSD were compared with left-sided SSD. Statistical calculations were done with the Mann-Whitney U test. Four hundred and six patients with SSD were identified, 182 with right-sided and 224 with left-sided SSD. The two groups had similar pure-tone thresholds without significant differences. All test parameters of speech audiometry had better values for right ears (SSD left) when compared with left ears (SSD right). Statistically significant results (p right and 97.5 ± 4.7% left, p right and 93.9 ± 9.1% left, p right and 63.8 ± 11.1 dB SPL left, p right ear advantage of speech audiometry was found in patients with SSD in this retrospective study of audiometric test results.

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

Science.gov (United States)

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Mohammad Rubayet Hasan

2014-01-01

Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

Single molecule imaging of RNA polymerase II using atomic force microscopy

International Nuclear Information System (INIS)

Rhodin, Thor; Fu Jianhua; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzi; Ishikawa, Mitsuru

2003-01-01

An atomic force microscopy (AFM) study of the shape, orientation and surface topology of RNA polymerase II supported on silanized freshly cleaved mica was made. The overall aim is to define the molecular topology of RNA polymerase II in appropriate fluids to help clarify the relationship of conformational features to biofunctionality. A Nanoscope III atomic force microscope was used in the tapping mode with oxide-sharpened (8-10 nm) Si 3 N 4 probes in aqueous zinc chloride buffer. The main structural features observed by AFM were compared to those derived from electron-density plots based on X-ray crystallographic studies. The conformational features included a bilobal silhouette with an inverted umbrella-shaped crater connected to a reaction site. These studies provide a starting point for constructing a 3D-AFM profiling analysis of proteins such as RNA polymerase complexes

Hydrodynamics of magnetizable suspensions in a traveling magnetic field of a single-sided inductor

International Nuclear Information System (INIS)

Maiorov, M.M.; Tsebers, A.O.

1979-01-01

A few qualitative tests are described which validate the basic concepts about the behavior of magnetic fluids in a traveling field of a single-sided inductor. In the experiment small droplets of a magnetic fluid were deposited on both sides of a transparent plate. With the traveling field turned on, one could observe the motion of these droplets in opposite directions: the droplets on the inductor side of the plate moving in the direction of the traveling field. This pattern of motion can be explained by the action of antisymmetric stresses due to rotation of ferromagnetic particles, in the traveling field, on the surface of a droplet. On the basis of present results, it is concluded that accounting for the antisymmetric stresses in the selection of an adequate model of magnetic relaxation makes it possible to correctly describe the motion of a magnetic fluid in a traveling field of a single-sided inductor. An adequate model for describing the motion of a colloidal suspension of cobalt ferrite is magnetic relaxation of rigid dipoles. 10 refs

A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

Science.gov (United States)

Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

2009-11-01

Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

KAUST Repository

Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.

2010-01-01

The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

KAUST Repository

Ghosh, Sharmistha

2010-04-06

The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

Science.gov (United States)

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

2009-10-30

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

Science.gov (United States)

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

2009-01-01

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

Universal quantum gates on electron-spin qubits with quantum dots inside single-side optical microcavities.

Science.gov (United States)

Wei, Hai-Rui; Deng, Fu-Guo

2014-01-13

We present some compact quantum circuits for a deterministic quantum computing on electron-spin qubits assisted by quantum dots inside single-side optical microcavities, including the CNOT, Toffoli, and Fredkin gates. They are constructed by exploiting the giant optical Faraday rotation induced by a single-electron spin in a quantum dot inside a single-side optical microcavity as a result of cavity quantum electrodynamics. Our universal quantum gates have some advantages. First, all the gates are accomplished with a success probability of 100% in principle. Second, our schemes require no additional electron-spin qubits and they are achieved by some input-output processes of a single photon. Third, our circuits for these gates are simple and economic. Moreover, our devices for these gates work in both the weak coupling and the strong coupling regimes, and they are feasible in experiment.

Two against one - a case for single-sided films

International Nuclear Information System (INIS)

Dixon, L.

1979-01-01

The disadvantages of double-sided X-ray film include parallax between the double images where the film is angled to the central ray, and a cross-over effect where light from the front screen affects the back emulsion and vice versa. An investigation of the percentage of the total film density due to cross-over showed the effect varied from 28% to 47%, increasing with total density and faster screens. Kilovoltage had little influence on the effect. A single emulsion film with one screen gave an appreciable increase in radiographic sharpness and definition but required an increase by about 2.5 times in the exposure required. A very fast screen overcame this effect without comparable loss of detail. The use of single emulsion films should also reduce the thickness of cut and therefore improve sharpness in tomography. (UK)

Genotyping of Trypanosoma cruzi Sublineage in Human Samples from a North-East Argentina Area by Hybridization with DNA Probes and Specific Polymerase Chain Reaction (PCR)

Science.gov (United States)

Diez, Cristina; Lorenz, Virginia; Ortiz, Silvia; Gonzalez, Verónica; Racca, Andrea; Bontempi, Iván; Manattini, Silvia; Solari, Aldo; Marcipar, Iván

2010-01-01

We have evaluated blood samples of chronic and congenital Trypanosoma cruzi-infected patients from the city of Reconquista located in the northeast of Argentina where no information was previously obtained about the genotype of infecting parasites. Fourteen samples of congenital and 19 chronical patients were analyzed by hybridization with DNA probes of minicircle hypervariable regions (mHVR). In congenital patients, 50% had single infections with TcIId, 7% single infections with TcIIe, 29% mixed infections with TcIId/e, and 7% had mixed infections with TcIId/b and 7% TcIId/b, respectively. In Chronical patients, 52% had single infections with TcIId, 11% single infections with TcIIe, 26% had mixed infections with TcIId/e, and 11% had non-identified genotypes. With these samples, we evaluated the minicircle lineage-specific polymerase chain reaction assay (MLS-PCR), which involves a nested PCR to HVR minicircle sequences and we found a correlation with hybridization probes of 96.4% for TcIId and 54.8% for TcIIe. PMID:20064998

Single-step simultaneous side-by-side placement of a self-expandable metallic stent with a 6-Fr delivery system for unresectable malignant hilar biliary obstruction: a feasibility study.

Science.gov (United States)

Kawakubo, Kazumichi; Kawakami, Hiroshi; Kuwatani, Masaki; Kudo, Taiki; Abe, Yoko; Kawahata, Shuhei; Kubo, Kimitoshi; Kubota, Yoshimasa; Sakamoto, Naoya

2015-02-01

Bilateral self-expandable metallic stent (SEMS) placement for the management of unresectable malignant hilar biliary obstruction (UMHBO) is technically challenging to perform using the existing metallic stents with thick delivery systems. The recently developed 6-Fr delivery systems could facilitate a single-step simultaneous side-by-side placement through the accessory channel of the duodenoscope. The aim of this study was to evaluate the feasibility of this procedure. Between May and September 2013, 13 consecutive patients with UMHBO underwent a single-step simultaneous side-by-side placement of SEMS with the 6-Fr delivery system. The technical success rate, stent patency, and rate of complications were evaluated from the prospectively collected database. Technical success was achieved in 11 (84.6%, 95% confidence interval [CI]: 57.8-95.8) patients. The median procedure time was 25 min. Early and late complications were observed in 23% (one segmental cholangitis and two liver abscesses) and 15% (one segmental cholangitis and one cholecystitis) patients, respectively. Median dysfunction free patency was 263 days (95% CI: 37-263). Five patients (38%) experienced stent occlusion that was successfully managed by endoscopic stent placement. A single-step simultaneous side-by-side placement of SEMS with a 6-Fr delivery system was feasible for the management of UMHBO. © 2014 Japanese Society of Hepato-Biliary-Pancreatic Surgery.

Cochlear Implantation and Single-sided Deafness: A Systematic Review of the Literature

Directory of Open Access Journals (Sweden)

Cabral Junior, Francisco

2015-07-01

Full Text Available Introduction Current data show that binaural hearing is superior to unilateral hearing, specifically in the understanding of speech in noisy environments. Furthermore, unilateral hearing reduce onés ability to localize sound. Objectives This study provides a systematic review of recent studies to evaluate the outcomes of cochlear implantation in patients with single-sided deafness (SSD with regards to speech discrimination, sound localization and tinnitus suppression. Data Synthesis We performed a search in the PubMed, Cochrane Library and Lilacs databases to assess studies related to cochlear implantation in patients with unilateral deafness. After critical appraisal, eleven studies were selected for data extraction and analysis of demographic, study design and outcome data. Conclusion Although some studies have shown encouraging results on cochlear implantation and SSD, all fail to provide a high level of evidence. Larger studies are necessary to define the tangible benefits of cochlear implantation in patients with SSD.

Magnetic resonance elastometry using a single-sided permanent magnet

International Nuclear Information System (INIS)

Tan, Carl S; Marble, Andrew E; Ono, Yuu

2012-01-01

In this paper, we describe a magnetic resonance method of measuring material elasticity using a single-sided magnet with a permanent static field gradient. This method encodes sample velocity in a reciprocal space using Hahn spin-echoes with variable timing. The experimental results show a strong correlation between magnetic resonance signal attenuation and elasticity when an oscillating force is applied on the sample. This relationship in turn provides us with information about the displacement velocity experienced by the sample, which is inversely proportional to Young's modulus. The proposed method shows promise in offering a portable and cost-effective magnetic resonance elastography system. (paper)

Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges

Science.gov (United States)

Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

2016-01-01

Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830

An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection

International Nuclear Information System (INIS)

Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping

2017-01-01

Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)

The evaluation-mediation hypothesis: does the specification of potential side effects influence the perceived risk of medication?

International Nuclear Information System (INIS)

Reimer, T.

1998-01-01

Full text of publication follows: starting from the assumptions of support theory, this project analyzed the extent to which the specification of potential side effects influences the perceived risk associated, with a particular medication. Respondents were presented with an instruction leaflet for a medication which indicated (a) the overall probability that a side effect will occur or (b) the probability of occurrence of several specific side effects. Support theory predicts that the cognitive availability of potential side effects and therefore the perceived risk increases as a function of the specificity with which the side effects are presented. In contrast the evaluation-mediation hypothesis predicts that a more detailed presentation of potential side effects enhances the perceived quality of the information leaflet and thereby leads to a reduction of perceived risk. Support for the evaluation-mediation hypothesis was found in a series of studies which included the editing hypothesis and the elaboration likelihood model as additional explanations: the more detailed the information about potential side effects, the lower the estimated risk of suffering a side effect on taking the medication. As predicted, the influence of presentation specificity on perceived risk was mediated almost exclusively by the perceived quality of the information leaflet. A current series of studies seeks to support the evaluation-mediation hypothesis in a completely different domain, the perceived risk of environmental pollution by motor vehicles. (author)

Demand Side Management for the European Supergrid: Occupancy variances of European single-person households

International Nuclear Information System (INIS)

Torriti, Jacopo

2012-01-01

The prospect of a European Supergrid calls for research on aggregate electricity peak demand and Europe-wide Demand Side Management. No attempt has been made as yet to represent a time-related demand curve of residential electricity consumption at the European level. This article assesses how active occupancy levels of single-person households vary in single-person household in 15 European countries. It makes use of occupancy time-series data from the Harmonised European Time Use Survey database to build European occupancy curves; identify peak occupancy periods; construct time-related electricity demand curves for TV and video watching activities and assess occupancy variances of single-person households. - Highlights: ► Morning peak occupancies of European single households tale place between 7h30 and 7h40. ► Evening peaks take place between 20h10 and 20h20. ► TV and video activities during evening peaks make up about 3.1 GWh of European peak electricity load. ► Baseline and peak occupancy variances vary across countries. ► Baseline and peak occupancy variances can be used as input for Demand Side Management choices.

DNA polymerase I-mediated repair of 365 nm-induced single-strand breaks in the DNA of Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)

1978-03-01

Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.

Single-sided Nuclear Magnetic Resonance for condition monitoring of cross-linked polyethylene exposed to aggressive media

Energy Technology Data Exchange (ETDEWEB)

Adams, A., E-mail: Alina.Adams@itmc.rwth-aachen.de [Institut für Technische und Makromolekulare Chemie, RWTH Aachen University, Templergraben 55, 52056 Aachen (Germany); Piechatzek, A.; Schmitt, G. [Institut für Instandhaltung und Korrosionsschutztechnik gGmbH, Kalkofen 4, 58638 Iserlohn (Germany); Siegmund, G. [ExxonMobil Production Germany, Riethorst 12, 30659 Hannover (Germany)

2015-08-05

The potential of single-sided Nuclear Magnetic Resonance (NMR) to monitor truly non-invasive changes in polymer materials during aging under aggressive media is for the first time evaluated. For this, the NMR method is used in combination with other condition monitoring methods including mechanical measurements, mass uptake, and differential scanning calorimetry. It is validated by studying for the first time the aging kinetics of silane cross-linked polyethylene (PEX) exposed to media used in oil and gas production and transportation, including aliphatic and aromatic hydrocarbons, sulphur solvents, and corrosion inhibitors in combination with CO{sub 2} and H{sub 2}S. All investigated parameters changed, with the strongest effects detected for the NMR chain mobility and in the presence of hydrocarbons. Furthermore, a universal linear correlation curve could be established between the depression of the tensile strength and the chain mobility. This result represents a fundamental step towards establishing single-sided NMR as a new analytical tool for in situ condition monitoring of polyethylene working under sour conditions. The proposed approach can be easily extended to other polymer materials. - Highlights: • The changes in PEX exposed to sour media were quantified for the first time. • The strongest morphological changes in PEX were detected under exposure to hydrocarbon media. • The chain mobility measured truly non-destructively by single-sided NMR showed the highest sensitivity to the aging process. • A universal linear correlation curve was found between the chain mobility and the tensile strength. • Single-sided NMR was validated as a condition monitoring tool.

Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

Science.gov (United States)

Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

2014-01-01

Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

Directory of Open Access Journals (Sweden)

Mark J Hoser

Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

DNA polymerase preference determines PCR priming efficiency.

Science.gov (United States)

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

Strand Displacement by DNA Polymerase III Occurs through a τ-ψ-χ Link to Single-stranded DNA-binding Protein Coating the Lagging Strand Template*

OpenAIRE

Yuan, Quan; McHenry, Charles S.

2009-01-01

In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

Science.gov (United States)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

Beam Test Results for Single- and Double-Sided Silicon Detector Prototypes of the CMS Central Detector

CERN Document Server

Adriani, O

1997-01-01

We report the results of two beam tests performed in July and September 1995 at CERN using silicon microstrip detectors of various types: single sided, double sided with small angle stereo strips, double sided with orthogonal strips, double sided with pads. For the read-out electronics use was made of Preshape32, Premux128 and VA1 chips. The signal to noise ratio and the resolution of the detectors was studied for different incident angles of the incoming particles and for different values of the detector bias voltage. The goal of these tests was to check and improve the performances of the prototypes for the CMS Central Detector.

Prediction of Active Site and Distal Residues in E. coli DNA Polymerase III alpha Polymerase Activity.

Science.gov (United States)

Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J

2018-02-20

The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.

Single-sided sheet-to-tube spot welding investigated by 3D numerical simulations

DEFF Research Database (Denmark)

Nielsen, Chris Valentin; Chergui, Azeddine; Zhang, Wenqi

The single-sided resistance spot welding process is analyzed by a 3D numerical study of sheet-to-tube joining. Finite element simulations are carried out in SORPAS® 3D. Two levels of electrode force and five levels of welding current are simulated. The overall effects of changing current and force...

Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

Science.gov (United States)

Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

2017-09-27

Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

Backtracking dynamics of RNA polymerase: pausing and error correction

International Nuclear Information System (INIS)

Sahoo, Mamata; Klumpp, Stefan

2013-01-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)

Backtracking dynamics of RNA polymerase: pausing and error correction

Science.gov (United States)

Sahoo, Mamata; Klumpp, Stefan

2013-09-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

Science.gov (United States)

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Effect of γ-irradiated DNA on the activity of DNA polymerase

International Nuclear Information System (INIS)

Leadon, S.A.; Ward, J.F.

1981-01-01

A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation

Dual-function photonic integrated circuit for frequency octo-tupling or single-side-band modulation.

Science.gov (United States)

Hasan, Mehedi; Maldonado-Basilio, Ramón; Hall, Trevor J

2015-06-01

A dual-function photonic integrated circuit for microwave photonic applications is proposed. The circuit consists of four linear electro-optic phase modulators connected optically in parallel within a generalized Mach-Zehnder interferometer architecture. The photonic circuit is arranged to have two separate output ports. A first port provides frequency up-conversion of a microwave signal from the electrical to the optical domain; equivalently single-side-band modulation. A second port provides tunable millimeter wave carriers by frequency octo-tupling of an appropriate amplitude RF carrier. The circuit exploits the intrinsic relative phases between the ports of multi-mode interference couplers to provide substantially all the static optical phases needed. The operation of the proposed dual-function photonic integrated circuit is verified by computer simulations. The performance of the frequency octo-tupling and up-conversion functions is analyzed in terms of the electrical signal to harmonic distortion ratio and the optical single side band to unwanted harmonics ratio, respectively.

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

High-Resolution Phenotypic Landscape of the RNA Polymerase II Trigger Loop.

Directory of Open Access Journals (Sweden)

Chenxi Qiu

2016-11-01

Full Text Available The active sites of multisubunit RNA polymerases have a "trigger loop" (TL that multitasks in substrate selection, catalysis, and translocation. To dissect the Saccharomyces cerevisiae RNA polymerase II TL at individual-residue resolution, we quantitatively phenotyped nearly all TL single variants en masse. Three mutant classes, revealed by phenotypes linked to transcription defects or various stresses, have distinct distributions among TL residues. We find that mutations disrupting an intra-TL hydrophobic pocket, proposed to provide a mechanism for substrate-triggered TL folding through destabilization of a catalytically inactive TL state, confer phenotypes consistent with pocket disruption and increased catalysis. Furthermore, allele-specific genetic interactions among TL and TL-proximal domain residues support the contribution of the funnel and bridge helices (BH to TL dynamics. Our structural genetics approach incorporates structural and phenotypic data for high-resolution dissection of transcription mechanisms and their evolution, and is readily applicable to other essential yeast proteins.

RNA binding and replication by the poliovirus RNA polymerase

International Nuclear Information System (INIS)

Oberste, M.S.

1988-01-01

RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

Direct observation of backbone planarization via side-chain alignment in single bulky-substituted polythiophenes

Science.gov (United States)

Raithel, Dominic; Simine, Lena; Pickel, Sebastian; Schötz, Konstantin; Panzer, Fabian; Baderschneider, Sebastian; Schiefer, Daniel; Lohwasser, Ruth; Köhler, Jürgen; Thelakkat, Mukundan; Sommer, Michael; Köhler, Anna; Rossky, Peter J.; Hildner, Richard

2018-03-01

The backbone conformation of conjugated polymers affects, to a large extent, their optical and electronic properties. The usually flexible substituents provide solubility and influence the packing behavior of conjugated polymers in films or in bad solvents. However, the role of the side chains in determining and potentially controlling the backbone conformation, and thus the optical and electronic properties on the single polymer level, is currently under debate. Here, we investigate directly the impact of the side chains by studying the bulky-substituted poly(3-(2,5-dioctylphenyl)thiophene) (PDOPT) and the common poly(3-hexylthiophene) (P3HT), both with a defined molecular weight and high regioregularity, using low-temperature single-chain photoluminescence (PL) spectroscopy and quantum-classical simulations. Surprisingly, the optical transition energy of PDOPT is significantly (˜2,000 cm‑1 or 0.25 eV) red-shifted relative to P3HT despite a higher static and dynamic disorder in the former. We ascribe this red shift to a side-chain induced backbone planarization in PDOPT, supported by temperature-dependent ensemble PL spectroscopy. Our atomistic simulations reveal that the bulkier 2,5-dioctylphenyl side chains of PDOPT adopt a clear secondary helical structural motif and thus protect conjugation, i.e., enforce backbone planarity, whereas, for P3HT, this is not the case. These different degrees of planarity in both thiophenes do not result in different conjugation lengths, which we found to be similar. It is rather the stronger electronic coupling between the repeating units in the more planar PDOPT which gives rise to the observed spectral red shift as well as to a reduced calculated electron‑hole polarization.

Using the Hepatitis C Virus RNA-Dependent RNA Polymerase as a Model to Understand Viral Polymerase Structure, Function and Dynamics

Directory of Open Access Journals (Sweden)

Ester Sesmero

2015-07-01

Full Text Available Viral polymerases replicate and transcribe the genomes of several viruses of global health concern such as Hepatitis C virus (HCV, human immunodeficiency virus (HIV and Ebola virus. For this reason they are key targets for therapies to treat viral infections. Although there is little sequence similarity across the different types of viral polymerases, all of them present a right-hand shape and certain structural motifs that are highly conserved. These features allow their functional properties to be compared, with the goal of broadly applying the knowledge acquired from studying specific viral polymerases to other viral polymerases about which less is known. Here we review the structural and functional properties of the HCV RNA-dependent RNA polymerase (NS5B in order to understand the fundamental processes underlying the replication of viral genomes. We discuss recent insights into the process by which RNA replication occurs in NS5B as well as the role that conformational changes play in this process.

Optical bistability in a single-sided cavity coupled to a quantum channel

Science.gov (United States)

Payravi, M.; Solookinejad, Gh; Jabbari, M.; Nafar, M.; Ahmadi Sangachin, E.

2018-06-01

In this paper, we discuss the long wavelength optical reflection and bistable behavior of an InGaN/GaN quantum dot nanostructure coupled to a single-sided cavity. It is found that due to the presence of a strong coupling field, the reflection coefficient can be controlled at long wavelength, which is essential for adjusting the threshold of reflected optical bistability. Moreover, the phase shift features of the reflection pulse inside an electromagnetically induced transparency window are also discussed.

Single-sided natural ventilation driven by wind pressure and temperature difference

DEFF Research Database (Denmark)

Larsen, Tine Steen; Heiselberg, Per

2008-01-01

-scale wind tunnel experiments have been made with the aim of making a new expression for calculation of the airflow rate in single-sided natural ventilation. During the wind tunnel experiments it was found that the dominating driving force differs between wind speed and temperature difference depending......Even though opening a window for ventilation of a room seems very simple, the flow that occurs in this situation is rather complicated. The amount of air going through the window opening will depend on the wind speed near the building, the temperatures inside and outside the room, the wind...

Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

Science.gov (United States)

Wang, Yaqiong; Ma, Hong

2015-09-01

Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Polymerase chain reaction for the detection of Mycobacterium leprae

NARCIS (Netherlands)

Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

1989-01-01

A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

Design and experimental validation of Unilateral Linear Halbach magnet arrays for single-sided magnetic resonance.

Science.gov (United States)

Bashyam, Ashvin; Li, Matthew; Cima, Michael J

2018-07-01

Single-sided NMR has the potential for broad utility and has found applications in healthcare, materials analysis, food quality assurance, and the oil and gas industry. These sensors require a remote, strong, uniform magnetic field to perform high sensitivity measurements. We demonstrate a new permanent magnet geometry, the Unilateral Linear Halbach, that combines design principles from "sweet-spot" and linear Halbach magnets to achieve this goal through more efficient use of magnetic flux. We perform sensitivity analysis using numerical simulations to produce a framework for Unilateral Linear Halbach design and assess tradeoffs between design parameters. Additionally, the use of hundreds of small, discrete magnets within the assembly allows for a tunable design, improved robustness to variability in magnetization strength, and increased safety during construction. Experimental validation using a prototype magnet shows close agreement with the simulated magnetic field. The Unilateral Linear Halbach magnet increases the sensitivity, portability, and versatility of single-sided NMR. Copyright © 2018 Elsevier Inc. All rights reserved.

Transcriptional analysis of left-sided colitis, pancolitis, and ulcerative colitis-associated dysplasia

DEFF Research Database (Denmark)

Bjerrum, Jacob T; Nielsen, Ole H; Riis, Lene B

2014-01-01

to identify potential biomarkers and transcripts of importance for the carcinogenic behavior of chronic inflammation. METHODS: The Affymetrix GeneChip Human Genome U133 Plus 2.0 was applied on colonic biopsies from UC patients with left-sided UC, pancolitis, dysplasia, and controls. Reverse transcription...... polymerase chain reaction and immunohistochemistry were performed for validating selected transcripts in the initial cohort and in 2 independent cohorts of patients with UC. Microarray data were analyzed by principal component analysis, and reverse transcription polymerase chain reaction...... and immunohistochemistry data by the Wilcoxon's rank-sum test. RESULTS: The principal component analysis results revealed separate clusters for left-sided UC, pancolitis, dysplasia, and controls. Close clustering of dysplastic and pancolitic samples indicated similarities in gene expression. Indeed, 101 and 656 parallel...

The Impact of Single-Sided Deafness upon Music Appreciation.

Science.gov (United States)

Meehan, Sarah; Hough, Elizabeth A; Crundwell, Gemma; Knappett, Rachel; Smith, Mark; Baguley, David M

2017-05-01

Many of the world's population have hearing loss in one ear; current statistics indicate that up to 10% of the population may be affected. Although the detrimental impact of bilateral hearing loss, hearing aids, and cochlear implants upon music appreciation is well recognized, studies on the influence of single-sided deafness (SSD) are sparse. We sought to investigate whether a single-sided hearing loss can cause problems with music appreciation, despite normal hearing in the other ear. A tailored questionnaire was used to investigate music appreciation for those with SSD. We performed a retrospective survey of a population of 51 adults from a University Hospital Audiology Department SSD clinic. SSD was predominantly adult-onset sensorineural hearing loss, caused by a variety of etiologies. Analyses were performed to assess for statistical differences between groups, for example, comparing music appreciation before and after the onset of SSD, or before and after receiving hearing aid(s). Results demonstrated that a proportion of the population experienced significant changes to the way music sounded; music was found to sound more unnatural (75%), unpleasant (71%), and indistinct (81%) than before hearing loss. Music was reported to lack the perceptual qualities of stereo sound, and to be confounded by distortion effects and tinnitus. Such changes manifested in an altered music appreciation, with 44% of participants listening to music less often, 71% of participants enjoying music less, and 46% of participants reporting that music played a lesser role in their lives than pre-SSD. Negative effects surrounding social occasions with music were revealed, along with a strong preference for limiting background music. Hearing aids were not found to significantly ameliorate these effects. Results could be explained in part through considerations of psychoacoustic changes intrinsic to an asymmetric hearing loss and impaired auditory scene analysis. Given the prevalence of

Measurement of the Rise-Time in a Single Sided Ladder Detector

International Nuclear Information System (INIS)

Gerber, C.E.

1997-01-01

In this note we report on the measurement of the preamplifier output rise time for a SVXII chip mounted on a D0 single sided ladder. The measurements were performed on the ladder 001-883-L, using the laser test stand of Lab D. The rise time was measured for different values of the response (or bandwidth) of the preamplifier. As a bigger bandwidth results in longer rise times and therefore in less noise, the largest possible bandwidth consistent with the time between bunch crossings should be chosen to operate the detectors. The rise time is defined as the time elapsed between 10% and 90% of the charge is collected. It is also interesting to measure the time for full charge collection and the percentage of charge collected in 132 ns and 396 ns. The results are shown in table 1, for bandwidths between 2 and 63 (binary numbers). The uncertainty on the time measurement is considered to be ∼ 10 ns. Figure 1 schematically defines the four quantities measured: rise time, time of full charge collection, and percentage of charge collected in 132 ns and 396 ns. Figures 2 to 8 are the actual measurements for bandwidths of 2, 4, 8, 12, 24, 32 and 63. Figure 9 is a second measurement for BW=24, used as a consistency check of the system and the time measurement performed on the plots. The data indicate that the single sided ladders can be operated at BW=63 for 396 ns and BW=12 for 132 ns, achieving full charge collection. This will result in smaller noise than originally anticipated.

Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

International Nuclear Information System (INIS)

Plotch, S.J.; Palant, O.; Gluzman, Y.

1989-01-01

A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer, RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, [α- 32 P]UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro

Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

Science.gov (United States)

Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

2018-03-27

The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

Insight into the da Vinci® Xi - technical notes for single-docking left-sided colorectal procedures.

Science.gov (United States)

Ngu, James Chi-Yong; Sim, Sarah; Yusof, Sulaiman; Ng, Chee-Yung; Wong, Andrew Siang-Yih

2017-12-01

The adoption of robot-assisted laparoscopic colorectal surgery has been hampered by issues with docking, operative duration, technical difficulties in multi-quadrant access, and cost. The da Vinci® Xi has been designed to overcome some of these limitations. We describe our experience with the system and offer technical insights to its application in left-sided colorectal procedures. Our initial series of left-sided robotic colorectal procedures was evaluated. Patient demographics and operative outcomes were recorded prospectively using a predefined database. Between March 2015 and April 2016, 54 cases of robot-assisted laparoscopic left-sided colorectal procedures were successfully completed with no cases of conversion. The majority were low anterior resections for colorectal malignancies. Using the da Vinci® Xi Surgical System, multi-quadrant surgery involving dissection from the splenic flexure to the pelvis was possible without redocking. The da Vinci® Xi simplifies the docking procedure and makes single-docking feasible for multi-quadrant left-sided colorectal procedures. Copyright © 2016 John Wiley & Sons, Ltd.

Role of damage-specific DNA polymerases in M13 phage mutagenesis induced by a major lipid peroxidation product trans-4-hydroxy-2-nonenal

Energy Technology Data Exchange (ETDEWEB)

Janowska, Beata [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Kurpios-Piec, Dagmara [Department of Biochemistry, Medical University of Warsaw, Banacha 1, 02-097 Warsaw (Poland); Prorok, Paulina [Institute of Genetics and Biotechnology, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland); Szparecki, Grzegorz [Medical University of Warsaw, Zwirki i Wigury 61, 02-097 Warsaw (Poland); Komisarski, Marek [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Kowalczyk, Pawel [Interdisciplinary Centre for Mathematical and Computational Modelling, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland); Janion, Celina [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Tudek, Barbara, E-mail: tudek@ibb.waw.pl [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Institute of Genetics and Biotechnology, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland)

2012-01-03

One of the major lipid peroxidation products trans-4-hydroxy-2-nonenal (HNE), forms cyclic propano- or ethenoadducts bearing six- or seven-carbon atom side chains to G > C Much-Greater-Than A > T. To specify the role of SOS DNA polymerases in HNE-induced mutations, we tested survival and mutation spectra in the lacZ{alpha} gene of M13mp18 phage, whose DNA was treated in vitro with HNE, and which was grown in uvrA{sup -}Escherichia coli strains, carrying one, two or all three SOS DNA polymerases. When Pol IV was the only DNA SOS polymerase in the bacterial host, survival of HNE-treated M13 DNA was similar to, but mutation frequency was lower than in the strain containing all SOS DNA polymerases. When only Pol II or Pol V were present in host bacteria, phage survival decreased dramatically. Simultaneously, mutation frequency was substantially increased, but exclusively in the strain carrying only Pol V, suggesting that induction of mutations by HNE is mainly dependent on Pol V. To determine the role of Pol II and Pol IV in HNE induced mutagenesis, Pol II or Pol IV were expressed together with Pol V. This resulted in decrease of mutation frequency, suggesting that both enzymes can compete with Pol V, and bypass HNE-DNA adducts in an error-free manner. However, HNE-DNA adducts were easily bypassed by Pol IV and only infrequently by Pol II. Mutation spectrum established for strains expressing only Pol V, showed that in uvrA{sup -} bacteria the frequency of base substitutions and recombination increased in relation to NER proficient strains, particularly mutations at adenine sites. Among base substitutions A:T {yields} C:G, A:T {yields} G:C, G:C {yields} A:T and G:C {yields} T:A prevailed. The results suggest that Pol V can infrequently bypass HNE-DNA adducts inducing mutations at G, C and A sites, while bypass by Pol IV and Pol II is error-free, but for Pol II infrequent.

The association of long-term treatment-related side effects with cancer-specific and general quality of life among prostate cancer survivors.

Science.gov (United States)

Davis, Kimberly M; Kelly, Scott P; Luta, George; Tomko, Catherine; Miller, Anthony B; Taylor, Kathryn L

2014-08-01

To examine the association between treatment-related side effects and cancer-specific and general quality of life (QOL) among long-term prostate cancer survivors. Within the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial, we conducted telephone interviews with prostate cancer survivors (N = 518) who were 5-10 years after diagnosis. We assessed demographic and clinical information, sexual, urinary, and bowel treatment-related side effects (Expanded Prostate Cancer Index Composite), cancer-specific QOL (Functional Assessment of Cancer Therapy--total score), and general QOL (the Medical Outcomes Study Short Form 12's physical and mental subscales). Participants were aged 74.6 years on average, primarily White (88.4%), and married (81.7%). Pearson correlation coefficients between the 3 treatment-related side effect domains (urinary, sexual, and bowel) and QOL ranged between 0.14 and 0.42 (P functioning and greater bowel side effects were independently associated with poorer cancer-specific QOL (P functions were also associated with poorer general QOL on the Medical Outcomes Study Short Form 12's physical component summary and mental component summary (P side effects demonstrated the strongest association with all QOL outcomes. Treatment-related side effects persisted for up to 10 years after diagnosis and continued to be associated with men's QOL. These results suggest that each of the treatment-related side effects was independently associated with cancer-specific QOL. Compared with the other Expanded Prostate Cancer Index Composite domains, bowel side effects had the strongest association with cancer-specific and general QOL. These associations emphasize the tremendous impact that bowel side effects continue to have for men many years after their initial diagnosis. Copyright © 2014. Published by Elsevier Inc.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

Science.gov (United States)

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Competition between replicative and translesion polymerases during homologous recombination repair in Drosophila.

Directory of Open Access Journals (Sweden)

Daniel P Kane

Full Text Available In metazoans, the mechanism by which DNA is synthesized during homologous recombination repair of double-strand breaks is poorly understood. Specifically, the identities of the polymerase(s that carry out repair synthesis and how they are recruited to repair sites are unclear. Here, we have investigated the roles of several different polymerases during homologous recombination repair in Drosophila melanogaster. Using a gap repair assay, we found that homologous recombination is impaired in Drosophila lacking DNA polymerase zeta and, to a lesser extent, polymerase eta. In addition, the Pol32 protein, part of the polymerase delta complex, is needed for repair requiring extensive synthesis. Loss of Rev1, which interacts with multiple translesion polymerases, results in increased synthesis during gap repair. Together, our findings support a model in which translesion polymerases and the polymerase delta complex compete during homologous recombination repair. In addition, they establish Rev1 as a crucial factor that regulates the extent of repair synthesis.

Kinetic mechanism of DNA polymerase I (Klenow)

International Nuclear Information System (INIS)

Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.

1987-01-01

The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

Science.gov (United States)

Cline, J; Braman, J C; Hogrefe, H H

1996-09-15

The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

Diode-side-pumped 131 W, 1319 nm single-wavelength cw Nd:YAG laser.

Science.gov (United States)

Haiyong, Zhu; Ge, Zhang; Chenghui, Huang; Yong, Wei; Lingxiong, Huang; Jing, Chen; Weidong, Chen; Zhenqiang, Chen

2007-01-20

A diode-side-pumped high-power 1319 nm single-wavelength Nd:YAG continuous wave (cw) laser is described. Through reasonable coating design of the cavity mirrors, the 1064 nm strongest line as well as the 1338 nm one have been successfully suppressed. The laser output powers corresponding to four groups of different output couplers operating at 1319 nm single wavelength have been compared. The output coupler with the transmission T=5.3% has the highest output power, and a 131 W cw output power was achieved at the pumping power of 555 W. The optical-optical conversion efficiency is 23.6%, and the slope efficiency is 46%. The output power is higher than the total output power of the dual-wavelength laser operating at 1319 nm and 1338 nm in the experiment.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Double-Sided Single-Pass Submerged Arc Welding for 2205 Duplex Stainless Steel

Science.gov (United States)

Luo, Jian; Yuan, Yi; Wang, Xiaoming; Yao, Zongxiang

2013-09-01

The duplex stainless steel (DSS), which combines the characteristics of ferritic steel and austenitic steel, is used widely. The submerged arc welding (SAW) method is usually applied to join thick plates of DSS. However, an effective welding procedure is needed in order to obtain ideal DSS welds with an appropriate proportion of ferrite (δ) and austenite (γ) in the weld zone, particularly in the melted zone and heat-affected zone. This study evaluated the effectiveness of a high efficiency double-sided single-pass (DSSP) SAW joining method for thick DSS plates. The effectiveness of the converse welding procedure, characterizations of weld zone, and mechanical properties of welded joint are analyzed. The results show an increasing appearance and continuous distribution feature of the σ phase in the fusion zone of the leading welded seam. The converse welding procedure promotes the σ phase to precipitate in the fusion zone of leading welded side. The microhardness appears to significantly increase in the center of leading welded side. Ductile fracture mode is observed in the weld zone. A mixture fracture feature appears with a shear lip and tears in the fusion zone near the fusion line. The ductility, plasticity, and microhardness of the joints have a significant relationship with σ phase and heat treatment effect influenced by the converse welding step. An available heat input controlling technology of the DSSP formation method is discussed for SAW of thick DSS plates.

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

Science.gov (United States)

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

Science.gov (United States)

Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo

2007-09-01

The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

CDK9-dependent RNA polymerase II pausing controls transcription initiation.

Science.gov (United States)

Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

2017-10-10

Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

Science.gov (United States)

Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

2011-03-01

The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

Host determinant residue lysine 627 lies on the surface of a discrete, folded domain of influenza virus polymerase PB2 subunit.

Directory of Open Access Journals (Sweden)

Franck Tarendeau

Full Text Available Understanding how avian influenza viruses adapt to human hosts is critical for the monitoring and prevention of future pandemics. Host specificity is determined by multiple sites in different viral proteins, and mutation of only a limited number of these sites can lead to inter-species transmission. Several of these sites have been identified in the viral polymerase, the best characterised being position 627 in the PB2 subunit. Efficient viral replication at the relatively low temperature of the human respiratory tract requires lysine 627 rather than the glutamic acid variant found systematically in avian viruses. However, the molecular mechanism by which any of these host specific sites determine host range are unknown, although adaptation to host factors is frequently evoked. We used ESPRIT, a library screening method, to identify a new PB2 domain that contains a high density of putative host specific sites, including residue 627. The X-ray structure of this domain (denoted the 627-domain exhibits a novel fold with the side-chain of Lys627 solvent exposed. The structure of the K627E mutated domain shows no structural differences but the charge reversal disrupts a striking basic patch on the domain surface. Five other recently proposed host determining sites of PB2 are also located on the 627-domain surface. The structure of the complete C-terminal region of PB2 comprising the 627-domain and the previously identified NLS-domain, which binds the host nuclear import factor importin alpha, was also determined. The two domains are found to pack together with a largely hydrophilic interface. These data enable a three-dimensional mapping of approximately half of PB2 sites implicated in cross-species transfer onto a single structural unit. Their surface location is consistent with roles in interactions with other viral proteins or host factors. The identification and structural characterization of these well-defined PB2 domains will help design

Specific Identification of Biomphalaria tenagophila and Biomphalaria occidentalis Populations by the Low Stringency Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Edina Rodrigues Pires

1997-01-01

Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive

Single Side Electrolytic In-Process Dressing (ELID) Grinding with Lapping Kinematics of Silicon Carbide

Science.gov (United States)

Khoshaim, Ahmed Bakr

The demand for Silicon Carbide ceramics (SiC) has increased significantly in the last decade due to its reliable physical and chemical properties. The silicon carbide is widely used for aerospace segments in addition to many uses in the industry. Sometimes, a single side grinding is preferable than conventional grinding, for it has the ability to produce flat ceramics. However, the manufacturing cost is still high because of the high tool wear and long machining time. Part of the solution is to use electrolytic in process dressing (ELID) to reduce the processing time. The study on ELID single side grinding of ceramics has never been attempted before. The study involves four variables with three levels each. One of the variables, which is the eccentricity, is being investigated for the first time on ceramics. A full factorial design, for both the surface roughness and material removal rate, guides to calculate mathematical models that can predict future results. Three grinding wheel mesh sizes are used. An investigation of the influence of different grain size on the results can then be evaluated. The kinematics of the process was studied based on eccentricity in order to optimize the pattern of the diamond grains. The experiment is performed with the assist of the proposed specialized ELID fluid, TRIM C270E.

DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction.

Science.gov (United States)

Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A

2014-01-01

The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

Factor C*, the specific initiation component of the mouse RNA polymerase I holoenzyme, is inactivated early in the transcription process.

OpenAIRE

Brun, R P; Ryan, K; Sollner-Webb, B

1994-01-01

Factor C* is the component of the RNA polymerase I holoenzyme (factor C) that allows specific transcriptional initiation on a factor D (SL1)- and UBF-activated rRNA gene promoter. The in vitro transcriptional capacity of a preincubated rDNA promoter complex becomes exhausted very rapidly upon initiation of transcription. This is due to the rapid depletion of C* activity. In contrast, C* activity is not unstable in the absence of transcription, even in the presence of nucleoside triphosphates ...

Progress with the single-sided module prototypes for the ATLAS tracker upgrade stave

CERN Document Server

Allport, P P; Wiik, L; Dressnandt, N; Matheson, J; Li, Z; Viehhauser, G; Gallop, B; Jones, T J; Dwuznik, M; Greenall, A; Eklund, L; Maddock, P; Pernecker, S; Wright, J; Puldon, D; Jakobs, K; Holt, R; Sevilla, S G; Koffeman, E; Dabrowski, W; Gilchriese, M; Wastie, R; Gibson, M; Robinson, D; Fadeyev, V; Gerling, M; Betancourt, C; Dawson, N; Bates, R; French, R; Kierstead, J; Anghinolfi, F; Weidberg, A; Martinez-McKinney, F; Paganis, S; Sutcliffe, P; Maunu, R; Newcomer, M; Weber, M; Parzefall, U; Clark, A; Colijn, A P; Xu, D; la Marra, D; Buttar, C; Grillo, A A; Schamberger, D; DeWilde, B; Poltorak, K; Affolder, A A; Tsionou, D; Hessey, N P; Casse, G; Fox, H; Ferrere, D; Villani, E G; Seiden, A; Tyndel, M; Sadrozinski, H F W; Wiimut, I; Carter, J R; Lacasta, C; Chilingarov, A; Santoyo, D; Lynn, D; Garcia, C; Haber, C H; Hommels, L B A; Dhawan, S; Lindgren, S; Farthouat, P; Nickerson, R; Chen, H; Kohler, M; Sattari, S; Civera, J V; McCarthy, R; Phillips, P; Unno, Y; Kaplon, J; Swientek, K; Wormald, M; Goodrick, M; Von Wilpert, J; Mahboubi, K

2011-01-01

The ATLAS experiment is preparing for the planned luminosity upgrade of the LHC (the super-luminous LHC or sLHC) with a programme of development for tracking able to withstand an order of greater magnitude radiation fluence and much greater hit occupancy rates than the current detector. This has led to the concept of an all-silicon tracker with an enhanced performance pixel-based inner region and short-strips for much of the higher radii. Both sub-systems employ many common technologies, including the proposed ``stave{''} concept for integrated cooling and support. For the short-strip region, use of this integrated stave concept requires single-sided modules mounted on either side of a thin central lightweight support. Each sensor is divided into four rows of 23.82 mm length strips; within each row, there are 1280 strips of 74.5 mu m pitch. Well over a hundred prototype sensors are being delivered by Hamamatsu Photonics (HPK) to Japan, Europe and the US. We present results of the first 20 chip ABCN25 ASIC hyb...

Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

Science.gov (United States)

Yu, Chuanhe; Gan, Haiyun

2017-01-01

ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications.

Directory of Open Access Journals (Sweden)

Rodrigo Jácome

Full Text Available The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, "fingertips" that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection.

Anti-tumor effects of dehydroaltenusin, a specific inhibitor of mammalian DNA polymerase α

International Nuclear Information System (INIS)

Maeda, Naoki; Kokai, Yasuo; Ohtani, Seiji; Sahara, Hiroeki; Kuriyama, Isoko; Kamisuki, Shinji; Takahashi, Shunya; Sakaguchi, Kengo; Sugawara, Fumio; Yoshida, Hiromi; Sato, Noriyuki; Mizushina, Yoshiyuki

2007-01-01

In the screening of selective inhibitors of eukaryotic DNA polymerases (pols), dehydroaltenusin was found to be an inhibitor of pol α from a fungus (Alternaria tennuis). We succeeded in chemically synthesizing dehydroaltenusin, and the compound inhibited only mammalian pol α with IC 50 value of 0.5 μM, and did not influence the activities of other replicative pols such as pols δ and ε, but also showed no effect on pol α activity from another vertebrate, fish, or from a plant species. Dehydroaltenusin also had no influence on the other pols and DNA metabolic enzymes tested. The compound also inhibited the proliferation of human cancer cells with LD 50 values of 38.0-44.4 μM. In an in vivo anti-tumor assay on nude mice bearing solid tumors of HeLa cells, dehydroaltenusin was shown to be a promising suppressor of solid tumors. Histopathological examination revealed that increased tumor necrosis and decreased mitotic index were apparently detected by the compound in vivo. Therefore, dehydroaltenusin could be of interest as not only a mammalian pol α-specific inhibitor, but also as a candidate drug for anti-cancer treatment

Non-destructive characterization of materials by single-sided NMR

International Nuclear Information System (INIS)

Goga, Nicolae-Octavian

2007-01-01

The experiments conducted in this work demonstrate the efficiency and sensitivity of single-sided NMR for investigating macromolecular materials on large time and length scales. Elastomers can readily be characterized by unilateral NMR of protons in terms of a variety of parameters, which correlate with the overall molecular mobility. In this way information about the cross-link density, state of cure and strain, the effects of aging and product heterogeneity can obtained. For these purposes, the NMR-MOUSE was used to optimize product development and to monitor product and production quality on-line. The sensor is also suitable for nondestructive probing of the mechanical deformation in cross-linked elastomers. A special magnet design that fits a stress-strain device has been used for complementary investigation of a series of different rubber stripes during mechanical testing. The profile NMR-MOUSE was found to be a unique tool for the characterization of changes induced by the UV irradiation in natural rubber. The aging profiles were interpreted for the first time based on a novel model in which the radiation absorption coefficient depends on the depth in the sample. (orig.)

Non-destructive characterization of materials by single-sided NMR

Energy Technology Data Exchange (ETDEWEB)

Goga, Nicolae-Octavian

2007-08-20

The experiments conducted in this work demonstrate the efficiency and sensitivity of single-sided NMR for investigating macromolecular materials on large time and length scales. Elastomers can readily be characterized by unilateral NMR of protons in terms of a variety of parameters, which correlate with the overall molecular mobility. In this way information about the cross-link density, state of cure and strain, the effects of aging and product heterogeneity can obtained. For these purposes, the NMR-MOUSE was used to optimize product development and to monitor product and production quality on-line. The sensor is also suitable for nondestructive probing of the mechanical deformation in cross-linked elastomers. A special magnet design that fits a stress-strain device has been used for complementary investigation of a series of different rubber stripes during mechanical testing. The profile NMR-MOUSE was found to be a unique tool for the characterization of changes induced by the UV irradiation in natural rubber. The aging profiles were interpreted for the first time based on a novel model in which the radiation absorption coefficient depends on the depth in the sample. (orig.)

Quantitative flow characteristics for side-by-side square cylinders via PIV

Directory of Open Access Journals (Sweden)

Dogan Sercan

2012-04-01

Full Text Available In this study, instantaneous and time-averaged flow structures downstream of the sharp-edged single and two and three side-by-side square cylinders (SCs immersed in a uniform open channel water flow were studied by a technique of particle image velocimetry (PIV. Experimental results of wake flow structures were presented for gap ratios (G/D in the range of 1.0”G/D”3.0 for Reynolds number values of 1050, 2450 and 3400. Flow structures depending on the square cylinder (SC configurations and Reynolds number were discussed. It has been found that the development of the vortex shedding as well as the flow structure were substantially altered for side-by-side SCs comparing to the single SC. Asymmetrical and biased wake structures were observed because of the jetlike flow between the SCs for two SCs cases for the gap ratio less than 2.0. Depending on the gap spacing between the SCs, the interaction results of time2 averaged vorticity, velocity vector field, Reynolds stress correlations and streamline patterns in the wake region form a distinguished flow structure. Strouhal numbers for the single square cylinder for 1050≤Re≤3400 are found in the range of 0.12-0.13. The present results have supported the previous works by providing detailed quantitative experimental information with PIV in the wake region of the SC and might be helpful for validation of numerical studies and designers.

Are There Mutator Polymerases?

Directory of Open Access Journals (Sweden)

Miguel Garcia-Diaz

2003-01-01

Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

Isolation and characterization of high affinity aptamers against DNA polymerase iota.

Science.gov (United States)

Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V

2012-02-01

Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

Molecular Etiology of Hereditary Single-Side Deafness

Science.gov (United States)

Kim, Shin Hye; Kim, Ah Reum; Choi, Hyun Seok; Kim, Min Young; Chun, Eun Hi; Oh, Seung-Ha; Choi, Byung Yoon

2015-01-01

Abstract Unilateral sensorineural hearing loss (USNHL)/single-side deafness (SSD) is a frequently encountered disability in children. The etiology of a substantial portion of USNHL/SSD still remains unknown, and genetic causes have not been clearly elucidated. In this study, the authors evaluated the heritability of USNHL/SSD. The authors sequentially recruited 50 unrelated children with SSD. For an etiologic diagnosis, we performed a rigorous review on the phenotypes of family members of all children and conducted, if necessary, molecular genetic tests including targeted exome sequencing of 129 deafness genes. Among the 50 SSD children cohort, the authors identify 4 (8%) unrelated SSD probands from 4 families (SH136, SB173, SB177, and SB199) with another hearing impaired family members. Notably, all 4 probands in our cohort with a familial history of SSD also have pigmentary abnormalities such as brown freckles or premature gray hair within first degree relatives, which may indicate that genes whose products are involved with pigmentary disorder could be candidates for heritable SSD. Indeed, SH136 and SB199 turned out to segregate a mutation in MITF and PAX3, respectively, leading to a molecular diagnosis of Waardenburg syndrome (WS). We report, for the first time in the literature, a significant heritability of pediatric SSD. There is a strong association between the heritability of USNHL/SSD and the pigmentary abnormality, shedding a new light on the understanding of the molecular basis of heritable USNHL/SSD. In case of children with congenital SSD, it would be mandatory to rigorously screen pigmentary abnormalities. WS should also be included in the differential diagnosis of children with USNHL/SSD, especially in a familial form. PMID:26512583

Residual strains and microstructure development in single and sequential double sided friction stir welds in RQT-701 steel

Energy Technology Data Exchange (ETDEWEB)

Barnes, S.J. [School of Materials, University of Manchester, Grosvenor Street, Manchester M1 7HS (United Kingdom)], E-mail: simon.barnes-2@manchester.ac.uk; Steuwer, A. [FaME38, ILL ESRF, 6 rue J.Horowitz, 38042 Grenoble, Cedex (France); University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom); Mahawish, S. [School of Materials, University of Manchester, Grosvenor Street, Manchester M1 7HS (United Kingdom); Johnson, R. [TWI Yorkshire, Wallis Way, Catcliffe, Rotherham S60 5TZ (United Kingdom); Withers, P.J. [School of Materials, University of Manchester, Grosvenor Street, Manchester M1 7HS (United Kingdom)

2008-09-25

Single and double sided partial penetration friction stir butt welds, in a rolled, quenched and tempered steel (RQT-701), were produced at The Welding Institute (TWI) under controlled process conditions. The residual strain distributions in the longitudinal and transverse directions have been measured using energy dispersive synchrotron X-ray diffraction. The measured strains were indicative of longitudinal tensile residual stresses at levels greater than the 0.2% yield stress of the parent metal in both the single and double pass welds. In both cases, the maximum tensile strain was found in the parent metal at the boundary of the heat affected zone (HAZ). Microstructural analysis of the welds was carried out using optical microscopy and hardness variations were also mapped across the weld-plate cross-section. The maximum hardness was observed in the mixed bainite/martensite structure of the weld nugget on the advancing side of the stir zone. The minimum hardness was observed in the HAZ.

Residual strains and microstructure development in single and sequential double sided friction stir welds in RQT-701 steel

International Nuclear Information System (INIS)

Barnes, S.J.; Steuwer, A.; Mahawish, S.; Johnson, R.; Withers, P.J.

2008-01-01

Single and double sided partial penetration friction stir butt welds, in a rolled, quenched and tempered steel (RQT-701), were produced at The Welding Institute (TWI) under controlled process conditions. The residual strain distributions in the longitudinal and transverse directions have been measured using energy dispersive synchrotron X-ray diffraction. The measured strains were indicative of longitudinal tensile residual stresses at levels greater than the 0.2% yield stress of the parent metal in both the single and double pass welds. In both cases, the maximum tensile strain was found in the parent metal at the boundary of the heat affected zone (HAZ). Microstructural analysis of the welds was carried out using optical microscopy and hardness variations were also mapped across the weld-plate cross-section. The maximum hardness was observed in the mixed bainite/martensite structure of the weld nugget on the advancing side of the stir zone. The minimum hardness was observed in the HAZ

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

A Single Sided Edge Marking Method for Detecting Pectoral Muscle in Digital Mammograms

Directory of Open Access Journals (Sweden)

G. Toz

2018-02-01

Full Text Available In the computer-assisted diagnosis of breast cancer, the removal of pectoral muscle from mammograms is very important. In this study, a new method, called Single-Sided Edge Marking (SSEM technique, is proposed for the identification of the pectoral muscle border from mammograms. 60 mammograms from the INbreast database were used to test the proposed method. The results obtained were compared for False Positive Rate, False Negative Rate, and Sensitivity using the ground truth values pre-determined by radiologists for the same images. Accordingly, it has been shown that the proposed method can detect the pectoral muscle border with an average of 95.6% sensitivity.

Allosteric inhibitors of Coxsackie virus A24 RNA polymerase.

Science.gov (United States)

Schein, Catherine H; Rowold, Diane; Choi, Kyung H

2016-02-15

Coxsackie virus A24 (CVA24), a causative agent of acute hemorrhagic conjunctivitis, is a prototype of enterovirus (EV) species C. The RNA polymerase (3D(pol)) of CVA24 can uridylylate the viral peptide linked to the genome (VPg) from distantly related EV and is thus, a good model for studying this reaction. Once UMP is bound, VPgpU primes RNA elongation. Structural and mutation data have identified a conserved binding surface for VPg on the RNA polymerase (3D(pol)), located about 20Å from the active site. Here, computational docking of over 60,000 small compounds was used to select those with the lowest (best) specific binding energies (BE) for this allosteric site. Compounds with varying structures and low BE were assayed for their effect on formation of VPgU by CVA24-3D(pol). Two compounds with the lowest specific BE for the site inhibited both uridylylation and formation of VPgpolyU at 10-20μM. These small molecules can be used to probe the role of this allosteric site in polymerase function, and may be the basis for novel antiviral compounds. Copyright © 2015 Elsevier Ltd. All rights reserved.

Consequences of Stimulus Type on Higher-Order Processing in Single-Sided Deaf Cochlear Implant Users.

Science.gov (United States)

Finke, Mareike; Sandmann, Pascale; Bönitz, Hanna; Kral, Andrej; Büchner, Andreas

2016-01-01

Single-sided deaf subjects with a cochlear implant (CI) provide the unique opportunity to compare central auditory processing of the electrical input (CI ear) and the acoustic input (normal-hearing, NH, ear) within the same individual. In these individuals, sensory processing differs between their two ears, while cognitive abilities are the same irrespectively of the sensory input. To better understand perceptual-cognitive factors modulating speech intelligibility with a CI, this electroencephalography study examined the central-auditory processing of words, the cognitive abilities, and the speech intelligibility in 10 postlingually single-sided deaf CI users. We found lower hit rates and prolonged response times for word classification during an oddball task for the CI ear when compared with the NH ear. Also, event-related potentials reflecting sensory (N1) and higher-order processing (N2/N4) were prolonged for word classification (targets versus nontargets) with the CI ear compared with the NH ear. Our results suggest that speech processing via the CI ear and the NH ear differs both at sensory (N1) and cognitive (N2/N4) processing stages, thereby affecting the behavioral performance for speech discrimination. These results provide objective evidence for cognition to be a key factor for speech perception under adverse listening conditions, such as the degraded speech signal provided from the CI. © 2016 S. Karger AG, Basel.

Single-Sided Deafness: Impact of Cochlear Implantation on Speech Perception in Complex Noise and on Auditory Localization Accuracy.

Science.gov (United States)

Döge, Julia; Baumann, Uwe; Weissgerber, Tobias; Rader, Tobias

2017-12-01

To assess auditory localization accuracy and speech reception threshold (SRT) in complex noise conditions in adult patients with acquired single-sided deafness, after intervention with a cochlear implant (CI) in the deaf ear. Nonrandomized, open, prospective patient series. Tertiary referral university hospital. Eleven patients with late-onset single-sided deafness (SSD) and normal hearing in the unaffected ear, who received a CI. All patients were experienced CI users. Unilateral cochlear implantation. Speech perception was tested in a complex multitalker equivalent noise field consisting of multiple sound sources. Speech reception thresholds in noise were determined in aided (with CI) and unaided conditions. Localization accuracy was assessed in complete darkness. Acoustic stimuli were radiated by multiple loudspeakers distributed in the frontal horizontal plane between -60 and +60 degrees. In the aided condition, results show slightly improved speech reception scores compared with the unaided condition in most of the patients. For 8 of the 11 subjects, SRT was improved between 0.37 and 1.70 dB. Three of the 11 subjects showed deteriorations between 1.22 and 3.24 dB SRT. Median localization error decreased significantly by 12.9 degrees compared with the unaided condition. CI in single-sided deafness is an effective treatment to improve the auditory localization accuracy. Speech reception in complex noise conditions is improved to a lesser extent in 73% of the participating CI SSD patients. However, the absence of true binaural interaction effects (summation, squelch) impedes further improvements. The development of speech processing strategies that respect binaural interaction seems to be mandatory to advance speech perception in demanding listening situations in SSD patients.

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Laboratory Performance of the Single-Sided E-A-R (registered trademark) Combat Arms Hearing Protective Earplug

Science.gov (United States)

2010-01-01

Research article / Article de recherche LABORATORY PERFORMANCE OF THE SINGLE-SIDED EAR® COMBAT ARMS HEARING PROTECTIVE EARPLUG Sharon M. Abel and...external microphones for enhanced L:. -communication-? ;‘ V SOMMAIRE. Le but de cet article est de comparer 1 effet du port de bouchons conventionnels a...MA. Bekesy audiometry and loudness balance testing. In: Katz, J, editor. Handbook of clinical audiology . 3rd ed. Williams & Wilkins: Baltimore; 1985

Real-time single-molecule tethered particle motion experiments reveal the kinetics and mechanisms of Cre-mediated site-specific recombination

Science.gov (United States)

Fan, Hsiu-Fang

2012-01-01

Tyrosine family recombinases (YRs) are widely utilized in genome engineering systems because they can easily direct DNA rearrangement. Cre recombinases, one of the most commonly used types of YRs, catalyze site-specific recombination between two loxP sites without the need for high-energy cofactors, other accessory proteins or a specific DNA target sequence between the loxP sites. Previous structural, analytical ultracentrifuge and electrophoretic analyses have provided details of the reaction kinetics and mechanisms of Cre recombinase activity; whether there are reaction intermediates or side pathways involved has been left unaddressed. Using tethered particle motion (TPM), the Cre-mediated site-specific recombination process has been delineated, from beginning to end, at the single-molecule level, including the formation of abortive complexes and wayward complexes blocking inactive nucleoprotein complexes from entering the recombination process. Reversibility in the strand-cleavage/-ligation process and the formation of a thermally stable Holliday junction intermediate were observed within the Cre-mediated site-specific recombination process. Rate constants for each elementary step, which explain the overall reaction outcomes under various conditions, were determined. Taking the findings of this study together, they demonstrate the potential of single-molecule methodology as an alternative approach for exploring reaction mechanisms in detail. PMID:22467208

Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

Energy Technology Data Exchange (ETDEWEB)

Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)

1977-03-02

DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

International Nuclear Information System (INIS)

Dorson, J.W.; Moses, R.E.

1978-01-01

DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

Science.gov (United States)

Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

2014-07-15

In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.

Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

International Nuclear Information System (INIS)

Piette, J.; Hearst, J.

1985-01-01

Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta.

Science.gov (United States)

Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N

2004-07-16

A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

Whole field strain measurement in critical thin adhesive layer of single- and double-sided repaired CFRP panel using DIC

Science.gov (United States)

Kashfuddoja, Mohammad; Ramji, M.

2015-03-01

In the present work, the behavior of thin adhesively layer in patch repaired carbon fiber reinforced polymer (CFRP) panel under tensile load is investigated experimentally using digital image correlation (DIC) technique. The panel is made of Carbon/epoxy composite laminate and the stacking sequence in the panel is [0º]4. A circular hole of 10 mm diameter (d) is drilled at the center of the panel to mimic the case of low velocity impact damage removal. The panel with open hole is repaired with double sided (symmetrical) and single sided (unsymmetrical) rectangular patch made of same panel material having stacking sequence of [0º]3. Araldite 2011 is used for bonding the patch onto the panel over the damaged area. The global behavior of thin adhesive layer is examined by analyzing whole field strain distribution using DIC. Longitudinal, peel and shear strain field in both double and single sided repair configuration is studied and a compression is made between them. An estimate of shear transfer length which is an essential parameter in arriving at an appropriate overlap length in patch design is proposed from DIC and FEA. Damage development, failure mechanism and load displacement behavior is also investigated. The experimental results are compared with the numerical predictions.

A single-sided homogeneous Green's function representation for holographic imaging, inverse scattering, time-reversal acoustics and interferometric Green's function retrieval

Science.gov (United States)

Wapenaar, Kees; Thorbecke, Jan; van der Neut, Joost

2016-04-01

Green's theorem plays a fundamental role in a diverse range of wavefield imaging applications, such as holographic imaging, inverse scattering, time-reversal acoustics and interferometric Green's function retrieval. In many of those applications, the homogeneous Green's function (i.e. the Green's function of the wave equation without a singularity on the right-hand side) is represented by a closed boundary integral. In practical applications, sources and/or receivers are usually present only on an open surface, which implies that a significant part of the closed boundary integral is by necessity ignored. Here we derive a homogeneous Green's function representation for the common situation that sources and/or receivers are present on an open surface only. We modify the integrand in such a way that it vanishes on the part of the boundary where no sources and receivers are present. As a consequence, the remaining integral along the open surface is an accurate single-sided representation of the homogeneous Green's function. This single-sided representation accounts for all orders of multiple scattering. The new representation significantly improves the aforementioned wavefield imaging applications, particularly in situations where the first-order scattering approximation breaks down.

Development of an efficient process intensification strategy for enhancing Pfu DNA polymerase production in recombinant Escherichia coli.

Science.gov (United States)

Hu, Jian-Hua; Wang, Feng; Liu, Chun-Zhao

2015-04-01

An efficient induction strategy that consisted of multiple additions of small doses of isopropyl-β-D-thiogalactopyranoside (IPTG) in the early cell growth phase was developed for enhancing Pfu DNA polymerase production in Escherichia coli. In comparison to the most commonly used method of a single induction of 1 mM IPTG, the promising induction strategy resulted in an increase in the Pfu activity of 13.5% in shake flasks, while simultaneously decreasing the dose of IPTG by nearly half. An analysis of the intracellular IPTG concentrations indicated that the cells need to maintain an optimum intracellular IPTG concentration after 6 h for efficient Pfu DNA polymerase production. A significant increase in the Pfu DNA polymerase activity of 31.5% under the controlled dissolved oxygen concentration of 30% in a 5 L fermentor was achieved using the multiple IPTG induction strategy in comparison with the single IPTG induction. The induction strategy using multiple inputs of IPTG also avoided over accumulation of IPTG and reduced the cost of Pfu DNA polymerase production.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

Science.gov (United States)

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Numerical Simulation of Inter-Flat Air Cross-Contamination under the Condition of Single-Sided Natural Ventilation

DEFF Research Database (Denmark)

Liu, Xiaoping; Niu, Jianlei; Perino, Marco

2008-01-01

ventilated room, the renormalization group based k-ε model, together with carbon dioxide used as a tracer, is chosen to reveal this air cross-contamination. The simulation results are in agreement with our prior on-site tracer-gas measurements, revealing that the windows flush with a flat fa ade can...... be a major route of the air cross-contamination in high-rise residential buildings. Finally, an assessment index is proposed to evaluate the potential infection risks associated with this inter-flat air flow occurring in high-rise residential buildings....... the two sides, each of which has a flat fa ade with openable windows. When the wind speed is extremely low, with doors closed and windows opened, the flats become single-sided naturally ventilated driven by buoyancy effects. The air pollutants can travel from a lower flat to a vertically adjacent upper...

Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

Science.gov (United States)

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

NARCIS (Netherlands)

Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

Crowding-induced transcriptional bursts dictate polymerase and nucleosome density profiles along genes

NARCIS (Netherlands)

van den Berg, A.A.; Depken, S.M.

2017-01-01

During eukaryotic transcription, RNA polymerase (RNAP) translocates along DNA molecules covered with nucleosomes and other DNA binding proteins. Though the interactions between a single nucleosome and RNAP are by now fairly well understood, this understanding has not been synthesized into a

Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

Directory of Open Access Journals (Sweden)

Haifeng eChen

2015-11-01

Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

Mitochondrial DNA polymerase from embryos of Drosophila melanogaster: purification, subunit structure, and partial characterization

International Nuclear Information System (INIS)

Wernette, C.M.; Kaguni, L.S.

1986-01-01

The mitochondrial DNA polymerase has been purified to near-homogeneity from early embryos of Drosophila melanogaster. Sodium dodecyl sulfate gel electrophoresis of the highly purified enzyme reveals two polypeptides with molecular masses of 125,000 and 35,000 daltons, in a ratio of 1:1. The enzyme has a sedimentation coefficient of 7.6 S and a stokes radius of 51 A. Taken together, the data suggest that the D. melanogaster DNA polymerase γ is a heterodimer. DNA polymerase activity gel analysis has allowed the assignment of the DNA polymerization function to the large subunit. The DNA polymerase exhibits a remarkable ability to utilize efficiently a variety of template-primers including gapped DNA, poly(rA).oligo(dT) and singly primed phiX174 DNA. Both the crude and the highly purified enzymes are stimulated by KCl, and inhibited by dideoxythymidine triphosphate and by N-ethylmaleimide. Thus, the catalytic properties of the near-homogeneous Drosophila enzyme are consistent with those of DNA polymerase γ as partially purified from several vertebrates

Single molecular biology: coming of age in DNA replication.

Science.gov (United States)

Liu, Xiao-Jing; Lou, Hui-Qiang

2017-09-20

DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.

Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.

Science.gov (United States)

Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

2014-01-01

Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.

Characterization of monoclonal antibodies that specifically recognize the palm subdomain of hepatitis C virus nonstructural protein 5B polymerase.

Science.gov (United States)

Ingravallo, P; Lahser, F; Xia, E; Sodowich, B; Lai, V C; Hong, Z; Zhong, W

2001-06-01

The nonstructural protein 5B (NS5B) of hepatitis C virus (HCV) is an RNA-dependent RNA polymerase (RdRp) which plays an essential role in viral RNA replication. Antibodies that specifically recognize NS5B will have utilities in monitoring NS5B production and subcellular localization, as well as in structure-function studies. In this report, three mouse monoclonal antibodies (mAbs), 16A9C9, 16D9A4 and 20A12C7, against a recombinant NS5B protein (genotype 1a, H-77 strain) were produced. These mAbs specifically recognize HCV NS5B, but not RdRps of polivirus (PV), bovine viral diarrhea virus (BVDV) or GB virus B (GBV-B). The mAbs can readily detect NS5B in cellular lysates of human osteosarcoma Saos2 cells constitutively expressing the nonstructural region of HCV (NS3-NS4A-NS4B-NS5A-NS5B). NS5B proteins of different HCV genotypes/subtypes (1a, 1b, 2a, 2c, 5a) showed varied affinity for these mAbs. Interestingly, the epitopes for the mAbs were mapped to the palm subdomain (amino acid 188-370) of the HCV RdRp as determined by immunoblotting analysis of a panel of HCV/GBV-B chimeric NS5B proteins. The binding site was mapped between amino acid 231 and 267 of NS5B for 16A9C9, and between 282 and 372 for 16D9A4 and 20A12C7. Furthermore, these mAbs showed no inhibitory effect on the NS5B polymerase activity in vitro.

Single-side electron multipacting at the photocathode in rf guns

Directory of Open Access Journals (Sweden)

Jang-Hui Han

2008-01-01

Full Text Available Multiple electron impacting (multipacting can take place in rf fields when the rf components are composed of materials with a secondary electron yield greater than one. In rf gun cavities, multipacting may change the properties of the vacuum components or even damage them. First systematic measurements of the multipacting occurring in a photocathode rf gun were made at the Fermilab/NICADD Photoinjector Laboratory in 2000. The multipacting properties were found to depend on the cathode material and the solenoid field configuration. In this study, we measure the multipacting properties in more detail and model the secondary electron generation for numerical simulation. Measurements and simulations for the photoinjectors at Fermilab and DESY are compared. The multipacting takes place at the photocathode in rf guns and is categorized as single-side multipacting. In a low rf field, the electrons emitted from the cathode area do not leave the gun cavity within one rf cycle and have an opportunity to travel back and hit the cathode. The solenoid field distribution in the vicinity of the cathode changes the probability of electron bombardment of the cathode and makes a major contribution to the multipacting behavior.

Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.

Science.gov (United States)

Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J

2011-01-21

In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

Directory of Open Access Journals (Sweden)

Fabio Lapenta

Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

First-passage problems in DNA replication: effects of template tension on stepping and exonuclease activities of a DNA polymerase motor

International Nuclear Information System (INIS)

Sharma, Ajeet K; Chowdhury, Debashish

2013-01-01

A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)

PCR performance of a thermostable heterodimeric archaeal DNA polymerase

Science.gov (United States)

Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

2014-01-01

DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

PCR performance of a thermostable heterodimeric archaeal DNA polymerase

Directory of Open Access Journals (Sweden)

Tom eKillelea

2014-05-01

Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Polymerase chain reaction as a tool for developing stress protein probes

Energy Technology Data Exchange (ETDEWEB)

Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

1994-08-01

Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

Archaeal RNA polymerase arrests transcription at DNA lesions.

Science.gov (United States)

Gehring, Alexandra M; Santangelo, Thomas J

2017-01-01

Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

Science.gov (United States)

Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

2015-02-03

The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

Influence of the side-by-side arrangement on the performance of a small Savonius wind turbine

Directory of Open Access Journals (Sweden)

Jang Choon-Man

2016-01-01

Full Text Available Scaled-down Savonius turbine rotors arrayed side-by-side are introduced to analyze the effects of design parameters on the performance between turbine rotors. Unsteady flow simulation and experimental measurement have been performed to compare turbine performance and validate the numerical simulation of the turbine rotor. Commercial code, SC/Tetra, which uses an unstructured grid system, has been used to solve the three-dimensional unsteady Reynolds-averaged Navier–Stokes equations. Single turbine rotors and two turbine rotors arrayed side-by-side were numerically analyzed. The distance between rotor tips is 0.5 times the rotor diameter. Throughout the numerical simulation, the power coefficient obtained by the time-averaged result of unsteady flow simulation was found to be in good agreement with the experimental result. A discussion on the design parameters using both a single and arrayed turbine rotors is presented based on the results of the unsteady flow simulation, including the flow field, power coefficient, velocity and vorticity contours.

Mitochondrial DNA deletion mutations in adult mouse cardiac side population cells

International Nuclear Information System (INIS)

Lushaj, Entela B.; Lozonschi, Lucian; Barnes, Maria; Anstadt, Emily; Kohmoto, Takushi

2012-01-01

We investigated the presence and potential role of mitochondrial DNA (mtDNA) deletion mutations in adult cardiac stem cells. Cardiac side population (SP) cells were isolated from 12-week-old mice. Standard polymerase chain reaction (PCR) was used to screen for the presence of mtDNA deletion mutations in (a) freshly isolated SP cells and (b) SP cells cultured to passage 10. When present, the abundance of mtDNA deletion mutation was analyzed in single cell colonies. The effect of different levels of deletion mutations on SP cell growth and differentiation was determined. MtDNA deletion mutations were found in both freshly isolated and cultured cells from 12-week-old mice. While there was no significant difference in the number of single cell colonies with mtDNA deletion mutations from any of the groups mentioned above, the abundance of mtDNA deletion mutations was significantly higher in the cultured cells, as determined by quantitative PCR. Within a single clonal cell population, the detectable mtDNA deletion mutations were the same in all cells and unique when compared to deletions of other colonies. We also found that cells harboring high levels of mtDNA deletion mutations (i.e. where deleted mtDNA comprised more than 60% of total mtDNA) had slower proliferation rates and decreased differentiation capacities. Screening cultured adult stem cells for mtDNA deletion mutations as a routine assessment will benefit the biomedical application of adult stem cells.

Thermally multiplexed polymerase chain reaction.

Science.gov (United States)

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Measuring diffusion-relaxation correlation maps using non-uniform field gradients of single-sided NMR devices.

Science.gov (United States)

Nogueira d'Eurydice, Marcel; Galvosas, Petrik

2014-11-01

Single-sided NMR systems are becoming a relevant tool in industry and laboratory environments due to their low cost, low maintenance and capacity to evaluate quantity and quality of hydrogen based materials. The performance of such devices has improved significantly over the last decade, providing increased field homogeneity, field strength and even controlled static field gradients. For a class of these devices, the configuration of the permanent magnets provides a linear variation of the magnetic field and can be used in diffusion measurements. However, magnet design depends directly on its application and, according to the purpose, the field homogeneity may significantly be compromised. This may prevent the determination of diffusion properties of fluids based on the natural inhomogeneity of the field using known techniques. This work introduces a new approach that extends the applicability of diffusion-editing CPMG experiments to NMR devices with highly inhomogeneous magnetic fields, which do not vary linearly in space. Herein, we propose a method to determine a custom diffusion kernel based on the gradient distribution, which can be seen as a signature of each NMR device. This new diffusion kernel is then utilised in the 2D inverse Laplace transform (2D ILT) in order to determine diffusion-relaxation correlation maps of homogeneous multi-phasic fluids. The experiments were performed using NMR MObile Lateral Explore (MOLE), which is a single-sided NMR device designed to maximise the volume at the sweet spot with enhanced depth penetration. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular interactions and trafficking of influenza A virus polymerase proteins analyzed by specific monoclonal antibodies

Energy Technology Data Exchange (ETDEWEB)

MacDonald, Leslie A.; Aggarwal, Shilpa; Bussey, Kendra A.; Desmet, Emily A.; Kim, Baek; Takimoto, Toru, E-mail: toru_takimoto@urmc.rochester.edu

2012-04-25

The influenza polymerase complex composed of PA, PB1 and PB2, plays a key role in viral replication and pathogenicity. Newly synthesized components must be translocated to the nucleus, where replication and transcription of viral genomes take place. Previous studies suggest that while PB2 is translocated to the nucleus independently, PA and PB1 subunits could not localize to the nucleus unless in a PA-PB1 complex. To further determine the molecular interactions between the components, we created a panel of 16 hybridoma cell lines, which produce monoclonal antibodies (mAbs) against each polymerase component. We showed that, although PB1 interacts with both PA and PB2 individually, nuclear localization of PB1 is enhanced only when co-expressed with PA. Interestingly, one of the anti-PA mAbs reacted much more strongly with PA when co-expressed with PB1. These results suggest that PA-PB1 interactions induce a conformational change in PA, which could be required for its nuclear translocation.

Validity and usefulness of a single-item measure of patient-reported bother from side effects of cancer therapy.

Science.gov (United States)

Pearman, Timothy P; Beaumont, Jennifer L; Mroczek, Daniel; O'Connor, Mary; Cella, David

2018-03-01

The improving efficacy of cancer treatment has resulted in an increasing array of treatment-related symptoms and associated burdens imposed on individuals undergoing aggressive treatment of their disease. Often, clinical trials compare therapies that have different types, and severities, of adverse effects. Whether rated by clinicians or patients themselves, it can be difficult to know which side effect profile is more disruptive or bothersome to patients. A simple summary index of bother can help to adjudicate the variability in adverse effects across treatments being compared with each other. Across 4 studies, a total of 5765 patients enrolled in cooperative group studies and industry-sponsored clinical trials were the subjects of the current study. Patients were diagnosed with a range of primary cancer sites, including bladder, brain, breast, colon/rectum, head/neck, hepatobiliary, kidney, lung, ovary, pancreas, and prostate as well as leukemia and lymphoma. All patients were administered the Functional Assessment of Cancer Therapy-General version (FACT-G). The single item "I am bothered by side effects of treatment" (GP5), rated on a 5-point Likert scale, is part of the FACT-G. To determine its validity as a useful summary measure from the patient perspective, it was correlated with individual and aggregated clinician-rated adverse events and patient reports of their general ability to enjoy life. Analyses of pharmaceutical trials demonstrated that mean GP5 scores ("I am bothered by side effects of treatment") significantly differed by maximum adverse event grade (PEffect sizes ranged from 0.13 to 0.46. Analyses of cooperative group trials demonstrated a significant correlation between GP5 and item GF3 ("I am able to enjoy life") in the predicted direction. The single FACT-G item "I am bothered by side effects of treatment" is significantly associated with clinician-reported adverse events and with patients' ability to enjoy their lives. It has promise as an

Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

OpenAIRE

Campbell, J; Lowe, J; Walz, S; Ezzell, J

1993-01-01

We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

Comparison of side effects of pentagastrin test and calcium stimulation test in patients with increased basal calcitonin concentration: the gender-specific differences.

Science.gov (United States)

Ubl, Philipp; Gincu, Tatiana; Keilani, Mohammad; Ponhold, Lothar; Crevenna, Richard; Niederle, Bruno; Hacker, Marcus; Li, Shuren

2014-08-01

The aim of this study was to compare the side effects of the pentagastrin test and the calcium stimulation test in patients with increased basal calcitonin concentration, especially the gender-specific differences of side effects. A total of 256 patients (123 females and 133 males, mean age of 56 ± 27 years, range 21-83 years) had both pentagastrin and calcium stimulation tests. All patients filled in a questionnaire regarding the side effects within 30 min after completion of the stimulation tests. The differences of side effects between female and male patients as well as between the pentagastrin stimulation test and the calcium stimulation test were evaluated. Warmth feeling was the most frequent occurring side effect in all patients who had both pentagastrin and calcium stimulation tests, followed by nausea, altered gustatory sensation, and dizziness. The incidences of urgency to micturate (p stimulation test. Significant higher incidences of urgency to micturate (p stimulation test as compared with those by pentagastrin test in female patients. The incidences of nausea (p stimulation test than by calcium stimulation test. There is a significant gender-specific difference in side effects induced by calcium stimulation test. Female patients have fewer side effects by pentagastrin test than by calcium stimulation test. Male patients may tolerate the calcium stimulation test better than the pentagastrin test.

DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.

1989-01-01

We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I

Vortex interactions in a two side-by-side cylinder near-wake

International Nuclear Information System (INIS)

Wang, Z.J.; Zhou, Y.

2005-01-01

The flow behind two side-by-side circular cylinders is experimentally investigated based on laser-illuminated flow-visualization, particle image velocimetry and hot-wire measurements. The flow is classified as three regimes: single street (the cylinder center-to-center spacing T/d 2.0). Special attention is given to the regime of 1.2 2.0, the flow structure change from the anti-phase to in-phase mode starts with a phase shift between gap vortices. The dynamical role of gap bleeding between cylinders for L/d < 1.2 is also examined

Polymerase chain reaction: Theory, practice and application: A review

Directory of Open Access Journals (Sweden)

S E Atawodi

2010-01-01

Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

Ability of preoperative 3.0-Tesla magnetic resonance imaging to predict the absence of side-specific extracapsular extension of prostate cancer.

Science.gov (United States)

Hara, Tomohiko; Nakanishi, Hiroyuki; Nakagawa, Tohru; Komiyama, Motokiyo; Kawahara, Takashi; Manabe, Tomoko; Miyake, Mototaka; Arai, Eri; Kanai, Yae; Fujimoto, Hiroyuki

2013-10-01

Recent studies have shown an improvement in prostate cancer diagnosis with the use of 3.0-Tesla magnetic resonance imaging. We retrospectively assessed the ability of this imaging technique to predict side-specific extracapsular extension of prostate cancer. From October 2007 to August 2011, prostatectomy was carried out in 396 patients after preoperative 3.0-Tesla magnetic resonance imaging. Among these, 132 (primary sample) and 134 patients (validation sample) underwent 12-core prostate biopsy at the National Cancer Center Hospital of Tokyo, Japan, and at other institutions, respectively. In the primary dataset, univariate and multivariate analyses were carried out to predict side-specific extracapsular extension using variables determined preoperatively, including 3.0-Tesla magnetic resonance imaging findings (T2-weighted and diffusion-weighted imaging). A prediction model was then constructed and applied to the validation study sample. Multivariate analysis identified four significant independent predictors (P Tesla diffusion-weighted magnetic resonance imaging findings, ≥2 positive biopsy cores on each side and a maximum percentage of positive cores ≥31% on each side. The negative predictive value was 93.9% in the combination model with these four predictors, meanwhile the positive predictive value was 33.8%. Good reproducibility of these four significant predictors and the combination model was observed in the validation study sample. The side-specific extracapsular extension prediction by the biopsy Gleason score and factors associated with tumor location, including a positive 3.0-Tesla diffusion-weighted magnetic resonance imaging finding, have a high negative predictive value, but a low positive predictive value. © 2013 The Japanese Urological Association.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

Science.gov (United States)

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.

Science.gov (United States)

Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi

2009-07-01

Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

Poliovirus Polymerase Leu420 Facilitates RNA Recombination and Ribavirin Resistance

Science.gov (United States)

Kempf, Brian J.; Peersen, Olve B.

2016-01-01

ABSTRACT RNA recombination is important in the formation of picornavirus species groups and the ongoing evolution of viruses within species groups. In this study, we examined the structure and function of poliovirus polymerase, 3Dpol, as it relates to RNA recombination. Recombination occurs when nascent RNA products exchange one viral RNA template for another during RNA replication. Because recombination is a natural aspect of picornavirus replication, we hypothesized that some features of 3Dpol may exist, in part, to facilitate RNA recombination. Furthermore, we reasoned that alanine substitution mutations that disrupt 3Dpol-RNA interactions within the polymerase elongation complex might increase and/or decrease the magnitudes of recombination. We found that an L420A mutation in 3Dpol decreased the frequency of RNA recombination, whereas alanine substitutions at other sites in 3Dpol increased the frequency of recombination. The 3Dpol Leu420 side chain interacts with a ribose in the nascent RNA product 3 nucleotides from the active site of the polymerase. Notably, the L420A mutation that reduced recombination also rendered the virus more susceptible to inhibition by ribavirin, coincident with the accumulation of ribavirin-induced G→A and C→U mutations in viral RNA. We conclude that 3Dpol Leu420 is critically important for RNA recombination and that RNA recombination contributes to ribavirin resistance. IMPORTANCE Recombination contributes to the formation of picornavirus species groups and the emergence of circulating vaccine-derived polioviruses (cVDPVs). The recombinant viruses that arise in nature are occasionally more fit than either parental strain, especially when the two partners in recombination are closely related, i.e., members of characteristic species groups, such as enterovirus species groups A to H or rhinovirus species groups A to C. Our study shows that RNA recombination requires conserved features of the viral polymerase. Furthermore, a

Direct measurement of the poliovirus RNA polymerase error frequency in vitro

International Nuclear Information System (INIS)

Ward, C.D.; Stokes, M.A.M.; Flanegan, J.B.

1988-01-01

The fidelity of RNA replication by the poliovirus-RNA-dependent RNA polymerase was examined by copying homopolymeric RNA templates in vitro. The poliovirus RNA polymerase was extensively purified and used to copy poly(A), poly(C), or poly(I) templates with equimolar concentrations of noncomplementary and complementary ribonucleotides. The error frequency was expressed as the amount of a noncomplementary nucleotide incorporated divided by the total amount of complementary and noncomplementary nucleotide incorporated. The polymerase error frequencies were very high, depending on the specific reaction conditions. The activity of the polymerase on poly(U) and poly(G) was too low to measure error frequencies on these templates. A fivefold increase in the error frequency was observed when the reaction conditions were changed from 3.0 mM Mg 2+ (pH 7.0) to 7.0 mM Mg 2+ (pH 8.0). This increase in the error frequency correlates with an eightfold increase in the elongation rate that was observed under the same conditions in a previous study

Functional roles of DNA polymerases β and γ

International Nuclear Information System (INIS)

Huebscher, U.; Kuenzle, C.C.; Spadari, S.

1979-01-01

The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

Estimation of the reaction efficiency in polymerase chain reaction

NARCIS (Netherlands)

Lalam, N.

2006-01-01

Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

Directory of Open Access Journals (Sweden)

Manjula Pandey

2014-03-01

Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

OpenAIRE

Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

2003-01-01

Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

International Nuclear Information System (INIS)

Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

1989-01-01

Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

The respiratory syncytial virus polymerase has multiple RNA synthesis activities at the promoter.

Directory of Open Access Journals (Sweden)

Sarah L Noton

Full Text Available Respiratory syncytial virus (RSV is an RNA virus in the Family Paramyxoviridae. Here, the activities performed by the RSV polymerase when it encounters the viral antigenomic promoter were examined. RSV RNA synthesis was reconstituted in vitro using recombinant, isolated polymerase and an RNA oligonucleotide template representing nucleotides 1-25 of the trailer complement (TrC promoter. The RSV polymerase was found to have two RNA synthesis activities, initiating RNA synthesis from the +3 site on the promoter, and adding a specific sequence of nucleotides to the 3' end of the TrC RNA using a back-priming mechanism. Examination of viral RNA isolated from RSV infected cells identified RNAs initiated at the +3 site on the TrC promoter, in addition to the expected +1 site, and showed that a significant proportion of antigenome RNAs contained specific nucleotide additions at the 3' end, demonstrating that the observations made in vitro reflected events that occur during RSV infection. Analysis of the impact of the 3' terminal extension on promoter activity indicated that it can inhibit RNA synthesis initiation. These findings indicate that RSV polymerase-promoter interactions are more complex than previously thought and suggest that there might be sophisticated mechanisms for regulating promoter activity during infection.

Small-sided games for young athletes: is game specificity influential?

Science.gov (United States)

Harrison, Craig B; Kilding, Andrew E; Gill, Nicholas D; Kinugasa, Taisuke

2014-01-01

This study aimed to quantify and compare the physiological, physical and technical demands of a sport-specific and non-sport-specific small-sided game (SSG) in young athletes. Ten male soccer players (mean ± SD: age, 13.0 ± 0.3 years, [Formula: see text]O2peak, 54.4 ± 4.9 ml · kg(-1) · min(-1)) completed 3 vs. 3 and 6 vs. 6 soccer and "bucketball" SSGs twice. Games lasted for 16 min and were performed in a randomised order, at least 48 h apart. Movement patterns and heart rate were measured using 4 Hz global positioning systems. Technical skill executions were assessed by video analysis and ratings of perceived exertion (RPE) using the Borg scale (RPEs, 6-20). Total distance (4.9 ± 4.1% and 8.3 ± 6.6%), distance at 7-12.9 km · h(-1) (14.5 ± 12.5% and 14.9 ± 16.1%), total possessions (14.7 ± 18.0% and 12.9 ± 18.9%) and percentage of successful passes (24.1 ± 11.7% and 30.1 ± 17.6%) were higher for bucketball compared to soccer (3 vs. 3 and 6 vs. 6, respectively). Total distance at 13-17.9 km · h(-1) was higher for 6 vs. 6 than 3 vs. 3 bucketball (32.3 ± 21.2%). There was likely substantial difference for %HRpeak (89.5 ± 3.1 vs. 87.4 ± 2.8 b · min(-1)) and time above 90% HRpeak (570 ± 288 s vs. 361 ± 288 s) between bucketball and soccer (3 vs. 3 and 6 vs. 6, respectively). Young players travelled further at higher overall speeds, experienced higher physiological workloads and performed more successful technical executions during the non-sport-specific SSG.

Bordetella pertussis diagnosed by polymerase chain reaction

DEFF Research Database (Denmark)

Birkebaek, N H; Heron, I; Skjødt, K

1994-01-01

The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

Distributed video coding with multiple side information

DEFF Research Database (Denmark)

Huang, Xin; Brites, C.; Ascenso, J.

2009-01-01

Distributed Video Coding (DVC) is a new video coding paradigm which mainly exploits the source statistics at the decoder based on the availability of some decoder side information. The quality of the side information has a major impact on the DVC rate-distortion (RD) performance in the same way...... the quality of the predictions had a major impact in predictive video coding. In this paper, a DVC solution exploiting multiple side information is proposed; the multiple side information is generated by frame interpolation and frame extrapolation targeting to improve the side information of a single...

Effect of Ear and Near-side Single Circular Pit Depth and Bulk Stress on Magnetic Flux Leakage at ferromagnetic Pipeline

International Nuclear Information System (INIS)

Ryu, Kwon Sang; Park, Young Tae; Atherton, D. L.; Clapham, L.

2003-01-01

Magnetic flux leakage (MFL) signals were used for corrosion inspection of buried oil and gas pipeline. 3D finite element analysis was used to examine the effects of far and near-side pit depth and tensile stress on MFL signals. Anisotropci materials were used, and the effects of simulated tensile stress on MFL were investigated. The axial and radial MFL signals depended on far and near-side single pit depth and on the bulk stress, but the circumferential MFL signal did not depend on them. The axial and radial MFL signals increased with increasing pit depth and the bulk stress, but the circumferential MFL signal was scarcely changed

Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

Directory of Open Access Journals (Sweden)

Deanna N Edwards

Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Toshiaki Higashi

2012-04-01

Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

Science.gov (United States)

Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

2001-04-01

Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

Higher cytoplasmic and nuclear poly(ADP-ribose) polymerase expression in familial than in sporadic breast cancer

NARCIS (Netherlands)

Klauke, M.L.; Hoogerbrugge-van der Linden, N.; Budczies, J.; Bult, P.; Prinzler, J.; Radke, C.; van Krieken, J.H.; Dietel, M.; Denkert, C.; Muller, B.M.

2012-01-01

Poly(ADP-ribose) polymerase 1 (PARP) is a key element of the single-base excision pathway for repair of DNA single-strand breaks. To compare the cytoplasmic and nuclear poly(ADP-ribose) expression between familial (BRCA1, BRCA2, or non BRCA1/2) and sporadic breast cancer, we investigated 39 sporadic

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

Science.gov (United States)

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

Directory of Open Access Journals (Sweden)

Elena K Braithwaite

2010-08-01

Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

Biomechanical comparison of double-row versus transtendon single-row suture anchor technique for repair of the grade III partial articular-sided rotator cuff tears.

Science.gov (United States)

Zhang, Chun-Gang; Zhao, De-Wei; Wang, Wei-Ming; Ren, Ming-Fa; Li, Rui-Xin; Yang, Sheng; Liu, Yu-Peng

2010-11-01

For partial-thickness tears of the rotator cuff, double-row fixation and transtendon single-row fixation restore insertion site anatomy, with excellent results. We compared the biomechanical properties of double-row and transtendon single-row suture anchor techniques for repair of grade III partial articular-sided rotator cuff tears. In 10 matched pairs of fresh-frozen sheep shoulders, the infraspinatus tendon from 1 shoulder was repaired with a double-row suture anchor technique. This comprised placement of 2 medial anchors with horizontal mattress sutures at an angle of ≤ 45° into the medial margin of the infraspinatus footprint, just lateral to the articular surface, and 2 lateral anchors with horizontal mattress sutures. Standardized, 50% partial, articular-sided infraspinatus lesions were created in the contralateral shoulder. The infraspinatus tendon from the contralateral shoulder was repaired using two anchors with transtendon single-row mattress sutures. Each specimen underwent cyclic loading from 10 to 100 N for 50 cycles, followed by tensile testing to failure. Gap formation and strain over the footprint area were measured using a motion capture system; stiffness and failure load were determined from testing data. Gap formation for the transtendon single-row repair was significantly smaller (P row repair for the first cycle ((1.74 ± 0.38) mm vs. (2.86 ± 0.46) mm, respectively) and the last cycle ((3.77 ± 0.45) mm vs. (5.89 ± 0.61) mm, respectively). The strain over the footprint area for the transtendon single-row repair was significantly smaller (P row repair. Also, it had a higher mean ultimate tensile load and stiffness. For grade III partial articular-sided rotator cuff tears, transtendon single-row fixation exhibited superior biomechanical properties when compared with double-row fixation.

Functional PMS2 hybrid alleles containing a pseudogene-specific missense variant trace back to a single ancient intrachromosomal recombination event.

Science.gov (United States)

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2010-05-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

A key role for poly(ADP-ribose polymerase 3 in ectodermal specification and neural crest development.

Directory of Open Access Journals (Sweden)

Michèle Rouleau

2011-01-01

Full Text Available The PARP family member poly(ADP-ribose polymerase 3 (PARP3 is structurally related to the well characterized PARP1 that orchestrates cellular responses to DNA strand breaks and cell death by the synthesis of poly(ADP-ribose. In contrast to PARP1 and PARP2, the functions of PARP3 are undefined. Here, we reveal critical functions for PARP3 during vertebrate development.We have used several in vitro and in vivo approaches to examine the possible functions of PARP3 as a transcriptional regulator, a function suggested from its previously reported association with several Polycomb group (PcG proteins. We demonstrate that PARP3 gene occupancy in the human neuroblastoma cell line SK-N-SH occurs preferentially with developmental genes regulating cell fate specification, tissue patterning, craniofacial development and neurogenesis. Addressing the significance of this association during zebrafish development, we show that morpholino oligonucleotide-directed inhibition of parp3 expression in zebrafish impairs the expression of the neural crest cell specifier sox9a and of dlx3b/dlx4b, the formation of cranial sensory placodes, inner ears and pectoral fins. It delays pigmentation and severely impedes the development of the median fin fold and tail bud.Our findings demonstrate that Parp3 is crucial in the early stages of zebrafish development, possibly by exerting its transcriptional regulatory functions as early as during the specification of the neural plate border.

Genetic and codon usage bias analyses of polymerase genes of equine influenza virus and its relation to evolution.

Science.gov (United States)

Bera, Bidhan Ch; Virmani, Nitin; Kumar, Naveen; Anand, Taruna; Pavulraj, S; Rash, Adam; Elton, Debra; Rash, Nicola; Bhatia, Sandeep; Sood, Richa; Singh, Raj Kumar; Tripathi, Bhupendra Nath

2017-08-23

Equine influenza is a major health problem of equines worldwide. The polymerase genes of influenza virus have key roles in virus replication, transcription, transmission between hosts and pathogenesis. Hence, the comprehensive genetic and codon usage bias of polymerase genes of equine influenza virus (EIV) were analyzed to elucidate the genetic and evolutionary relationships in a novel perspective. The group - specific consensus amino acid substitutions were identified in all polymerase genes of EIVs that led to divergence of EIVs into various clades. The consistent amino acid changes were also detected in the Florida clade 2 EIVs circulating in Europe and Asia since 2007. To study the codon usage patterns, a total of 281,324 codons of polymerase genes of EIV H3N8 isolates from 1963 to 2015 were systemically analyzed. The polymerase genes of EIVs exhibit a weak codon usage bias. The ENc-GC3s and Neutrality plots indicated that natural selection is the major influencing factor of codon usage bias, and that the impact of mutation pressure is comparatively minor. The methods for estimating host imposed translation pressure suggested that the polymerase acidic (PA) gene seems to be under less translational pressure compared to polymerase basic 1 (PB1) and polymerase basic 2 (PB2) genes. The multivariate statistical analysis of polymerase genes divided EIVs into four evolutionary diverged clusters - Pre-divergent, Eurasian, Florida sub-lineage 1 and 2. Various lineage specific amino acid substitutions observed in all polymerase genes of EIVs and especially, clade 2 EIVs underwent major variations which led to the emergence of a phylogenetically distinct group of EIVs originating from Richmond/1/07. The codon usage bias was low in all the polymerase genes of EIVs that was influenced by the multiple factors such as the nucleotide compositions, mutation pressure, aromaticity and hydropathicity. However, natural selection was the major influencing factor in defining the

Collision-Induced Dissociation of Deprotonated Peptides. Relative Abundance of Side-Chain Neutral Losses, Residue-Specific Product Ions, and Comparison with Protonated Peptides.

Science.gov (United States)

Liang, Yuxue; Neta, Pedatsur; Yang, Xiaoyu; Stein, Stephen E

2018-03-01

High-accuracy MS/MS spectra of deprotonated ions of 390 dipeptides and 137 peptides with three to six residues are studied. Many amino acid residues undergo neutral losses from their side chains. The most abundant is the loss of acetaldehyde from threonine. The abundance of losses from the side chains of other amino acids is estimated relative to that of threonine. While some amino acids lose the whole side chain, others lose only part of it, and some exhibit two or more different losses. Side-chain neutral losses are less abundant in the spectra of protonated peptides, being significant mainly for methionine and arginine. In addition to the neutral losses, many amino acid residues in deprotonated peptides produce specific negative ions after peptide bond cleavage. An expanded list of fragment ions from protonated peptides is also presented and compared with those of deprotonated peptides. Fragment ions are mostly different for these two cases. These lists of fragments are used to annotate peptide mass spectral libraries and to aid in the confirmation of specific amino acids in peptides. Graphical Abstract ᅟ.

DNA polymerase beta participates in mitochondrial DNA repair

DEFF Research Database (Denmark)

Sykora, P; Kanno, S; Akbari, M

2017-01-01

We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

Adaptive Mutations in Influenza A/California/07/2009 Enhance Polymerase Activity and Infectious Virion Production

Science.gov (United States)

Slaine, Patrick D.; MacRae, Cara; Kleer, Mariel; Lamoureux, Emily; McAlpine, Sarah; Warhuus, Michelle; Comeau, André M.; Hatchette, Todd

2018-01-01

Mice are not natural hosts for influenza A viruses (IAVs), but they are useful models for studying antiviral immune responses and pathogenesis. Serial passage of IAV in mice invariably causes the emergence of adaptive mutations and increased virulence. Here, we report the adaptation of IAV reference strain A/California/07/2009(H1N1) (also known as CA/07) in outbred Swiss Webster mice. Serial passage led to increased virulence and lung titers, and dissemination of the virus to brains. We adapted a deep-sequencing protocol to identify and enumerate adaptive mutations across all genome segments. Among mutations that emerged during mouse-adaptation, we focused on amino acid substitutions in polymerase subunits: polymerase basic-1 (PB1) T156A and F740L and polymerase acidic (PA) E349G. These mutations were evaluated singly and in combination in minigenome replicon assays, which revealed that PA E349G increased polymerase activity. By selectively engineering three PB1 and PA mutations into the parental CA/07 strain, we demonstrated that these mutations in polymerase subunits decreased the production of defective viral genome segments with internal deletions and dramatically increased the release of infectious virions from mouse cells. Together, these findings increase our understanding of the contribution of polymerase subunits to successful host adaptation. PMID:29783694

Development and internal validation of a side-specific, multiparametric magnetic resonance imaging-based nomogram for the prediction of extracapsular extension of prostate cancer.

Science.gov (United States)

Martini, Alberto; Gupta, Akriti; Lewis, Sara C; Cumarasamy, Shivaram; Haines, Kenneth G; Briganti, Alberto; Montorsi, Francesco; Tewari, Ashutosh K

2018-04-19

To develop a nomogram for predicting side-specific extracapsular extension (ECE) for planning nerve-sparing radical prostatectomy. We retrospectively analysed data from 561 patients who underwent robot-assisted radical prostatectomy between February 2014 and October 2015. To develop a side-specific predictive model, we considered the prostatic lobes separately. Four variables were included: prostate-specific antigen; highest ipsilateral biopsy Gleason grade; highest ipsilateral percentage core involvement; and ECE on multiparametric magnetic resonance imaging (mpMRI). A multivariable logistic regression analysis was fitted to predict side-specific ECE. A nomogram was built based on the coefficients of the logit function. Internal validation was performed using 'leave-one-out' cross-validation. Calibration was graphically investigated. The decision curve analysis was used to evaluate the net clinical benefit. The study population consisted of 829 side-specific cases, after excluding negative biopsy observations (n = 293). ECE was reported on mpMRI and final pathology in 115 (14%) and 142 (17.1%) cases, respectively. Among these, mpMRI was able to predict ECE correctly in 57 (40.1%) cases. All variables in the model except highest percentage core involvement were predictors of ECE (all P ≤ 0.006). All variables were considered for inclusion in the nomogram. After internal validation, the area under the curve was 82.11%. The model demonstrated excellent calibration and improved clinical risk prediction, especially when compared with relying on mpMRI prediction of ECE alone. When retrospectively applying the nomogram-derived probability, using a 20% threshold for performing nerve-sparing, nine out of 14 positive surgical margins (PSMs) at the site of ECE resulted above the threshold. We developed an easy-to-use model for the prediction of side-specific ECE, and hope it serves as a tool for planning nerve-sparing radical prostatectomy and in the reduction of PSM in

Comparison of polymerase chain reaction (PCR) and loop-mediated ...

African Journals Online (AJOL)

Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Diffusion tensor imaging of the auditory nerve in patients with acquired single-sided deafness

DEFF Research Database (Denmark)

Vos, Sjoerd; Haakma, Wieke; Versnel, Huib

2015-01-01

following cochlear hair cell loss, and the amount of degeneration may considerably differ between the two ears, also in patients with bilateral deafness. A measure that reflects the nerve's condition would help to assess the best of both nerves and decide accordingly which ear should be implanted......A cochlear implant (CI) can restore hearing in patients with profound sensorineural hearing loss by direct electrical stimulation of the auditory nerve. Therefore, the viability of the auditory nerve is vitally important in successful hearing recovery. However, the nerve typically degenerates...... single-sided sensorineural hearing loss. A specialized acquisition protocol was designed for a 3 T MRI scanner to image the small nerve bundle. The nerve was reconstructed using fiber tractography and DTI metrics - which reflect the nerve's microstructural properties - were computed per tract. Comparing...

Single cell subtractive transcriptomics for identification of cell-specifically expressed candidate genes of pyrrolizidine alkaloid biosynthesis.

Science.gov (United States)

Sievert, Christian; Beuerle, Till; Hollmann, Julien; Ober, Dietrich

2015-09-01

Progress has recently been made in the elucidation of pathways of secondary metabolism. However, because of its diversity, genetic information concerning biosynthetic details is still missing for many natural products. This is also the case for the biosynthesis of pyrrolizidine alkaloids. To close this gap, we tested strategies using tissues that express this pathway in comparison to tissues in which this pathway is not expressed. As many pathways of secondary metabolism are known to be induced by jasmonates, the pyrrolizidine alkaloid-producing species Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale of the Boraginales order were treated with methyl jasmonate. An effect on pyrrolizidine alkaloid levels and on transcript levels of homospermidine synthase, the first specific enzyme of pyrrolizidine alkaloid biosynthesis, was not detectable. Therefore, a method was developed by making use of the often observed cell-specific production of secondary compounds. H. indicum produces pyrrolizidine alkaloids exclusively in the shoot. Homospermidine synthase is expressed only in the cells of the lower leaf epidermis and the epidermis of the stem. Suggesting that the whole pathway of pyrrolizidine alkaloid biosynthesis might be localized in these cells, we have isolated single cells of the upper and lower epidermis by laser-capture microdissection. The resulting cDNA preparations have been used in a subtractive transcriptomic approach. Quantitative real-time polymerase chain reaction has shown that the resulting library is significantly enriched for homospermidine-synthase-coding transcripts providing a valuable source for the identification of further genes involved in pyrrolizidine alkaloid biosynthesis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Double-sided FoxFET biased microstrip detectors

International Nuclear Information System (INIS)

Allport, P.P.; Carter, J.R.; Dunwoody, U.C.; Gibson, V.; Goodrick, M.J.; Beck, G.A.; Carter, A.A.; Martin, A.J.; Pritchard, T.W.; Bullough, M.A.; Greenwood, N.M.; Lucas, A.D.; Wilburn, C.D.

1994-01-01

The use of the field effect transistor, integrated onto AC-coupled silicon detectors, as a novel technique for biasing the implanted p + strips [P.P. Allport et al., Nucl. Instr. and Meth. A 310 (1991) 155], was first employed for the OPAL microvertex detector. The detector has proved very successful, with ladders of three single-sided detectors showing signal/noise of 22 : 1 with MX5 readout electronics [P.P. Allport et al., Nucl. Instr. and Meth. A 324 (1993) 34; Nucl. Phys. B (Proc. Suppl.) 32 (1993) 208]. This technique has been extended to bias also the n + strips and p strips on the ohmic side of a double-sided detector [P.P. Allport et al., Nucl. Instr. and Meth. A, to be submitted]. Full-size detectors with orthogonal readout have been fabricated by Micron and tested with MX7 readout on both sides. Both the junction and ohmic sides of these detectors have similar signal/noise values to those for single-sided wafers [P.P. Allport et al., Nucl. Instr. and Meth. A, to be submitted]. Test structures have been irradiated with beta particles to study the radiation hardness of the devices, and probe station electrical measurements of the detectors and test structures are presented. ((orig.))

The expanding polymerase universe.

Science.gov (United States)

Goodman, M F; Tippin, B

2000-11-01

Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

Wind-induced single-sided natural ventilation in buildings near a long street canyon: CFD evaluation of street configuration and envelope design

DEFF Research Database (Denmark)

Ai, Z.T.; Mak, C.M.

2018-01-01

an urban context, this study investigates the wind-induced single-sided natural ventilation in buildings near a long street canyon under a perpendicular wind direction using CFD method. Four aspect ratios (AR) of the street canyon, from 1.0, 2.0, 4.0 to 6.0, are investigated to examine the influence...

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Biochemical and genetic analysis of the role of the viral polymerase in enterovirus recombination.

Science.gov (United States)

Woodman, Andrew; Arnold, Jamie J; Cameron, Craig E; Evans, David J

2016-08-19

Genetic recombination in single-strand, positive-sense RNA viruses is a poorly understand mechanism responsible for generating extensive genetic change and novel phenotypes. By moving a critical cis-acting replication element (CRE) from the polyprotein coding region to the 3' non-coding region we have further developed a cell-based assay (the 3'CRE-REP assay) to yield recombinants throughout the non-structural coding region of poliovirus from dually transfected cells. We have additionally developed a defined biochemical assay in which the only protein present is the poliovirus RNA dependent RNA polymerase (RdRp), which recapitulates the strand transfer events of the recombination process. We have used both assays to investigate the role of the polymerase fidelity and nucleotide turnover rates in recombination. Our results, of both poliovirus intertypic and intratypic recombination in the CRE-REP assay and using a range of polymerase variants in the biochemical assay, demonstrate that RdRp fidelity is a fundamental determinant of recombination frequency. High fidelity polymerases exhibit reduced recombination and low fidelity polymerases exhibit increased recombination in both assays. These studies provide the basis for the analysis of poliovirus recombination throughout the non-structural region of the virus genome and provide a defined biochemical assay to further dissect this important evolutionary process. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Polymerases ImuC and DinB Are Involved in DNA Alkylation Damage Tolerance in Pseudomonas aeruginosa and Pseudomonas putida.

Science.gov (United States)

Jatsenko, Tatjana; Sidorenko, Julia; Saumaa, Signe; Kivisaar, Maia

2017-01-01

Translesion DNA synthesis (TLS), facilitated by low-fidelity polymerases, is an important DNA damage tolerance mechanism. Here, we investigated the role and biological function of TLS polymerase ImuC (former DnaE2), generally present in bacteria lacking DNA polymerase V, and TLS polymerase DinB in response to DNA alkylation damage in Pseudomonas aeruginosa and P. putida. We found that TLS DNA polymerases ImuC and DinB ensured a protective role against N- and O-methylation induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) in both P. aeruginosa and P. putida. DinB also appeared to be important for the survival of P. aeruginosa and rapidly growing P. putida cells in the presence of methyl methanesulfonate (MMS). The role of ImuC in protection against MMS-induced damage was uncovered under DinB-deficient conditions. Apart from this, both ImuC and DinB were critical for the survival of bacteria with impaired base excision repair (BER) functions upon alkylation damage, lacking DNA glycosylases AlkA and/or Tag. Here, the increased sensitivity of imuCdinB double deficient strains in comparison to single mutants suggested that the specificity of alkylated DNA lesion bypass of DinB and ImuC might also be different. Moreover, our results demonstrated that mutagenesis induced by MMS in pseudomonads was largely ImuC-dependent. Unexpectedly, we discovered that the growth temperature of bacteria affected the efficiency of DinB and ImuC in ensuring cell survival upon alkylation damage. Taken together, the results of our study disclosed the involvement of ImuC in DNA alkylation damage tolerance, especially at low temperatures, and its possible contribution to the adaptation of pseudomonads upon DNA alkylation damage via increased mutagenesis.

Monolithic Composite “Pressure + Acceleration + Temperature + Infrared” Sensor Using a Versatile Single-Sided “SiN/Poly-Si/Al” Process-Module

Directory of Open Access Journals (Sweden)

Xinxin Li

2013-01-01

Full Text Available We report a newly developed design/fabrication module with low-cost single-sided “low-stress-silicon-nitride (LS-SiN/polysilicon (poly-Si/Al” process for monolithic integration of composite sensors for sensing-network-node applications. A front-side surface-/bulk-micromachining process on a conventional Si-substrate is developed, featuring a multifunctional SiN/poly-Si/Al layer design for diverse sensing functions. The first “pressure + acceleration + temperature + infrared” (PATIR composite sensor with the chip size of 2.5 mm × 2.5 mm is demonstrated. Systematic theoretical design and analysis methods are developed. The diverse sensing components include a piezoresistive absolute-pressure sensor (up to 700 kPa, with a sensitivity of 49 mV/MPa under 3.3 V supplied voltage, a piezoresistive accelerometer (±10 g, with a sensitivity of 66 μV/g under 3.3 V and a −3 dB bandwidth of 780 Hz, a thermoelectric infrared detector (with a responsivity of 45 V/W and detectivity of 3.6 × 107 cm·Hz1/2/W and a thermistor (−25–120 °C. This design/fabrication module concept enables a low-cost monolithically-integrated “multifunctional-library” technique. It can be utilized as a customizable tool for versatile application-specific requirements, which is very useful for small-size, low-cost, large-scale sensing-network node developments.

Transient expression and activity of human DNA polymerase iota in loach embryos.

Science.gov (United States)

Makarova, Irina V; Kazakov, Andrey A; Makarova, Alena V; Khaidarova, Nella V; Kozikova, Larisa V; Nenasheva, Valentina V; Gening, Leonid V; Tarantul, Vyacheslav Z; Andreeva, Ludmila E

2012-02-01

Human DNA polymerase iota (Pol ι) is a Y-family DNA polymerase with unusual biochemical properties and not fully understood functions. Pol ι preferentially incorporates dGTP opposite template thymine. This property can be used to monitor Pol ι activity in the presence of other DNA polymerases, e.g. in cell extracts of tissues and tumors. We have now confirmed the specificity and sensitivity of the method of Pol ι activity detection in cell extracts using an animal model of loach Misgurnus fossilis embryos transiently expressing human Pol ι. The overexpression of Pol ι was shown to be accompanied by an increase in abnormalities in development and the frequency of pycnotic nuclei in fish embryos. Further analysis of fish embryos with constitutive or regulated Pol ι expression may provide insights into Pol ι functions in vertebrate animals.

UVB DNA dosimeters analyzed by polymerase chain reactors

International Nuclear Information System (INIS)

Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL

1997-01-01

Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

Novel Polymerase Gene Mutations for Human Adaptation in Clinical Isolates of Avian H5N1 Influenza Viruses.

Directory of Open Access Journals (Sweden)

Yasuha Arai

2016-04-01

Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.

Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

Directory of Open Access Journals (Sweden)

Bahram Nasr Isfahani

2006-09-01

Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

Comparisons between designs for single-sided linear electric motors: Homopolar synchronous and induction

Science.gov (United States)

Nondahl, T. A.; Richter, E.

1980-09-01

A design study of two types of single sided (with a passive rail) linear electric machine designs, namely homopolar linear synchronous machines (LSM's) and linear induction machines (LIM's), is described. It is assumed the machines provide tractive effort for several types of light rail vehicles and locomotives. These vehicles are wheel supported and require tractive powers ranging from 200 kW to 3735 kW and top speeds ranging from 112 km/hr to 400 km/hr. All designs are made according to specified magnetic and thermal criteria. The LSM advantages are a higher power factor, much greater restoring forces for track misalignments, and less track heating. The LIM advantages are no need to synchronize the excitation frequency precisely to vehicle speed, simpler machine construction, and a more easily anchored track structure. The relative weights of the two machine types vary with excitation frequency and speed; low frequencies and low speeds favor the LSM.

The exosome component Rrp6 is required for RNA polymerase II termination at specific targets of the Nrd1-Nab3 pathway.

Science.gov (United States)

Fox, Melanie J; Gao, Hongyu; Smith-Kinnaman, Whitney R; Liu, Yunlong; Mosley, Amber L

2015-01-01

The exosome and its nuclear specific subunit Rrp6 form a 3'-5' exonuclease complex that regulates diverse aspects of RNA biology including 3' end processing and degradation of a variety of noncoding RNAs (ncRNAs) and unstable transcripts. Known targets of the nuclear exosome include short (Polymerase II (RNAPII) localization. Deletion of RRP6 promotes hyper-elongation of multiple NNS-dependent transcripts resulting from both improperly processed 3' RNA ends and faulty transcript termination at specific target genes. The defects in RNAPII termination cause transcriptome-wide changes in mRNA expression through transcription interference and/or antisense repression, similar to previously reported effects of depleting Nrd1 from the nucleus. Elongated transcripts were identified within all classes of known NNS targets with the largest changes in transcription termination occurring at CUTs. Interestingly, the extended transcripts that we have detected in our studies show remarkable similarity to Nrd1-unterminated transcripts at many locations, suggesting that Rrp6 acts with the NNS complex globally to promote transcription termination in addition to 3' end RNA processing and/or degradation at specific targets.

Constructions of secure entanglement channels assisted by quantum dots inside single-sided optical cavities

Science.gov (United States)

Heo, Jino; Kang, Min-Sung; Hong, Chang-Ho; Choi, Seong-Gon; Hong, Jong-Phil

2017-08-01

We propose quantum information processing schemes to generate and swap entangled states based on the interactions between flying photons and quantum dots (QDs) confined within optical cavities for quantum communication. To produce and distribute entangled states (Bell and Greenberger-Horne-Zeilinger [GHZ] states) between the photonic qubits of flying photons of consumers (Alice and Bob) and electron-spin qubits of a provider (trust center, or TC), the TC employs the interactions of the QD-cavity system, which is composed of a charged QD (negatively charged exciton) inside a single-sided cavity. Subsequently, the TC constructs an entanglement channel (Bell state and 4-qubit GHZ state) to link one consumer with another through entanglement swapping, which can be realized to exploit a probe photon with interactions of the QD-cavity systems and single-qubit measurements without Bell state measurement, for quantum communication between consumers. Consequently, the TC, which has quantum nodes (QD-cavity systems), can accomplish constructing the entanglement channel (authenticated channel) between two separated consumers from the distributions of entangled states and entanglement swapping. Furthermore, our schemes using QD-cavity systems, which are feasible with a certain probability of success and high fidelity, can be experimentally implemented with technology currently in use.

Role of exonucleolytic processing and polymerase-DNA association in bypass of lesions during replication in vitro. Significance for SOS-targeted mutagenesis

International Nuclear Information System (INIS)

Shwartz, H.; Shavitt, O.; Livneh, Z.

1988-01-01

The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected

Advancing Polymerase Ribozymes Towards Self-Replication

Science.gov (United States)

Tjhung, K. F.; Joyce, G. F.

2017-07-01

Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.

Role of DNA polymerase I in liquid holding recovery of uv-irradiated Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Tang, M S; Patrick, M H [Texas Univ., Dallas (USA)

1977-09-01

Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in DNA of different strains of E.coli K12 were determined during liquid holding recovery after uv irradiation. The extent of Pyr <> Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' ..-->.. 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' ..-->.. 3' exonuclease.

Multiple isoelectric forms of poliovirus RNA-dependent RNA polymerase: Evidence for phosphorylation

International Nuclear Information System (INIS)

Ransone, L.J.; Dasgupta, A.

1989-01-01

Poliovirus-specific RNA-dependent RNA polymerase (3Dpol) was purified to apparent homogeneity. A single polypeptide of an apparent molecular weight of 63,000 catalyzes the synthesis of dimeric and monomeric RNA products in response to the poliovirion RNA template. Analysis of purified 3Dpol by two-dimensional electrophoresis showed multiple forms of 3Dpol, suggesting posttranslational modification of the protein in virus-infected cells. The two major forms of 3Dpol appear to have approximate pI values of 7.1 and 7.4. Incubation of purified 3Dpol with calf intestinal phosphatase resulted in almost complete disappearance of the pI 7.1 form and a concomitant increase in the intensity of the pI 7.4 form of 3Dpol. Addition of 32P-labeled Pi during infection of HeLa cells with poliovirus resulted in specific labeling of 3Dpol and 3CD, a viral protein which contains the entire 3Dpol sequence. Both 3Dpol and 3CD appear to be phosphorylated at serine residues. Ribosomal salt washes prepared from both mock- and poliovirus-infected cells contain phosphatases capable of dephosphorylating quantitatively the phosphorylated form (pI 7.1) of 3Dpol

DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

Directory of Open Access Journals (Sweden)

Elisa Mentegari

2016-08-01

Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

Science.gov (United States)

Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

2016-08-31

DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

Statistical analysis of entropy generation in longitudinally finned tube heat exchanger with shell side nanofluid by a single phase approach

Directory of Open Access Journals (Sweden)

Konchada Pavan Kumar

2016-06-01

Full Text Available The presence of nanoparticles in heat exchangers ascertained increment in heat transfer. The present work focuses on heat transfer in a longitudinal finned tube heat exchanger. Experimentation is done on longitudinal finned tube heat exchanger with pure water as working fluid and the outcome is compared numerically using computational fluid dynamics (CFD package based on finite volume method for different flow rates. Further 0.8% volume fraction of aluminum oxide (Al2O3 nanofluid is considered on shell side. The simulated nanofluid analysis has been carried out using single phase approach in CFD by updating the user-defined functions and expressions with thermophysical properties of the selected nanofluid. These results are thereafter compared against the results obtained for pure water as shell side fluid. Entropy generated due to heat transfer and fluid flow is calculated for the nanofluid. Analysis of entropy generation is carried out using the Taguchi technique. Analysis of variance (ANOVA results show that the inlet temperature on shell side has more pronounced effect on entropy generation.

Structure and mechanism of human DNA polymerase [eta

Energy Technology Data Exchange (ETDEWEB)

Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

2010-11-03

The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis.

Science.gov (United States)

Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

2015-03-01

A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).

Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

DEFF Research Database (Denmark)

Blair, D.; Waycott, M.; Byrne, L.

2006-01-01

This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

Affinity isolation and I-DIRT mass spectrometric analysis of the Escherichia coli O157:H7 Sakai RNA polymerase complex.

Science.gov (United States)

Lee, David J; Busby, Stephen J W; Westblade, Lars F; Chait, Brian T

2008-02-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the "core" E. coli genome.

Influence of directionality and maximal power output on speech understanding with bone anchored hearing implants in single sided deafness

OpenAIRE

Krempaska, Silvia; Koval, Juraj; Schmid, Christoph; Pfiffner, Flurin; Kurz, Anja; Kompis, Martin

2014-01-01

Bone-anchored hearing implants (BAHI) are routinely used to alleviate the effects of the acoustic head shadow in single-sided sensorineural deafness (SSD). In this study, the influence of the directional microphone setting and the maximum power output of the BAHI sound processor on speech understanding in noise in a laboratory setting were investigated. Eight adult BAHI users with SSD participated in this pilot study. Speech understanding in noise was measured using a new Slovak speech-in-noi...

DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients.

Science.gov (United States)

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-07-14

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.

DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients

Science.gov (United States)

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-01-01

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618

Single base pair mutation analysis by PNA directed PCR clamping

DEFF Research Database (Denmark)

Ørum, H.; Nielsen, P.E.; Egholm, M.

1993-01-01

A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

Evolving a polymerase for hydrophobic base analogues.

Science.gov (United States)

Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

2009-10-21

Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

Dynamics of termination during in vitro replication of ultraviolet-irradiated DNA with DNA polymerase III holoenzyme of Escherichia coli

International Nuclear Information System (INIS)

Shwartz, H.; Livneh, Z.

1987-01-01

During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers. The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP. The reinitiation events are nonproductive and are not followed by further elongation. The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase. Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers. We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini

Specific heat of ceramic and single crystal MgB{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Junod, A.; Wang, Y.; Bouquet, F.; Sheikin, I.; Toulemonde, P.; Eskildsen, M.R.; Eisterer, M.; Weber, H.W.; Lee, S.; Tajima, S

2003-05-15

The two-gap structure of MgB{sub 2} gives rise to unusual thermodynamic properties which depart markedly from the single-gap BCS model, both in their temperature- and field-dependence. We report measurements of the specific heat up to 16 T on ceramic and single crystal samples, which demonstrate these effects in bulk. The low-temperature mixed-state specific heat reveals a field-dependent anisotropy, and points to the existence of unusually large vortices, in agreement with local density-of-states measurements by scanning tunneling spectroscopy. It is finally shown that a suitable irradiation process nearly doubles H{sub c2} in the bulk.

Optimizing Taq polymerase concentration for improved signal-to-noise in the broad range detection of low abundance bacteria.

Directory of Open Access Journals (Sweden)

Rudolph Spangler

Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

Science.gov (United States)

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

Science.gov (United States)

Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

2017-01-01

Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

Replication slippage of the thermophilic DNA polymerases B and D from the Euryarchaeota Pyrococcus abyssi

Directory of Open Access Journals (Sweden)

Melissa G. eCastillo-Lizardo

2014-08-01

Full Text Available Replication slippage or slipped-strand mispairing involves the misalignment of DNA strands during the replication of repeated DNA sequences, and can lead to genetic rearrangements such as microsatellite instability. Here, we show that PolB and PolD replicative DNA polymerases from the archaeal model Pyrococcus abyssi (Pab slip in vitro during replication of a single-stranded DNA template carrying a hairpin structure and short direct repeats. We find that this occurs in both their wild-type (exo+ and exonuclease deficient (exo- forms. The slippage behavior of PabPolB and PabPolD, probably due to limited strand displacement activity, resembles that observed for the high fidelity Pyrococcus furiosus (Pfu DNA polymerase. The presence of PabPCNA inhibited PabPolB and PabPolD slippage. We propose a model whereby PabPCNA stimulates strand displacement activity and polymerase progression through the hairpin, thus permitting the error-free replication of repetitive sequences.

The role of DNA polymerase I in liquid holding recovery of UV-irradiated Escherichia coli

International Nuclear Information System (INIS)

Tang, M.-S.; Patrick, M.H.

1977-01-01

Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in, DNA of different strains of E.coli K12 were determined during liquid holding recovery after UV irradiation. The extent of Pyr Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' → 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' → 3' exonuclease. (author)

DNA polymerase η mutational signatures are found in a variety of different types of cancer.

Science.gov (United States)

Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I

2018-01-01

DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.

Affinity Isolation and I-DIRT Mass Spectrometric Analysis of the Escherichia coli O157:H7 Sakai RNA Polymerase Complex▿

Science.gov (United States)

Lee, David J.; Busby, Stephen J. W.; Westblade, Lars F.; Chait, Brian T.

2008-01-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the “core” E. coli genome. PMID:18083804

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

Science.gov (United States)

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

DEFF Research Database (Denmark)

Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer

DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...

A uv-sensitive Chinese hamster lung fibroblast cell line (V79/UC) with a possible defect in DNA polymerase activity is deficient in DNA repair

International Nuclear Information System (INIS)

Creissen, D.M.; Hill, C.K.

1991-01-01

Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present

DNA repair synthesis in human fibroblasts requires DNA polymerase delta

International Nuclear Information System (INIS)

Nishida, C.; Reinhard, P.; Linn, S.

1988-01-01

When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

Side Stream Filtration for Cooling Towers

Energy Technology Data Exchange (ETDEWEB)

None

2012-10-20

This technology evaluation assesses side stream filtration options for cooling towers, with an objective to assess key attributes that optimize energy and water savings along with providing information on specific technology and implementation options. This information can be used to assist Federal sites to determine which options may be most appropriate for their applications. This evaluation provides an overview of the characterization of side stream filtration technology, describes typical applications, and details specific types of filtration technology.

COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

Directory of Open Access Journals (Sweden)

Masashi Miura

2013-12-01

Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

Following DNA chain extension and protein conformational changes in crystals of a Y-family DNA polymerase via Raman crystallography.

Science.gov (United States)

Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R

2013-07-23

Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

DEFF Research Database (Denmark)

Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

2011-01-01

and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

Polymerase Gamma Disease through the Ages

Science.gov (United States)

Saneto, Russell P.; Naviaux, Robert K.

2010-01-01

The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

Inhibition of polymerases-alpha and -beta completely blocks DNA repair induced by UV irradiation in cultured mouse neuronal cells

International Nuclear Information System (INIS)

Licastro, F.; Sarafian, T.; Verity, A.M.; Walford, R.L.

1985-01-01

The effects of hydroxyurea, aphidicolin and dideoxythymidine on UV-induced DNA repair of mouse neuronal granular cells were studied. Aphidicolin, which is considered a specific inhibitor of polymerase-alpha, decreased spontaneous DNA synthesis by 93% and totally suppressed DNA repair. Dideoxythymidine, an inhibitor of polymerase-beta, was more potent in decreasing scheduled DNA synthesis than aphidicolin, and also completely blocked the UV-induced DNA repair. Hydroxyurea, a specific inhibitor of ribonucleotide reductase, inhibited scheduled DNA synthesis, but unscheduled DNA synthesis after UV irradiation was always well detectable. Our data suggest that in neuronal cells from 5 to 10 days old mice both polymerases-alpha and -beta are required for both DNA synthesis and repair. These two enzymes may act jointly in filling up the gaps along the DNA molecule and elongating the DNA chain

No auditory experience, no tinnitus: Lessons from subjects with congenital- and acquired single-sided deafness.

Science.gov (United States)

Lee, Sang-Yeon; Nam, Dong Woo; Koo, Ja-Won; De Ridder, Dirk; Vanneste, Sven; Song, Jae-Jin

2017-10-01

Recent studies have adopted the Bayesian brain model to explain the generation of tinnitus in subjects with auditory deafferentation. That is, as the human brain works in a Bayesian manner to reduce environmental uncertainty, missing auditory information due to hearing loss may cause auditory phantom percepts, i.e., tinnitus. This type of deafferentation-induced auditory phantom percept should be preceded by auditory experience because the fill-in phenomenon, namely tinnitus, is based upon auditory prediction and the resultant prediction error. For example, a recent animal study observed the absence of tinnitus in cats with congenital single-sided deafness (SSD; Eggermont and Kral, Hear Res 2016). However, no human studies have investigated the presence and characteristics of tinnitus in subjects with congenital SSD. Thus, the present study sought to reveal differences in the generation of tinnitus between subjects with congenital SSD and those with acquired SSD to evaluate the replicability of previous animal studies. This study enrolled 20 subjects with congenital SSD and 44 subjects with acquired SSD and examined the presence and characteristics of tinnitus in the groups. None of the 20 subjects with congenital SSD perceived tinnitus on the affected side, whereas 30 of 44 subjects with acquired SSD experienced tinnitus on the affected side. Additionally, there were significant positive correlations between tinnitus characteristics and the audiometric characteristics of the SSD. In accordance with the findings of the recent animal study, tinnitus was absent in subjects with congenital SSD, but relatively frequent in subjects with acquired SSD, which suggests that the development of tinnitus should be preceded by auditory experience. In other words, subjects with profound congenital peripheral deafferentation do not develop auditory phantom percepts because no auditory predictions are available from the Bayesian brain. Copyright © 2017 Elsevier B.V. All rights

Two Family B DNA Polymerases From Aeropyrum pernix, Based on Revised Translational Frames

Directory of Open Access Journals (Sweden)

Katsuya Daimon

2018-04-01

Full Text Available Living organisms are divided into three domains, Bacteria, Eukarya, and Archaea. Comparative studies in the three domains have provided useful information to understand the evolution of the DNA replication machinery. DNA polymerase is the central enzyme of DNA replication. The presence of multiple family B DNA polymerases is unique in Crenarchaeota, as compared with other archaeal phyla, which have a single enzyme each for family B (PolB and family D (PolD. We analyzed PolB1 and PolB3 in the hyperthermophilic crenarchaeon, Aeropyrum pernix, and found that they are larger proteins than those predicted from the coding regions in our previous study and from public database annotations. The recombinant larger PolBs exhibited the same DNA polymerase activities as previously reported. However, the larger PolB3 showed remarkably higher thermostability, which made this enzyme applicable to PCR. In addition, the high tolerance to salt and heparin suggests that PolB3 will be useful for amplification from the samples with contaminants, and therefore it has a great potential for diagnostic use in the medical and environmental field.

Chromosomal location of the human gene for DNA polymerase β

International Nuclear Information System (INIS)

McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

1987-01-01

Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

Real-time dynamics of RNA Polymerase II clustering in live human cells

Science.gov (United States)

Cisse, Ibrahim

2014-03-01

Transcription is the first step in the central dogma of molecular biology, when genetic information encoded on DNA is made into messenger RNA. How this fundamental process occurs within living cells (in vivo) is poorly understood,[1] despite extensive biochemical characterizations with isolated biomolecules (in vitro). For high-order organisms, like humans, transcription is reported to be spatially compartmentalized in nuclear foci consisting of clusters of RNA Polymerase II, the enzyme responsible for synthesizing all messenger RNAs. However, little is known of when these foci assemble or their relative stability. We developed an approach based on photo-activation localization microscopy (PALM) combined with a temporal correlation analysis, which we refer to as tcPALM. The tcPALM method enables the real-time characterization of biomolecular spatiotemporal organization, with single-molecule sensitivity, directly in living cells.[2] Using tcPALM, we observed that RNA Polymerase II clusters form transiently, with an average lifetime of 5.1 (+/- 0.4) seconds. Stimuli affecting transcription regulation yielded orders of magnitude changes in the dynamics of the polymerase clusters, implying that clustering is regulated and plays a role in the cells ability to effect rapid response to external signals. Our results suggest that the transient crowding of enzymes may aid in rate-limiting steps of genome regulation.

77 FR 23238 - Guidelines for Home Energy Professionals: Standard Work Specifications for Single Family Energy...

Science.gov (United States)

2012-04-18

...: Comments on the Guidelines for Home Energy Professionals: Standard Work Specifications for Single Family... DEPARTMENT OF ENERGY Office of Energy Efficiency and Renewable Energy Guidelines for Home Energy Professionals: Standard Work Specifications for Single Family Energy Upgrades AGENCY: Office of Energy...

Shuttling single metal atom into and out of a metal nanoparticle.

Science.gov (United States)

Wang, Shuxin; Abroshan, Hadi; Liu, Chong; Luo, Tian-Yi; Zhu, Manzhou; Kim, Hyung J; Rosi, Nathaniel L; Jin, Rongchao

2017-10-10

It has long been a challenge to dope metal nanoparticles with a specific number of heterometal atoms at specific positions. This becomes even more challenging if the heterometal belongs to the same group as the host metal because of the high tendency of forming a distribution of alloy nanoparticles with different numbers of dopants due to the similarities of metals in outmost electron configuration. Herein we report a new strategy for shuttling a single Ag or Cu atom into a centrally hollow, rod-shaped Au 24 nanoparticle, forming AgAu 24 and CuAu 24 nanoparticles in a highly controllable manner. Through a combined approach of experiment and theory, we explain the shuttling pathways of single dopants into and out of the nanoparticles. This study shows that the single dopant is shuttled into the hollow Au 24 nanoparticle either through the apex or side entry, while shuttling a metal atom out of the Au 25 to form the Au 24 nanoparticle occurs mainly through the side entry.Doping a metal nanocluster with heteroatoms dramatically changes its properties, but it remains difficult to dope with single-atom control. Here, the authors devise a strategy to dope single atoms of Ag or Cu into hollow Au nanoclusters, creating precise alloy nanoparticles atom-by-atom.

Allele specific hybridization using oligonucleotide probes of very high specific activity: Discrimination of the human β/sup A/ and β/sup S/-globin genes

International Nuclear Information System (INIS)

Studencki, A.B.; Wallace, R.B.

1984-01-01

The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence

Functionally Graded Ceramics Fabricated with Side-by-Side Tape Casting for Use in Magnetic Refrigeration

DEFF Research Database (Denmark)

Bulatova, Regina; Bahl, Christian; Andersen, Kjeld Bøhm

2015-01-01

Functionally graded ceramic tapes have been fabricated by a side-by-side tape casting technique. This study shows the possibility and describes the main principles of adjacent coflow of slurries resulting in formation of thin plates of graded ceramic material. Results showed that the small...... variations of solvent and binder system concentrations have a substantial effect on slurry viscosity. Varying these parameters showed that side-by-side tape casting with a well-defined interface area is possible for slurries with viscosities above 3500 mPa s at a casting shear rate of 3.3 s -1...... of developing this graded ceramic tape casting was applications of these specific magnetocaloric properties within the magnetic refrigeration technology....

Attenuation of Foot-and-Mouth Disease Virus by Engineered Viral Polymerase Fidelity.

Science.gov (United States)

Rai, Devendra K; Diaz-San Segundo, Fayna; Campagnola, Grace; Keith, Anna; Schafer, Elizabeth A; Kloc, Anna; de Los Santos, Teresa; Peersen, Olve; Rieder, Elizabeth

2017-08-01

Foot-and-mouth disease virus (FMDV) RNA-dependent RNA polymerase (RdRp) (3D pol ) catalyzes viral RNA synthesis. Its characteristic low fidelity and absence of proofreading activity allow FMDV to rapidly mutate and adapt to dynamic environments. In this study, we used the structure of FMDV 3D pol in combination with previously reported results from similar picornaviral polymerases to design point mutations that would alter replication fidelity. In particular, we targeted Trp237 within conserved polymerase motif A because of the low reversion potential inherent in the single UGG codon. Using biochemical and genetic tools, we show that the replacement of tryptophan 237 with phenylalanine imparts higher fidelity, but replacements with isoleucine and leucine resulted in lower-fidelity phenotypes. Viruses containing these W237 substitutions show in vitro growth kinetics and plaque morphologies similar to those of the wild-type (WT) A 24 Cruzeiro strain in BHK cells, and both high- and low-fidelity variants retained fitness during coinfection with the wild-type virus. The higher-fidelity W237F (W237F HF ) mutant virus was more resistant to the mutagenic nucleoside analogs ribavirin and 5-fluorouracil than the WT virus, whereas the lower-fidelity W237I (W237I LF ) and W237L LF mutant viruses exhibited lower ribavirin resistance. Interestingly, the variant viruses showed heterogeneous and slightly delayed growth kinetics in primary porcine kidney cells, and they were significantly attenuated in mouse infection experiments. These data demonstrate, for a single virus, that either increased or decreased RdRp fidelity attenuates virus growth in animals, which is a desirable feature for the development of safer and genetically more stable vaccine candidates. IMPORTANCE Foot-and-mouth disease (FMD) is the most devastating disease affecting livestock worldwide. Here, using structural and biochemical analyses, we have identified FMDV 3D pol mutations that affect polymerase

Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

NARCIS (Netherlands)

Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

Reduction of postreplication DNA repair in two Escherichia coli mutants with temperature-sensitive polymerase III activity: implications for the postreplication repair pathway

International Nuclear Information System (INIS)

Johnson, R.C.

1978-01-01

Daughter strand gaps are secondary lesions caused by interrupted DNA synthesis in the proximity of uv-induced pyrimidine dimers. The relative roles of DNA recombination and de novo DNA synthesis in filling such gaps have not been clarified, although both are required for complete closure. In this study, the Escherichia coli E486 and E511 dnaE(Ts) mutants, in which DNA polymerase I but not DNA polymerase III is active at 43 0 C, were examined. Both mutants demonstrated reduced gap closure in comparison with the progenitor strain at the nonpermissive temperature. These results and those of previous studies support the hypothesis that both DNA polymerase I and DNA polymerase III contribute to gap closure, suggesting a cooperative effort in the repair of each gap. Benzoylated, naphthoylated diethylaminoethyl-cellulose chromatography analysis for persistence of single-strand DNA in the absence of DNA polymerase III activity suggested that de novo DNA synthesis initiates the filling of daughter strand gaps

The Afghan Mission: The Other Side of the COIN

Directory of Open Access Journals (Sweden)

Luděk MORAVEC

2010-12-01

Full Text Available This article called “The Afghan Mission: The Other Side of the COIN” brings an evaluation of NATO and the Taliban strategies in contemporary Afghanistan. The strategic choice of both actors is researched using the concept of the “centers of gravity” and confronted with a specific situation on the ground. Furthermore, additional attention is paid to the struggle for hearts and minds and its role in NATO’s strategy. The paper is concluded with the determination of a single center of gravity of the NATO-Taliban confrontation which is offered as the evaluation criterion for further steps to be used in the Afghan war.

Magnetic field modeling and optimal operational control of a single-side axial-flux permanent magnet motor with center poles

International Nuclear Information System (INIS)

Liu, C.-T.; Lee, S.-C.

2006-01-01

A detailed approach for analyzing magnetic field distributions of a single-sided axial-flux permanent magnet motor with center poles will be provided. Based on the devised flux model, the related position-dependent torque and axial force of the motor can be systematically developed. By incorporating adequate control designs, the optimal operational performance of the motor system can be conveniently achieved. Results showed that not only the motor structure is suitable for related military and transportation applications, but also the magnetic field model can provide appropriate mathematical basis for relative operational realizations

Detection of Left-Sided and Right-Sided Hearing Loss via Fractional Fourier Transform

Directory of Open Access Journals (Sweden)

Shuihua Wang

2016-05-01

Full Text Available In order to detect hearing loss more efficiently and accurately, this study proposed a new method based on fractional Fourier transform (FRFT. Three-dimensional volumetric magnetic resonance images were obtained from 15 patients with left-sided hearing loss (LHL, 20 healthy controls (HC, and 14 patients with right-sided hearing loss (RHL. Twenty-five FRFT spectrums were reduced by principal component analysis with thresholds of 90%, 95%, and 98%, respectively. The classifier is the single-hidden-layer feed-forward neural network (SFN trained by the Levenberg–Marquardt algorithm. The results showed that the accuracies of all three classes are higher than 95%. In all, our method is promising and may raise interest from other researchers.

Effects of side lying on lung function in older individuals.

Science.gov (United States)

Manning, F; Dean, E; Ross, J; Abboud, R T

1999-05-01

Body positioning exerts a strong effect on pulmonary function, but its effect on other components of the oxygen transport pathway are less well understood, especially the effects of side-lying positions. This study investigated the interrelationships between side-lying positions and indexes of lung function such as spirometry, alveolar diffusing capacity, and inhomogeneity of ventilation in older individuals. Nineteen nonsmoking subjects (mean age=62.8 years, SD=6.8, range=50-74) with no history of cardiac or pulmonary disease were tested over 2 sessions. The test positions were sitting and left side lying in one session and sitting and right side lying in the other session. In each of the positions, forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), single-breath pulmonary diffusing capacity (DLCO/VA), and the slope of phase III (DN2%/L) of the single-breath nitrogen washout test to determine inhomogeneity of ventilation were measured. Compared with measurements obtained in the sitting position, FVC and FEV1 were decreased equally in the side-lying positions, but no change was observed in DLCO/VA or DN2%/L. Side-lying positions resulted in decreases in FVC and FEV1, which is consistent with the well-documented effects of the supine position. These findings further support the need for prescriptive rather than routine body positioning of patients with risks of cardiopulmonary compromise and the need to use upright positions in which lung volumes and capacities are maximized.

Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

Science.gov (United States)

Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

2017-02-07

Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Science.gov (United States)

Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

2012-01-01

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

Worldsid small female side impact dummy specifications and prototype evaluation

NARCIS (Netherlands)

Been, B.W.; Meijer, R.; Bermond, F.; Bortenschlager, K.; Hynd, D.; Martinez, L.; Ferichola, G.

2007-01-01

The WorldSID program was set up to develop a new, worldwide acceptable, advanced technology, side impact crash test dummy for improved assessment of injury risk to car occupants in lateral collisions. Following the release of the mid-sized male WorldSID, the development of the small female WorldSID

Detection of Leptospira spp. in wild Phrynops geoffroanus (Geoffroy's side-necked turtle) in urban environment.

Science.gov (United States)

Oliveira, J P; Kawanami, A E; Silva, A S L; Chung, D G; Werther, K

2016-12-01

Leptospira spp., a zoonotic agent relevant for public health, occurs frequently in tropical regions. The aquatic environment represents a viable survival and transmission pathway. This study aimed to investigate the presence of anti-Leptospira spp. antibodies in Phrynops geoffroanus (Geoffroy's side-necked turtle) serum samples using the microagglutination test (MAT), and Leptospira spp. in gastric and cloacal lavage samples using the polymerase chain reaction (PCR) technique. Antibodies against nine different Leptospira spp. serovars were detected in 45.45% (30/66) of the serum samples. Specific amplification of Leptospira spp. genomic material (331bp) was observed in 16.67% (11/66) of the samples. In conclusion, these freshwater testudines host Leptospira spp. and eliminate them. This situation may represent a risk to public health, especially to people who use urban streams for fishing and recreational activities. Additionally, we described some Leptospira spp. serovars, not yet reported in testudines, detected here in P. geoffroanus. Copyright © 2016 Elsevier B.V. All rights reserved.

The operation of a single-sided linear induction motor with squirrel-cage and solid-steel reaction rails

Science.gov (United States)

Eastham, A. R.; Katz, R. M.

1980-09-01

Two test programs have been conducted to evaluate the performance of a single-sided linear induction motor with a squirrel-cage reaction rail and with a solid steel reaction rail. A 1.73-m-long six-pole stator interacted with the rails mounted on the rim of a 7.6-m-diam wheel. A 64-channel data acquisition system allowed tests to be performed over a wide range of operating conditions at speeds up to 20 m/sec. Typical test results which compare and contrast the mechanical, electrical and magnetic behavior of the SLIMs are presented. The test data are being used to assess the SLIM as an integrated suspension/propulsion system and for other transportation applications.

Role of DNA polymerase α in chromosomal aberration production by ionizing radiation

International Nuclear Information System (INIS)

Bender, M.A.

1983-01-01

Aphidicolin is a tetracyclic diterpinoid fungal antibiotic which inhibits DNA synthesis in eukaryotic cells by interfering specifically with DNA polymerase α, apparently by binding to and inactivating the DNA-polymerase α complex. We have shown that aphidicolin, like other inhibitors of DNA synthesis, both induces chromosomal aberrations in human peripheral lymphocytes, and, as a post-treatment, interacts synergistically with x rays to produce greatly enhanced aberration yields. The present experiments explore the effects of aphidicolin in human lymphocytes in the post-DNA-synthetic G 2 phase of the cell cycle. These experiments utilized labeling with tritiated thymidine to positively identify cells in the S phase at the time of treatment, and used serial colcemid collections and fixations to determine aberration yields over as much of the G 2 phase as feasible. Because DNA polymerase α is the only DNA synthetic or repair enzyme known to be affected by aphidicolin, we infer that this enzyme is directly involved in the repair of DNA lesions which can result in visible chromosomal aberrations. (DT)

Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

International Nuclear Information System (INIS)

Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.

1988-01-01

DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

Directory of Open Access Journals (Sweden)

Partha Sarathi Mandal

2017-03-01

Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

Diagnostic challenges of single plaque-like lesion paucibacillary leprosy

Directory of Open Access Journals (Sweden)

Raquel Rodrigues Barbieri

2014-11-01

Full Text Available The diagnosis of single-lesion paucibacillary leprosy remains a challenge. Reviews by expert dermatopathologists and quantitative polymerase chain reaction (qPCR results obtained from 66 single-plaque biopsy samples were compared. Histological findings were graded as high (HP, medium (MP or low (LP probability of leprosy or other dermatopathy (OD. Mycobacterium leprae-specific genes were detected using qPCR. The biopsies of 47 out of 57 clinically diagnosed patients who received multidrug therapy were classified as HP/MP, eight of which were qPCR negative. In the LP/OD (n = 19, two out of eight untreated patients showed positive qPCR results. In the absence of typical histopathological features, qPCR may be utilised to aid in final patient diagnosis, thus reducing overtreatment and delay in diagnosis.

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

Science.gov (United States)

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

DEFF Research Database (Denmark)

Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

2015-01-01

BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

The role of DNA polymerase {iota} in UV mutational spectra

Energy Technology Data Exchange (ETDEWEB)

Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail: gpfeifer@coh.org

2006-07-25

UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.

Repair of X-ray-induced single-strand breaks by a cell-free system

International Nuclear Information System (INIS)

Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

1990-01-01

Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

Interaction of sigma 70 with Escherichia coli RNA polymerase core enzyme studied by surface plasmon resonance.

Science.gov (United States)

Ferguson, A L; Hughes, A D; Tufail, U; Baumann, C G; Scott, D J; Hoggett, J G

2000-09-22

The interaction between the core form of bacterial RNA polymerases and sigma factors is essential for specific promoter recognition, and for coordinating the expression of different sets of genes in response to varying cellular needs. The interaction between Escherichia coli core RNA polymerase and sigma 70 has been investigated by surface plasmon resonance. The His-tagged form of sigma 70 factor was immobilised on a Ni2+-NTA chip for monitoring its interaction with core polymerase. The binding constant for the interaction was found to be 1.9x10(-7) M, and the dissociation rate constant for release of sigma from core, in the absence of DNA or transcription, was 4x10(-3) s(-1), corresponding to a half-life of about 200 s.

Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

Directory of Open Access Journals (Sweden)

Trina Ekawati Tallei

2015-10-01

Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

Directory of Open Access Journals (Sweden)

C Coelho

2003-06-01

Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

Mammalian α-polymerase: cloning of partial complementary DNA and immunobinding of catalytic subunit in crude homogenate protein blots

International Nuclear Information System (INIS)

SenGupta, D.N.; Kumar, P.; Zmudzka, B.Z.; Coughlin, S.; Vishwanatha, J.K.; Robey, F.A.; Parrott, C.; Wilson, S.H.

1987-01-01

A new polyclonal antibody against the α-polymerase catalytic polypeptide was prepared by using homogeneous HeLa cellα-polymerase. The antibody neutralized α-polymerase activity and was strong and specific for the α-polymerase catalytic polypeptide (M/sub r/ 183,000) in Western blot analysis of crude extracts of HeLa cells. The antibody was used to screen a cDNA library of newborn rat brain poly(A+) RNA in λgt11. A positive phage was identified and plaque purified. This phage, designated λpolα1.2, also was found to be positive with an antibody against Drosophila α-polymerase. The insert in λpolα1.2 (1183 base pairs) contained a poly(A) sequence at the 3' terminus and a short in-phase open reading frame at the 5' terminus. A synthetic oligopeptide (eight amino acids) corresponding to the open reading frame was used to raise antiserum in rabbits. Antibody affinity purified from this serum was found to be immunoreactive against purified α-polymerase by enzyme-linked immunosorbent assay and was capable of immunoprecipitating α-polymerase. This indicated the λpolα1.2 insert encoded an α-polymerase epitope and suggested that the cDNA corresponded to an α-polymerase mRNA. This was confirmed in hybrid selection experiments using pUC9 containing the cDNA insert and poly(A+) RNA from newborn rat brain; the insert hybridized to mRNA capable of encoding α-polymerase catalytic polypeptides. Northern blot analysis of rat brain poly(A+) RNA revealed that this mRNA is ∼5.4 kilobases

Structural relationships among the multiple forms of DNA-dependent RNA polymerase II from cultured parsley cells

International Nuclear Information System (INIS)

Link, G.; Bogorad, L.; Kidd, G.H.; Richter, G.

1978-01-01

DNA-dependent RNA polymerase II (or B) was purified from cultured parsley cells, and its molecular structure was examined in detail. Upon centrifugation through glycerol gradients, RNA polymerase II sediments as a single band with an apparent sedimentation constant of 15S. No contamination with RNA polymerases I or III could be detected when the activity of purified RNA polymerase II was assayed in the presence of high concentrations of α-amanitin. Analysis of purified RNA polymerase II be nondenaturing and denaturing polyacrylamide gel electrophoresis revealed that this enzyme exists in multiple forms. They were designated II(O), II(A), and II(B). It is suggested that each form has a subunit of Mr = 140000 as well as smaller polypeptides in common. They differ, however, in the molecular weights of their largest subunits which is 220000 in form II(O), 200000 in form II(A), and 180000 in form II(B). These large subunits were labelled with 125 I, digested with trypsin, and tryptic digests were compared by two-dimensional analysis on thin-layer plates (Elder et al. (1977) J. Biol. Chem. 252, 6510-6515). Fingerprints of tryptic digests from the polypeptides with Mr = 220000, Mr = 200000, and Mr = 180000 were similar. It is, therefore, suggested that these subunits are stucturally related. A tryptic digest was also produced from the subunit with Mr = 140000. Its fingerprint was found to yield a considerably different distribution of peptides as compared to those from the three large subunits. (orig.) [de

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

Science.gov (United States)

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Side insertable spacer

International Nuclear Information System (INIS)

Patterson, J.F.; Ewing, R.H.

1992-01-01

This patent describes a spacer for restraining the fuel rods of a nuclear fuel assembly, the assembly being formed of a plurality of parallel, elongated fuel rods so arranged that the assembly is bounded by a polygon having an even number of sides, the rods being so arranged as to lie in a plurality of sets of parallel rows, the rows of each set being perpendicular to one of the sides of the polygon. It comprises a number of spacer combs equal to at least half the number of the sides of the polygon, the spacer combs being superposed on each other, each of the spacer combs comprising: a single base strip having a length equal to that of one of the sides of the polygon and grid strips equal in number to the spaces between rows in one of the sets, and at least a majority of the grid strips being of a length sufficient to extend substantially the full length of the rows; the grid strips being provided with spring members positioned to engage each of the rods; the grid strips being provided with spring members positioned to engage each of the rods; the grid strips being secured to and extending at right angles to the base strip; the grid strips of different combs being positioned at angles to each other, so as to occupy the spaces between rows in different sets

Early detection of typhoid by polymerase chain reaction

International Nuclear Information System (INIS)

Haque, A.; Qureshi, Javed A.; Ahmed, J.

1999-01-01

Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

Science.gov (United States)

Tubeleviciute, Agne; Skirgaila, Remigijus

2010-08-01

The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

DEFF Research Database (Denmark)

Østergaard, Lars; Traulsen, J; Birkelund, Svend

1991-01-01

the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

DEFF Research Database (Denmark)

Østergaard, Lars; Traulsen, J; Birkelund, Svend

1993-01-01

the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

RNA polymerase activity of Ustilago maydis virus

Energy Technology Data Exchange (ETDEWEB)

Yie, S.W.

1986-01-01

Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

Science.gov (United States)

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

DEFF Research Database (Denmark)

Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

2005-01-01

Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

Directory of Open Access Journals (Sweden)

Javier Abellón-Ruiz

2016-01-01

Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

Science.gov (United States)

Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

2011-08-01

DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

A polymerase chain reaction strategy for the diagnosis of camelpox.

Science.gov (United States)

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

Conformation-specific spectroscopy of capped glutamine-containing peptides: role of a single glutamine residue on peptide backbone preferences.

Science.gov (United States)

Walsh, Patrick S; Dean, Jacob C; McBurney, Carl; Kang, Hyuk; Gellman, Samuel H; Zwier, Timothy S

2016-04-28

The conformational preferences of a series of short, aromatic-capped, glutamine-containing peptides have been studied under jet-cooled conditions in the gas phase. This work seeks a bottom-up understanding of the role played by glutamine residues in directing peptide structures that lead to neurodegenerative diseases. Resonant ion-dip infrared (RIDIR) spectroscopy is used to record single-conformation infrared spectra in the NH stretch, amide I and amide II regions. Comparison of the experimental spectra with the predictions of calculations carried out at the DFT M05-2X/6-31+G(d) level of theory lead to firm assignments for the H-bonding architectures of a total of eight conformers of four molecules, including three in Z-Gln-OH, one in Z-Gln-NHMe, three in Ac-Gln-NHBn, and one in Ac-Ala-Gln-NHBn. The Gln side chain engages actively in forming H-bonds with nearest-neighbor amide groups, forming C8 H-bonds to the C-terminal side, C9 H-bonds to the N-terminal side, and an amide-stacked geometry, all with an extended (C5) peptide backbone about the Gln residue. The Gln side chain also stabilizes an inverse γ-turn in the peptide backbone by forming a pair of H-bonds that bridge the γ-turn and stabilize it. Finally, the entire conformer population of Ac-Ala-Gln-NHBn is funneled into a single structure that incorporates the peptide backbone in a type I β-turn, stabilized by the Gln side chain forming a C7 H-bond to the central amide group in the β-turn not otherwise involved in a hydrogen bond. This β-turn backbone structure is nearly identical to that observed in a series of X-(AQ)-Y β-turns in the protein data bank, demonstrating that the gas-phase structure is robust to perturbations imposed by the crystalline protein environment.

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

Science.gov (United States)

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

Science.gov (United States)

James, Ameh; Macdonald, Joanne

2015-01-01

Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents.

Science.gov (United States)

Murray, V

1999-01-01

This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

DNA Polymerase α (swi7) and the Flap Endonuclease Fen1 (rad2) Act Together in the S-Phase Alkylation Damage Response in S. pombe

Science.gov (United States)

Koulintchenko, Milana; Vengrova, Sonya; Eydmann, Trevor; Arumugam, Prakash; Dalgaard, Jacob Z.

2012-01-01

Polymerase α is an essential enzyme mainly mediating Okazaki fragment synthesis during lagging strand replication. A specific point mutation in Schizosaccharomyces pombe polymerase α named swi7-1, abolishes imprinting required for mating-type switching. Here we investigate whether this mutation confers any genome-wide defects. We show that the swi7-1 mutation renders cells hypersensitive to the DNA damaging agents methyl methansulfonate (MMS), hydroxyurea (HU) and UV and incapacitates activation of the intra-S checkpoint in response to DNA damage. In addition we show that, in the swi7-1 background, cells are characterized by an elevated level of repair foci and recombination, indicative of increased genetic instability. Furthermore, we detect novel Swi1-, -Swi3- and Pol α- dependent alkylation damage repair intermediates with mobility on 2D-gel that suggests presence of single-stranded regions. Genetic interaction studies showed that the flap endonuclease Fen1 works in the same pathway as Pol α in terms of alkylation damage response. Fen1 was also required for formation of alkylation- damage specific repair intermediates. We propose a model to explain how Pol α, Swi1, Swi3 and Fen1 might act together to detect and repair alkylation damage during S-phase. PMID:23071723

An Evaluation of One-Sided and Two-Sided Communication Paradigms on Relaxed-Ordering Interconnect

Energy Technology Data Exchange (ETDEWEB)

Ibrahim, Khaled Z. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Hargrove, Paul H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Iancu, Costin [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Yelick, Katherine [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2014-08-14

The Cray Gemini interconnect hardware provides multiple transfer mechanisms and out-of-order message delivery to improve communication throughput. In this paper we quantify the performance of one-sided and two-sided communication paradigms with respect to: 1) the optimal available hardware transfer mechanism, 2) message ordering constraints, 3) per node and per core message concurrency. In addition to using Cray native communication APIs, we use UPC and MPI micro-benchmarks to capture one- and two-sided semantics respectively. Our results indicate that relaxing the message delivery order can improve performance up to 4.6x when compared with strict ordering. When hardware allows it, high-level one-sided programming models can already take advantage of message reordering. Enforcing the ordering semantics of two-sided communication comes with a performance penalty. Furthermore, we argue that exposing out-of-order delivery at the application level is required for the next-generation programming models. Any ordering constraints in the language specifications reduce communication performance for small messages and increase the number of active cores required for peak throughput.

Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

Science.gov (United States)

Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

2018-01-01

Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

A DANREF certified reference plastic for measurement of overall migration into the food simulant olive oil by single sided testing

DEFF Research Database (Denmark)

Lund, K. H.; Lillemark, L.; Petersen, Jens Højslev

2000-01-01

A reference material for the determination of overall migration from a plastic coextrudate into the fatty food simulant olive oil was produced and certified in an interlaboratory study. The analyses were carried out according to the ENV 1186 standard from the European Committee for Standardization...... (CEN) [1, 2, 3] with exposure of the coextrudate to olive oil for 10 days at 40 degrees C. After an initial preliminary interlaboratory study eight laboratories participated in the certification round, and two different methods were used to obtain single sided exposure of the plastic to the oil...

Galactomannan and Polymerase Chain Reaction-Based Screening for Invasive Aspergillosis Among High-Risk Hematology Patients: A Diagnostic Meta-analysis.

Science.gov (United States)

Arvanitis, Marios; Anagnostou, Theodora; Mylonakis, Eleftherios

2015-10-15

Screening of high-risk patients for invasive aspergillosis (IA) has the potential to decrease the use of empiric antifungal agents. However, the performance of different screening methods has not been studied. We performed a meta-analysis of published studies to assess the diagnostic performance of galactomannan (GM) and polymerase chain reaction (PCR) as weekly screening tests in high-risk populations. The sensitivity and specificity of 6 approaches combining GM and PCR were estimated using the bivariate model. Thirteen studies with 1670 patients met our inclusion criteria. Single positive test results had modest sensitivity and specificity for screening (respectively, 92% and 90% for GM; 84% and 76% for PCR). The screening approach with the highest sensitivity was the one that used at least 1 GM- or PCR-positive result to define a positive episode, achieving a sensitivity of 99%, significantly higher than any single test (P = .0018 compared with GM and P value of 100%, whereas the presence of at least 2 positive results is highly suggestive of an active infection with a positive predictive value of 88%. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

NARCIS (Netherlands)

Vens, C.; Hofland, I.; Begg, A.C.

2007-01-01

Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

Design Multi-Sides System Unmanned Surface Vehicle (USV) Rocket

Science.gov (United States)

Syam, Rafiudin; Sutresman, Onny; Mappaita, Abdullah; Amiruddin; Wiranata, Ardi

2018-02-01

This study aims to design and test USV multislide forms. This system is excellent for maneuvering on the x-y-z coordinates. The disadvantage of a single side USV is that it is very difficult to maneuver to achieve very dynamic targets. While for multi sides system easily maneuvered though x-y-z coordinates. In addition to security defense purposes, multi-side system is also good for maritime intelligence, surveillance. In this case, electric deducted fan with Multi-Side system so that the vehicle can still operate even in reverse condition. Multipleside USV experiments have done with good results. In a USV study designed to use two propulsions.

Enhancement of DNA polymerase activity in potato tuber slices

International Nuclear Information System (INIS)

Watanabe, Akira; Imaseki, Hidemasa

1977-01-01

DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)

DNA Polymerase Fidelity: Beyond Right and Wrong.

Science.gov (United States)

Washington, M Todd

2016-11-01

Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

Science.gov (United States)

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

2012-10-01

To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

[Psychoanalysis and Side Effect].

Science.gov (United States)

Shirahase, Joichiro

2015-01-01

A study of psychoanalysis from the perspective of side effects reveals that its history was a succession of measures to deal with its own side effects. This, however, does not merely suggest that, as a treatment method, psychoanalysis is incomplete and weak: rather, its history is a record of the growth and development of psychoanalysis that discovered therapeutic significance from phenomena that were initially regarded as side effects, made use of these discoveries, and elaborated them as a treatment method. The approach of research seen during the course of these developments is linked to the basic therapeutic approach of psychoanalysis. A therapist therefore does not draw conclusions about a patient's words and behaviors from a single aspect, but continues to make efforts to actively discover a variety of meanings and values from them, and to make the patient's life richer and more productive. This therapeutic approach is undoubtedly one of the unique aspects of psychoanalysis. I discuss the issue of psychoanalysis and side effects with the aim of clarifying this unique characteristic of psychoanalysis. The phenomenon called resistance inevitably emerges during the process of psychoanalytic treatment. Resistance can not only obstruct the progress of therapy; it also carries the risk of causing a variety of disadvantages to the patient. It can therefore be seen as an adverse effect. However, if we re-examine this phenomenon from the perspective of transference, we find that resistance is in fact a crucial tool in psychoanalysis, and included in its main effect, rather than a side effect. From the perspective of minimizing the character of resistance as a side effect and maximizing its character as a main effect, I have reviewed logical organization, dynamic evaluation, the structuring of treatment, the therapist's attitudes, and the training of therapists. I conclude by stating that psychoanalysis has aspects that do not match the perspective known as a side

Development of the polymerase chain reaction for diagnosis of chancroid.

Science.gov (United States)

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Constraints for system specifications for the double-shell and single-shell tank systems

International Nuclear Information System (INIS)

SHAW, C.P.

1999-01-01

This is a supporting document for the Level 1 Double-Shell and Single-Shell System Specifications. The rationale for selection of specific regulatory constraining documents cited in the two system specifications is provided. many of the regulations have been implemented by the Project Hanford Management Contract procedures (HNF-PROs) and as such noted and traced back to their origins in State and Federal regulations

Constraints for system specifications for the double-shell and single-shell tank systems

Energy Technology Data Exchange (ETDEWEB)

SHAW, C.P.

1999-05-18

This is a supporting document for the Level 1 Double-Shell and Single-Shell System Specifications. The rationale for selection of specific regulatory constraining documents cited in the two system specifications is provided. many of the regulations have been implemented by the Project Hanford Management Contract procedures (HNF-PROs) and as such noted and traced back to their origins in State and Federal regulations.

An AP endonuclease 1-DNA polymerase beta complex: theoretical prediction of interacting surfaces.

Directory of Open Access Journals (Sweden)

Alexej Abyzov

2008-04-01

Full Text Available Abasic (AP sites in DNA arise through both endogenous and exogenous mechanisms. Since AP sites can prevent replication and transcription, the cell contains systems for their identification and repair. AP endonuclease (APEX1 cleaves the phosphodiester backbone 5' to the AP site. The cleavage, a key step in the base excision repair pathway, is followed by nucleotide insertion and removal of the downstream deoxyribose moiety, performed most often by DNA polymerase beta (pol-beta. While yeast two-hybrid studies and electrophoretic mobility shift assays provide evidence for interaction of APEX1 and pol-beta, the specifics remain obscure. We describe a theoretical study designed to predict detailed interacting surfaces between APEX1 and pol-beta based on published co-crystal structures of each enzyme bound to DNA. Several potentially interacting complexes were identified by sliding the protein molecules along DNA: two with pol-beta located downstream of APEX1 (3' to the damaged site and three with pol-beta located upstream of APEX1 (5' to the damaged site. Molecular dynamics (MD simulations, ensuring geometrical complementarity of interfaces, enabled us to predict interacting residues and calculate binding energies, which in two cases were sufficient (approximately -10.0 kcal/mol to form a stable complex and in one case a weakly interacting complex. Analysis of interface behavior during MD simulation and visual inspection of interfaces allowed us to conclude that complexes with pol-beta at the 3'-side of APEX1 are those most likely to occur in vivo. Additional multiple sequence analyses of APEX1 and pol-beta in related organisms identified a set of correlated mutations of specific residues at the predicted interfaces. Based on these results, we propose that pol-beta in the open or closed conformation interacts and makes a stable interface with APEX1 bound to a cleaved abasic site on the 3' side. The method described here can be used for analysis in

Identification of the Viscous Superlayer on the Low-Speed Side of a Single-Stream Shear Layer

Science.gov (United States)

Foss, John; Peabody, Jason

2010-11-01

Image pairs (elevation/plan views) have been acquired of a smoke streakline originating in the irrotational region on the low-speed side of a high Re single-stream shear layer of Morris and Foss (2003). The viscous superlayer (VSL) is identified as the terminus of the streak; 1800 such images provide VSL position statistics. Hot-wire data acquired concurrently at the shear layer edge and interior are used to investigate the relationship between these velocity magnitudes and the large-scale motions. Distinctive features (plumes) along the streakline are tracked between images to provide discrete irrotational region velocity magnitudes and material trajectories. A non-diffusive marker, introduced in the separating (high speed) boundary layer and imaged at x/θo=352, has revealed an unexpected bias in the streak-defined VSL locations. The interpretation of this bias clarifies the induced flow patterns in the entrainment region. The observations are consistent with a conception of the large-scale shear layer motions as "billows" of vortical fluid separated by re-entrant "wedges" of irrotational fluid, per Phillips (1972). Morris, S.C. and Foss, J.F. (2003). "Turbulent Boundary Layer to Single Stream Shear Layer: The Transition Region." Journal of Fluid Mechanics. Vol. 494, pp. 187-221. Phillips, O. M. (1972). "The Entrainment Interface." Journal of Fluid Mechanics. Vol. 51, pp. 97-118.

Molecular mechanisms of conformational specificity: A study of Hox in vivo target DNA binding specificities and the structure of a Ure2p mutation that affects fibril formation rates

Science.gov (United States)

Bauer, William Joseph, Jr.

The fate of an individual cell, or even an entire organism, is often determined by minute, yet very specific differences in the conformation of a single protein species. Very often, proteins take on alternate folds or even side chain conformations to deal with different situations present within the cell. These differences can be as large as a whole domain or as subtle as the alteration of a single amino acid side chain. Yet, even these seemingly minor side chain conformational differences can determine the development of a cell type during differentiation or even dictate whether a cell will live or die. Two examples of situations where minor conformational differences within a specific protein could lead to major differences in the life cycle of a cell are described herein. The first example describes the variations seen in DNA conformations which can lead to slightly different Hox protein binding conformations responsible for recognizing biologically relevant regulatory sites. These specific differences occur in the minor groove of the bound DNA and are limited to the conformation of only two side chains. The conformation of the bound DNA, however, is not solely determined by the sequence of the DNA, as multiple sequences can result in the same DNA conformation. The second example takes place in the context of a yeast prion protein which contains a mutation that decreases the frequency at which fibrils form. While the specific interactions leading to this physiological change were not directly detected, it can be ascertained from the crystal structure that the structural changes are subtle and most likely involve another binding partner. In both cases, these conformational changes are very slight but have a profound effect on the downstream processes.

Mechanism for Coordinated RNA Packaging and Genome Replication by Rotavirus Polymerase VP1

Energy Technology Data Exchange (ETDEWEB)

Lu, Xiaohui; McDonald, Sarah M.; Tortorici, M. Alejandra; Tao, Yizhi Jane; Vasquez-Del Carpio, Rodrigo; Nibert, Max L.; Patton, John T.; Harrison, Stephen C. (Harvard-Med); (NIH); (CH-Boston)

2009-04-08

Rotavirus RNA-dependent RNA polymerase VP1 catalyzes RNA synthesis within a subviral particle. This activity depends on core shell protein VP2. A conserved sequence at the 3' end of plus-strand RNA templates is important for polymerase association and genome replication. We have determined the structure of VP1 at 2.9 {angstrom} resolution, as apoenzyme and in complex with RNA. The cage-like enzyme is similar to reovirus {lambda}3, with four tunnels leading to or from a central, catalytic cavity. A distinguishing characteristic of VP1 is specific recognition, by conserved features of the template-entry channel, of four bases, UGUG, in the conserved 3' sequence. Well-defined interactions with these bases position the RNA so that its 3' end overshoots the initiating register, producing a stable but catalytically inactive complex. We propose that specific 3' end recognition selects rotavirus RNA for packaging and that VP2 activates the autoinhibited VP1/RNA complex to coordinate packaging and genome replication.

Nucleotide-mimetic synthetic ligands for DNA-recognizing enzymes One-step purification of Pfu DNA polymerase.

Science.gov (United States)

Melissis, S; Labrou, N E; Clonis, Y D

2006-07-28

The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.

Repair of Clustered Damage and DNA Polymerase Iota.

Science.gov (United States)

Belousova, E A; Lavrik, O I

2015-08-01

Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

Directory of Open Access Journals (Sweden)

Hirokazu Takahashi

Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

Scheme for secure swapping two unknown states of a photonic qubit and an electron-spin qubit using simultaneous quantum transmission and teleportation via quantum dots inside single-sided optical cavities

Energy Technology Data Exchange (ETDEWEB)

Heo, Jino [College of Electrical and Computer Engineering, Chungbuk National University, Chungdae-ro 1, Seowon-Gu, Cheongju (Korea, Republic of); Kang, Min-Sung [Center for Quantum Information, Korea Institute of Science and Technology (KIST), Seoul, 136-791 (Korea, Republic of); Hong, Chang-Ho [National Security Research Institute, P.O.Box 1, Yuseong, Daejeon, 34188 (Korea, Republic of); Choi, Seong-Gon [College of Electrical and Computer Engineering, Chungbuk National University, Chungdae-ro 1, Seowon-Gu, Cheongju (Korea, Republic of); Hong, Jong-Phil, E-mail: jongph@cbnu.ac.kr [College of Electrical and Computer Engineering, Chungbuk National University, Chungdae-ro 1, Seowon-Gu, Cheongju (Korea, Republic of)

2017-06-15

We propose a scheme for swapping two unknown states of a photon and electron spin confined to a charged quantum dot (QD) between two users by transferring a single photon. This scheme simultaneously transfers and teleports an unknown state (electron spin) between two users. For this bidirectional quantum communication, we utilize the interactions between a photonic and an electron-spin qubits of a QD located inside a single-sided optical cavity. Thus, our proposal using QD-cavity systems can obtain a certain success probability with high fidelity. Furthermore, compared to a previous scheme using cross-Kerr nonlinearities and homodyne detections, our scheme (using QD-cavity systems) can improve the feasibility under the decoherence effect in practice. - Highlights: • Design of Simultaneous quantum transmission and teleportation scheme via quantum dots and cavities. • We have developed the experimental feasibility of this scheme compared with the existing scheme. • Analysis of some benefits when our scheme is experimentally implemented using quantum dots and single-sided cavities.

Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae

Energy Technology Data Exchange (ETDEWEB)

Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)

2013-02-08

Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.

Residue specific hydration of primary cell wall potato pectin identified by solid-state 13C single-pulse MAS and CP/MAS NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Chrestensen, Inge Byg; Damager, Iben

2011-01-01

Hydration of rhamnogalacturonan-I (RG-I) derived from potato cell wall was analyzed by 13C single-pulse (SP) magic-angle-spinning (MAS) and 13C cross-polarization (CP) MAS nuclear magnetic resonance (NMR) and supported by 2H SP/MAS NMR experiments. The study shows that the arabinan side chains...... hydrate more readily than the galactan side chains and suggests that the overall hydration properties can be controlled by modifying the ratio of these side chains. Enzymatic modification of native (NA) RG-I provided samples with reduced content of arabinan (sample DA), galactan (sample DG), or both side...... chains (sample DB). Results of these samples suggested that hydration properties were determined by the length and character of the side chains. NA and DA exhibited similar hydration characteristics, whereas DG and DB were difficult to hydrate because of the less hydrophilic properties of the rhamnose...

Supply-side collaboration for energy-efficient renovations

NARCIS (Netherlands)

Straub, A.; Mlecnik, E.

2015-01-01

The supply side for nearly zero energy building (nZEB) renovation of owner-occupied single-family houses in Europe is suffering from a severe image problem of lack of knowledge and trust, inefficient construction processes, insufficient quality assurance and communication difficulties with

Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

Science.gov (United States)

Lorenz, Todd C

2012-05-22

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

Convergent and divergent functional connectivity patterns in patients with long-term left-sided and right-sided deafness.

Science.gov (United States)

Zhang, Yanyang; Mao, Zhiqi; Feng, Shiyu; Wang, Wenxin; Zhang, Jun; Yu, Xinguang

2018-02-05

Cortical reorganization may be induced in long-term single-sided deafness (SD); however, the influence of the deafness side on the functional changes remains poorly understood. Here, we investigated whole-brain functional connectivity patterns in long-term SD patients. The normalized voxel-based functional connectivity strength (FCS) was determined using resting-state fMRI (rs-fMRI) in 17 left-sided deafness (LD) patients, 21 right-sided deafness (RD) patients and 21 healthy controls (HCs). Relative to the HCs, both the LD and RD patients exhibited a reduction in the FCS in the ipsilateral visual cortex. However, compared to that in the HCs, a significantly higher FCS was observed in some regions in the salience and default-mode networks in the RD patients, but this FCS alternation pattern was not observed in the LD patients. A direct comparison of the two patient groups revealed a significantly increased FCS in the supplemental motor area in the LD group. Altogether, the long-term SD groups with LD and RD exhibited convergent and divergent functional connectivity patterns in whole-brain networks, providing promising evidence that the functional changes in long-term SD are highly deafness-side-dependent. Copyright © 2017 Elsevier B.V. All rights reserved.

Real-time polymerase chain reaction assay for endogenous reference gene for specific detection and quantification of common wheat-derived DNA (Triticum aestivum L.).

Science.gov (United States)

Vautrin, Sonia; Zhang, David

2007-01-01

A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.

Lattice cluster theory for polymer melts with specific interactions

International Nuclear Information System (INIS)

Xu, Wen-Sheng; Freed, Karl F.

2014-01-01

Despite the long-recognized fact that chemical structure and specific interactions greatly influence the thermodynamic properties of polymer systems, a predictive molecular theory that enables systematically addressing the role of chemical structure and specific interactions has been slow to develop even for polymer melts. While the lattice cluster theory (LCT) provides a powerful vehicle for understanding the influence of various molecular factors, such as monomer structure, on the thermodynamic properties of polymer melts and blends, the application of the LCT has heretofore been limited to the use of the simplest polymer model in which all united atom groups within the monomers of a species interact with a common monomer averaged van der Waals energy. Thus, the description of a compressible polymer melt involves a single van der Waals energy. As a first step towards developing more realistic descriptions to aid in the analysis of experimental data and the design of new materials, the LCT is extended here to treat models of polymer melts in which the backbone and side groups have different interaction strengths, so three energy parameters are present, namely, backbone-backbone, side group-side group, and backbone-side group interaction energies. Because of the great algebraic complexity of this extension, we retain maximal simplicity within this class of models by further specializing this initial study to models of polymer melts comprising chains with poly(n-α-olefin) structures where only the end segments on the side chains may have different, specific van der Waals interaction energies with the other united atom groups. An analytical expression for the LCT Helmholtz free energy is derived for the new model. Illustrative calculations are presented to demonstrate the degree to which the thermodynamic properties of polymer melts can be controlled by specific interactions

Experimental research on end-to-side anastomosis of peripheral nerves and effect of FK506 on end-to-side anastomosis.

Science.gov (United States)

Yang, L M; Wu, Y X; Zhang, X P; Li, X H

2014-01-01

To study the effects of end-to-side anastomosis of initially-denatured nerves at different times. 60 male Wistar albino rats were used to fabricate animal models for the experiment on end-to-side anastomosis of peripheral nerves and 50 female Wistar albino rats were used to fabricate animal models for the experiment on the effect of FK506 on end-to-side anastomosis. Bilateral common peroneal nerve, tibialis anterior muscle electrophysiological and histological examinations, tibialis anterior muscle wet muscle weight determination, and motor end plate examination were performed 3 months after operation. All recovery rates of action potential, single muscle contraction force and tetanic contraction force of the FK506 experimental group are significantly higher than those of the control group and the sectional area of muscle fiber is also higher than that of the control group of normal saline. The best time for end-to-side anastomosis of nerves should be controlled within 2 weeks and the effect of end-to-side anastomosis of nerves will gradually become unsatisfactory. FK506 plays a role in promoting functional rehabilitation following nerve end-to-side anastomosis (Tab. 7, Fig. 4, Ref. 31).

Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

NARCIS (Netherlands)

Hatta, Mochammad; Smits, Henk L.

2007-01-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.

Science.gov (United States)

Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun

2018-02-19

DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

Use of geolocators reveals previously unknown Chinese and Korean scaly-sided merganser wintering sites

DEFF Research Database (Denmark)

Soloveyva, Diana; Afanasiev, Vsevolod; Fox, James W.

2012-01-01

areas in successive years, suggesting winter fidelity to catchments if not specific sites. A single female from the adjacent Avvakumovka catchment wintered on saltwater in Korea, at least 1300 km east of Chinese wintering birds. Most sea duck species (Tribe Mergini) form pairs away from breeding areas......, suggesting that this high level of winter dispersal amongst close-nesting females is a potential mechanism to maintain gene flow in this threatened species that has specialist habitat requirements. Hence, female scaly-sided mergansers disperse widely from breeding areas, but show fidelity to nesting areas...

Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.

Directory of Open Access Journals (Sweden)

Ahmed Abd El Wahed

Full Text Available Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF. Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR are the standard method for molecular detection of the dengue virus (DENV. Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA assays were developed to detect DENV1-4.Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4 to 241 (DENV1-3 RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal and in Bangkok (Thailand. In Kedougou, the RT-RPA was operated at an ambient temperature of 38 °C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31 and 100% (n=23, respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90 and 100%(n=41, respectively.During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.

Theory and applications of the polymerase chain reaction.

Science.gov (United States)

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

Directory of Open Access Journals (Sweden)

V.K. Jain

2010-02-01

Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

Development of a recombinase polymerase amplification assay for Vibrio parahaemolyticus detection with an internal amplification control.

Science.gov (United States)

Yang, Huan-Lan; Wei, Shuang; Gooneratne, Ravi; Mutukumira, Anthony N; Ma, Xue-Jun; Tang, Shu-Ze; Wu, Xi-Yang

2018-04-01

A novel RPA-IAC assay using recombinase polymerase and an internal amplification control (IAC) for Vibrio parahaemolyticus detection was developed. Specific primers were designed based on the coding sequence for the toxR gene in V. parahaemolyticus. The recombinase polymerase amplification (RPA) reaction was conducted at a constant low temperature of 37 °C for 20 min. Assay specificity was validated by using 63 Vibrio strains and 10 non-Vibrio bacterial species. In addition, a competitive IAC was employed to avoid false-negative results, which co-amplified simultaneously with the target sequence. The sensitivity of the assay was determined as 3 × 10 3 CFU/mL, which is decidedly more sensitive than the established PCR method. This method was then used to test seafood samples that were collected from local markets. Seven out of 53 different raw seafoods were detected as V. parahaemolyticus-positive, which were consistent with those obtained using traditional culturing method and biochemical assay. This novel RPA-IAC assay provides a rapid, specific, sensitive, and more convenient detection method for V. parahaemolyticus.

Poly(ADP-ribose) polymerase-independent potentiation of nitrosourea cytotoxicity by 3-aminobenzamide in human malignant glioma cells.

Science.gov (United States)

Winter, S; Weller, M

2000-06-16

Poly(ADP-ribose) polymerase is a zinc-finger DNA-binding protein that detects specifically DNA strand breaks generated by genotoxic agents and is thought to be involved in DNA repair. Here, we examined the effects of 3-aminobenzamide, a poly(ADP-ribose) polymerase inhibitor, on the chemosensitivity of human malignant glioma cells. 3-Aminobenzamide selectively potentiated the cytotoxicity of the nitrosoureas, nimustine, carmustine and lomustine in 10 of 12 human malignant glioma cell lines. In contrast, 3-aminobenzamide did not modulate the cytotoxic effects of doxorubicine, teniposide, vincristine, camptothecin or cytarabine. The nitrosoureas did not induce poly(ADP-ribose) polymerase activity in the glioma cells. Ectopic expression of truncated poly(ADP-ribose) polymerase containing the poly(ADP-ribose) polymerase DNA-binding domain, which acts as a dominant-negative mutant, in LN-18 or LN-229 cells did not alter the 3-aminobenzamide effect on nitrosourea-mediated cytotoxicity. Thus, 3-aminobenzamide may target another nicotinamide adenine dinucleotide (NAD)-requiring enzyme, but not poly(ADP-ribose) polymerase, when enhancing nitrosourea cytotoxicity in human malignant glioma cells. Carmustine cytotoxicity was associated with a G2/M arrest. Coexposure to carmustine and 3-aminobenzamide overcame this G2/M arrest in T98G cells, which are sensitized to carmustine by 3-aminobenzamide, but not in U251MG cells, which are refractory to 3-aminobenzamide-mediated sensitization to carmustine. Thus, 3-aminobenzamide-mediated sensitization to carmustine cytotoxicity may result from interference with the stable G2/M arrest response to carmustine in human glioma cells.

File list: Pol.Dig.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.10.RNA_polymerase_II.AllCell.bed ...

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

File list: Pol.Neu.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Neu.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Neural ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Myo.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Muscle SR.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Myo.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Lar.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Oth.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Myo.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.ALL.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II All cell ...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Brs.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Breast ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Lar.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Embryo ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Emb.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Emb.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Epd.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Epidermis... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Epd.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Spl.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Spl.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Spleen ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Myo.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Brs.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Brs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Oth.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Brs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lar.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Lar.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Emb.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Neu.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Neu.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Neural... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_III.AllCell.bed ...

SCit: web tools for protein side chain conformation analysis.

Science.gov (United States)

Gautier, R; Camproux, A-C; Tufféry, P

2004-07-01

SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.

Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1990-01-01

The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

File list: Pol.Lar.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Larvae h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Bld.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bld.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Bld.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bld.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Blood h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Placent...a http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Plc.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.CDV.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Adp.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adp.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Adipocy...te http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Gon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.CDV.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Unc.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Unc.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Bld.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bld.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.50.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Emb.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.50.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Embryo h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.CDV.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Bon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Pancrea...s http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Pan.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Bon.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Bone ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bon.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Adp.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adp.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Adp.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adp.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Prs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.CDV.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lng.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Myo.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Myo.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Bon.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Bon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.CDV.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Prs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lng.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lng.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_II.AllCell.bed ...

Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

Czech Academy of Sciences Publication Activity Database

Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

2012-01-01

Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

File list: Pol.Dig.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Pup.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pup.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Brs.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Breast SR...078990 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Pup.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pup.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Kid.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Kid.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Kid.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Kid.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Dig.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.50.RNA_polymerase_II.AllCell.bed ...