WorldWideScience

Sample records for single-pulse x-ray diffraction

  1. Single-pulse x-ray diffraction using polycapillary optics for in situ dynamic diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Maddox, B. R., E-mail: maddox3@llnl.gov; Akin, M. C., E-mail: akin1@llnl.gov; Teruya, A.; Hunt, D.; Hahn, D.; Cradick, J. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Morgan, D. V. [National Security Technologies LLC, Los Alamos, New Mexico 87544 (United States)

    2016-08-15

    Diagnostic use of single-pulse x-ray diffraction (XRD) at pulsed power facilities can be challenging due to factors such as the high flux and brightness requirements for diffraction and the geometric constraints of experimental platforms. By necessity, the x-ray source is usually positioned very close, within a few inches of the sample. On dynamic compression platforms, this puts the x-ray source in the debris field. We coupled x-ray polycapillary optics to a single-shot needle-and-washer x-ray diode source using a laser-based alignment scheme to obtain high-quality x-ray diffraction using a single 16 ns x-ray pulse with the source >1 m from the sample. The system was tested on a Mo sample in reflection geometry using 17 keV x-rays from a Mo anode. We also identified an anode conditioning effect that increased the x-ray intensity by 180%. Quantitative measurements of the x-ray focal spot produced by the polycapillary yielded a total x-ray flux on the sample of 3.3 ± 0.5 × 10{sup 7} molybdenum Kα photons.

  2. Diffraction leveraged modulation of X-ray pulses using MEMS-based X-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, Daniel; Shenoy, Gopal; Wang, Jin; Walko, Donald A.; Jung, Il-Woong; Mukhopadhyay, Deepkishore

    2016-08-09

    A method and apparatus are provided for implementing Bragg-diffraction leveraged modulation of X-ray pulses using MicroElectroMechanical systems (MEMS) based diffractive optics. An oscillating crystalline MEMS device generates a controllable time-window for diffraction of the incident X-ray radiation. The Bragg-diffraction leveraged modulation of X-ray pulses includes isolating a particular pulse, spatially separating individual pulses, and spreading a single pulse from an X-ray pulse-train.

  3. X-ray diffraction

    International Nuclear Information System (INIS)

    Einstein, J.R.; Wei, C.H.

    1982-01-01

    We have been interested in structural elucidation by x-ray diffraction of compounds of biological interest. Understanding exactly how atoms are arranged in three-dimensional arrays as molecules can help explain the relationship between structure and functions. The species investigated may vary in size and shape; our recent studies included such diverse substances as antischistosomal drugs, a complex of cadmium with nucleic acid base, nitrate salts of adenine, and proteins

  4. X-ray diffraction

    International Nuclear Information System (INIS)

    Vries, J.L. de.

    1976-01-01

    The seventh edition of Philips' Review of literature on X-ray diffraction begins with a list of conference proceedings on the subject, organised by the Philips' organisation at regular intervals in various European countries. This is followed by a list of bulletins. The bibliography is divided according to the equipment (cameras, diffractometers, monochromators) and its applications. The applications are subdivided into sections for high/low temperature and pressure, effects due to the equipment, small angle scattering and a part for stress, texture and phase analyses of metals and quantitative analysis of minerals

  5. X-ray diffraction apparatus

    International Nuclear Information System (INIS)

    Padini, F.R.

    1978-01-01

    The invention provides an x-ray diffraction apparatus permitting the rotation of the divergence sit in conjunction with the rotation of the x-ray irradiated specimen, whereby the dimensions of the x-ray irradiated portion of the specimen remain substantially constant during the rotation of the specimen. In a preferred embodiment, the divergence slit is connected to a structural element linked with a second structural element connected to the specimen such that the divergence slit rotates at a lower angular speed than the specimen

  6. Diffractive X-ray Telescopes

    OpenAIRE

    Skinner, Gerald K.

    2010-01-01

    Diffractive X-ray telescopes using zone plates, phase Fresnel lenses, or related optical elements have the potential to provide astronomers with true imaging capability with resolution several orders of magnitude better than available in any other waveband. Lenses that would be relatively easy to fabricate could have an angular resolution of the order of micro-arc-seconds or even better, that would allow, for example, imaging of the distorted space- time in the immediate vicinity of the super...

  7. Submicron X-ray diffraction

    International Nuclear Information System (INIS)

    MacDowell, Alastair; Celestre, Richard; Tamura, Nobumichi; Spolenak, Ralph; Valek, Bryan; Brown, Walter; Bravman, John; Padmore, Howard; Batterman, Boris; Patel, Jamshed

    2000-01-01

    At the Advanced Light Source in Berkeley the authors have instrumented a beam line that is devoted exclusively to x-ray micro diffraction problems. By micro diffraction they mean those classes of problems in Physics and Materials Science that require x-ray beam sizes in the sub-micron range. The instrument is for instance, capable of probing a sub-micron size volume inside micron sized aluminum metal grains buried under a silicon dioxide insulating layer. The resulting Laue pattern is collected on a large area CCD detector and automatically indexed to yield the grain orientation and deviatoric (distortional) strain tensor of this sub-micron volume. A four-crystal monochromator is then inserted into the beam, which allows monochromatic light to illuminate the same part of the sample. Measurement of diffracted photon energy allows for the determination of d spacings. The combination of white and monochromatic beam measurements allow for the determination of the total strain/stress tensor (6 components) inside each sub-micron sized illuminated volume of the sample

  8. Diffractive X-Ray Telescopes

    International Nuclear Information System (INIS)

    Skinner, G.K.; Skinner, G.K

    2010-01-01

    Diffractive X-ray telescopes using zone plates, phase Fresnel lenses, or related optical elements have the potential to provide astronomers with true imaging capability with resolution several orders of magnitude better than available in any other waveband. Lenses that would be relatively easy to fabricate could have an angular resolution of the order of micro arc seconds or even better, that would allow, for example, imaging of the distorted spacetime in the immediate vicinity of the supermassive black holes in the center of active galaxies What then is precluding their immediate adoption Extremely long focal lengths, very limited bandwidth, and difficulty stabilizing the image are the main problems. The history and status of the development of such lenses is reviewed here and the prospects for managing the challenges that they present are discussed atmospheric absorption

  9. X-ray topography and multiple diffraction

    International Nuclear Information System (INIS)

    Chang, S.-L.

    1983-01-01

    A short summary on X-ray topography, which is based on the dynamical theory of X-ray diffraction, is made. The applications and properties related to the use of the multiple diffraction technique are analized and discussed. (L.C.) [pt

  10. X-ray diffraction computed tomography

    International Nuclear Information System (INIS)

    Harding, G.; Kosanetzky, J.; Neitzel, U.

    1987-01-01

    Coherent scattering of x-ray photons leads to the phenomenon of x-ray diffraction, which is widely used for determining atomic structure in materials science. A technique [x-ray diffraction computed tomography (CT)] is described, analogous to conventional CT, in which the x-ray diffraction properties of a stack of two-dimensional object sections may be imaged. The technique has been investigated using a first generation (single pencil beam) CT scanner to measure small angle coherent scatter, in addition to the customary transmitted radiation. Diffraction data from a standard CT performance phantom obtained with this new technique and with an x-ray diffractometer are compared. The agreement is satisfactory bearing in mind the poor momentum resolution of our apparatus. The dose and sensitivity of x-ray diffraction CT are compared with those of conventional transmission CT. Diffraction patterns of some biological tissues and plastics presented in a companion paper indicate the potential of x-ray diffraction CT for tissue discrimination and material characterization. Finally, possibilities for refinement of the technique by improving the momentum resolution are discussed

  11. X-Ray Diffractive Optics

    Science.gov (United States)

    Dennis, Brian; Li, Mary; Skinner, Gerald

    2013-01-01

    X-ray optics were fabricated with the capability of imaging solar x-ray sources with better than 0.1 arcsecond angular resolution, over an order of magnitude finer than is currently possible. Such images would provide a new window into the little-understood energy release and particle acceleration regions in solar flares. They constitute one of the most promising ways to probe these regions in the solar atmosphere with the sensitivity and angular resolution needed to better understand the physical processes involved. A circular slit structure with widths as fine as 0.85 micron etched in a silicon wafer 8 microns thick forms a phase zone plate version of a Fresnel lens capable of focusing approx. =.6 keV x-rays. The focal length of the 3-cm diameter lenses is 100 microns, and the angular resolution capability is better than 0.1 arcsecond. Such phase zone plates were fabricated in Goddard fs Detector Development Lab. (DDL) and tested at the Goddard 600-microns x-ray test facility. The test data verified that the desired angular resolution and throughput efficiency were achieved.

  12. Two-dimensional x-ray diffraction

    CERN Document Server

    He, Bob B

    2009-01-01

    Written by one of the pioneers of 2D X-Ray Diffraction, this useful guide covers the fundamentals, experimental methods and applications of two-dimensional x-ray diffraction, including geometry convention, x-ray source and optics, two-dimensional detectors, diffraction data interpretation, and configurations for various applications, such as phase identification, texture, stress, microstructure analysis, crystallinity, thin film analysis and combinatorial screening. Experimental examples in materials research, pharmaceuticals, and forensics are also given. This presents a key resource to resea

  13. X-ray diffraction 2 - diffraction principles

    International Nuclear Information System (INIS)

    O'Connor, B.

    1999-01-01

    Full text: The computation of powder diffraction intensities is based on the principle that the powder pattern comprises the summation of the intensity contributions from each of the crystallites (or single crystals) in the material. Therefore, it is of value for powder diffractionists to appreciate the form of the expression for calculating single crystal diffraction pattern intensities. This knowledge is especially important for Rietveld analysis practitioners in terms of the (i) mathematics of the method and (ii) retrieving single crystal structure data from the literature. We consider the integrated intensity from a small single crystal being rotated at velocity ω through the Bragg angle θ for reflection (hkl).... I(hkl) = [l o /ω]. [e 4 /m 2 c 4 ]. [λ 3 δV F(hkl) 2 /υ 2 ].[(1+cos 2 2θ)/2sin2θ] where e, m and c are the usual fundamental constants; λ is the x-ray wavelength, δV is the crystallite volume; F(hkl) is the structure factor; υ is the unit cell volume; and (1+cos 2 θ)/2sin2θ] is the Lorentz-polarisation factor for an unpolarised incident beam. The expression does not include a contribution for extinction. The influence of factors λ, δV, F(hkl) and υ on the intensities should be appreciated by powder diffractionists, especially the structure factor, F(hkl), which is responsible for the fingerprint nature of diffraction patterns, such as the rise and fall of intensity from peak to peak. The structure factor expression represents the summation of the scattered waves from each of the j scattering centres (i e atoms) in the unit cell: F(hkl) Σ f j exp[2πi (h.x j +k.y i +l. z i )] T j . Symbol f is the scattering factor (representing the atom-type scattering efficiency); (x, y, z) are the fractional position coordinates of atom j within the unit cell; and T is the thermal vibration factor for the atom given by: T j = 8π 2 2 > sin 2 θ/λ 2 with 2 > being the mean-square vibration amplitude of the atom (assumed to be isotropic). The

  14. X-ray filter for x-ray powder diffraction

    Science.gov (United States)

    Sinsheimer, John Jay; Conley, Raymond P.; Bouet, Nathalie C. D.; Dooryhee, Eric; Ghose, Sanjit

    2018-01-23

    Technologies are described for apparatus, methods and systems effective for filtering. The filters may comprise a first plate. The first plate may include an x-ray absorbing material and walls defining first slits. The first slits may include arc shaped openings through the first plate. The walls of the first plate may be configured to absorb at least some of first x-rays when the first x-rays are incident on the x-ray absorbing material, and to output second x-rays. The filters may comprise a second plate spaced from the first plate. The second plate may include the x-ray absorbing material and walls defining second slits. The second slits may include arc shaped openings through the second plate. The walls of the second plate may be configured to absorb at least some of second x-rays and to output third x-rays.

  15. Precession X-ray diffraction chamber

    International Nuclear Information System (INIS)

    Rieder, M.

    1978-01-01

    An X-ray diffraction chamber is described whose design allows the tilting of the goniometric head 90deg along the axis normal to the axis of precession. Images may thus be made in the reverse reflexion region and of reciprocal networks in any arbitrary direction with a single adhesion of the crystal. (H.S.)

  16. Polarisation resonance in X-ray diffraction

    International Nuclear Information System (INIS)

    Goodman, P.; Paterson, D.; Matheson, S.

    1994-01-01

    The study of crystal structures by means of dynamic X-ray diffraction has placed a challenge to theoreticians to revise the X-ray diffraction theory based on Maxwell's equation. In this paper the feasibility of using 'polarisation resonance' as a tool in the determination of absolute configuration for asymmetric structures is investigated. Two (left- and right-handed), σ + and σ- , circular polarization states for 3-beam conditions are considered. Moreover, extending interaction into the 3 rd. dimension (normal to the beam) opens the possibility of absolute configuration determination of asymmetric structures in 3 dimensions. The computational scheme used is shown in terms of scattering diagrams. 7 refs., 1 tab., 6 figs

  17. Basic of X-ray diffraction

    International Nuclear Information System (INIS)

    Giacovazzo, C.

    1996-01-01

    The basic concepts of X-ray diffraction may be more easily understood if it is made preliminary use of a mathematical background. In these pages the authors will first define the delta function and its use for the representation of a lattice. Then the concepts of Fourier transform and convolution are given. At the end of this talk one should realize that a crystal is the convolution of the lattice with a function representing the content of the unit cell

  18. Basic of X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Giacovazzo, C. [Bari Univ. (Italy). Dip. Geomineralogico

    1996-09-01

    The basic concepts of X-ray diffraction may be more easily understood if it is made preliminary use of a mathematical background. In these pages the authors will first define the delta function and its use for the representation of a lattice. Then the concepts of Fourier transform and convolution are given. At the end of this talk one should realize that a crystal is the convolution of the lattice with a function representing the content of the unit cell.

  19. X-ray diffraction and chemical bonding

    International Nuclear Information System (INIS)

    Bats, J.W.

    1976-01-01

    Chemical bonds are investigated in sulfamic acid (H 3 N-SO 3 ), sodium sulfonlate dihydrate (H 2 NC 6 H 4 SO 3 Na.2H 2 O), 2,5-dimercaptothiadiazole (HS-C 2 N 2 S-SH), sodium cyanide dihydrate (NaCN.2H 2 O), sodium thiocyanate (NaSCN) and ammonium thiocyanate (NH 4 SCN) by X-ray diffraction, and if necessary completed with neutron diffraction. Crystal structures and electron densities are determined together with bond length and angles. Also the effects of thermal motion are discussed

  20. Glancing angle synchrotron X-ray diffraction

    International Nuclear Information System (INIS)

    Cernik, R.J.

    1996-01-01

    This paper describes in basic detail some of the techniques that can be used to study thin films and surfaces. These are all in the X-ray region and cover reflectivity, diffraction form polycrystalline films, textured films and single crystal films. Other effects such as fluorescence and diffuse scattering are mentioned but not discussed in detail. Two examples of the reflectivity from multilayers and the diffraction from iron oxide films are discussed. The advantages of the synchrotron for these studies is stressed and the experimental geometries that can be employed are described i detail. A brief bibliography is provided at the end to accompany this part of the 1996 Frascati school

  1. Glancing angle synchrotron X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cernik, R.J. [Daresbury Lab., Warrington, WA (United States)

    1996-09-01

    This paper describes in basic detail some of the techniques that can be used to study thin films and surfaces. These are all in the X-ray region and cover reflectivity, diffraction form polycrystalline films, textured films and single crystal films. Other effects such as fluorescence and diffuse scattering are mentioned but not discussed in detail. Two examples of the reflectivity from multilayers and the diffraction from iron oxide films are discussed. The advantages of the synchrotron for these studies is stressed and the experimental geometries that can be employed are described i detail. A brief bibliography is provided at the end to accompany this part of the 1996 Frascati school.

  2. Gas multidetector for neutron and X-ray diffraction studies

    International Nuclear Information System (INIS)

    Allemand, R.

    1975-01-01

    In the context of nuclear imagery research the LETI is studying neutron, X-ray and γ-ray localisation detectors, the fields of application being neutron diffraction, X-ray diffraction and nuclear medicine. This report deals only with gas localisation methods, describing the physical results obtained in neutron and X-ray diffraction [fr

  3. X-ray microimaging by diffractive techniques

    Energy Technology Data Exchange (ETDEWEB)

    Kirz, Janos; Jacobsen, Chris

    2001-07-31

    The report summarizes the development of soft x-ray microscopes at the National Synchrotron Light Source X-1A beamline. We have developed a soft x-ray microscopy beamline (X-1A) at the National Synchrotron Light Source at Brookhaven National Laboratory. This beamline has been upgraded recently to provide two endstations dedicated to microscopy experiments. One endstation hosts a brand new copy of the redesigned room temperature scanning x-ray microscope (STXM), and the other end station hosts a cryo STXM and the original redesigned room temperature microscope, which has been commissioned and has started operation. Cryo STXM and the new microscope use the same new software package, running under the LINUX operating system. The new microscope is showing improved image resolution and extends spectromicroscopy to the nitrogen, oxygen and iron edges. These microscopes are used by us, and by users of the facility, to image hydrated specimens at 50 nm or better spatial resolution and with 0.1-0.5 eV energy resolution. This allows us to carry out chemical state mapping in biological, materials science, and environmental and colloidal science specimens. In the cryo microscope, we are able to do chemical state mapping and tomography of frozen hydrated specimens, and this is of special importance for radiation-sensitive biological specimens. for spectromicroscopic analysis, and methods for obtaining real-space images from the soft x-ray diffraction patterns of non-crystalline specimens. The user program provides opportunities for collaborators and other groups to exploit the techniques available and to develop them further. We have also developed new techniques such as an automated method for acquiring ''stacks'' of images.

  4. X-ray diffraction imaging of material microstructures

    KAUST Repository

    Varga, Laszlo

    2016-10-20

    Various examples are provided for x-ray imaging of the microstructure of materials. In one example, a system for non-destructive material testing includes an x-ray source configured to generate a beam spot on a test item; a grid detector configured to receive x- rays diffracted from the test object; and a computing device configured to determine a microstructure image based at least in part upon a diffraction pattern of the x-rays diffracted from the test object. In another example, a method for determining a microstructure of a material includes illuminating a beam spot on the material with a beam of incident x-rays; detecting, with a grid detector, x-rays diffracted from the material; and determining, by a computing device, a microstructure image based at least in part upon a diffraction pattern of the x-rays diffracted from the material.

  5. X-ray diffraction of modulated structures

    International Nuclear Information System (INIS)

    Tsujimoto, T.; Hashimoto, K.; Saito, K.

    1977-01-01

    Modulated structures are regarded as a macrolattice, in which each lattice point is a ''unit region of concentration variation'' (abbreviated to ''unit region'') and an average lattice parameter is Qa 0 . The X-ray intensity diffracted from modulated structures, I/sub m(s) is given by I/sub m(s). I/sub d/(s). I/sub u/(s) is the scattering intensity from the ''unit region'' and I/sub u/(s) is that from the imaginary macrolattice in which each lattice point is the unit scattering factor. A region containing one zone-complex has been chosen as the ''unit region'' and the effects of the lattice spacing of the macrolattice and its disturbance on diffraction patterns have been discussed. When zone-complexes are small, I/sub m(s) is dominated by I/sub d/(s) and peaks of I/sub d/(s) are observed as side-bands or additional diffraction lines. The number of additional diffraction lines increases with an increase in Qa 0 and typical side-bands appear at a stage of this process. When the periodicity of the macrolattice is distrubed deeply or Qa 0 is large, I/sub u/(s) is observed directly as diffraction effects. The present theory explains reasonably the asymmetry of side-bands in position, the movement of main diffraction line with aging and the change of side-bands into diffraction lines of metastable phases during aging

  6. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    Powder X-ray diffraction studies were carried out on doped lithium niobate for phase identification. High-resolution X-ray diffraction technique was used to study the crystalline quality through full-width at half-maximum values. The refractive index values are more for doped samples than for pure sample as determined by ...

  7. 100 years of discovery of X-ray diffraction

    International Nuclear Information System (INIS)

    Zhang Tao

    2012-01-01

    X-ray diffraction was discovered by Max von Laue a hundred years ago. Later, through the work of William H. Bragg and William L. Bragg, an experimental analysis method was developed to solve the structure of molecules at the atomic level. Over the past hundred years, science and technology has been dramatically changed by X-ray diffraction analysis, which has also undergone considerable development. The recent emergence of hard X-ray free electron lasers has provided a new dimension for X-ray diffraction analysis, promising even greater progress in the fields of physics, chemistry and biology. (author)

  8. X-ray diffraction on solids under pressure

    International Nuclear Information System (INIS)

    Holzapfel, W.B.

    1984-01-01

    In the first part, various techniques and examples for X-ray diffraction on polycrystalline samples under high pressure will be reviewed with special emphasis on a comparison between angular and energy dispersive techniques. The second part reviews X-ray diffraction techniques for single crystals under pressure and demonstrates on few examples typical applications

  9. X-ray diffraction contrast tomography (DCT) system, and an X-ray diffraction contrast tomography (DCT) method

    DEFF Research Database (Denmark)

    2012-01-01

    Source: US2012008736A An X-ray diffraction contrast tomography system (DCT) comprising a laboratory X-ray source (2), a staging device (5) rotating a polycrystalline material sample in the direct path of the X-ray beam, a first X-ray detector (6) detecting the direct X-ray beam being transmitted ...... in the polycrystalline sample is determined based on the two-dimensional position of extinction spots and the associated angular position of the sample for a set of extinction spots pertaining to the individual grain....

  10. Thin film characterisation by advanced X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Cappuccio, G.; Terranova, M.L.

    1996-09-01

    The Fifth School on X-ray diffraction from polycrystalline materials was devoted to thin film characterization by advanced X-ray diffraction techniques. Twenty contributions are contained in this volume; all twenty are recorded in the INIS Database. X-ray diffraction is known to be a powerful analytical tool for characterizing materials and understanding their structural features. The aim of these articles is to illustrate the fundamental contribution of modern diffraction techniques (grazing incidence, surface analysis, standing waves, etc.) to the characterization of thin and ultra-thin films, which have become important in many advanced technologies

  11. X-ray Microprobe for Fluorescence and Diffraction Analysis

    International Nuclear Information System (INIS)

    Ice, G.E.

    2005-01-01

    X-ray diffraction (see unit 1.1) and x-ray excited fluorescence analysis are powerful techniques for the nondestructive measurement of crystal structure and chemical composition. X-ray fluorescence analysis is inherently nondestructive with orders of magnitude lower power deposited for the same detectable limit as with fluorescence excited by charged particle probes (Sparks, 1980). X-ray diffraction analysis is sensitive to crystal structure with orders-of-magnitude greater sensitivity to crystallographic strain than electron probes (Rebonato, et al. 1989). When a small-area x-ray microbeam is used as the probe, chemical composition (Z>14), crystal structure, crystalline texture, and crystalline strain distributions can be determined. These distributions can be studied both at the surface of the sample and deep within the sample (Fig. 1). Current state-of-the-art can achieve an ∼1 mm-D x-ray microprobe and an ∼0.1 mm-D x-ray microprobe has been demonstrated (Bilderback, et al., 1994). Despite their great chemical and crystallographic sensitivities, x-ray microprobe techniques have until recently been restricted by inefficient x-ray focusing optics and weak x-ray sources; x-ray microbeam analysis was largely superseded by electron techniques in the 50's. However, interest in x-ray microprobe techniques has now been revived (Howells, et al., 1983; Ice and Sparks, 1984; Chevallier, et al., 1997; Riekel 1992; Thompson, el al., 1992; and Making and Using... 1997) by the development of efficient x-ray focusing optics and ultra-high intensity synchrotron x-ray sources (Buras and Tazzari, 1984; Shenoy, et al., 1988). These advances have increased the achievable microbeam flux by more than 11 orders of magnitude (Fig. 2) (Ice, 1997); the flux in a tunable 1 mm-D beam on a 'so called' 3rd-generation synchrotron source such as the APS can exceed the flux in a fixed-energy mm2 beam on a conventional source. These advances make x-ray microfluorescence and x-ray

  12. Characterization of Metalloproteins and Biomaterials by X-ray Absorption Spectroscopy and X-ray Diffraction

    DEFF Research Database (Denmark)

    Frankær, Christian Grundahl

    by estimation of the water content by thermogravimetric analysis. Bone tissue from dogs treated with strontiummalonate was studied using XAS. A new approach for analysing the X-ray absorption spectra resulted in a compositional model, from which the relative distribution of strontium in the different bone......-ray crystallography and X-ray absorption spectroscopy (XAS) applied to studying different hexameric insulin conformations. (iii) The structures of polymorphs of strontium ranelate and the distribution of strontium in bone tissue. A procedure for fast identification and verification of protein powders using XRPD...... and R6) were solved by single crystal X-ray diffraction (XRD) to 1.40 Å, 1.30 Å and 1.80 Å resolution, respectively. The zinc coordination in each conformation was studied by XAS including both extended X-ray absorption fine structure (EXAFS) spectroscopy and X-ray absorption near edge structure (XANES...

  13. Diffraction peaks in x-ray spectroscopy: Friend or foe?

    International Nuclear Information System (INIS)

    Tissot, R.G.; Goehner, R.P.

    1992-01-01

    Diffraction peaks can occur as unidentifiable peaks in the energy spectrum of an x-ray spectrometric analysis. Recently, there has been increased interest in oriented polycrystalline films and epitaxial films on single crystal substrates for electronic applications. Since these materials diffract x-rays more efficiently than randomly oriented polycrystalline materials, diffraction peaks are being observed more frequently in x-ray fluorescent spectra. In addition, micro x-ray spectrometric analysis utilizes a small, intense, collimated x-ray beam that can yield well defined diffraction peaks. In some cases these diffraction peaks can occur at the same position as elemental peaks. These diffraction peaks, although a possible problem in qualitative and quantitative elemental analysis, can give very useful information about the crystallographic structure and orientation of the material being analyzed. The observed diffraction peaks are dependent on the geometry of the x-ray spectrometer, the degree of collimation and the distribution of wavelengths (energies) originating from the x-ray tube and striking the sample

  14. Preparation of specimens for analysis by: X-ray diffraction and X-ray fluorescence analysis

    International Nuclear Information System (INIS)

    Banos L, L.

    2004-01-01

    Specimen preparation is one of the most important requirements in the analysis of samples by X-ray Diffraction and X-ray Fluorescence. This statement is especially true for samples containing different types of materials. There are many forms of specimen suitable for X-ray analysis and the type of the sample as received will generally determine the method of pretreatment. It is convenient to refer to the material received for analysis as the sample, and that, which is actually analyzed as the specimen. The powder Diffraction method assumes that the particles in the specimen are ideally random orientation and that there are enough crystallites in the specimen to achieve a representative intensity distribution for these crystallites. X ray Fluorescence is essentially a comparative method of analysis, it is vital that all standards and unknowns be presented to the spectrometer in a reproducible and identical manner. (Author) 3 refs., 6 figs

  15. Diffraction of X-ray beams in capillary waveguides

    International Nuclear Information System (INIS)

    Kukhlevsky, S.V.; Flora, F.; Marinai, A.; Nyitray, G.; Ritucci, A.; Palladino, L.; Reale, A.; Tomassetti, G.

    2000-01-01

    Propagation of the soft X-ray radiation generated by a small-diameter incoherent source through the capillary plane waveguide which satisfies the multimode condition is studied using the Fresnel-Kirchhoff diffraction theory. The diffraction is manifested by appearance of the diffraction fringes, dark and light bands, in the far-field zone of the capillary output. Such a behaviour of the X-ray radiation is confirmed by our experimental data. The results give explanation for the interference effect recently observed in many experiments on the grazing reflections of X-rays in single and multiple capillary optics

  16. Grazing Incidence X-ray Scattering and Diffraction

    Indian Academy of Sciences (India)

    IAS Admin

    tion. In thia article, various aspects of surface X- ray diffraction and scattering are discussed with illustrations of some typical applications of these techniques. 1. ..... ray reflectivity. Here, X-rays are incident on the sample at very small grazing angles to the surface and below the critical angle, αc. As explained earlier, this ...

  17. High-resolution X-ray diffraction studies of multilayers

    DEFF Research Database (Denmark)

    Christensen, Finn Erland; Hornstrup, Allan; Schnopper, H. W.

    1988-01-01

    High-resolution X-ray diffraction studies of the perfection of state-of-the-art multilayers are presented. Data were obtained using a triple-axis perfect-crystal X-ray diffractometer. Measurements reveal large-scale figure errors in the substrate. A high-resolution triple-axis set up is required...

  18. Fabrication of diffraction X-ray elements

    International Nuclear Information System (INIS)

    Babin, S.V.; Erko, A.I.

    1989-01-01

    The use of focusing elements in the X-ray range shows promise for nondestructive chemical analysis of samples with spatial resolution up to fractions of a μm. This paper considers the problems of fabricating Fresnel zone plates of different types: Amplitude- and phase-transparent zone plates and reflective zone plates formed on a multilayer mirror, as well as microstructures with a specified zone profile. (orig.)

  19. Thin film characterisation by advanced X-ray diffraction techniques

    Energy Technology Data Exchange (ETDEWEB)

    Cappuccio, G.; Terranova, M.L. [eds.] [INFN, Laboratori Nazionali di Frascati, Rome (Italy)

    1996-09-01

    This report described the papers presented at the 5. School on X-ray diffraction from polycrystalline materials held at Frascati (Rome) in 2-5 October 1996. A separate abstract was prepared for each of the papers.

  20. X-ray topographic investigation of the deformation field around spots irradiated by FLASH single pulses

    Czech Academy of Sciences Publication Activity Database

    Wierzchowski, W.; Wieteska, K.; Balcer, T.; Klinger, D.; Sobierajski, R.; Zymierska, D.; Chalupský, Jaromír; Hájková, Věra; Burian, Tomáš; Gleeson, A.J.; Juha, Libor; Tiedtke, K.; Toleikis, S.; Vyšín, Luděk; Wabnitz, H.; Gaudin, J.

    2011-01-01

    Roč. 80, č. 10 (2011), s. 1036-1040 ISSN 0969-806X R&D Projects: GA AV ČR KAN300100702; GA MŠk LC510; GA ČR(CZ) GAP108/11/1312; GA MŠk(CZ) LC528; GA MŠk LA08024; GA AV ČR IAAX00100903; GA MŠk(CZ) ME10046 Institutional research plan: CEZ:AV0Z10100523 Keywords : silicon * FLASH irradiation * x-ray topography * deformation fields Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.227, year: 2011

  1. Theory of time-resolved inelastic x-ray diffraction

    DEFF Research Database (Denmark)

    Lorenz, Ulf; Møller, Klaus Braagaard; Henriksen, Niels Engholm

    2010-01-01

    Starting from a general theory of time-resolved x-ray scattering, we derive a convenient expression for the diffraction signal based on a careful analysis of the relevant inelastic scattering processes. We demonstrate that the resulting inelastic limit applies to a wider variety of experimental...... conditions than similar, previously derived formulas, and it directly allows the application of selection rules when interpreting diffraction signals. Furthermore, we present a simple extension to systems simultaneously illuminated by x rays and a laser beam....

  2. Synchrotron x-ray diffraction study of liquid surfaces

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Pershan, P.S.

    1983-01-01

    A spectrometer for X-ray diffraction and refraction studies of horizontal, free surfaces of liquids is described. As an illustration smetic-A layering at the surface of a liquid crystal is presented.......A spectrometer for X-ray diffraction and refraction studies of horizontal, free surfaces of liquids is described. As an illustration smetic-A layering at the surface of a liquid crystal is presented....

  3. A = Rb, K: Single crystal X-ray diffraction studies

    Indian Academy of Sciences (India)

    Unknown

    X-ray diffraction on structural phase transition. 475. Figure 2. Powder X-ray diffraction pattern of KLHS at 298 and 100 K. 3. Structure determination and refinement. 3.1 Structure of RLHS at 293 K. A crystal of size 0⋅7 × 0⋅3 × 0⋅4 mm was mounted on a BRUKER AXS SMART APEX. CCD9 diffractometer with a crystal to ...

  4. X-ray diffraction identification of clay minerals by microcomputer

    International Nuclear Information System (INIS)

    Rodrigues, S.; Imasava, F.J.

    1988-01-01

    The identification of clay minerals by X-ray powder diffraction are done by searching an unknown pattern with a file of standard X-ray diffraction patterns. For this searching done by hand is necessary a long time. This paper shows a program in ''Basic'' language to be utilized in microcomputers for the math of the unknown pattern, using the high velocity of comparison of the microcomputer. A few minutes are used for the match. (author) [pt

  5. Residual stresses analysis by X-ray and neutrons diffraction

    International Nuclear Information System (INIS)

    Lodini, A.; Perrin, M.

    1996-04-01

    This conference is composed of 17 papers grouped in 13 chapters which main themes are: advantages of neutrons and synchrotron radiation for material characterization; residual stress evaluation from micro-deformation measurements in polycrystalline materials; X-ray and neutron diffractometry; residual stress evaluation by X-ray diffraction in extreme surfaces; residual stress diffraction evaluation in monocrystalline nickel base alloys, in polyphasic materials, composite materials, thin films, multilayers and joints; application to thermonuclear reactor components

  6. Saturated multikilovolt x-ray amplification with Xe clusters: single-pulse observation of Xe(L) spectral hole burning

    International Nuclear Information System (INIS)

    Borisov, Alex B; Davis, Jack; Song, Xiangyang; Koshman, Yevgeniya; Dai Yang; Boyer, Keith; Rhodes, Charles K

    2003-01-01

    Single-pulse measurements of spectral hole burning of Xe(L) 3d → 2p hollow atom transition arrays observed from a self-trapped plasma channel provide new information on the dynamics of saturated amplification in the λ ∼ 2.8-2.9 A region. The spectral hole burning on transitions in the Xe 34+ and Xe 35+ arrays reaches full suppression of the spontaneous emission and presents a corresponding width Δ h-bar ω x ∼ = 60 eV, a value adequate for efficient amplification of multikilovolt x-ray pulses down to a limiting length τ x ∼ 30 as. The depth of the suppression at 2.86 A indicates that the gain-to-loss ratio is ≥10. An independent determination of the x-ray pulse energy from damage produced on the surface of a Ti foil in the far field of the source gives a pulse energy of 20-30 μJ, a range that correlates well with the observation of the spectral hole burning and indicates an overall extraction efficiency of ∼10%. (letter to the editor)

  7. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    successfully grown by Czochralski technique in the automatic diameter control facility. As-grown crystal boules were oriented into (0 0 1) direction cut and optically polished for all measurements. Influence of Ti-ion incorporation into LiNbO3 was studied by core level. XPS analysis. Powder X-ray diffraction studies were ...

  8. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    International Nuclear Information System (INIS)

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons

  9. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    Energy Technology Data Exchange (ETDEWEB)

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons.

  10. X-ray diffraction microtomography using synchrotron radiation

    CERN Document Server

    Barroso, R C; Jesus, E F O; Oliveira, L F

    2001-01-01

    The X-ray diffraction computed tomography technique is based on the interference phenomena of the coherent scatter. For low-momentum transfer, it is most probable that the scattering interaction will be coherent. A selective discrimination of a given element in a scanned specimen can be realized by fixing the Bragg angle which produces an interference peak and then, to carry out the computed tomography in the standard mode. The image reconstructed exalts the presence of this element with respect to other ones in a sample. This work reports the feasibility of a non-destructive synchrotron radiation X-ray diffraction imaging technique. This research was performed at the X-ray Diffraction beam line of the National Synchrotron Light Laboratory (LNLS) in Brazil. The coherent scattering properties of different tissue and bone substitute materials were evaluated. Furthermore, diffraction patterns of some polycrystalline solids were studied due to industrial and environmental human exposure to these metals. The obtai...

  11. High resolution X-ray diffraction studies on unirradiated

    Indian Academy of Sciences (India)

    High-resolution X-ray diffraction technique, employing a three-crystal monochromator–collimator combination is used to study the irradiation induced defects in flux grown Sr-hexaferrite crystals irradiated with 50 MeV Li3+ ion beams at room temperature with a fluence value of 1 × 1014 ions/cm2. The diffraction curves of the ...

  12. Coherent X-ray diffraction studies of mesoscopic materials

    International Nuclear Information System (INIS)

    Shabalin, Anatoly

    2015-12-01

    This thesis is devoted to three separate projects, which can be considered as independent. First, the dynamical scattering effects in the Coherent X-ray Diffractive Imaging (CXDI) method are discussed. Based on the simulation results, a straightforward method for correction for the refraction and absorption artifacts in the Bragg CXDI reconstruction is suggested. The second part summarizes the results of an Coherent X-ray Diffractive Imaging experiment with a single colloidal crystal grain. A remarkable result is that positions of individual particles in the crystal lattice have been resolved in three dimensions. The third project is devoted to X-ray diffraction experimental studies of structural evolution of colloidal crystalline films upon incremental heating. Based on the results of the analysis a model of structural evolution of a colloidal crystal upon heating on nanoscopic and mesoscopic length scales is suggested.

  13. X-ray diffraction study of directionally grown perylene crystallites

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Lemke, H. T.; Hammershøj, P.

    2008-01-01

    Using grazing incidence X-ray diffraction, perylene crystallites grown on thin highly oriented poly(tetrafluoroethylene) (PTFE) films on silicon substrates have been investigated. All the perylene crystallites are found to orient with the ab plane of the monoclinic unit cell parallel to the subst......Using grazing incidence X-ray diffraction, perylene crystallites grown on thin highly oriented poly(tetrafluoroethylene) (PTFE) films on silicon substrates have been investigated. All the perylene crystallites are found to orient with the ab plane of the monoclinic unit cell parallel...

  14. X-Ray diffraction Investigation of Electrochemically Deposited Copper

    DEFF Research Database (Denmark)

    Pantleon, Karen; Jensen, Jens Dahl; Somers, Marcel A.J.

    2004-01-01

    by the determination of X-ray diffraction (XRD) pole figures and the calculation of the orientation distribution functions. XRD results are discussed in relation to the morphologies of the electrodeposits as investigated with light optical microscopy and correlated with the process parameters during electrodeposition....

  15. Oxygen precipitation studied by x-ray diffraction techniques

    Czech Academy of Sciences Publication Activity Database

    Meduňa, M.; Caha, O.; Růžička, J.; Bernatová, S.; Svoboda, Milan; Buršík, Jiří

    178 -179, - (2011), s. 325-330 ISSN 1012-0394 R&D Projects: GA ČR(CZ) GA202/09/1013 Institutional research plan: CEZ:AV0Z20410507 Keywords : Czochralski silicon * oxygen precipitates * x-ray Laue diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism

  16. Fusion bonding of Si wafers investigated by x ray diffraction

    DEFF Research Database (Denmark)

    Weichel, Steen; Grey, Francois; Rasmussen, Kurt

    2000-01-01

    The interface structure of bonded Si(001) wafers with twist angle 6.5 degrees is studied as a function of annealing temperature. An ordered structure is observed in x-ray diffraction by monitoring a satellite reflection due to the periodic modulation near the interface, which results from...

  17. Diffractive-refractive optics: X-ray collimator

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Oberta, Peter

    2008-01-01

    Roč. 79, č. 7 (2008), 073105/1-073105/4 ISSN 0034-6748 R&D Projects: GA AV ČR IAA100100716 Institutional research plan: CEZ:AV0Z10100522 Keywords : x-ray collimator * diffractive-refractive optics Subject RIV: BH - Optics , Masers, Lasers Impact factor: 1.738, year: 2008

  18. X-ray diffraction of iron containing samples

    NARCIS (Netherlands)

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2017-01-01

    X-ray diffraction (XRD) is a commonly used technology to identify crystalline phases. However, care must be taken with the combination of XRD configuration and sample. Copper (most commonly used radiation source) is a poor match with iron containing materials due to induced fluorescence. Magnetite

  19. X-Ray Diffraction of Iron Containing Samples

    NARCIS (Netherlands)

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2018-01-01

    In X-ray diffraction, a good combination of configuration and sample is essential. Copper radiation for iron containing materials leads to a high background. Although this has been recognized, many researchers still use this combination. To clearly show the unsuitability of copper radiation for iron

  20. Differential scanning calorimetric and powder X-ray diffraction ...

    Indian Academy of Sciences (India)

    The thermotropic phase transitions and supramolecular structure of NAAEs were investigated by differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD). Results obtained from DSC studies indicate that the transition temperatures (t), enthalpies ( t) and entropies ( t) exhibit odd-even alternation ...

  1. Ultra-small angle X-ray diffraction from muscle

    Energy Technology Data Exchange (ETDEWEB)

    Nave, C.; Diakun, G.P.; Bordas, J.

    1986-05-15

    An ultra-small angle X-ray scattering instrument is described. It uses two channel cut crystals, one to monochromatise and collimate the beam and the other to analyse the scattered radiation. It has been used to collect diffraction data from muscle, in which the physiological unit cell, the sarcomere, has a repeat of 2000 nm or more.

  2. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Unknown

    Powder data is especially useful to deduce accurate cell parameters. Rietveld's refinement procedure1,2 has revolutionized the application of powder X-ray diffraction by resulting in a large number of structures being refined in the last decade. If a suitable starting model is available, it has become routine to refine structures ...

  3. Simulating X-ray diffraction of textured films

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Bunk, Oliver; Andreasen, Jens Wenzel

    2008-01-01

    Computationally efficient simulations of grazing-incidence X-ray diffraction (GIXD) are discussed, with particular attention given to textured thin polycrystalline films on supporting substrates. A computer program has been developed for simulating scattering from thin films exhibiting varying...... from the totally substrate-reflected beam ( two-beam approximation) and refraction effects are also included in the program, together with the geometrical intensity corrections associated with GIXD measurements. To achieve 'user friendliness' for scientists less familiar with diffraction...

  4. Diffraction enhanced X-ray imaging of mammals crystalline lens

    Energy Technology Data Exchange (ETDEWEB)

    Antunes, A. [Departamento de Fisica Aplicada, USP, CP 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: antunes@if.usp.br; Hoennicke, M.G. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Curitiba (Brazil); Safatle, A.M.V. [Faculdade de Medicina Veterinaria e Zootecnia, USP, 05508-900 Sao Paulo, SP (Brazil); Cusatis, C. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Curitiba (Brazil); Moraes Barros, P.S. [Faculdade de Medicina Veterinaria e Zootecnia, USP, 05508-900 Sao Paulo, SP (Brazil); Morelhao, S.L. [Departamento de Fisica Aplicada, USP, CP 66318, 05315-970 Sao Paulo, SP (Brazil)

    2005-08-15

    Crystalline lenses are transparent biological materials where the organization of the lens fibers can also be affected by changes at molecular level, and therefore the structure and morphology of the tissue can be correlated to the loss of transparency of the lens. In this work, internal structure of mammal lenses regarding the long-range ordering of the fibers are investigated by diffraction enhanced X-ray imaging (DEI) radiography. Moreover, DEI and absorption X-ray synchrotron radiographs for healthy and cataractous crystalline lenses are compared. Significant differences in healthy and cataractous crystalline lenses are observed.

  5. Diffraction enhanced X-ray imaging of mammals crystalline lens

    International Nuclear Information System (INIS)

    Antunes, A.; Hoennicke, M.G.; Safatle, A.M.V.; Cusatis, C.; Moraes Barros, P.S.; Morelhao, S.L.

    2005-01-01

    Crystalline lenses are transparent biological materials where the organization of the lens fibers can also be affected by changes at molecular level, and therefore the structure and morphology of the tissue can be correlated to the loss of transparency of the lens. In this work, internal structure of mammal lenses regarding the long-range ordering of the fibers are investigated by diffraction enhanced X-ray imaging (DEI) radiography. Moreover, DEI and absorption X-ray synchrotron radiographs for healthy and cataractous crystalline lenses are compared. Significant differences in healthy and cataractous crystalline lenses are observed

  6. Raman spectroscopy and X-ray diffraction studies on celestite

    International Nuclear Information System (INIS)

    Chen Yenhua; Yu Shucheng; Huang, Eugene; Lee, P.-L.

    2010-01-01

    High-pressure Raman spectroscopy and X-ray diffraction studies of celestite (SrSO 4 ) were carried out in a diamond anvil cell at room temperature. Variation in the Raman vibrational frequency and change of lattice parameters with pressure indicate that a transformation occurs in celestite. This transformation caused an adjustment in the Sr-O polyhedra that affected the stretching-force constant of SO 4 . Moreover, compressibilities along the crystallographic axes decreased in the order a to c to b. From the compression data, the bulk modulus of the celestite was 87 GPa. Both X-ray and Raman data show that the transition in celestite is reversible.

  7. MSL Chemistry and Mineralogy X-Ray Diffraction X-Ray Fluorescence (CheMin) Instrument

    Science.gov (United States)

    Zimmerman, Wayne; Blake, Dave; Harris, William; Morookian, John Michael; Randall, Dave; Reder, Leonard J.; Sarrazin, Phillipe

    2013-01-01

    This paper provides an overview of the Mars Science Laboratory (MSL) Chemistry and Mineralogy Xray Diffraction (XRD), X-ray Fluorescence (XRF) (CheMin) Instrument, an element of the landed Curiosity rover payload, which landed on Mars in August of 2012. The scientific goal of the MSL mission is to explore and quantitatively assess regions in Gale Crater as a potential habitat for life - past or present. The CheMin instrument will receive Martian rock and soil samples from the MSL Sample Acquisition/Sample Processing and Handling (SA/SPaH) system, and process it utilizing X-Ray spectroscopy methods to determine mineral composition. The Chemin instrument will analyze Martian soil and rocks to enable scientists to investigate geophysical processes occurring on Mars. The CheMin science objectives and proposed surface operations are described along with the CheMin hardware with an emphasis on the system engineering challenges associated with developing such a complex instrument.

  8. Determination of organic crystal structures by X ray powder diffraction

    CERN Document Server

    McBride, L

    2000-01-01

    The crystal structure of Ibuprofen has been solved from synchrotron X-ray powder diffraction data using a genetic algorithm (GA). The performance of the GA is improved by incorporating prior chemical information in the form of hard limits on the values that can be taken by the flexible torsion angles within the molecule. Powder X-ray diffraction data were collected for the anti-convulsant compounds remacemide, remacemide nitrate and remacemide acetate at 130 K on BM 16 at the X-ray European Synchrotron Radiation Facility (ESRF) at Grenoble. High quality crystal structures were obtained using data collected to a resolution of typically 1.5 A. The structure determinations were performed using a simulated annealing (SA) method and constrained Rietveld refinements for the structures converged to chi sup 2 values of 1.64, 1.84 and 1.76 for the free base, nitrate and acetate respectively. The previously unknown crystal structure of the drug famotidine Form B has been solved using X-ray powder diffraction data colle...

  9. Instrument and method for X-ray diffraction, fluorescence, and crystal texture analysis without sample preparation

    Science.gov (United States)

    Gendreau, Keith (Inventor); Martins, Jose Vanderlei (Inventor); Arzoumanian, Zaven (Inventor)

    2010-01-01

    An X-ray diffraction and X-ray fluorescence instrument for analyzing samples having no sample preparation includes a X-ray source configured to output a collimated X-ray beam comprising a continuum spectrum of X-rays to a predetermined coordinate and a photon-counting X-ray imaging spectrometer disposed to receive X-rays output from an unprepared sample disposed at the predetermined coordinate upon exposure of the unprepared sample to the collimated X-ray beam. The X-ray source and the photon-counting X-ray imaging spectrometer are arranged in a reflection geometry relative to the predetermined coordinate.

  10. Multiple x-ray diffraction simulation and applications

    International Nuclear Information System (INIS)

    Costa, C.A.B.S. da.

    1989-09-01

    A computer program (MULTX) was implemented for simulation X-ray multiple diffraction diagrams in Renninger geometries. The program uses the X-ray multiple diffraction theory for imperfect crystals. The iterative calculation of the intensities is based on the Taylor series general term, and the primary beam power expansion is given as function of the beam x penetration in the crystal surface. This development allows to consider the simultaneous interaction of the beams involved in the multiple diffraction phenomenon. The simulated diagrams are calculated point-to-point and the tests for the Si and GaAs presented good reproduction of the experimental diagrams for different primary reflections. (L.C.J.A.)

  11. Real-time x-ray diffraction measurements of shocked polycrystalline tin and aluminum

    Science.gov (United States)

    Morgan, Dane V.; Macy, Don; Stevens, Gerald

    2008-11-01

    A new, fast, single-pulse x-ray diffraction (XRD) diagnostic for determining phase transitions in shocked polycrystalline materials has been developed. The diagnostic consists of a 37-stage Marx bank high-voltage pulse generator coupled to a needle-and-washer electron beam diode via coaxial cable, producing line and bremsstrahlung x-ray emission in a 35 ns pulse. The characteristic Kα lines from the selected anodes of silver and molybdenum are used to produce the diffraction patterns, with thin foil filters employed to remove the characteristic Kβ line emission. The x-ray beam passes through a pinhole collimator and is incident on the sample with an approximately 3×6 mm2 spot and 1° full width half maximum angular divergence in a Bragg-reflecting geometry. For the experiments described in this report, the angle between the incident beam and the sample surface was 8.5°. A Debye-Scherrer diffraction image was produced on a phosphor located 76 mm from the polycrystalline sample surface. The phosphor image was coupled to a charge-coupled device camera through a coherent fiber-optic bundle. Dynamic single-pulse XRD experiments were conducted with thin foil samples of tin, shock loaded with a 1 mm vitreous carbon back window. Detasheet high explosive with a 2-mm-thick aluminum buffer was used to shock the sample. Analysis of the dynamic shock-loaded tin XRD images revealed a phase transformation of the tin beta phase into an amorphous or liquid state. Identical experiments with shock-loaded aluminum indicated compression of the face-centered-cubic aluminum lattice with no phase transformation.

  12. Extinction correction in white X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Tomiyoshi, S.; Yamada, M.; Watanabe, H.

    1980-01-01

    Extinction effects in white-beam X-ray and neutron diffraction are considered. In white-beam diffraction, a small deviation of the wavelength from the Bragg condition Δlambda is a variable which represents the line profile of the diffraction peaks, so that by using the new parameter Δlambda the theory is converted to one in white-beam diffraction. It is shown that for a convex crystal, primary extinction agrees with the results calculated already for monochromatic diffraction. The same relation is shown to hold in secondary extinction. It is concluded that extinction theory derived for monochromatic diffraction is applicable without any modification in white-beam diffraction. (Auth.)

  13. Locating and Visualizing Crystals for X-Ray Diffraction Experiments.

    Science.gov (United States)

    Becker, Michael; Kissick, David J; Ogata, Craig M

    2017-01-01

    Macromolecular crystallography has advanced from using macroscopic crystals, which might be >1 mm on a side, to crystals that are essentially invisible to the naked eye, or even under a standard laboratory microscope. As crystallography requires recognizing crystals when they are produced, and then placing them in an X-ray, electron, or neutron beam, this provides challenges, particularly in the case of advanced X-ray sources, where beams have very small cross sections and crystals may be vanishingly small. Methods for visualizing crystals are reviewed here, and examples of different types of cases are presented, including: standard crystals, crystals grown in mesophase, in situ crystallography, and crystals grown for X-ray Free Electron Laser or Micro Electron Diffraction experiments. As most techniques have limitations, it is desirable to have a range of complementary techniques available to identify and locate crystals. Ideally, a given technique should not cause sample damage, but sometimes it is necessary to use techniques where damage can only be minimized. For extreme circumstances, the act of probing location may be coincident with collecting X-ray diffraction data. Future challenges and directions are also discussed.

  14. Diffraction anomalous fine structure using X-ray anomalous dispersion

    International Nuclear Information System (INIS)

    Soejima, Yuji; Kuwajima, Shuichiro

    1998-01-01

    A use of X-ray anomalous dispersion effects for structure investigation has recently been developed by using synchrotron radiation. One of the interesting method is the observation of anomalous fine structure which arise on diffraction intensity in energy region of incident X-ray at and higher than absorption edge. The phenomenon is so called Diffraction Anomalous Fine Structure (DAFS). DAFS originates in the same physical process an that of EXAFS: namely photoelectric effect at the corresponding atom and the interaction of photoelectron waves between the atom and neighboring atoms. In contrast with EXAFS, the method is available for only the crystalline materials, but shows effective advantages of the structure investigations by a use of diffraction: one is the site selectivity and the other is space selectivity. In the present study, demonstrations of a use of X-ray anomalous dispersion effect for the superstructure determination will be given for the case of PbZrO 3 , then recent trial investigations of DAFS in particular on the superlattice reflections will be introduced. In addition, we discuss about Forbidden Reflection near Edge Diffraction (FRED) which is more recently investigated as a new method of the structure analysis. (author)

  15. Focal construct geometry for high intensity energy dispersive x-ray diffraction based on x-ray capillary optics

    Energy Technology Data Exchange (ETDEWEB)

    Li, Fangzuo; Liu, Zhiguo; Sun, Tianxi, E-mail: stx@bnu.edu.cn; Jiang, Bowen; Zhu, Yu [The Key Laboratory of Beam Technology and Materials Modification of the Ministry of Education, Beijing Normal University, Beijing 100875 (China); College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China)

    2016-03-14

    We presented a focal construct geometry (FCG) method for high intensity energy dispersive X-ray diffraction by utilizing a home-made ellipsoidal single-bounce capillary (ESBC) and a polycapillary parallel X-ray lens (PPXRL). The ESBC was employed to focus the X-rays from a conventional laboratory source into a small focal spot and to produce an annular X-ray beam in the far-field. Additionally, diffracted polychromatic X-rays were confocally collected by the PPXRL attached to a stationary energy-resolved detector. Our FCG method based on ESBC and PPXRL had achieved relatively high intensity diffraction peaks and effectively narrowed the diffraction peak width which was helpful in improving the potential d-spacing resolution for material phase analysis.

  16. High Pressure X-ray Diffraction Studies on Barium.

    Science.gov (United States)

    Barnett, J D; Bennion, R B; Hall, H T

    1963-08-09

    Simultaneous x-ray diffraction and electrical resistance measurements on barium establish, with certainty, that Bridgman's 78-kb resistance transition is identical with his 59-kb volumetransition. During this transition, the bodycentered cubic structure changes to hexagonalclose packed. Lattice parameters for the latter structure at 62 kb (volume scale) are: a = 3.90 A, c = 6.15 A, and c/a = 1.58. Compression (AV/Vo) at 62 kb is 0.359 + 0.005 compared to 0.345 previously reported by Bridgman. Below the transition, at 49 kb, compression is 0.300 +/- 0.005 compared to Bridgman's 0.288. Bridgman's 17-kb volume transition was not detected by x-ray diffraction.

  17. Diffractive-refractive optics: X-ray splitter

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír

    2010-01-01

    Roč. 17, č. 1 (2010), s. 129-131 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412; GA AV ČR IAA100100716 Institutional research plan: CEZ:AV0Z10100522 Keywords : x-ray splitter * diffractive-refractive optics Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.335, year: 2010

  18. X-Ray Diffraction of Iron Containing Samples

    OpenAIRE

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2018-01-01

    In X-ray diffraction, a good combination of configuration and sample is essential. Copper radiation for iron containing materials leads to a high background. Although this has been recognized, many researchers still use this combination. To clearly show the unsuitability of copper radiation for iron oxides, magnetite, goethite, maghemite, and hematite were analysed in different configurations using copper or cobalt radiation. Results show effects of fluorescence repressing measures and differ...

  19. Nanofabrication of Diffractive Soft X-ray Optics

    OpenAIRE

    Lindblom, Magnus

    2009-01-01

    This thesis summarizes the present status of the nanofabrication of diffractive optics, i.e. zone plates, and test objects for soft x-ray microscopy at KTH. The emphasis is on new and improved fabrication processes for nickel and germanium zone plates. A new concept in which nickel and germanium are combined in a zone plate is also presented. The main techniques used in the fabrication are electron beam lithography for the patterning, followed by plasma etching and electroplating for the stru...

  20. Coherent X-ray diffraction from collagenous soft tissues

    Energy Technology Data Exchange (ETDEWEB)

    Berenguer de la Cuesta, Felisa; Wenger, Marco P.E.; Bean, Richard J.; Bozec, Laurent; Horton, Michael A.; Robinson, Ian K.; (UCL)

    2009-09-11

    Coherent X-ray diffraction has been applied in the imaging of inorganic materials with great success. However, its application to biological specimens has been limited to some notable exceptions, due to the induced radiation damage and the extended nature of biological samples, the last limiting the application of most part of the phasing algorithms. X-ray ptychography, still under development, is a good candidate to overcome such difficulties and become a powerful imaging method for biology. We describe herein the feasibility of applying ptychography to the imaging of biological specimens, in particular collagen rich samples. We report here speckles in diffraction patterns from soft animal tissue, obtained with an optimized small angle X-ray setup that exploits the natural coherence of the beam. By phasing these patterns, dark field images of collagen within tendon, skin, bone, or cornea will eventually be obtained with a resolution of 60-70 nm. We present simulations of the contrast mechanism in collagen based on atomic force microscope images of the samples. Simulations confirmed the 'speckled' nature of the obtained diffraction patterns. Once inverted, the patterns will show the disposition and orientation of the fibers within the tissue, by enhancing the phase contrast between protein and no protein regions of the sample. Our work affords the application of the most innovative coherent X-ray diffraction tools to the study of biological specimens, and this approach will have a significant impact in biology and medicine because it overcomes many of the limits of current microscopy techniques.

  1. X-ray diffraction from single GaAs nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Biermanns, Andreas

    2012-11-12

    In recent years, developments in X-ray focussing optics have allowed to produce highly intense, coherent X-ray beams with spot sizes in the range of 100 nm and below. Together with the development of new experimental stations, X-ray diffraction techniques can now be applied to study single nanometer-sized objects. In the present work, X-ray diffraction is applied to study different aspects of the epitaxial growth of GaAs nanowires. Besides conventional diffraction methods, which employ X-ray beams with dimensions of several tens of {mu}m, special emphasis lies on the use of nanodiffraction methods which allow to study single nanowires in their as-grown state without further preparation. In particular, coherent X-ray diffraction is applied to measure simultaneously the 3-dimensional shape and lattice parameters of GaAs nanowires grown by metal-organic vapor phase epitaxy. It is observed that due to a high density of zinc-blende rotational twins within the nanowires, their lattice parameter deviates systematically from the bulk zinc-blende phase. In a second step, the initial stage in the growth of GaAs nanowires on Si (1 1 1) surfaces is studied. This nanowires, obtained by Ga-assisted growth in molecular beam epitaxy, grow predominantly in the cubic zinc-blende structure, but contain inclusions of the hexagonal wurtzite phase close to their bottom interface. Using nanodiffraction methods, the position of the different structural units along the growth axis is determined. Because the GaAs lattice is 4% larger than silicon, these nanowires release their lattice mismatch by the inclusion of dislocations at the interface. Whereas NWs with diameters below 50 nm are free of strain, a rough interface structure in nanowires with diameters above 100 nm prevents a complete plastic relaxation, leading to a residual strain at the interface that decays elastically along the growth direction. Finally, measurements on GaAs-core/InAs-shell nanowire heterostructures are presented

  2. X-ray diffraction at Bragg angles around π/2

    International Nuclear Information System (INIS)

    Mayolo, C.M.G. de.

    1991-01-01

    X-ray diffraction at Bragg angles around π/2 is studied from the theoretical and experimental points of view. The proposed corrections to the dynamical theory in the θ β ≅ π/2 cases, has been reviewed showing the equivalence between two formalisms leading to a corrected expression for the dependence of the angular parameter y with the angle of incidence. An expression for y valid in the conventional and θ β ≅ π/2 cases has been obtained. A general expression for Bragg law and for energy resolution after a Bragg diffraction was also deduced. (author)

  3. X-ray diffraction, neutron diffraction and analysis of molecular structures

    International Nuclear Information System (INIS)

    Fontecilla-Camps, J.C.

    1997-01-01

    The only method that is capable to show the atomic structure of most of macromolecules is the X ray diffraction; neutron diffraction is mostly used for the localization of hydrogen atoms, too light to be detected by X ray diffraction. With the growing number of known structures, the molecular crystallographic study may combine the molecular replacement technique and the co-crystallization method, or use the new Laue method, and leads to the functional and topological analysis of biological molecular structures

  4. Nano structured materials studied by coherent X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Gulden, Johannes

    2013-03-15

    Structure determination with X-rays in crystallography is a rapidly evolving field. Crystallographic methods for structure determination are based on the assumptions about the crystallinity of the sample. It is vital to understand the structure of possible defects in the crystal, because they can influence the structure determination. All conventional methods to characterize defects require a modelling through simulated data. No direct methods exist to image the core of defects in crystals. Here a new method is proposed, which will enable to visualize the individual scatterers around and at defects in crystals. The method is based on coherent X-ray scattering. X-rays are perfectly suited since they can penetrate thick samples and buried structures can be investigated Recent developments increased the coherent flux of X-Ray sources such as synchrotrons by orders of magnitude. As a result, the use of the coherent properties of X-rays is emerging as a new aspect of X-ray science. New upcoming and operating X-ray laser sources will accelerate this trend. One new method which has the capacity to recover structural information from the coherently scattered photons is Coherent X-ray Diffraction Imaging (CXDI). The main focus of this thesis is the investigation of the structure and the dynamics of colloidal crystals. Colloidal crystals can be used as a model for atomic crystals in order to understand the growth and defect structure. Despite the large interest in these structures, many details are still unknown.Therefore, it is vital to develop new approaches to measure the core of defects in colloidal crystals. After an introduction into the basics of the field of coherent X-ray scattering, this thesis introduces a novel method, Small Angle Bragg Coherent Diffractive Imaging, (SAB-CDI). This new measurement technique which besides the relevance to colloidal crystals can be applied to a large variety of nano structured materials. To verify the experimental possibilities the

  5. Nano structured materials studied by coherent X-ray diffraction

    International Nuclear Information System (INIS)

    Gulden, Johannes

    2013-03-01

    Structure determination with X-rays in crystallography is a rapidly evolving field. Crystallographic methods for structure determination are based on the assumptions about the crystallinity of the sample. It is vital to understand the structure of possible defects in the crystal, because they can influence the structure determination. All conventional methods to characterize defects require a modelling through simulated data. No direct methods exist to image the core of defects in crystals. Here a new method is proposed, which will enable to visualize the individual scatterers around and at defects in crystals. The method is based on coherent X-ray scattering. X-rays are perfectly suited since they can penetrate thick samples and buried structures can be investigated Recent developments increased the coherent flux of X-Ray sources such as synchrotrons by orders of magnitude. As a result, the use of the coherent properties of X-rays is emerging as a new aspect of X-ray science. New upcoming and operating X-ray laser sources will accelerate this trend. One new method which has the capacity to recover structural information from the coherently scattered photons is Coherent X-ray Diffraction Imaging (CXDI). The main focus of this thesis is the investigation of the structure and the dynamics of colloidal crystals. Colloidal crystals can be used as a model for atomic crystals in order to understand the growth and defect structure. Despite the large interest in these structures, many details are still unknown.Therefore, it is vital to develop new approaches to measure the core of defects in colloidal crystals. After an introduction into the basics of the field of coherent X-ray scattering, this thesis introduces a novel method, Small Angle Bragg Coherent Diffractive Imaging, (SAB-CDI). This new measurement technique which besides the relevance to colloidal crystals can be applied to a large variety of nano structured materials. To verify the experimental possibilities the

  6. Design and fabrication of micro X-ray diffraction system

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yang Soon; Han, Sun Ho; Kim, Jong Goo; Jee, Kwang Yong

    2006-10-15

    It has been observed that microstructure changes occur at the pellet periphery(rim) of the fuel at very high burn-up. Despite its narrow range (below some hundreds microns in depth), this peripheral region(rim) determines the behaviour of nuclear fuel. To determine lattice parameter with XRD at intervals as small as 30-50 {mu} m in radial direction of irradiated fuel samples, a micro X-ray diffraction system was designed and fabricated. This report describes the micro X-ray diffraction system consisted of an X-ray microbeam alignment system and a sample micro translation system, its characterization, and its performance test through the analysis for the micro region of some specimens. This system will be set in a radiation shielded glove box, and then used for analysis of lattice parameter change and the phase change at intervals as small as 30-50 {mu} m in radial direction of the rim of an irradiated fuel sample and a fuel cladding.

  7. Serial femtosecond X-ray diffraction of enveloped virus microcrystals

    Directory of Open Access Journals (Sweden)

    Robert M. Lawrence

    2015-07-01

    Full Text Available Serial femtosecond crystallography (SFX using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ∼700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ∼40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is an important step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.

  8. Identifications studies of Lauha Bhasma by X-ray diffraction and X-ray fluorescence.

    Science.gov (United States)

    Bhargava, S C; Reddy, K R C; Sastry, G V S

    2012-01-01

    Procedures for preparation of Lauha Bhasma are described in ancient texts of Ayurveda. These procedures also begin with different source material for iron such as Teekshna Lauha and Kanta Lauha etc. In the present study, we have selected different source materials viz. magnetite iron ore for Kanta Lauha and pure (Armco grade) iron turnings for Teekshna Lauha. The standard procedures of preparation of Lauha Bhasma are carried out in identical conditions for these two raw materials. The final product from the Puta are characterized by using X-ray diffraction and X-ray fluorescence spectroscopy to understanding the crystallographic form or forms of iron oxides and their composition at the end of each Puta. The iron content at the end of repeated Putas (18 for Kanta Lauha and 20 for Teekshna Lauha) have shown a decrease in case of Teekshna Lauha since the starting material is pure iron while it showed only marginal decreases in the case of Kanta Lauha because the Fe(3)O(4) of magnetite is undergoing oxidation to Fe(2)O(3). The trace elements remain within the Bhasma in the form of various oxides of Si, Al, Ca, etc.

  9. Surface analysis of dental amalgams by X-ray photoelectron spectroscopy and X-ray diffraction.

    Science.gov (United States)

    Uo, Motohiro; Berglund, Anders; Cardenas, Juan; Pohl, Lars; Watari, Fumio; Bergman, Maud; Sjöberg, Staffan

    2003-11-01

    It is important to characterize the surface of dental amalgam in order to understand the process of mercury release from amalgam restorations in the oral cavity. The mercury evaporation occurs not only from the newly made restoration but also from the set material. The surfaces of four different types of amalgams, which had been well set, were analyzed with X-ray photoelectron spectroscopy (XPS) and X-ray diffraction (XRD) and the relationship between surface compositions and mercury release was studied. Fresh amalgam surfaces as well as aged surfaces, which were stored for 30 days in air, were investigated using XPS and the chemical states of amalgam components and oxygen were studied. The aged surfaces were also characterized with XRD and grazing angle XRD. With increased oxidation, the surface contents of tin and oxygen were increased in all amalgams. In contrast, the surface contents of copper and mercury were decreased. An increase of zinc or indium content were observed in zinc or indium containing amalgams, respectively. A surface layer enriched with indium and oxygen was clearly detected by XPS but not with grazing angle XRD. The thickness of the enriched surface layer is estimated to be in the order of few nanometer, which is approximately equal to the analysis depth of XPS. In addition, the presence of metallic elements, like tin and zinc, that readily form a stable oxide layer at the surface suppress the release of mercury.

  10. X-ray diffraction imaging of biological cells

    CERN Document Server

    Nakasako, Masayoshi

    2018-01-01

    In this book, the author describes the development of the experimental diffraction setup and structural analysis of non-crystalline particles from material science and biology. Recent advances in X-ray free electron laser (XFEL)-coherent X-ray diffraction imaging (CXDI) experiments allow for the structural analysis of non-crystalline particles to a resolution of 7 nm, and to a resolution of 20 nm for biological materials. Now XFEL-CXDI marks the dawn of a new era in structural analys of non-crystalline particles with dimensions larger than 100 nm, which was quite impossible in the 20th century. To conduct CXDI experiments in both synchrotron and XFEL facilities, the author has developed apparatuses, named KOTOBUKI-1 and TAKASAGO-6 for cryogenic diffraction experiments on frozen-hydrated non-crystalline particles at around 66 K. At the synchrotron facility, cryogenic diffraction experiments dramatically reduce radiation damage of specimen particles and allow tomography CXDI experiments. In addition, in XFEL ex...

  11. Software system for X-ray diffraction quantitative phase analysis

    International Nuclear Information System (INIS)

    Fuentes, L.; Herrera, V.; Rubio, E.

    1989-01-01

    A system of experimental methods and computer programs for X-ray diffraction analysis is presented. The most important cases occurring in practice are considered. Program MARIA for spectral analysis is described. The external standard method for powder analysis is presented. Program STANDEXT calculates the sample absorption coefficient, the concentrations and standard deviations by a least squares method. For the case of partly identified samples, the internal standard method is developed. All measured peak are considered in the calculations. Program STANDINT solves the concentrations of the identified phases, their errors and the sample's absorption coefficient. A modification is introduced in the so-called direct method for massive sample analysis. The effect of texture is characterized by model representation of the inverse pole figure associated to the sample diffracting surface. Program DIREC is proposed for titting texture-modulated theoretical diffraction patterns to experimental ones, thus calculating phase concentrations and corresponding errors. Examples are given in some applications

  12. Modern trends in x-ray powder diffraction

    International Nuclear Information System (INIS)

    Goebel, H.E.; Snyder, R.L.

    1985-01-01

    The revival of interest in X-ray powder diffraction, being quoted as a metamorphosis from the 'ugly duckling' to a 'beautiful swan', can be attributed to a number of modern developments in instrumentation and evaluation software. They result in faster data collection, improved accuracy and resolution, and better detectability of minor phases. The ease of data evaluation on small computers coupled direct to the instrument allows convenient execution of previously tedious and time-consuming off-line tasks like qualitative and quantitative analysis, characterization of microcrystalline properties, indexing, and lattice-constant refinements, as well as structure refinements or even exploration of new crystal structures. Powder diffraction has also progressed from an isolated analytical laboratory method to an in situ technique for analysing solid-state reactions or for the on-stream control of industrial processes. The paper surveys these developments and their real and potential applications, and tries to emphasize new trends that are regarded as important steps for the further progress of X-ray powder diffraction

  13. Automation of a Guinier camera for X-ray diffraction

    International Nuclear Information System (INIS)

    Duijn, J.H.

    1988-01-01

    The automation of a Guinier X-ray diffraction camera is discussed. The photographic plate in the conventional setup has been replaced by a curved proportional counter (CPC) which has an electronic readout system. As a result the recording time has been reduced from a few hours to a few minutes. The construction and optimum dimensions of the CPC are discussed and the most essential parts of the readout electronics are highlighted. A linewidth of 200 μm FWHM and an accuracy of 30 μm are achieved. 45 refs.; 53 figs.; 4 tabs

  14. Ultrafast X-Ray Diffraction of Heterogeneous Solid Hydrogen

    Energy Technology Data Exchange (ETDEWEB)

    Levitan, Abraham [Olin College of Engineering, Needham, MA (United States)

    2015-08-19

    Angularly resolved x-ray diffraction at 5.5 keV establishes the structure of a 5 µm diameter solid hydrogen jet, providing a foundation for analysis of hydrogen in a warm dense matter state. The jet was composed of approximately 65 % ± 5% HCP and 35 % ± 5% FCC by volume with an average crystallite size on the order of hundreds of nanometers. Broadening in the angularly resolved spectrum provided strong evidence for anisotropic strain up to approximately 3 % in the HCP lattice. Finally, we found no evidence for orientational ordering of the crystal domains.

  15. Oxides neutron and synchrotron X-ray diffraction studies

    CERN Document Server

    Sosnowska, I M

    1999-01-01

    We review some results from several areas of oxide science in which neutron scattering and X-ray synchrotron scattering exercise a complementary role to high-resolution transmission electron microscopy. The very high-resolution time-of-flight neutron diffraction technique and its role in studies of the magnetic structure of oxides is especially reviewed. The selected topics of structural studies for the chosen oxides are: crystal and magnetic structure of the so-called cellular random systems, magnetic structure and phase transitions in ferrites and the behaviour of water in non-stoichiometric protonic conductors and in the opal silica-water system. (40 refs).

  16. X-ray diffraction analysis device with electronic photon counter

    International Nuclear Information System (INIS)

    Fillit, R.Y.; Bruyas, H.; Patay, F.

    1985-01-01

    The means provided to control the movements around the three axes are composed of step-by-step motors related to exits control logic which is connected to the calculation and monitored by a clock. The clock monitors also the calculator so as that the calculator controls, together with the programmable clock and control logic, the coordination of the whole rotation movements, along the three rotation axes, their velocity, their duration and the acquisition of the measured intensities of the diffracted X-ray beam [fr

  17. Synchrotron X-ray diffraction using triple-axis spectrometry

    International Nuclear Information System (INIS)

    Als-Nielsen, J.

    1980-12-01

    High resolution X-ray diffraction studies of (i) monolayers of the noble gases Kr and Ar physiosorbed on graphite (ii) smectic A fluctuations in the nematic and the smectic A phases of liquid crystals are described. The apparatus used is a triple axis spectrometer situated at the storage ring DORIS at Hasylab, DESY, Hamburg. A monochromatic, well collimated beam is extracted from the synchrotron radiation spectrum by Bragg reflection from perfect Si or Ge crystals. The direction of the beam scattered from the sample is determined by Bragg reflection from a perfect Si or Ge crystal. High intensities even with resolution extending beyond the wavelength of visible light can be obtained. (Auth.)

  18. Powder X-ray diffraction study af alkali alanates

    DEFF Research Database (Denmark)

    Cao, Thao; Mosegaard Arnbjerg, Lene; Jensen, Torben René

    Powder X-ray diffraction study of alkali alanates Thao Cao, Lene Arnbjerg, Torben R. Jensen. Center for Materials Crystallography (CMC), Center for Energy Materials (CEM), iNANO and Department of Chemistry, Aarhus University, DK-8000, Denmark. Abstract: To meet the energy demand in the future...... for mobile applications, new materials with high gravimetric and volumetric storage capacity of hydrogen have to be developed. Alkali alanates are promising for hydrogen storage materials. Sodium alanate stores hydrogen reversibly at moderate conditions when catalysed with, e.g. titanium, whereas potassium...

  19. X-ray diffraction analysis of InAs nanowires

    International Nuclear Information System (INIS)

    Davydok, Anton

    2013-01-01

    Semiconductor nanowires have attracted great interest as building blocks for future electronic and optoelectronic devices. The variability of the growth process opens the opportunity to control and combine the various properties tailoring for specific application. It was shown that the electrical and optical characteristics of the nanowires are strongly connected with their structure. Despite intensive research in this field, the growth process is still not fully understood. In particular, extensive real structure investigations are required. Most of the reports dedicated on the structural researches are based on the results of scanning electron microscopy (SEM) or transmission electron microscopy (TEM). SEM provides an image of the surface with nanostructures and is mainly used to describe the morphology of the sample, but it does not bring information about the internal structure, phase composition and defect structure. At the same time, the internal structure can be examined by TEM down to atomic scale. TEM image of good quality are very expensive due to the efforts in sample preparation and in localisation of a single object. All these aspects make the statistical structural analysis difficult. In the present work, X-ray diffraction analysis has been applied for structural investigation of InAs nanowires grown by different techniques. Using various X-ray diffraction geometries, the nanowire systems were investigated in terms of the lattice parameters, phase composition, strains and displacement fields and stacking defects. In particular, realizing grazing incidence diffraction and controlling the penetration depth of X-ray beam, we characterized sample series grown by Au-assisted metal organic phase epitaxy on GaAs [111]B substrate with different growth time. According to the results of SEM and X-ray investigations, a model of the growth process has been proposed. A more detailed analysis was performed on InAs nanowires grown by molecular beam epitaxy (MBE) on

  20. New progress on monolithic X-ray lens in diffraction application

    International Nuclear Information System (INIS)

    Li Yude; He Yejun; Chen Jun; Luo Ping; Wang Dachun; Yan Yiming

    1999-12-01

    The basic physical properties for monolithic X-ray lens are introduced. The X-ray diffraction for macromolecular crystallography using monolithic X-ray lens were investigated. The experimental results show that in the same X-ray source power the diffracted intensity in the condition with X-ray lens was increased about 7 times, and the resolution was improved by 0.2 x 10 -10 -0.6 x 10 -10 m. The signal to noise ratio was also improved, and the time of measurement was reduced. The X-ray diffraction of Au thin films on the Si(100) single crystal substrates were investigated in a X-ray powder diffractometer. The experimental results show that in the same X-ray source power the diffracted intensity in the condition with X-ray lens was increased about 2 times, and the angular resolution of the diffractometer was enhanced

  1. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.

    1992-01-01

    The term open-quote Variable-Metricclose quotes (V-M) when applied to diffraction crystals refers to a crystal in which the spacing between crystalline planes varies with the position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes. The variation in the crystalline spacing of a V-M crystal can be produced by introducing a thermal gradient in the crystal. This approach works well when the over-all percentage change in the lattice spacing is small (less than 0.1 %). For V-M crystals where the over-all change in spacing is the order of 0.1 percent or larger, it is more practical to produce the change in crystal spacing by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. One of the simplest applications of this type of crystal diffraction optics is to use V-M crystals to increase the number of photon per unit bandwidth in a diffracted x-ray beam. Typical enhancement factors of 3 to 20 are possible with wiggler sources. For near perfect silicon crystals the rocking curve for (111) planes is typically 8.5 arc seconds at 8 keV and 2.6 arc seconds at 20 keV. If one changes the crystalline spacing to match the change in the incident angle of the beam on the crystalline planes, then the full surface of the diffraction crystal will diffract the same wavelength x-ray. The increase in flux per unit bandwidth in the diffracted beam is 6 to 1 and 20 to 1 for the 8 keV and 20 keV x-rays, respectively, for the NSLS example. In most of the experiments the changes in crystalline spacings were generated with thermal gradients. One set of experiments used a V-M crystal grown with a variable percentage of germanium and silicon. This crystal had a 0.1 percent change in crystal spacing in 1 mm of distance in the crystal

  2. Characterization of Brazilian asphalt using X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Edson R.; Pinto, Nivia G.V.; Almeida, Ana P.G.; Braz, Delson; Lopes, Ricardo T. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Lab. de Instrumentacao Nuclear], E-mail: ecardoso@lin.ufrj.br; Barroso, Regina C. [Universidade do Estado do Rio de Janeiro (UERJ), Rio de Janeiro, RJ (Brazil). Inst. de Fisica], E-mail: cely@uerj.br; Motta, Laura M.G. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Lab. de Geotecnia], E-mail: laura@coc.ufrj.br

    2007-07-01

    Asphalt is a sticky, black and highly viscous liquid or semi-solid that is presented in most crude petroleum and in some natural deposits. The X ray diffraction can give valuable information over the characteristics of a material. Thus, the X-ray diffraction (XRD) method was employed to investigate parameters that characterize and differentiate asphalt groups (Boscan, CAP20, CAP40, CAP50/60, CAP50/70 and CAP85/100). The scattering measurements were carried out in {theta}-2{theta} reflection geometry using a powder diffractometer Shimadzu XRD-6000 at the Nuclear Instrumentation Laboratory, Brazil. Scans were typically done from 8 deg to 28 deg every 0.05. The parameters analyzed were: FWHM, peak area, peak center, peak height, left half width and right half width. Thus, in this study, scattering profiles from different asphalt groups were carefully measured in order to establish characteristic signatures of these materials. The results indicate that by using three parameters (peak centroid, peak area and peak intensity) it is possible to characterize and differentiate the asphalt. (author)

  3. X-ray Diffraction Study of Arsenopyrite at High Pressure

    Energy Technology Data Exchange (ETDEWEB)

    D Fan; M Ma; W Zhou; S Wei; Z Chen; H Xie

    2011-12-31

    The high-pressure X-ray diffraction study of a natural arsenopyrite was investigated up to 28.2 GPa using in situ angle-dispersive X-ray diffraction and a diamond anvil cell at National Synchrotron Light Source, Brookhaven National Laboratory. The 16:3:1 methanol-ethanol-water mixture was used as a pressure-transmitting medium. Pressures were measured using the ruby-fluorescence method. No phase change has been observed up to 28.2 GPa. The isothermal equation of state (EOS) was determined. The values of K{sub 0}, and K'{sub 0} refined with a third-order Birch-Murnaghan EOS are K{sub 0} = 123(9) GPa, and K'{sub 0} = 5.2(8). Furthermore, we confirm that the linear compressibilities ({beta}) along a, b and c directions of arsenopyrite is elastically isotropic ({beta}{sub a} = 6.82 x 10{sup -4}, {beta}{sub b} = 6.17 x 10{sup -4} and {beta}{sub c} = 6.57 x 10{sup -4} GPa{sup -1}).

  4. Quantification of rutile in anatase by X-ray diffraction

    International Nuclear Information System (INIS)

    Chavez R, A.

    2001-01-01

    Nowadays the discovering of new and better materials required in all areas of the industry has been lead to the human being to introduce him to this small and great world. The crystalline materials, have properties markedly directional. When it is necessary to realize a quantitative analysis to these materials the task is not easy. The main objective of this work is the research of a real problem, its solution and perfecting of a technique involving the theoretical and experimental principles which allow the quantification of crystalline phases. The chapter 1 treats about the study of crystalline state during the last century, by means of the X-ray diffraction technique. The chapter 2 studies the nature and production of X-rays, the chapter 3 expounds the principles of the diffraction technique which to carry out when it is satisfied the Bragg law studying the powder diffraction method and its applications. In the chapter 4 it is explained how the intensities of the beams diffracted are determined by the atoms positions inside of the elemental cell of the crystal. The properties of the crystalline samples of anatase and rutile are described in the chapter 5. The results of this last analysis are the information which will be processed by means of the auxiliary software: Diffrac AT, Axum and Peakfit as well as the TAFOR and CUANTI software describing this part with more detail in the chapters 6 and 7 where it is mentioned step by step the function of each software until to reach the quantification of crystalline phases, objective of this work. Finally, in the chapter 8 there are a results analysis and conclusions. The contribution of this work is for those learned institutions of limited resources which can tackle in this way the characterization of materials. (Author)

  5. X-Ray Diffraction and Fluorescence Instrument for Mineralogical Analysis at the Lunar Surface, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a compact and lightweight X-Ray Diffraction (XRD) / X-Ray Fluorescence (XRF) instrument for analysis of mineralogical composition of regolith,...

  6. X-Ray Diffraction and Fluorescence Instrument for Mineralogical Analysis at the Lunar Surface, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop LUNA, a compact and lightweight X-Ray Diffraction (XRD) / X-Ray Fluorescence (XRF) instrument for mineralogical analysis of regolith, rock...

  7. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.; Fernandez, P.B.

    1992-01-01

    A variable-metric (VM) crystal is one in which the spacing between the crystalline planes changes with position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes of interest and can be produced by either introducing a thermal gradient in the crystal or by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. A series of experiments were performed in the laboratory to demonstrate the principle of the variable-metric crystal and its potential use in synchrotron beam lines. One of the most useful applications of the VM crystal is to increase the number of photons per unit bandwidth in a diffracted beam without losing any of the overall intensity. In a normal synchrotron beam line that uses a two-crystal monochromator, the bandwidth of the diffracted photon beam is determined by the vertical opening angle of the beam which is typically 0.10--0.30 mrad or 20--60 arcsec. When the VM crystal approach is applied, the bandwidth of the beam can be made as narrow as the rocking curve of the diffracting crystal, which is typically 0.005--0.050 mrad or 1--10 arcsec. Thus a very large increase of photons per unit bandwidth (or per unit energy) can be achieved through the use of VM crystals. When the VM principle is used with bent crystals, new kinds of x-ray optical elements can be generated that can focus and defocus x-ray beams much like simple lenses where the focal length of the lens can be changed to match its application. Thus both large magnifications and large demagnifications can be achieved as well as parallel beams with narrow bandwidths

  8. Acemetacin cocrystal structures by powder X-ray diffraction

    Directory of Open Access Journals (Sweden)

    Geetha Bolla

    2017-05-01

    Full Text Available Cocrystals of acemetacin drug (ACM with nicotinamide (NAM, p-aminobenzoic acid (PABA, valerolactam (VLM and 2-pyridone (2HP were prepared by melt crystallization and their X-ray crystal structures determined by high-resolution powder X-ray diffraction. The powerful technique of structure determination from powder data (SDPD provided details of molecular packing and hydrogen bonding in pharmaceutical cocrystals of acemetacin. ACM–NAM occurs in anhydrate and hydrate forms, whereas the other structures crystallized in a single crystalline form. The carboxylic acid group of ACM forms theacid–amide dimer three-point synthon R32(9R22(8R32(9 with three different syn amides (VLM, 2HP and caprolactam. The conformations of the ACM molecule observed in the crystal structures differ mainly in the mutual orientation of chlorobenzene fragment and the neighboring methyl group, being anti (type I or syn (type II. ACM hydrate, ACM—NAM, ACM–NAM-hydrate and the piperazine salt of ACM exhibit the type I conformation, whereas ACM polymorphs and other cocrystals adopt the ACM type II conformation. Hydrogen-bond interactions in all the crystal structures were quantified by calculating their molecular electrostatic potential (MEP surfaces. Hirshfeld surface analysis of the cocrystal surfaces shows that about 50% of the contribution is due to a combination of strong and weak O...H, N...H, Cl...H and C...H interactions. The physicochemical properties of these cocrystals are under study.

  9. The first X-ray diffraction measurements on Mars

    Directory of Open Access Journals (Sweden)

    David Bish

    2014-11-01

    Full Text Available The Mars Science Laboratory landed in Gale crater on Mars in August 2012, and the Curiosity rover then began field studies on its drive toward Mount Sharp, a central peak made of ancient sediments. CheMin is one of ten instruments on or inside the rover, all designed to provide detailed information on the rocks, soils and atmosphere in this region. CheMin is a miniaturized X-ray diffraction/X-ray fluorescence (XRD/XRF instrument that uses transmission geometry with an energy-discriminating CCD detector. CheMin uses onboard standards for XRD and XRF calibration, and beryl:quartz mixtures constitute the primary XRD standards. Four samples have been analysed by CheMin, namely a soil sample, two samples drilled from mudstones and a sample drilled from a sandstone. Rietveld and full-pattern analysis of the XRD data reveal a complex mineralogy, with contributions from parent igneous rocks, amorphous components and several minerals relating to aqueous alteration. In particular, the mudstone samples all contain one or more phyllosilicates consistent with alteration in liquid water. In addition to quantitative mineralogy, Rietveld refinements also provide unit-cell parameters for the major phases, which can be used to infer the chemical compositions of individual minerals and, by difference, the composition of the amorphous component.

  10. [Diffraction gratings used in x-ray spectroscopy]: Final report

    International Nuclear Information System (INIS)

    Smith, H.I.

    1988-01-01

    This subcontract was initiated in order to facilitate the development at MIT of technologies for fabricating the very fine diffraction grating required in x-ray spectroscopy at Lawrence Livermore Laboratory (LLL). These gratings are generally gold transmission gratings with spatial periods of 200 nm or less. The major focus of our efforts was to develop a means of fabricating gratings of 100 nm period. We explored two approaches: e-beam fabrication of x-ray lithography masks, and achromatic holographic lithography. This work was pursued by Erik Anderson as a major component of his Ph.D. thesis. Erik was successful in both the e-beam and holographic approaches. However, the e-beam method proved to be highly impractical: exposure times of about 115 days would be required to cover an area of 1 cm 2 . The achromatic holography, on the other hand, should be capable of exposing areas well in excess of 1 cm 2 in times under 1 hour. Moreover, 100 nm-period gratings produced by achromatic holography are coherent over their entire area whereas gratings produced by e-beam lithography are coherent only over areas /approximately/100 μm. The remainder of this report consists of portions excerpted from Erik Anderson's thesis. These contain all the details of our work on 100 nm period gratings. 26 refs., 17 figs

  11. X-ray diffraction from single molecules at the worlds first X-ray free-electron laser source

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Stephan; Kuepper, Jochen; Chapman, Henry; Rolles, Daniel [Center for Free-Electron Laser Science (CFEL), DESY, Hamburg (Germany)

    2011-07-01

    The advent of the first X-ray Free-Electron Laser, the Linac Coherent Light Source (LCLS), opens up a new approach for diffractive imaging of even single molecules that cannot be crystallized into macromolecular crystals of sufficient size necessary for conventional X-ray crystallography. Here, we present the concept, the experimental parametric space that has to be addressed together with first experimental results of X-ray diffractive imaging of single molecules in the gas phase at LCLS. We use a supersonically cooled molecular beam to provide an ensemble of test-molecules, laser-align them, and subsequently probe them with the LCLS in order to get diffraction patterns of single molecules.

  12. X-ray diffraction patterns of thermally-reduced graphenes

    International Nuclear Information System (INIS)

    Ju, Hae-Mi; Choi, Sung-Ho; Huh, Seung-Hun

    2010-01-01

    Thermally-reduced graphenes (GPs) from graphene oxides (GOs) in the range of 200 - 800 .deg. C have been investigated by using X-ray diffraction (XRD). The temperature-dependent evolutions of the (002) peaks show that exfoliation of GO sheets occurs, along with wrinkling, at ∼200 .deg. C and that high-quality GPs are produced at ∼ 600 .deg. C (GP 600 ). These phenomena are explained by the vaporization of intercalated water molecules and the effective removal of the oxide groups of GO by thermal annealing, respectively. GP 600 exhibited a clean and sharp (002) peak corresponding to an interlayer distance of 3.392 A, which is close to that of conventional graphene (∼3.4 A). The structure of GP 600 is further discussed.

  13. Powder X-ray diffraction laboratory, Reston, Virginia

    Science.gov (United States)

    Piatak, Nadine M.; Dulong, Frank T.; Jackson, John C.; Folger, Helen W.

    2014-01-01

    The powder x-ray diffraction (XRD) laboratory is managed jointly by the Eastern Mineral and Environmental Resources and Eastern Energy Resources Science Centers. Laboratory scientists collaborate on a wide variety of research problems involving other U.S. Geological Survey (USGS) science centers and government agencies, universities, and industry. Capabilities include identification and quantification of crystalline and amorphous phases, and crystallographic and atomic structure analysis for a wide variety of sample media. Customized laboratory procedures and analyses commonly are used to characterize non-routine samples including, but not limited to, organic and inorganic components in petroleum source rocks, ore and mine waste, clay minerals, and glassy phases. Procedures can be adapted to meet a variety of research objectives.

  14. Quantitative biological imaging by ptychographic X-ray diffraction microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Giewekemeyer, Klaus; Kalbfleisch, Sebastian; Beerlink, Andre; Salditt, Tim [Institut fuer Roentgenphysik, Georg-August-Universitaet Goettingen (Germany); Thibault, Pierre; Dierolf, Martin; Pfeiffer, Franz [Department Physik (E17), Technische Universitaet Muenchen, Garching (Germany); Kewish, Cameron M. [Paul Scherrer Institut, Villigen PSI (Switzerland)

    2010-07-01

    Mesoscopic structures with specific functions are abundant in many cellular systems and have been well characterized by electron microscopy in the past. However, the quantitative study of the three-dimensional structure and density of subcellular components remains a difficult problem. In this contribution we show how these limitations could be overcome in the future by the application of recently introduced and now rapidly evolving coherent X-ray imaging techniques for quantitative biological imaging on the nanoscale. More specifically, we report on a recent scanning (ptychographic) diffraction experiment on unstained and unsliced freeze-dried cells of the bacterium Deinococcus radiourans using only a pinhole as beam defining optical element. As a result quantitative density projections well below optical resolution have been achieved.

  15. Innovative in Situ Ball Mill for X-ray Diffraction.

    Science.gov (United States)

    Ban, Voraksmy; Sadikin, Yolanda; Lange, Michael; Tumanov, Nikolay; Filinchuk, Yaroslav; Černý, Radovan; Casati, Nicola

    2017-12-19

    The renewed interest of mechanochemistry as an ecofriendly synthetic route has inspired original methodologies to probe reactions, with the aim to rationalize unknown mechanisms. Recently, Friščić et al. ( Nat. Chem. 2013 , 5 , 66 - 73 , DOI: 10.1038/nchem.1505 ) monitored the progress of milling reactions by synchrotron X-ray powder diffraction (XRPD). For the first time, it was possible to acquire directly information during a mechanochemical process. This new methodology is still in its early stages, and its development will definitively transform the fundamental understanding of mechanochemistry. A new type of in situ ball mill setup has been developed at the Materials Science beamline (Swiss Light Source, Paul Scherrer Institute, Switzerland). Its particular geometry, described here in detail, results in XRPD data displaying significantly lower background and much sharper Bragg peaks, which in turn allow more sophisticated analysis of mechanochemical processes, extending the limits of the technique.

  16. X-ray diffraction study of choline chloride's β form

    International Nuclear Information System (INIS)

    Petrouleas, V.; Lemmon, R.M.; Christensen, A.

    1978-01-01

    The organic salt choline chloride exists in two crystalline polymorphs. One (the α form) is extraordinarily sensitive to ionizing radiation, the other (the β form) is not. The present report describes an x-ray diffraction study of the β form. The structure has been found to be highly disordered face centered cubic. A reasonable least-square refinement of the intensity data has been achieved in the centrosymmetric space group Fm3 or Fm3m by use of a molecular model with restrained bond lengths. The results show that in the β form the electronic density due to the choline cation is closely spaced around the N, so that hydrogen bonding to the chloride is unlikely. Comparison with infrared and NMR data indicates that the disordering is dynamic and can be ascribed to rotations of the choline ion around crystallographic symmetry axes. Possible connections of these results with the radiation stability of the β form are discussed

  17. Analysis of the corium phases by X-ray diffraction

    International Nuclear Information System (INIS)

    Trillon, G.

    2004-01-01

    In the framework of the severe accidents R and D studies led by CEA, the better knowledge of the corium behaviour, corium coming from the melting of a nuclear reactor, are fundamental stakes in order to master this kind of accident. Among the available physical properties of the corium, the nature of the final crystalline compounds which have been made during the, cooling gives information about its solidification and its stabilisation. X-Rays Diffraction is the reference method used in order to characterize the corium coming from the different facilities of the European platform PLINIUS of CEA-Cadarache. This work presents the scientific approach that has been followed in order to obtain information both qualitative and quantitative on corium, using X-Rays Diffraction. For instance, a specific method for identifying U 1-x Zr x O 2 solid solutions has been developed, and the validity of quantitative analysis of corium crystalline phases using the Rietveld method (with an internal standard), has been tested. This last method has also permitted semi-quantitative measurements of amorphous phases within corium. For these studies, analysis of prototypical corium has been conducted on samples coming from the experiences led on the different facilities of the PLINIUS platform. These analysis allowed for the first time to obtain quantitative data of the corium crystalline phases in order to validate thermodynamic databases and has been used to estimate the thereto-physical properties of the corium. New information on crystalline phases of corium has also been found, especially for the UO 2 -ZrO 2 pseudo binary system. (author)

  18. Phosphor Scanner For Imaging X-Ray Diffraction

    Science.gov (United States)

    Carter, Daniel C.; Hecht, Diana L.; Witherow, William K.

    1992-01-01

    Improved optoelectronic scanning apparatus generates digitized image of x-ray image recorded in phosphor. Scanning fiber-optic probe supplies laser light stimulating luminescence in areas of phosphor exposed to x rays. Luminescence passes through probe and fiber to integrating sphere and photomultiplier. Sensitivity and resolution exceed previously available scanners. Intended for use in x-ray crystallography, medical radiography, and molecular biology.

  19. Nanostructured diffractive optical devices for soft X-ray microscopes

    CERN Document Server

    Hambach, D; Schneider, G

    2001-01-01

    The new transmission X-ray microscope (TXM) installed at the BESSY II electron storage ring uses an off-axis transmission zone plate (OTZ) as diffractive and focusing element of the condenser-monochromator setup. A high resolution micro-zone plate (MZP) forms a magnified image on a CCD-detector. Both, the OTZ with an active area of up to 24 mm sup 2 and the MZP with zone widths as small as 25 nm are generated by a process including electron beam lithography (EBL), dry etching and subsequent electroplating of nickel on top of silicon membrane substrates with about 100-150 nm thickness. The combination of a larger zone width and the usage of nickel zone structures allows to increase the diffraction efficiency of the condenser element at least by a factor of 3 compared to the earlier used KZP7 condenser zone plate in the TXM at BESSY I. Groove diffraction efficiencies of 21.6% and 14.7% were measured for MZP objectives with 40 and 25 nm outermost zone width, respectively.

  20. Fundamentals of powder x-ray diffraction practice

    International Nuclear Information System (INIS)

    Raftery, T.

    2002-01-01

    Full text: The goal of powder Xray diffraction is to gain information about a specimen or sample. Key aspects of this goal are 1. the sample selection, preparation and presentation; 2. the data collection process and conditions; 3. the interaction between these and the interpretation of the data. The 'ideal' powder (or polycrystalline) xray diffraction sample is fine grained, randomly orientated, homogenous and representative. There exists standard sample selection and preparation techniques for powders - sometimes however, the required information must be gained by alternate sample selection and preparation techniques. While there are few variables in the data collection process, there are some significant ones such as matching diffractometer resolution and intensity to the data collection goal whether that is phase identity, quantitative analysis or structure refinement, etc. There are also options of optical arrangement (Bragg-Brintano versus parallel beam versus Debye-Scherrer). One important aspect of the collection process is the assessment of the data quality. Powder xray diffraction has many applications from the straight-forward confirmation of phase identity and purity to structural analysis. Some of these applications will be considered and the interaction between the goal of the application and aspects of sample selection. Copyright (2002) Australian X-ray Analytical Association Inc

  1. Ultrafast time-resolved X-ray diffraction using an optimized laser-plasma based X-ray source

    International Nuclear Information System (INIS)

    Lu, Wei

    2013-01-01

    Femtosecond X-ray pulses are invaluable tools to investigate the structural dynamics triggered by a femtosecond laser pulse. These ultrashort X-ray pulses can be provided by lab-sized laser-produced plasma X-ray sources. This thesis is dedicated to optimizing the X-ray emission from the X-ray source at the University of Duisburg-Essen and using this source to investigate ultrafast structural dynamics in laser excited materials. For these purposes, detailed investigations on how the laser intensities, target thicknesses, angles of incidence and different pre-pulse/pre-plasma conditions affecting the emission of Kα-photons from Cu and Ti targets were performed. The outcomes from these studies are applied to optimize the X-ray production of the existing X-ray source for time resolved X-ray diffraction (TRXD) experiments. In the mean time, in order to improve the measurement sensitivity/accuracy, and automatize and speed up the experimental procedures, several other improvements have been implemented in the experimental setup for TRXD experiments. These improvements of the setup are essential to achieve the results of the three TRXD experiments discussed in this thesis. In the first experiment, Debye-Waller effect in a thin laser-excited Au film was observed. The drop of measured diffraction signal with a decay time constant of 4.3±1 ps was measured for high excitation fluences. This result is in good agreement with previous experimental results as well as the Two-Temperature Model (TTM) calculations at high fluences. The second experiment extends the studies of coherent optical phonons in laser-excited Bi to a higher excitation fluence range that has not been investigated previously. Large amplitude coherent atomic motion and a complete softening of the A1g phonon mode were observed. These observations represents conclusive experimental evidence that the Peierls distortion, which defines the equilibrium structure of Bi, vanishes and the material is transformed into

  2. Simultaneous X-ray diffraction and phase-contrast imaging for investigating material deformation mechanisms during high-rate loading

    Energy Technology Data Exchange (ETDEWEB)

    Hudspeth, M. [Purdue University, West Lafayette, IN 47907 (United States); Sun, T. [Argonne National Laboratory, Argonne, IL 60439 (United States); Parab, N.; Guo, Z. [Purdue University, West Lafayette, IN 47907 (United States); Fezzaa, K. [Argonne National Laboratory, Argonne, IL 60439 (United States); Luo, S. [The Peac Institute of Multiscale Sciences, Chengdu, Sichuan 610207, People’s Republic of (China); Chen, W., E-mail: wchen@purdue.edu [Purdue University, West Lafayette, IN 47907 (United States)

    2015-01-01

    A simultaneous X-ray imaging and diffraction technique has been developed for studying dynamic material behaviors during high-rate tensile loading provided by a miniature Kolsky bar. Using a high-speed camera and an intensified charge-coupled device (ICCD), a simultaneous X-ray imaging and diffraction technique has been developed for studying dynamic material behaviors during high-rate tensile loading. A Kolsky tension bar has been used to pull samples at 1000 s{sup −1} and 5000 s{sup −1} strain-rates for super-elastic equiatomic NiTi and 1100-O series aluminium, respectively. By altering the ICCD gating time, temporal resolutions of 100 ps and 3.37 µs have been achieved in capturing the diffraction patterns of interest, thus equating to single-pulse and 22-pulse X-ray exposure. Furthermore, the sample through-thickness deformation process has been simultaneously imaged via phase-contrast imaging. It is also shown that adequate signal-to-noise ratios are achieved for the detected white-beam diffraction patterns, thereby allowing sufficient information to perform quantitative data analysis diffraction via in-house software (WBXRD-GUI). Of current interest is the ability to evaluate crystal d-spacing, texture evolution and material phase transitions, all of which will be established from experiments performed at the aforementioned elevated strain-rates.

  3. X-ray diffraction using the time structure of the SRS

    International Nuclear Information System (INIS)

    Tanner, B.K.

    1983-01-01

    The subject is discussed under the headings: introduction (advances in the techniques of X-ray topography; comparison with transmission electron microscopy); stroboscopic X-ray topography; stroboscopic X-ray topography of travelling surface acoustic waves; possible general diffraction experiments. (U.K.)

  4. X-ray diffraction studies of NbTe 2 single crystal

    Indian Academy of Sciences (India)

    The composition of the grown crystals was confirmed on the basis of energy dispersive analysis by X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and X-ray density have been carried out for the grown crystals. The particle size ...

  5. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    Energy Technology Data Exchange (ETDEWEB)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil; Liu, Zunping; Lang, Keenan; Huang, Xianrong; Wieczorek, Michael; Kasman, Elina; Hammonds, John; Macrander, Albert; Assoufid, Lahsen [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States)

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity and spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.

  6. An autonomous CZT module for X-ray diffraction imaging

    International Nuclear Information System (INIS)

    Montemont, G.; Monnet, O.; Stanchina, S.; Verger, L.; Kosciesza, D.; Schlomka, J.P.

    2013-01-01

    We present the development of a CZT-based detection module dedicated to X-ray diffraction imaging. This kind of application requires a good energy and spatial resolution in order to resolve Bragg peaks. In a first part, we present the detector configuration used and dimensioning constraints. As the input energy range is comprised between 20 and 150 keV, we use 5 mm thick high resistivity CZT crystals. The 660 mm 2 detection area is segmented on both sides into 192 anodes and 12 cathodes. Signals from both sides are read jointly in order to perform multi parametric event corrections (depth of interaction, charge sharing, induction sharing). In order to be integrated easily inside an X-ray imaging system, the system has been conceived to be completely autonomous: it is powered by a single 12 V supply and is interfaced with the external system by Ethernet for communication and RS485 for synchronization. In a second part, we describe the system readout architecture and then the implementation of the data processing. An FPGA circuit embeds a digital processing chain that carries out readout ASIC interfacing and advanced multi parametric data corrections. Gain, offset but also depth of interaction and charge sharing are corrected on the flow. Incoming events from different channels are clustered together by comparing their location and time of occurrence. The FPGA also embeds a processor running an operating system that controls the system, carries out all calibrations, automated tests and acquisitions. Eventually, we show the results obtained and demonstrate the relative influence of depth of interaction and charge sharing. Homogeneity of detector behavior is also discussed and the reproducibility of the performance between modules is presented. The average energy resolution at 25 C is 2.4 % FWHM at 122 keV and 3.8 % FWHM at 60 keV and the average efficiency is 73 %. (authors)

  7. IL 12: Femtosecond x-ray powder diffraction

    International Nuclear Information System (INIS)

    Woerner, M.; Zamponi, F.; Rothhardt, P.; Ansari, Z.; Dreyer, J.; Freyer, B.; Premont-Schwarz, M.; Elsaesser, T.

    2010-01-01

    A chemical reaction generates new compounds out of one or more initial species. On a molecular level, the spatial arrangement of electrons and nuclei changes. While the structure of the initial and the product molecules can be measured routinely, the transient structures and molecular motions during a reaction have remained unknown in most cases. This knowledge, however, is a key element for the exact understanding of the reaction. The ultimate dream is a 'reaction microscope' which allows for an in situ imaging of the molecules during a reaction. We report on the first femtosecond x-ray powder diffraction experiment in which we directly map the transient electronic charge density in the unit cell of a crystalline solid with 30 pico-meter spatial and 100 femtosecond temporal resolution. X-ray diffraction from polycrystalline powder samples, the Debye Scherrer diffraction technique, is a standard method for determining equilibrium structures. The intensity of the Debye Scherrer rings is determined by the respective x-ray structure factor which represents the Fourier transform of the spatial electron density. In our experiments, the transient intensity and angular positions of up to 20 Debye Scherrer reactions from a polycrystalline powder are measured and unravel for the first time a concerted electron and proton transfer in hydrogen-bonded ionic (NH 4 ) 2 SO 4 crystals. Photoexcitation of ammonium sulfate induces a sub-100 fs electron transfer from the sulfate groups into a highly conned electron channel along the z-axis of the unit cell. The latter geometry is stabilized by transferring protons from the adjacent ammonium groups into the channel. Time-dependent charge density maps derived from the diffraction data display a periodic modulation of the channels charge density by low-frequency lattice motions with a concerted electron and proton motion between the channel and the initial proton binding site. A deeper insight into the underlying microscopic

  8. High-Resolution Detector For X-Ray Diffraction

    Science.gov (United States)

    Carter, Daniel C.; Withrow, William K.; Pusey, Marc L.; Yost, Vaughn H.

    1988-01-01

    Proposed x-ray-sensitive imaging detector offers superior spatial resolution, counting-rate capacity, and dynamic range. Instrument based on laser-stimulated luminescence and reusable x-ray-sensitive film. Detector scans x-ray film line by line. Extracts latent image in film and simultaneously erases film for reuse. Used primarily for protein crystallography. Principle adapted to imaging detectors for electron microscopy and fluorescence spectroscopy and general use in astronomy, engineering, and medicine.

  9. Two digital X-ray imaging systems for applications in X-ray diffraction

    International Nuclear Information System (INIS)

    Bateman, J.E.; Connolly, J.F.; Stephenson, R.; Flesher, A.C.; Bryant, C.J.; Lincoln, A.D.; Tucker, P.A.; Swanton, S.W.

    1986-08-01

    Two digital X-ray imaging systems developed at the Rutherford Appleton Laboratory are described:- the Mark I and the Mark II. Both use a bidimensionally sensitive Multiwire proportional counter as the basic X-ray image transducer coupled to a digital microcomputer system. The Mark I system provides the advantages of high speed, high sensitivity digital imaging directly into the computer with the potential for software control of the sample orientation and environment. The Mark II system adds the novel features of signal averaging and multi-frame exposures. (author)

  10. Spectral feature variations in x-ray diffraction imaging systems

    Science.gov (United States)

    Wolter, Scott D.; Greenberg, Joel A.

    2016-05-01

    Materials with different atomic or molecular structures give rise to unique scatter spectra when measured by X-ray diffraction. The details of these spectra, though, can vary based on both intrinsic (e.g., degree of crystallinity or doping) and extrinsic (e.g., pressure or temperature) conditions. While this sensitivity is useful for detailed characterizations of the material properties, these dependences make it difficult to perform more general classification tasks, such as explosives threat detection in aviation security. A number of challenges, therefore, currently exist for reliable substance detection including the similarity in spectral features among some categories of materials combined with spectral feature variations from materials processing and environmental factors. These factors complicate the creation of a material dictionary and the implementation of conventional classification and detection algorithms. Herein, we report on two prominent factors that lead to variations in spectral features: crystalline texture and temperature variations. Spectral feature comparisons between materials categories will be described for solid metallic sheet, aqueous liquids, polymer sheet, and metallic, organic, and inorganic powder specimens. While liquids are largely immune to texture effects, they are susceptible to temperature changes that can modify their density or produce phase changes. We will describe in situ temperature-dependent measurement of aqueous-based commercial goods in the temperature range of -20°C to 35°C.

  11. Federated repositories of X-ray diffraction images.

    Science.gov (United States)

    Androulakis, Steve; Schmidberger, Jason; Bate, Mark A; DeGori, Ross; Beitz, Anthony; Keong, Cyrus; Cameron, Bob; McGowan, Sheena; Porter, Corrine J; Harrison, Andrew; Hunter, Jane; Martin, Jennifer L; Kobe, Bostjan; Dobson, Renwick C J; Parker, Michael W; Whisstock, James C; Gray, Joan; Treloar, Andrew; Groenewegen, David; Dickson, Neil; Buckle, Ashley M

    2008-07-01

    There is a pressing need for the archiving and curation of raw X-ray diffraction data. This information is critical for validation, methods development and improvement of archived structures. However, the relatively large size of these data sets has presented challenges for storage in a single worldwide repository such as the Protein Data Bank archive. This problem can be avoided by using a federated approach, where each institution utilizes its institutional repository for storage, with a discovery service overlaid. Institutional repositories are relatively stable and adequately funded, ensuring persistence. Here, a simple repository solution is described, utilizing Fedora open-source database software and data-annotation and deposition tools that can be deployed at any site cheaply and easily. Data sets and associated metadata from federated repositories are given a unique and persistent handle, providing a simple mechanism for search and retrieval via web interfaces. In addition to ensuring that valuable data is not lost, the provision of raw data has several uses for the crystallographic community. Most importantly, structure determination can only be truly repeated or verified when the raw data are available. Moreover, the availability of raw data is extremely useful for the development of improved methods of image analysis and data processing.

  12. X-Ray Powder Diffraction with Guinier - Haegg Focusing Cameras

    International Nuclear Information System (INIS)

    Brown, Allan

    1970-12-01

    The Guinier - Haegg focusing camera is discussed with reference to its use as an instrument for rapid phase analysis. An actual camera and the alignment procedure employed in its setting up are described. The results obtained with the instrument are compared with those obtained with Debye - Scherrer cameras and powder diffractometers. Exposure times of 15 - 30 minutes with compounds of simple structure are roughly one-sixth of those required for Debye - Scherrer patterns. Coupled with the lower background resulting from the use of a monochromatic X-ray beam, the shorter exposure time gives a ten-fold increase in sensitivity for the detection of minor phases as compared with the Debye - Scherrer camera. Attention is paid to the precautions taken to obtain reliable Bragg angles from Guinier - Haegg film measurements, with particular reference to calibration procedures. The evaluation of unit cell parameters from Guinier - Haegg data is discussed together with the application of tests for the presence of angle-dependent systematic errors. It is concluded that with proper calibration procedures and least squares treatment of the data, accuracies of the order of 0.005% are attainable. A compilation of diffraction data for a number of compounds examined in the Active Central Laboratory at Studsvik is presented to exemplify the scope of this type of powder camera

  13. X-Ray Diffraction and the Discovery of the Structure of DNA

    Science.gov (United States)

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  14. Modelling the X-ray powder diffraction of nitrogen-expanded austenite using the Debye formula

    DEFF Research Database (Denmark)

    Oddershede, Jette; Christiansen, Thomas; Ståhl, Kenny

    2008-01-01

    Stress-free and homogeneous samples of nitrogen-expanded austenite, a defect-rich f.c.c. structure with a high interstitial nitrogen occupancy (between 0.36 and 0.61), have been studied using X-ray powder diffraction and Debye simulations. The simulations confirm the presence of deformation...... to be indistinguishable to X-ray powder diffraction....

  15. On the theory of time-resolved x-ray diffraction

    DEFF Research Database (Denmark)

    Henriksen, Niels Engholm; Møller, Klaus Braagaard

    2008-01-01

    We derive the basic theoretical formulation for X-ray diffraction with pulsed fields, using a fully quantized description of light and matter. Relevant time scales are discussed for coherent as well as incoherent X-ray pulses, and we provide expressions to be used for calculation of the experimen......We derive the basic theoretical formulation for X-ray diffraction with pulsed fields, using a fully quantized description of light and matter. Relevant time scales are discussed for coherent as well as incoherent X-ray pulses, and we provide expressions to be used for calculation...... of the experimental diffraction signal for both types of X-ray sources. We present a simple analysis of time-resolved X-ray scattering for direct bond breaking in diatomic molecules. This essentially analytical approach highlights the relation between the signal and the time-dependent quantum distribution...

  16. X-ray and neutron diffraction in the study of organic crystalline hydrates.

    OpenAIRE

    Fucke, K.; Steed, J.W.

    2010-01-01

    A review. Diffraction methods are a powerful tool to investigate the crystal structure of organic compounds in general and their hydrates in particular. The laboratory standard technique of single crystal X-ray diffraction gives information about the molecular conformation, packing and hydrogen bonding in the crystal structure, while powder X-ray diffraction on bulk material can trace hydration/dehydration processes and phase transitions under non-ambient conditions. Neutron diffraction is a ...

  17. High-energy X-ray diffraction of disordered materials in high-energy X-ray diffraction beamline BL04B2 at SPring-8

    International Nuclear Information System (INIS)

    Kohara, Shinji; Suzuya, Kentaro

    2001-01-01

    The high-energy (E≥30 keV) X-ray diffraction with the latest generation synchrotron sources as well as the introduction of advanced insertion devices has created new approaches to the quantitative study of the structure of non-crystalline materials because of several improvements: higher resolution in real space due to a wide range of Q, smaller correction terms (especially for absorption correction), reduction of truncation errors, the feasibility of running under extreme environments, including low- and high-temperatures, and of obtaining a direct comparison between X-ray and neutron diffraction data. Recently, this technique has been combined with neutron diffraction with a pulsed source to provide more detailed and reliable structural information not previously available. This article reviews and summarizes a horizontal two-axis diffractometer for non-crystalline materials, installed at the high-energy X-ray diffraction beamline BL04B2 of SPring-8, and recent results obtained from the high-energy X-ray diffraction on several oxide glasses: SiO 2 and GeO 2 . In particular, it addresses the structural models of oxide glasses obtained by the reverse Monte Carlo (RMC) modelling technique using both the high-energy X-ray and neutron diffraction data. (author)

  18. Qualitative analysis of powder x-ray diffraction data

    International Nuclear Information System (INIS)

    Raftery, T.

    1999-01-01

    based methods of considering significant lines such as with the Hanawalt, Fink and alphabetical index; computer based search-match based on FOM and the more recent graphically based full pattern methods of phase identification. No single approach is foolproof. a range of techniques is recommended if a high level of success is required. Copyright (1999) Australian X-ray Analytical Association Inc

  19. Two digital X-ray imaging systems for applications in X-ray diffraction

    International Nuclear Information System (INIS)

    Bateman, J.E.; Connolly, J.F.; Stephenson, R.; Flesher, A.C.; Tucker, P.A.; Swanton, S.W.

    1987-01-01

    Two digital X-ray imaging systems developed at the Rutherford Appleton Laboratory are described: the Mark I and the Mark II. Both use a bidimensionally sensitive multiwire proportional counter (MWPC) as the basic X-ray image transducer coupled, in the case of the Mark I to a Digital LSI 11-23 microcomputer system via CAMAC, and in the case of the Mark II to a Digital LSI 11-73 microcomputer system via custom-built data acquisition hardware mounted directly on the Q-bus of the microcomputer. The Mark I system provides the advantages of high speed, high sensitivity digital imaging directly into the computer with the potential for software control of the sample orientation and environment. The Mark II system adds the novel features of signal averaging and multiframe exposures. The dedicated digital memories have a resolution of 512x512 pixels of 16 bits, matching well to the spatial resolution of the xenon-filled MWPC (0.5 mm fwhm over an aperture of 200 mm x 200 mm). A 512x512x4 bit video graphics system displays the images in grey scales or colour. (orig.)

  20. Single shot diffraction of picosecond 8.7-keV x-ray pulses

    Directory of Open Access Journals (Sweden)

    F. H. O’Shea

    2012-02-01

    Full Text Available We demonstrate multiphoton, single shot diffraction images of x rays produced by inverse Compton scattering a high-power CO_{2} laser from a relativistic electron beam, creating a pulse of 8.7 keV x rays. The tightly focused, relatively high peak brightness electron beam and high photon density from the 2 J CO_{2} laser yielded 6×10^{7} x-ray photons over the full opening angle in a single shot. Single shot x-ray diffraction is performed by passing the x rays though a vertical slit and on to a flat silicon (111 crystal. 10^{2} diffracted photons were detected. The spectrum of the detected x rays is compared to simulation. The diffraction and detection of 10^{2} x rays is a key step to a more efficient time resolved diagnostic in which the number of observed x rays might reach 10^{4}; enabling a unique, flexible x-ray source as a sub-ps resolution diagnostic for studying the evolution of chemical reactions, lattice deformation and melting, and magnetism.

  1. X-ray and neutron diffraction studies of superionic conductors: protonic compounds

    International Nuclear Information System (INIS)

    Tranqui, D.; Anne, M.

    1982-01-01

    Rapid reviews of X-ray and neutron diffraction theories and instrumentations are presented. It is shown that X-ray diffraction is a very powerful tool to determine three dimensional crystal structures. However localization of light atoms by X-ray is somewhat uncertain in compounds containing heavy atoms. In neutron diffraction the irregular but limited variation of scattering lengths of all elements within the periodic table render it possible to localize almost all atoms, especially hydrogen atoms in solids. Some recent and successful studies of protonic compounds and other by X-ray and neutron diffraction are cited. These examples demonstrate that the combined X-ray and neutron techniques should be used to obtain not only geometrical features of rigid framework in superionic conductor materials but also in an indirect way the dynamic properties of mobile ions. (author)

  2. A conical-type X-ray guide tube for diffraction experiments with small crystals

    International Nuclear Information System (INIS)

    Nozaki, Hiroshi; Nakazawa, Hiromoto

    1986-01-01

    The divergence and intensity distribution of X-rays transported through a conical-type X-ray guide tube (XGT) were measured. Diverging X-rays from a point source were condensed by use of the conical-type XGT. The parallelism of X-rays through the XGT was better than that encountered for a cylindrical-type XGT proposed previously. The intensity of the X-ray beam around the central axis of the conical-type XGT was exceedingly high in comparison with that measured without the tube and almost uniform over a cross-sectional area 60 μm in diameter. The high intensity provides the possibility of performing diffraction experiments with crystals as small as 20 μm in diameter with a conventional X-ray diffraction system. (orig.)

  3. Measurement of thickness of thin films by the X-ray diffraction method

    International Nuclear Information System (INIS)

    Srinivasan, C.; Balasingh, C.; Singh, A.K.

    1979-07-01

    X-ray diffraction method can be used to measure the thickness of thin films (coatings). The principle and the experimental details of the x-ray diffraction methods are described. The intensities of the diffracted beams are derived assuming a random orientation of the crystallites in the diffracting medium. Consequently, the expressions are not valid when the sample has preferred orientation. To check the performance of the method, thicknesses of nickel deposits on mild steel plates were determined by the x-ray diffraction method and the results compared with those obtained by the weighing method and metallographic examination. The weighing method which gives an accuracy of +- 0.1 micron is taken as the standard. The x-ray diffraction methods and the metallographic examinations give values within +- 1 micron of the value obtained by the weighing method. (author)

  4. Physical methods for studying minerals and solid materials: X-ray, electron and neutron diffraction; scanning and transmission electron microscopy; X-ray, electron and ion spectrometry

    International Nuclear Information System (INIS)

    Eberhart, J.-P.

    1976-01-01

    The following topics are discussed: theoretical aspects of radiation-matter interactions; production and measurement of radiations (X rays, electrons, neutrons); applications of radiation interactions to the study of crystalline materials. The following techniques are presented: X-ray and neutron diffraction, electron microscopy, electron diffraction, X-ray fluorescence analysis, electron probe microanalysis, surface analysis by electron emission spectrometry (ESCA and Auger electrons), scanning electron microscopy, secondary ion emission analysis [fr

  5. X-ray micro diffraction study on mesostructured silica thin films

    CERN Document Server

    Noma, T; Miyata, H; Iida, A

    2001-01-01

    The local structure of highly ordered mesostructured silica films was investigated by using a synchrotron X-ray microbeam and a CCD X-ray detector. Two-dimensional X-ray diffraction patterns clearly showed the detailed arrangement of the mesostructures, in which the hexagonal mesochannels aligned uniaxially in the mesostructured silica films formed on a silica glass substrate with a rubbing-treated thin polyimide coating. The alignment direction was shown to be perpendicular to the rubbing direction. The grazing incidence condition revealed the structural anisotropy of the mesostructures, while normal incidence X-ray diffraction data indicated the in-plane structural uniformity of the films. Extra spots were observed in the diffraction patterns. This suggested that the X-ray beam reflected at the boundary of the mesostructured silica film and the substrate.

  6. Structural Investigations of Nanowires Using X-Ray Diffraction

    DEFF Research Database (Denmark)

    Stankevic, Tomas

    Advancements in growth of the nanowire-based devices opened another dimension of possible structures and material combinations, which nd their applications in a wide variety of elds, including everyday life. Characterization of such devices brings its own challenges and here we show that X-rays oer...

  7. (X-ray diffraction experiments with condenser matter)

    Energy Technology Data Exchange (ETDEWEB)

    Coppens, P.

    1990-01-01

    This report discusses research on the following topics: high-{Tc} superconductors; The response of crystal to an applied electric field; quasicrystals; surface structure and kinetics of surface layer formation; EXAFS studies of superconductors and heterostructures; effect of iron on the crystal structure of perovskite; x-ray detector development; and SAXS experiments. (LSP)

  8. Electronic structure of nanoscale Cu/Pt alloys: A combined X-ray diffraction and X-ray absorption investigations

    International Nuclear Information System (INIS)

    Chen Xing; Chu Wangsheng; Cai Quan; Xia Dingguo; Wu Zhonghua; Wu Ziyu

    2006-01-01

    PVP-protected Cu/Pt clusters were prepared by glycol/water reduction method and characterized with transmission electron microscopy (TEM), X-ray diffraction (XRD) and absorption spectra. TEM and XRD analysis show that the Cu/Pt clusters with different molar ratio have fcc structure with particle size of about 4 nm, while the lattice parameters in these clusters reduce with increasing Cu concentration. From the X-ray absorption near edge structure (XANES) at Cu-K edge and Pt-L 2,3 edge, we demonstrate that the d-electronic states of Cu and Pt are affected by the local environment as a function of Cu/Pt molar ratio. With increasing Cu concentration, Pt loses a fraction of 5d electrons and the hybridization between p- and d-states at Cu sites is enhanced

  9. Electronic structure of nanoscale Cu/Pt alloys: A combined X-ray diffraction and X-ray absorption investigations

    Energy Technology Data Exchange (ETDEWEB)

    Chen Xing [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Graduate School of the Chinese Academy of Sciences, 100864 Beijing (China); Chu Wangsheng [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); University of Science and Technology of China, Hefei, 230036 (China); Cai Quan [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Graduate School of the Chinese Academy of Sciences, 100864 Beijing (China); Xia Dingguo [College of Environmental and Energy Engineering, Beijing University of Technology, 100022 Beijing (China); Wu Zhonghua [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Wu Ziyu [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China) and National Center for Nanoscience and Technology (China)]. E-mail: wuzy@ihep.ac.cn

    2006-11-15

    PVP-protected Cu/Pt clusters were prepared by glycol/water reduction method and characterized with transmission electron microscopy (TEM), X-ray diffraction (XRD) and absorption spectra. TEM and XRD analysis show that the Cu/Pt clusters with different molar ratio have fcc structure with particle size of about 4 nm, while the lattice parameters in these clusters reduce with increasing Cu concentration. From the X-ray absorption near edge structure (XANES) at Cu-K edge and Pt-L{sub 2,3} edge, we demonstrate that the d-electronic states of Cu and Pt are affected by the local environment as a function of Cu/Pt molar ratio. With increasing Cu concentration, Pt loses a fraction of 5d electrons and the hybridization between p- and d-states at Cu sites is enhanced.

  10. X-ray Diffraction Crystal Calibration and Characterization

    International Nuclear Information System (INIS)

    Haugh, Michael J.; Stewart, Richard; Kugland, Nathan

    2009-01-01

    National Security Technologies X-ray Laboratory is comprised of a multi-anode Manson type source and a Henke type source that incorporates a dual goniometer and XYZ translation stage. The first goniometer is used to isolate a particular spectral band. The Manson operates up to 10 kV and the Henke up to 20 kV. The Henke rotation stages and translation stages are automated. Procedures have been developed to characterize and calibrate various NIF diagnostics and their components. The diagnostics include X-ray cameras, gated imagers, streak cameras, and other X-ray imaging systems. Components that have been analyzed include filters, filter arrays, grazing incidence mirrors, and various crystals, both flat and curved. Recent efforts on the Henke system are aimed at characterizing and calibrating imaging crystals and curved crystals used as the major component of an X-ray spectrometer. The presentation will concentrate on these results. The work has been done at energies ranging from 3 keV to 16 keV. The major goal was to evaluate the performance quality of the crystal for its intended application. For the imaging crystals we measured the laser beam reflection offset from the X-ray beam and the reflectivity curves. For the curved spectrometer crystal, which was a natural crystal, resolving power was critical. It was first necessary to find sources of crystals that had sufficiently narrow reflectivity curves. It was then necessary to determine which crystals retained their resolving power after being thinned and glued to a curved substrate

  11. Interaction between lipid monolayers and poloxamer 188: An X-ray reflectivity and diffraction study

    DEFF Research Database (Denmark)

    Wu, G.H.; Majewski, J.; Ege, C.

    2005-01-01

    The mechanism by which poloxamer 188 (P188) seals a damaged cell membrane is examined using the lipid monolayer as a model system. X-ray reflectivity and grazing-incidence x-ray diffraction results show that at low nominal lipid density, P188, by physically occupying the available area and phase ...

  12. X-ray diffraction studies of NbTe2 single crystal

    Indian Academy of Sciences (India)

    Unknown

    X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and ... The layered structure compound, NbTe2, is one of the typical materials which lead to charge .... financial assistance to carry out this work. References. Brown B E 1966 Acta ...

  13. Microprocessor-based system for automatic X-ray diffraction and fluorescence

    International Nuclear Information System (INIS)

    Souza, A.M. de; Carmo, L.C.S. do; Pereira, V.J.E.; Soares, E.A.

    1984-01-01

    A data acquisition and processing device appropriate for X-ray analysis and goniometer control was built. The Z-80 based system as well as the whole architeture is described. The advantages and new possibilities of the automated instrument as compared to the traditional ones are listed. The X-ray diffraction and fluorescence techniques can take advantage of the automation. (Author) [pt

  14. Modern X-ray diffraction. X-ray diffractometry for materials scientists, physicists, and chemicists. 2. rev. and enl. ed.; Moderne Roentgenbeugung. Roentgendiffraktometrie fuer Materialwissenschaftler, Physiker und Chemiker

    Energy Technology Data Exchange (ETDEWEB)

    Spiess, Lothar; Teichert, Gerd; Schwarzer, Robert; Behnken, Herfried; Genzel, Christoph

    2009-07-01

    This book offers a comprehensive survey over the applications of X-ray diffractions in fields like materials technique, metallurgy, electrotechniques, mechanical engineering, as well as micro- and nanotechniques. The necessary baic knowledges of X-ray diffraction are mediated foundedly and illustratively. Thereby new techniques and evaluation procedures are presented as well as well known methods.

  15. High-energy X-ray diffraction studies of disordered materials

    International Nuclear Information System (INIS)

    Kohara, Shinji; Suzuya, Kentaro

    2003-01-01

    With the arrival of the latest generation of synchrotron sources and the introduction of advanced insertion devices (wigglers and undulators), the high-energy (E≥50 keV) X-ray diffraction technique has become feasible, leading to new approaches in the quantitative study of the structure of disordered materials. High-energy X-ray diffraction has several advantages: higher resolution in real space due to a wide range of scattering vector Q, smaller correction terms (especially the absorption correction), reduction of truncation errors, the feasibility of running under extreme environments, including high-temperatures and high-pressures, and the ability to make direct comparisons between X-ray and neutron diffraction data. Recently, high-energy X-ray diffraction data have been combined with neutron diffraction data from a pulsed source to provide more detailed and reliable structural information than that hitherto available

  16. Reflectivity and diffraction of X rays applied to organic thin films

    International Nuclear Information System (INIS)

    Rieutord, Francois

    1987-01-01

    This research thesis reports the study of organic thin films by using X-ray-based technologies, and more particularly X-ray reflectivity. After some recalls on X ray diffraction, and on the fabrication of Langmuir-Blodgett films, the author shows how, by combining three X-ray-based techniques, it is possible to study a volume structure of a thin film. He describes the technique of measurement by X- ray reflexivity, its experimental implementation, and methods for result interpretation. In the next part, the author reports the study of peculiar interference effects which are noticed in reflexivity on Langmuir-Blodgett films, and then describes the nature of these films by correlating results of X ray reflexivity with direct observations performed by electronic microscopy on replica [fr

  17. High-k Gate Dielectric Films Studied by Extremely Asymmetric X-ray Diffraction and X-ray Photoelectron Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Yuki [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Akimoto, Koichi [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Yoshida, Hironori [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Emoto, Takashi [Toyota National College of Technology, Toyota, Aichi 471-8525 (Japan); Kobayashi, Daisuke [Institute of Space and Astronautical Science, Sagamihara, Kanagawa 229-8510 (Japan); Hirose, Kazuyuki [Institute of Space and Astronautical Science, Sagamihara, Kanagawa 229-8510 (Japan)

    2007-10-15

    We studied HfAlO{sub x}(N)/SiO{sub 2}/Si films which were fabricated by the layer-by-layer deposition and annealing (LL-D and A) method with different annealing conditions. In this time, in-situ annealing was performed at various temperatures in an NH{sub 3} ambient. In addition, post-deposition annealing (PDA) was performed for some samples. For each sample, the interfacial lattice strain was evaluated using extremely asymmetric X-ray diffraction and the local dielectric constant near the Al atoms was measured by X-ray photoelectron spectroscopy (XPS). Observation of the strain field was done by measuring the X-ray rocking curve of the Si 113 reflection of the Si (001) substrate under grazing incidence conditions. It was found that in the case of the samples without PDA, for higher in-situ annealing temperatures compressive strain is introduced and the local dielectric constant becomes lower. For the samples with PDA, the differences of the lattice strain and the local dielectric constant are small for different in-situ annealing temperatures.

  18. Characterization of Polycrystalline Materials Using Synchrotron X-ray Imaging and Diffraction Techniques

    DEFF Research Database (Denmark)

    Ludwig, Wolfgang; King, A.; Herbig, M.

    2010-01-01

    propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X-ray......The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using...... diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure...

  19. Powder Handling Device for X-ray Diffraction Analysis with Minimal Sample Preparation, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This project consists of developing a Vibrating Sample Holder (VSH) for planetary X-Ray Diffraction (XRD) instruments. The principle of this novel sample handling...

  20. Powder Handling Device for X-ray Diffraction Analysis with Minimal Sample Preparation, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — This project consists in developing a Vibrating Powder Handling System for planetary X-Ray Diffraction instruments. The principle of this novel sample handling...

  1. State-of-the-art and problems of X-ray diffraction analysis of biomacromolecules

    International Nuclear Information System (INIS)

    Andreeva, N. S.

    2006-01-01

    The state-of-the-art of X-ray diffraction studies of biomacromolecules is briefly characterized, and the challenge imposed by science is discussed. These studies are characterized by a wide scope and extensive use. This field of science is of great interest and is developed in many countries. The main purpose is to solve practical problems in medicine consisting in the design of drugs against various diseases. X-ray diffraction analysis of enzymes brought the pharmaceutical industry to a new level, thus allowing the rational design of drugs against formerly untreatable diseases. Modern X-ray diffraction studies of biomacromolecules laid the basis for a new science called structural biology. This method allows one to solve fundamental problems of physical chemistry for a new state of matter existing in living systems. Here, science poses numerous problems in analysis of X-ray diffraction data on biological macromolecules. Many of theses problems are in their infancy

  2. Characterization of Polycrystalline Materials Using Synchrotron X-ray Imaging and Diffraction Techniques

    DEFF Research Database (Denmark)

    Ludwig, Wolfgang; King, A.; Herbig, M.

    2010-01-01

    The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using...... propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X......-ray diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure...

  3. Method for improve x-ray diffraction determinations of residual stress in nickel-base alloys

    Science.gov (United States)

    Berman, Robert M.; Cohen, Isadore

    1990-01-01

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys which comprises covering part of a predetermined area of the surface of a nickel-base alloy with a dispersion, exposing the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample.

  4. Method for improving x-ray diffraction determinations of residual stress in nickel-base alloys

    Science.gov (United States)

    Berman, R.M.; Cohen, I.

    1988-04-26

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys is discussed. Part of a predetermined area of the surface of a nickel-base alloy is covered with a dispersion. This exposes the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose, since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample. 2 figs.

  5. In situ x-ray diffraction and in situ x-ray absorption spectroscopy for investigation of intercalation batteries

    International Nuclear Information System (INIS)

    Levy-Clement, C.; Mondoloni, C.; Godart, C.; Cortes, R.

    1991-01-01

    This paper presents applications of in situ X-ray diffraction and absorption techniques to the study of H + /MnO 2 alkaline batteries. The two complementary in situ techniques are described. Investigation of the electrochemical insertion and deinsertion of H + has been made through its influence on the evolution of the crystallographic structure of γ-MnO 2 , while investigation of the transfer of e - has been undertaken through the variation of the oxidation state of the manganese during the discharging and charging process of a battery. New insights in the understanding of the mechanisms of proton insertion and charge transfer into γ-MnO 2 are discussed

  6. Structural characterization of thin-film cadmium stearate by X-ray diffraction technique

    International Nuclear Information System (INIS)

    Mohamad Deraman; Mohd Ali Sufi; Kok Kuan Ying; Muhamad Mat Salleh; Chew Tat Tian

    1990-01-01

    X-ray diffraction measurement were carried out on thin films of cadmium stearate using an X-ray diffractometer at Unit Tenaga Nuklear. Structure characteristic obtained from the measured diffraction pattern are compared with that of thin films of manganese stearate reported earlier by Pomerantz et. al. Some of the structural similarities (such as inter-planar spacing) and differences (such as the absence of subsidiary peak between Bragg peaks) are found and discussed

  7. Synchrotron radiation X-ray powder diffraction techniques applied in hydrogen storage materials - A review

    OpenAIRE

    Honghui Cheng; Chen Lu; Jingjing Liu; Yongke Yan; Xingbo Han; Huiming Jin; Yu Wang; Yi Liu; Changle Wu

    2017-01-01

    Synchrotron radiation is an advanced collimated light source with high intensity. It has particular advantages in structural characterization of materials on the atomic or molecular scale. Synchrotron radiation X-ray powder diffraction (SR-XRPD) has been successfully exploited to various areas of hydrogen storage materials. In the paper, we will give a brief introduction on hydrogen storage materials, X-ray powder diffraction (XRPD), and synchrotron radiation light source. The applications of...

  8. Neutron and X-ray diffraction from modulated structures

    International Nuclear Information System (INIS)

    Harris, P.

    1994-07-01

    This thesis describes X-ray and neutron scattering experiments performed on two examples of modulated structures. After an introduction to the subject of modulated structures, the thesis is divided in three parts. A single crystal elastic neutron scattering experiment between 4.2 and 115 Κ has been performed and four-circle X-ray data have been collected at 8 Κ for the monoclinic low-temperature phase of the layered perovskite PAMC. The results from the neutron scattering experiment indicate that magnetoelastic effects influence the ordering of the crystal. The X-ray experiments have made it possible to determine the crystal structure in the low-temperature phase. The superspace group is P2 1 /b(β-30)Os, with β = 1/3. A small-angle neutron scattering experiment has been performed on the magnetic structure of manganese silicide. When a magnetic field is applied, the modulation vectors turn towards the field direction, showing domain growth and diverging peak widths as they approach the field direction. Phase 'A' is established to have the modulation vectors directed perpendicular to the field direction. Cooling in zero field shows increasing peak widths at low temperatures, indicating a lock-in transition below the lowest reached temperature. To be able to analyse the data of the magnetic order in MnSi, and analytical calculation of the three dimensional resolution function for a small-angle neutron scattering spectrometer has been performed. The calculation is done by application of a combination of phase space analysis and Gaussian approximations for the neutron distribution as well as for the transmission functions of the different apertures. A finite mosaic spread of the crystal and finite correlation widths of the Bragg reflections have been included in the cross section. (au) (3 tabs., 48 ills., 100 refs.)

  9. X-ray diffraction applied to powder studies

    International Nuclear Information System (INIS)

    Assaf, Josiane

    1982-01-01

    the thesis starts with general definitions of x-ray: their nature, sources and production mechanism. it describesdifferent methods such as Debye-scherrer, absorption coefficient method, diffractometer method...The use of pattern-fitting techniques for the characterization of the microstructure is discussed through applications to nanocrystalline materials. Remarkable results achieved in the solution of crystal structures are presented, as well as the impact in solid-state chemistry of powder crystallography, particularly for elucidating the crystal chemistry of families of compounds for which only powders are available

  10. X-ray and Neutron Diffraction in the Study of Organic Crystalline Hydrates

    Directory of Open Access Journals (Sweden)

    Katharina Fucke

    2010-07-01

    Full Text Available A review. Diffraction methods are a powerful tool to investigate the crystal structure of organic compounds in general and their hydrates in particular. The laboratory standard technique of single crystal X-ray diffraction gives information about the molecular conformation, packing and hydrogen bonding in the crystal structure, while powder X-ray diffraction on bulk material can trace hydration/dehydration processes and phase transitions under non-ambient conditions. Neutron diffraction is a valuable complementary technique to X-ray diffraction and gives highly accurate hydrogen atom positions due to the interaction of the radiation with the atomic nuclei. Although not yet often applied to organic hydrates, neutron single crystal and neutron powder diffraction give precise structural data on hydrogen bonding networks which will help explain why hydrates form in the first place.

  11. Evaluation of In-Vacuum Imaging Plate Detector for X-Ray Diffraction Microscopy

    International Nuclear Information System (INIS)

    Nishino, Yoshinori; Takahashi, Yukio; Yamamoto, Masaki; Ishikawa, Tetsuya

    2007-01-01

    We performed evaluation tests of a newly developed in-vacuum imaging plate (IP) detector for x-ray diffraction microscopy. IP detectors have advantages over direct x-ray detection charge-coupled device (CCD) detectors, which have been commonly used in x-ray diffraction microscopy experiments, in the capabilities for a high photon count and for a wide area. The detector system contains two IPs to make measurement efficient by recording data with the one while reading or erasing the other. We compared speckled diffraction patterns of single particles taken with the IP and a direct x-ray detection CCD. The IP was inferior to the CCD in spatial resolution and in signal-to-noise ratio at a low photon count

  12. Progress in X-ray synchrotron diffraction studies of muscle contraction. Ch. 19

    International Nuclear Information System (INIS)

    Wakabayashi, Katsuzo

    1991-01-01

    This chapter provides a review of applications of synchrotron radiation (SR) to X-ray diffraction studies on the dynamic aspects of muscle contraction and is, at the same time, a progress report on the technical developments specifically related to muscle research. The introduction of SR as an intense X-ray source and the development of high ability detectors have led to enormous improvement in the quality of data from time-resolved X-ray diffraction studies of muscle contraction. The X-ray diffraction pattern taken during contraction shows that the force generation of a muscle proceeds upon interaction of the incommensurate structures of the thin and thick filaments. In this framework a distinct intensity change of the weaker reflections from the thin filaments was detected. However, there was still no strong evidence of direct physical attachment of myosin heads to actin during contraction. (author). 170 refs.; 52 figs.; 3 tabs

  13. Background removal in X-ray fiber diffraction patterns

    International Nuclear Information System (INIS)

    Millane, R.P.; Arnott, S.

    1985-01-01

    Background can be a major source of error in measurement of diffracted intensities in fiber diffraction patterns. Errors can be large when poorly oriented less-crystalline specimens give diffraction patterns with little uncontaminated background. A method for estimating and removing a general global background in such cases is described and illustrated with an example. (orig.)

  14. Determination of precise X-ray diffraction angles by fast Fourier transform

    International Nuclear Information System (INIS)

    Tokita, S.; Kojima, T.

    1987-01-01

    A new analytical method is presented for the separation of two or more closely overlapping X-ray diffraction lines using the narrowly distributed Gaussian function and one-dimensional fast Fourier transform pair. To test the method, the diffraction lines associated with characteristic Kα 1 and Kα 2 rays are measured by an X-ray diffractometer using a Brazilian quartz powder as a standard sample. It is found that the observed diffraction lines can be completely separated into Kα 1 and Kα 2 lines and that the accuracy of those diffraction angles is better than 2x10 -4 . (orig.)

  15. Determination of austenite vs. α-ferrite in steel by neutron and X-ray diffraction

    International Nuclear Information System (INIS)

    Als-Nielsen, J.; Clausen, K.

    1984-06-01

    Neutron and X-ray diffraction studies for determining the relative content of fcc (austenite) and bcc (α-ferrite) phases in steel samples are reported. In addition to determine the relative content of phases the diffraction method also provides information about the strain fields in the sample by the concomitant broadening of diffraction peaks. Neutron diffraction has the advantage that large sample volumes (several cc) are probed, and the effect of texture can thus be eliminated. X-ray diffraction patterns can be registered in a short time thus allowing kinetic studies of phase changes during heat treatment or mechanical treatment. In addition it is possible to probe different surface thickness by utilizing different X-ray wavelengths. Measurements of this type can be carried out on a commercial contract basis in the Solid State Physics Division at Risoe National Laboratory. (author)

  16. X-ray and neutron diffraction studies of crystallinity in hydroxyapatite coatings.

    Science.gov (United States)

    Girardin, E; Millet, P; Lodini, A

    2000-02-01

    To standardize industrial implant production and make comparisons between different experimental results, we have to be able to quantify the crystallinity of hydroxyapatite. Methods of measuring crystallinity ratio were developed for various HA samples before and after plasma spraying. The first series of methods uses X-ray diffraction. The advantage of these methods is that X-ray diffraction equipment is used widely in science and industry. In the second series, a neutron diffraction method is developed and the results recorded are similar to those obtained by the modified X-ray diffraction methods. The advantage of neutron diffraction is the ability to obtain measurements deep inside a component. It is a nondestructive method, owing to the very low absorption of neutrons in most materials. Copyright 2000 John Wiley & Sons, Inc.

  17. Measurements of transient electron density distributions by femtosecond X-ray diffraction

    International Nuclear Information System (INIS)

    Freyer, Benjamin

    2013-01-01

    This thesis concerns measurements of transient charge density maps by femtosecond X-ray diffraction. Different X-ray diffraction methods will be considered, particularly with regard to their application in femtosecond X-ray diffraction. The rotation method is commonly used in stationary X-ray diffraction. In the work in hand an X-ray diffraction experiment is demonstrated, which combines the method with ultrafast X-ray pulses. This experiment is the first implementation which makes use of the rotation method to map transient intensities of a multitude of Bragg reflections. As a prototype material Bismuth is used, which previously was studied frequently by femtosecond X-ray diffraction by measuring Bragg reflections successively. The experimental results of the present work are compared with the literature data. In the second part a powder-diffraction experiment will be presented, which is used to study the dynamics of the electron-density distribution on ultrafast time scales. The experiment investigates a transition metal complex after photoexcitation of the metal to ligand charge transfer state. Besides expected results, i. e. the change of the bond length between the metal and the ligand and the transfer of electronic charge from the metal to the ligand, a strong contribution of the anion to the charge transfer was found. Furthermore, the charge transfer has predominantly a cooperative character. That is, the excitation of a single complex causes an alteration of the charge density of several neighboring units. The results show that more than 30 transition-metal complexes and 60 anions contribute to the charge transfer. This collective response is a consequence of the strong coulomb interactions of the densely packed ions.

  18. High Pressure X-Ray Diffraction Studies on Nanocrystalline Materials

    Science.gov (United States)

    Palosz, B.; Stelmakh, S.; Grzanka, E.; Gierlotka, S.; Pielaszek, R.; Bismayer, U.; Werner, S.; Palosz, W.

    2003-01-01

    Application of in situ high pressure powder diffraction technique for examination of specific structural properties of nanocrystals based on the experimental data of SiC nanocrystalline powders of 2 to 30 nrn diameter in diameter is presented. Limitations and capabilities of the experimental techniques themselves and methods of diffraction data elaboration applied to nanocrystals with very small dimensions (nanoparticles of different grain size.

  19. Comparative study of macrotexture analysis using X-ray diffraction and electron backscattered diffraction techniques

    International Nuclear Information System (INIS)

    Serna, Marilene Morelli

    2002-01-01

    The macrotexture is one of the main characteristics in metallic materials, which the physical properties depend on the crystallographic direction. The analysis of the macrotexture to middles of the decade of 80 was just accomplished by the techniques of Xray diffraction and neutrons diffraction. The possibility of the analysis of the macrotexture using, the technique of electron backscattering diffraction in the scanning electronic microscope, that allowed to correlate the measure of the orientation with its location in the micro structure, was a very welcome tool in the area of engineering of materials. In this work it was studied the theoretical aspects of the two techniques and it was used of both techniques for the analysis of the macrotexture of aluminum sheets 1050 and 3003 with intensity, measured through the texture index 'J', from 2.00 to 5.00. The results obtained by the two techniques were shown reasonably similar, being considered that the statistics of the data obtained by the technique of electron backscatter diffraction is much inferior to the obtained by the X-ray diffraction. (author)

  20. Microbeam high-resolution diffraction and x-ray standing wave methods applied to semiconductor structures

    International Nuclear Information System (INIS)

    Kazimirov, A; Bilderback, D H; Huang, R; Sirenko, A; Ougazzaden, A

    2004-01-01

    A new approach to conditioning x-ray microbeams for high angular resolution x-ray diffraction and scattering techniques is introduced. We combined focusing optics (one-bounce imaging capillary) and post-focusing collimating optics (miniature Si(004) channel-cut crystal) to generate an x-ray microbeam with a size of 10 μm and ultimate angular resolution of 14 μrad. The microbeam was used to analyse the strain in sub-micron thick InGaAsP epitaxial layers grown on an InP(100) substrate by the selective area growth technique in narrow openings between the oxide stripes. For the structures for which the diffraction peaks from the substrate and the film overlap, the x-ray standing wave technique was applied for precise measurements of the strain with a Δd/d resolution of better than 10 -4 . (rapid communication)

  1. Monitoring protein precipitates by in-house X-ray powder diffraction

    OpenAIRE

    Ståhl, Kenny; Frankær, Christian Grundahl; Petersen, Jakob; Harris, Pernille

    2013-01-01

    Powder diffraction from protein powders using in-house diffractometers is an effective tool for identification and monitoring of protein crystal forms and artifacts. As an alternative to conventional powder diffractometers a single crystal diffractometer equipped with an X-ray micro-source can be used to collect powder patterns from 1 l samples. Using a small-angle X-ray scattering (SAXS) camera it is possible to collect data within minutes. A streamlined program has been developed for the ca...

  2. Ultrafast Structural Dynamics in InSb Probed by Time-Resolved X-Ray Diffraction

    International Nuclear Information System (INIS)

    Chin, A.H.; Shank, C.V.; Chin, A.H.; Schoenlein, R.W.; Shank, C.V.; Glover, T.E.; Leemans, W.P.; Balling, P.

    1999-01-01

    Ultrafast structural dynamics in laser-perturbed InSb are studied using time-resolved x-ray diffraction with a novel femtosecond x-ray source. We report the first observation of a delay in the onset of lattice expansion, which we attribute to energy relaxation processes and lattice strain propagation. In addition, we observe direct indications of ultrafast disordering on a subpicosecond time scale. copyright 1999 The American Physical Society

  3. Information extracting and processing with diffraction enhanced imaging of X-ray

    International Nuclear Information System (INIS)

    Chen Bo; Chinese Academy of Science, Beijing; Chen Chunchong; Jiang Fan; Chen Jie; Ming Hai; Shu Hang; Zhu Peiping; Wang Junyue; Yuan Qingxi; Wu Ziyu

    2006-01-01

    X-ray imaging at high energies has been used for many years in many fields. Conventional X-ray imaging is based on the different absorption within a sample. It is difficult to distinguish different tissues of a biological sample because of their small difference in absorption. The authors use the diffraction enhanced imaging (DEI) method. The authors took images of absorption, extinction, scattering and refractivity. In the end, the authors presented pictures of high resolution with all these information combined. (authors)

  4. Nano-fabrication of diffractive optics for soft X-ray and atom beam focusing

    International Nuclear Information System (INIS)

    Rehbein, S.

    2002-01-01

    Nano-structuring processes are described for manufacturing diffractive optics for the condenser-monochromator set-up of the transmission X-ray microscope (TXM) and for the scanning transmission X-ray microscope (STXM) at the BESSY II electron storage ring in Berlin. Furthermore, a process for manufacturing free-standing nickel zone plates for helium atom beam focusing experiments is presented. (author)

  5. Model experiment of in vivo synchrotron X-ray diffraction of human kidney stones

    Energy Technology Data Exchange (ETDEWEB)

    Ancharov, A.I. [Institute of Solid State Chemistry and Mechanochemistry SB RAS, Novosibirsk (Russian Federation)]. E-mail: ancharov@mail.ru; Potapov, S.S. [Institute of Mineralogy UB RAS, Miass (Russian Federation); Moiseenko, T.N. [The State Regional Clinical Hospital, Novosibirsk (Russian Federation); Feofilov, I.V. [The State Regional Clinical Hospital, Novosibirsk (Russian Federation); Nizovskii, A.I. [Boreskov Institute of Catalysis SB RAS, Novosibirsk (Russian Federation)

    2007-05-21

    The diffraction of synchrotron radiation (SR) was used to explore the phase composition of kidney stones placed into a specific object phantom, which imitated the human body. As an imitation of the patient breath, the kidney stone was moved vertically and rotated to an angle of 15{sup o} during the recording of the X-ray pattern. It was shown that rotation and displacement did not distort the X-ray pattern.

  6. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Mikulík, P.; Oberta, Peter

    2011-01-01

    Roč. 18, č. 2 (2011), s. 299-301 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412 Institutional research plan: CEZ:AV0Z10100522 Keywords : diffractive-refractive optics * x-ray synchrotron radiation monochromator * x-ray crystal monochromator * harmonics separation Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.726, year: 2011

  7. X-ray diffraction from intact tau aggregates in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Landahl, Eric C.; Antipova, Olga; Bongaarts, Angela; Barrea, Raul; Berry, Robert; Binder, Lester I.; Irving, Thomas; Orgel, Joseph; Vana, Laurel; Rice, Sarah E. (DePaul); (IIT); (NWU)

    2011-09-15

    We describe an instrument to record X-ray diffraction patterns from diseased regions of human brain tissue by combining an in-line visible light fluorescence microscope with an X-ray diffraction microprobe. We use thiazine red fluorescence to specifically label and detect the filamentous tau protein pathology associated with Pick's disease, as several laboratories have done previously. We demonstrate that thiazine red-enhanced regions within the tissue show periodic structure in X-ray diffraction, which is not observed in healthy tissue. One observed periodicity (4.2 {angstrom}) is characteristic of cross-beta sheet structure, consistent with previous results from powder diffraction studies performed on purified, dried tau protein.

  8. X-ray diffraction from intact tau aggregates in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Landahl, Eric C. [DePaul University, Department of Physics, 2219 N. Kenmore Ave., IL 60614, Chicago (United States); Antipova, Olga [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Bongaarts, Angela [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Barrea, Raul [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Berry, Robert; Binder, Lester I. [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Irving, Thomas; Orgel, Joseph [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Vana, Laurel [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Rice, Sarah E., E-mail: s-rice@northwestern.edu [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States)

    2011-09-01

    We describe an instrument to record X-ray diffraction patterns from diseased regions of human brain tissue by combining an in-line visible light fluorescence microscope with an X-ray diffraction microprobe. We use thiazine red fluorescence to specifically label and detect the filamentous tau protein pathology associated with Pick's disease, as several laboratories have done previously. We demonstrate that thiazine red-enhanced regions within the tissue show periodic structure in X-ray diffraction, which is not observed in healthy tissue. One observed periodicity (4.2 A) is characteristic of cross-beta sheet structure, consistent with previous results from powder diffraction studies performed on purified, dried tau protein.

  9. Materials identification using a small-scale pixellated x-ray diffraction system

    Science.gov (United States)

    O'Flynn, D.; Crews, C.; Drakos, I.; Christodoulou, C.; Wilson, M. D.; Veale, M. C.; Seller, P.; Speller, R. D.

    2016-05-01

    A transmission x-ray diffraction system has been developed using a pixellated, energy-resolving detector (HEXITEC) and a small-scale, mains operated x-ray source (Amptek Mini-X). HEXITEC enables diffraction to be measured without the requirement of incident spectrum filtration, or collimation of the scatter from the sample, preserving a large proportion of the useful signal compared with other diffraction techniques. Due to this efficiency, sufficient molecular information for material identification can be obtained within 5 s despite the relatively low x-ray source power. Diffraction data are presented from caffeine, hexamine, paracetamol, plastic explosives and narcotics. The capability to determine molecular information from aspirin tablets inside their packaging is demonstrated. Material selectivity and the potential for a sample classification model is shown with principal component analysis, through which each different material can be clearly resolved.

  10. Chemistry of Metal-organic Frameworks Monitored by Advanced X-ray Diffraction and Scattering Techniques.

    Science.gov (United States)

    Mazaj, Matjaž; Kaučič, Venčeslav; Zabukovec Logar, Nataša

    2016-01-01

    The research on metal-organic frameworks (MOFs) experienced rapid progress in recent years due to their structure diversity and wide range of application opportunities. Continuous progress of X-ray and neutron diffraction methods enables more and more detailed insight into MOF's structural features and significantly contributes to the understanding of their chemistry. Improved instrumentation and data processing in high-resolution X-ray diffraction methods enables the determination of new complex MOF crystal structures in powdered form. By the use of neutron diffraction techniques, a lot of knowledge about the interaction of guest molecules with crystalline framework has been gained in the past few years. Moreover, in-situ time-resolved studies by various diffraction and scattering techniques provided comprehensive information about crystallization kinetics, crystal growth mechanism and structural dynamics triggered by external physical or chemical stimuli. The review emphasizes most relevant advanced structural studies of MOFs based on powder X-ray and neutron scattering.

  11. Serial femtosecond X-ray diffraction of 30S ribosomal subunit microcrystals in liquid suspension at ambient temperature using an X-ray free-electron laser

    International Nuclear Information System (INIS)

    Demirci, Hasan; Sierra, Raymond G.; Laksmono, Hartawan; Shoeman, Robert L.; Botha, Sabine; Barends, Thomas R. M.; Nass, Karol; Schlichting, Ilme; Doak, R. Bruce; Gati, Cornelius; Williams, Garth J.; Boutet, Sébastien; Messerschmidt, Marc; Jogl, Gerwald; Dahlberg, Albert E.; Gregory, Steven T.; Bogan, Michael J.

    2013-01-01

    Serial femtosecond X-ray (SFX) diffraction extending beyond 6 Å resolution using T. thermophilus 30S ribosomal subunit crystals is reported. High-resolution ribosome structures determined by X-ray crystallography have provided important insights into the mechanism of translation. Such studies have thus far relied on large ribosome crystals kept at cryogenic temperatures to reduce radiation damage. Here, the application of serial femtosecond X-ray crystallography (SFX) using an X-ray free-electron laser (XFEL) to obtain diffraction data from ribosome microcrystals in liquid suspension at ambient temperature is described. 30S ribosomal subunit microcrystals diffracted to beyond 6 Å resolution, demonstrating the feasibility of using SFX for ribosome structural studies. The ability to collect diffraction data at near-physiological temperatures promises to provide fundamental insights into the structural dynamics of the ribosome and its functional complexes

  12. High resolution X-ray diffraction studies on unirradiated and ...

    Indian Academy of Sciences (India)

    ray diffraction techniques are widely used as non- destructive direct methods for analysing defects and dislo- cations in nearly perfect crystals (Lang 1958, 1970; Kato. 1992; Bowen and Tanner 1998). Crystallography has become an integral part ...

  13. Mechanical characterisation of surface layers by x-ray diffraction -application to tribology

    International Nuclear Information System (INIS)

    Farrahi, G.H.

    1996-01-01

    The results presented in this paper show that X-ray diffraction can be employed for the characterisation of surface layer damage through residual stresses and work hardening by some tribological actions such as fretting and dry sliding. X-ray diffraction technique can also be employed for a rapid and non-destructive measurement of hardness of hardened steel. The diffraction profile analysis can offer a good indication about the materials characteristics and the microstructural evolution caused by heat treatment or by mechanical loading

  14. Characterization of Gas-Solid Reactions using In Situ Powder X-ray Diffraction

    DEFF Research Database (Denmark)

    Møller, Kasper Trans; Hansen, Bjarne Rosenlund Søndertoft; Dippel, Ann-Christin

    2014-01-01

    X-ray diffraction is a superior technique for structural characterization of crystalline matter. Here we review the use of in situ powder X-ray diffraction (PXD) mainly for real-time studies of solid/gas reactions, data analysis and the extraction of valuable knowledge of structural, chemical...... by diffraction techniques, e.g. crystallite size. The aim of this review is to provide new inspiration for utilization of in situ PXD for characterization of a wide range of properties beyond the scope of crystal structure solution....

  15. Quantitative determination of phases of X-ray reflections from three-beam diffractions. Pt. 2

    International Nuclear Information System (INIS)

    Tang Mautsu; Chang Shihlin

    1988-01-01

    The method proposed by Chang and Tang of quantitative determination of X-ray reflection phases from multiple diffraction profiles is applied to nearly perfect crystals of gallium arsenide. The detailed intensity-profile-analysis procedures are given. Multiple diffraction profiles obtained with a conventional X-ray source and synchrotron radiation are subjected to this analysis. It is found that, for this particular diffraction example, errors as small as 15 0 in phase determination are achieved. Errors due to the theoretical approximation, peak position measurement and scaling factor are also discussed. (orig.)

  16. Phase analysis of micro-alloyed steels using X-ray diffraction measurements

    International Nuclear Information System (INIS)

    Tobisch, J.; Kleinstueck, K.; Schatt, W.; Riehle, M.; Technische Univ., Dresden

    1977-01-01

    The applicability of neutron diffraction and X-ray diffraction to phase analyses of micro-alloyed steels is tested. The results show that the resolution of neutron reflexes was too low for quantitative statements. X-ray diffraction measurements of the reflex intensity permit quantitative analyses of the phase TiN, TiC, and Ti 4 C 2 S 2 in micro-alloyed steels without and after heat treatment. The values of the quantitative determination of these phases ranged from about 0.03 to 0.4 per cent by weight

  17. Synchrotron X-ray and neutron diffraction studies in solid-state chemistry

    International Nuclear Information System (INIS)

    Cheetham, A.K.; Wilkinson, A.P.

    1992-01-01

    Since the scatterers are different - X-rays are scattered by the electrons of an atom, neutrons by the nuclei - the questions addressed by the two diffraction experiments have been complementary. For example, neighboring elements of the periodic table could be distinguished formerly only by neutron diffraction. Now, however, this is also partly possible with high-energy synchrotron radiation. This review describes recent applications of X-ray and neutron diffraction methods in solid-state chemistry and how the maximal information can be extracted by a combination of techniques. (orig.)

  18. Neutron and x-ray diffraction studies of liquids and glasses

    International Nuclear Information System (INIS)

    Fischer, Henry E; Barnes, Adrian C; Salmon, Philip S

    2006-01-01

    The techniques of neutron diffraction and x-ray diffraction, as applied to structural studies of liquids and glasses, are reviewed. Emphasis is placed on the explanation and discussion of the experimental techniques and data analysis methods, as illustrated by the results of representative experiments. The disordered, isotropic nature of the structure of liquids and glasses leads to special considerations and certain difficulties when neutron and x-ray diffraction techniques are applied, especially when used in combination on the same system. Recent progress in experimental technique, as well as in data analysis and computer simulation, has motivated the writing of this review

  19. Optomechanical design of a high-precision detector robot arm system for x-ray nano-diffraction with x-ray nanoprobe

    Science.gov (United States)

    Shu, D.; Kalbfleisch, S.; Kearney, S.; Anton, J.; Chu, Y. S.

    2014-03-01

    Collaboration between Argonne National Laboratory and Brookhaven National Laboratory has created a design for the high-precision detector robot arm system that will be used in the x-ray nano-diffraction experimental station at the Hard X-ray Nanoprobe (HXN) beamline for the NSLS-II project. The robot arm system is designed for positioning and manipulating an x-ray detector in three-dimensional space for nano-diffraction data acquisition with the HXN x-ray microscope. It consists of the following major component groups: a granite base with air-bearing support, a 2-D horizontal base stage, a vertical axis goniometer, a 2-D vertical plane robot arm, a 3-D fast scanning stages group, and a 2-D x-ray pixel detector. The design specifications and unique optomechanical structure of this novel high-precision detector robot arm system will be presented in this paper.

  20. X-ray diffraction analysis of some single crystals with special properties

    Energy Technology Data Exchange (ETDEWEB)

    Antipin, M.Yu. [Russian Academy of Sciences, Moscow (Russian Federation). Inst. of Organoelement Compounds

    1996-12-31

    New possibilities of the X-ray diffraction method for studies of some single crystals with special physical properties are analyzed. It is demonstrated that wide range temperature diffraction data, special single crystals experiments under strong electric fields, and charge density analysis in crystals might enrich the knowledge on the nature of the crystal properties.

  1. Analytic theory of soft x-ray diffraction by lamellar multilayer gratings

    NARCIS (Netherlands)

    Kozhevnikov, I.V.; van der Meer, R.; Bastiaens, Hubertus M.J.; Boller, Klaus J.; Bijkerk, Frederik

    2011-01-01

    An analytic theory describing soft x-ray diffraction by Lamellar Multilayer Gratings (LMG) has been developed. The theory is derived from a coupled waves approach for LMGs operating in the single-order regime, where an incident plane wave can only excite a single diffraction order. The results from

  2. Energy-dispersive X-ray diffraction beamline at Indus-2 synchrotron ...

    Indian Academy of Sciences (India)

    Abstract. An energy-dispersive X-ray diffraction beamline has been designed, developed and commissioned at BL-11 bending magnet port of the Indian synchrotron source, Indus-2. The performance of this beamline has been benchmarked by measuring diffraction patterns from var- ious elemental metals and standard ...

  3. Energy-dispersive X-ray diffraction beamline at Indus-2 synchrotron ...

    Indian Academy of Sciences (India)

    An energy-dispersive X-ray diffraction beamline has been designed, developed and commissioned at BL-11 bending magnet port of the Indian synchrotron source, Indus-2. The performance of this beamline has been benchmarked by measuring diffraction patterns from various elemental metals and standard inorganic ...

  4. New structural studies of liquid crystal by reflectivity and resonant X-ray diffraction

    International Nuclear Information System (INIS)

    Fernandes, P.

    2007-04-01

    This memory presents three structural studies of smectic Liquid Crystals by reflectivity and resonant diffraction of X-rays. It is divided in five chapters. In the first a short introduction to Liquid Crystals is given. In particular, the smectic phases that are the object of this study are presented. The second chapter is consecrated to the X-ray experimental techniques that were used in this work. The three last chapters present the works on which this thesis can be divided. Chapter three demonstrates on free-standing films of MHPOBC (historic liquid crystal that possesses the antiferroelectric sub-phases) the possibility to extend the technique of resonant X-ray diffraction to liquid crystals without resonant element. In the fourth chapter the structure of the B 2 liquid crystal phase of bent-core molecules (or banana molecules) is elucidated by using resonant X-ray diffraction combined with polarization analysis of the diffracted beam. A model of the polarization of the resonant beam diffracted by four different structures proposed for the B 2 phase is developed in this chapter. In the fifth chapter a smectic binary mixture presenting a very original critical point of phase separation is studied by X-ray reflectivity and optical microscopy. A concentration gradient in the direction perpendicular to the plane of the film seems to be induced by the free-standing film geometry. The results of a simplified model of the system are compatible with this interpretation

  5. X-ray diffraction and X-ray K absorption near edge studies of copper (II) complexes with amino acids

    Science.gov (United States)

    Sharma, P. K.; Mishra, Ashutosh; Malviya, Varsha; Kame, Rashmi; Malviya, P. K.

    2017-05-01

    Synthesis of copper (II) complexes [CuL1L2X].nH2O, where n=1, 2,3 (X=Cl,Br,NO3) (L1is 2,2’-bipyridine and L2 is L-tyrosine) by the chemical root method. The XRD data for the samples have been recorded. EXAFS spectra have also been recorded at the K-edge of Cu using the dispersive beam line BL-8 at 2.5 Gev Indus-2 Synchrotron radiation source at RRCAT, Indore, India. XRD and EXAFS data have been analysed using the computer software. X-ray diffraction studies of all complexes indicate their crystalline nature. Lattice parameter, bond length, particle size have been determined from XRD data.

  6. High Pressure X-Ray Diffraction Studies of Nanocrystalline Materials

    Science.gov (United States)

    Palosz, B.; Stel'makh, S.; Grzanka, E.; Gierlotka, S.; Palosz, W.

    2004-01-01

    Experimental evidence obtained for a variety of nanocrystalline materials suggest that the crystallographic structure of a very small size particle deviates from that in the bulk crystals. In this paper we show the effect of the surface of nanocrystals on their structure by the analysis of generation and distribution of macro- and micro-strains at high pressures and their dependence on the grain size in nanocrystalline powders of Sic. We studied the structure of Sic nanocrystals by in-situ high-pressure powder diffraction technique using synchrotron and neutron sources and hydrostatic or isostatic pressure conditions. The diffraction measurements were done in HASYLAB at DESY using a Diamond Anvil Cell (DAC) in the energy dispersive geometry in the diffraction vector range up to 3.5 - 4/A and under pressures up to 50 GPa at room temperature. In-situ high pressure neutron diffraction measurements were done at LANSCE in Los Alamos National Laboratory using the HIPD and HIPPO diffractometers with the Paris-Edinburgh and TAP-98 cells, respectively, in the diffraction vector range up to 26 Examination of the response of the material to external stresses requires nonstandard methodology of the materials characterization and description. Although every diffraction pattern contains a complete information on macro- and micro-strains, a high pressure experiment can reveal only those factors which contribute to the characteristic diffraction patterns of the crystalline phases present in the sample. The elastic properties of powders with the grain size from several nm to micrometers were examined using three methodologies: (l), the analysis of positions and widths of individual Bragg reflections (used for calculating macro- and micro-strains generated during densification) [I], (2). the analysis of the dependence of the experimental apparent lattice parameter, alp, on the diffraction vector Q [2], and (3), the atomic Pair Distribution Function (PDF) technique [3]. The results

  7. Structure of drug-target proteins determined by both X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Kuroki, Ryota

    2009-01-01

    Crystallography enables us to obtain accurate atomic positions within proteins. High resolution X-ray crystallography provides information for most of the atoms comprising a protein, with the exception of hydrogens. Neutron diffraction data can provide information of the location of hydrogen atoms to the structural information determined by X-ray crystallography. Here, we show the recent of the structural determination of drug-target proteins, porcine pancreatic elastase (PPE) and human immuno-deficiency virus type-1 protease (HIV-PR) by both X-ray and neutron diffraction. The structure of porcine pancreatic elastase with its potent inhibitor (FR13080) was determined to 0.94A resolution by X-ray diffraction and 1.75 A resolution by neutron diffraction. It was found that there are two characteristic hydrogen bonding interactions in which hydrogen atoms were confirmed. One is located between a catalytic aspartate and histidine, another is involved in the inhibitor recognition site. The structure of HIV-PR with its potent inhibitor (KNI-272) was also determined to 0.93 A resolution by X-ray diffraction and 2.3 A resolution by neutron diffraction. The ionization state of the catalytic residues were clarified to show that Asp125 is protonated and Asp25 is deprotonated. The ionization state and the location of hydrogen atoms of the catalytic residue in HIV-PR were firstly determined by neutron diffraction. Furthermore, collaborative use of both X-ray and neutron to identify the location of ambiguous hydrogen atoms will be shown. (author)

  8. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    Energy Technology Data Exchange (ETDEWEB)

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi, E-mail: nakasako@phys.keio.ac.jp [Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); RIKEN SPring-8 Center, 1-1-1 Kohto, Sayo, Sayo-gun, Hyogo 679-5148 (Japan)

    2014-03-15

    The software suite SITENNO is developed for processing diffraction data collected in coherent X-ray diffraction imaging experiments of non-crystalline particles using an X-ray free-electron laser. Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles.

  9. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    International Nuclear Information System (INIS)

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi

    2014-01-01

    The software suite SITENNO is developed for processing diffraction data collected in coherent X-ray diffraction imaging experiments of non-crystalline particles using an X-ray free-electron laser. Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles

  10. Note: Application of a pixel-array area detector to simultaneous single crystal x-ray diffraction and x-ray absorption spectroscopy measurements

    International Nuclear Information System (INIS)

    Sun, Cheng-Jun; Brewe, Dale L.; Heald, Steve M.; Zhang, Bangmin; Chen, Jing-Sheng; Chow, G. M.; Venkatesan, T.

    2014-01-01

    X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr 0.67 Sr 0.33 MnO 3 film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam

  11. Long-Wavelength X-Ray Diffraction and Its Applications in Macromolecular Crystallography.

    Science.gov (United States)

    Weiss, Manfred S

    2017-01-01

    For many years, diffraction experiments in macromolecular crystallography at X-ray wavelengths longer than that of Cu-K α (1.54 Å) have been largely underappreciated. Effects caused by increased X-ray absorption result in the fact that these experiments are more difficult than the standard diffraction experiments at short wavelengths. However, due to the also increased anomalous scattering of many biologically relevant atoms, important additional structural information can be obtained. This information, in turn, can be used for phase determination, for substructure identification, in molecular replacement approaches, as well as in structure refinement. This chapter reviews the possibilities and the difficulties associated with such experiments, and it provides a short description of two macromolecular crystallography synchrotron beam lines dedicated to long-wavelength X-ray diffraction experiments.

  12. Influence of neutron irradiation on the microstructure of nuclear graphite: An X-ray diffraction study

    Science.gov (United States)

    Zhou, Z.; Bouwman, W. G.; Schut, H.; van Staveren, T. O.; Heijna, M. C. R.; Pappas, C.

    2017-04-01

    Neutron irradiation effects on the microstructure of nuclear graphite have been investigated by X-ray diffraction on virgin and low doses (∼ 1.3 and ∼ 2.2 dpa), high temperature (750° C) irradiated samples. The diffraction patterns were interpreted using a model, which takes into account the turbostratic disorder. Besides the lattice constants, the model introduces two distinct coherent lengths in the c-axis and the basal plane, that characterise the volumes from which X-rays are scattered coherently. The methodology used in this work allows to quantify the effect of irradiation damage on the microstructure of nuclear graphite seen by X-ray diffraction. The results show that the changes of the deduced structural parameters are in agreement with previous observations from electron microscopy, but not directly related to macroscopic changes.

  13. Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

    Science.gov (United States)

    Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

    2016-09-01

    We present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional data cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. We demonstrate this ‘big data’ approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.

  14. Determination of the strain hardening rate of metals and alloys by X ray diffraction

    International Nuclear Information System (INIS)

    Cadalbert, Robert

    1977-01-01

    This report for engineering graduation is based on the study of X ray diffraction line profile which varies with the plastic strain rate of the metal. After some generalities of strain hardening (consequence of a plastic deformation on the structure of a polycrystalline metal, means to study a strain hardened structure, use of X ray diffraction to analyse the strain hardened crystalline structure), the author reports the strain hardening rate measurement by using X ray diffraction. Several aspects are addressed: principles, experimental technique, apparatus, automation and programming of the measurement cycle, method sensitivity and precision. In the next part, the author reports applications: measurement of the strain hardening rate in different materials (tubes with hexagonal profile, cylindrical tubes in austenitic steel), and study of the evolution of strain hardening with temperature [fr

  15. Growth of ω inclusions in Ti alloys: An X-ray diffraction study

    International Nuclear Information System (INIS)

    Šmilauerová, J.; Harcuba, P.; Pospíšil, J.; Matěj, Z.; Holý, V.

    2013-01-01

    We investigated the size and crystal structure of nanometer-sized ω inclusions in single crystals of β-Ti alloys by X-ray diffraction pole-figure measurements and reciprocal space mapping. We studied the topotactical relation of the β and ω crystal lattices, and from the positions and shapes of the diffraction maxima of the ω lattice determined the mean size of the ω inclusions and the misfit of the inclusion lattice with respect to the host lattice, as well as their changes during ageing. The lattice of the ω inclusions exhibits a large positive misfit already before ageing and the misfit is subsequently reduced during the ageing process. Using the theories of elasticity and X-ray scattering we simulated diffuse X-ray scattering around the β diffraction maxima and demonstrated that the diffuse scattering is caused mainly by local elastic strains in the β host phase around the ω inclusions

  16. Direct observation of ultrafast atomic motion using time-resolved X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Shymanovich, U.

    2007-11-13

    This thesis is dedicated to the study of the atomic motion in laser irradiated solids on a picosecond to subpicosecond time-scale using the time-resolved X-ray diffraction technique. In the second chapter, the laser system, the laser-plasma based X-ray source and the experimental setup for optical pump / X-ray probe measurements were presented. Chapter 3 is devoted to the characterization and comparison of different types of X-ray optics. Chapter 4 presented the time-resolved X-ray diffraction experiments performed for this thesis. The first two sections of this chapter discuss the measurements of initially unexpected strain-induced transient changes of the integrated reflectivity of the X-ray probe beam. The elimination of the strain-induced transient changes of the integrated reflectivity represented an important prerequisite to perform the study of lattice heating in Germanium after femtosecond optical excitation by measuring the transient Debye-Waller effect. The third section describes the investigations of acoustic waves upon ultrafast optical excitation and discusses the two different pressure contributions driving them: the thermal and the electronic ones. (orig.)

  17. Electronic properties of crystalline materials observed in X-ray diffraction

    Science.gov (United States)

    Lovesey, S. W.; Balcar, E.; Knight, K. S.; Fernández Rodríguez, J.

    2005-05-01

    The few electrons in valence states of a material participate in many of its physical properties, including both structural and transport properties. In the diffraction of X-rays, or neutrons, valence electrons can lead to weak Bragg reflections that are extremely sensitive signatures of their charge and magnetic degrees of freedom. In this regard, diffraction instruments supplied with X-rays from a synchrotron source are particularly useful because the brightness, tuneability and polarization of the X-rays are all helpful in making valuable observations. The data obtained from Bragg diffraction can be analyzed on the basis of an atomic model, which has the virtue that it can be used as a common platform for the analysis of X-ray and neutron diffraction and, in addition, the analysis of observations made with X-ray absorption, NMR, EPR, muon and Mössbauer spectroscopies. We present the salient features for the calculation of structure factors based on an atomic model and applied to the analysis of Bragg diffraction by non-magnetic and magnetic materials, with an emphasis on resonant X-ray Bragg diffraction. The presentation contains a new treatment of parity-odd events found in the mixed electric dipole-electric quadrupole channel of scattering. In addition we discuss the complementary observation of dichroic signals, including natural circular and magnetochiral dichroism. The survey of available analytical tools is complemented by a series of worked examples demonstrating the application of the formalism to different materials with different crystal structures and resonant ions: dysprosium borocarbide ( DyB2C2), vanadium sesquioxide (V2O3), gadolinium tetraboride ( GdB4), chromium sesquioxide ( Cr2O3), haematite and perovskite-type manganites.

  18. Electronic properties of crystalline materials observed in X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Lovesey, S.W. [Diamond Light Source Ltd., ISIS Facility, RAL, Oxfordshire OX11 0QX (United Kingdom) and RIKEN Harima Institute, SPring-8, Hyogo 679-5148 (Japan)]. E-mail: s.w.lovesey@rl.ac.uk; Balcar, E. [Vienna University of Technology, Atominstitut, Stadionallee 2, A1020, Vienna (Austria); Knight, K.S. [Diamond Light Source Ltd., ISIS Facility, RAL, Oxfordshire OX11 0QX (United Kingdom); Department of Mineralogy, Natural History Museum, London SW7 5BD (United Kingdom); Fernandez Rodriguez, J. [Departamento de Fisica, Universidad de Oviedo, E-33007 Oviedo (Spain)

    2005-05-01

    The few electrons in valence states of a material participate in many of its physical properties, including both structural and transport properties. In the diffraction of X-rays, or neutrons, valence electrons can lead to weak Bragg reflections that are extremely sensitive signatures of their charge and magnetic degrees of freedom. In this regard, diffraction instruments supplied with X-rays from a synchrotron source are particularly useful because the brightness, tuneability and polarization of the X-rays are all helpful in making valuable observations. The data obtained from Bragg diffraction can be analyzed on the basis of an atomic model, which has the virtue that it can be used as a common platform for the analysis of X-ray and neutron diffraction and, in addition, the analysis of observations made with X-ray absorption, NMR, EPR, muon and Mossbauer spectroscopies. We present the salient features for the calculation of structure factors based on an atomic model and applied to the analysis of Bragg diffraction by non-magnetic and magnetic materials, with an emphasis on resonant X-ray Bragg diffraction. The presentation contains a new treatment of parity-odd events found in the mixed electric dipole-electric quadrupole channel of scattering. In addition we discuss the complementary observation of dichroic signals, including natural circular and magnetochiral dichroism. The survey of available analytical tools is complemented by a series of worked examples demonstrating the application of the formalism to different materials with different crystal structures and resonant ions: dysprosium borocarbide (DyB{sub 2}C{sub 2}), vanadium sesquioxide (V{sub 2}O{sub 3}), gadolinium tetraboride (GdB{sub 4}), chromium sesquioxide (Cr{sub 2}O{sub 3}), haematite and perovskite-type manganites.

  19. Controlled molecules for X-ray diffraction experiments at free-electron lasers

    International Nuclear Information System (INIS)

    Stern, Stephan

    2013-12-01

    X-ray diffractive imaging is at the very heart of materials science and has been utilized for decades to solve unknown molecular structures. Nowadays, it serves as the key method of structural biology to solve molecular structures of large biological molecules comprising several thousand or even millions of atoms. However, X-ray diffraction from isolated molecules is very weak. Therefore, the regular and periodic arrangement of a huge number of identical copies of a certain molecule of interest within a crystal lattice has been a necessary condition in order to exploit Bragg diffraction of X-rays. This results in a huge increase in scattered signal and a strongly improved signal-to-noise ratio compared to diffraction from non-crystalline samples. The major bottleneck of structural biology is that many of biologically interesting molecules refuse to form crystals of sufficient size to be used at synchrotron X-ray lightsources. However, novel X-ray free-electron lasers (XFELs), which became operational very recently, promise to address this issue. X-ray pulses provided by XFELs are many orders of magnitude more intense than X-ray pulses from a synchrotron source and at the same time as short as only several tens of femtoseconds. Combined with wavelengths in the nm-pm range, XFELs are well-suited to study ultrafast atomic and molecular dynamics. Additionally, the ultrashort pulses can be utilized to circumvent the damage threshold which set a limit to the incident intensity in X-ray diffraction experiments before. At XFELs, though eventually destroying the investigated sample, no significant sample deterioration happens on the ultrashort timescale of the XFEL pulse and the measured diffraction pattern is due to an (almost) unharmed sample. In the framework of this thesis, the approach of utilizing the highly intense XFEL pulses for X-ray diffraction of weakly-scattering non-crystalline samples was taken to the limit of small isolated molecules. X-ray diffraction was

  20. Controlled molecules for X-ray diffraction experiments at free-electron lasers

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Stephan

    2013-12-15

    X-ray diffractive imaging is at the very heart of materials science and has been utilized for decades to solve unknown molecular structures. Nowadays, it serves as the key method of structural biology to solve molecular structures of large biological molecules comprising several thousand or even millions of atoms. However, X-ray diffraction from isolated molecules is very weak. Therefore, the regular and periodic arrangement of a huge number of identical copies of a certain molecule of interest within a crystal lattice has been a necessary condition in order to exploit Bragg diffraction of X-rays. This results in a huge increase in scattered signal and a strongly improved signal-to-noise ratio compared to diffraction from non-crystalline samples. The major bottleneck of structural biology is that many of biologically interesting molecules refuse to form crystals of sufficient size to be used at synchrotron X-ray lightsources. However, novel X-ray free-electron lasers (XFELs), which became operational very recently, promise to address this issue. X-ray pulses provided by XFELs are many orders of magnitude more intense than X-ray pulses from a synchrotron source and at the same time as short as only several tens of femtoseconds. Combined with wavelengths in the nm-pm range, XFELs are well-suited to study ultrafast atomic and molecular dynamics. Additionally, the ultrashort pulses can be utilized to circumvent the damage threshold which set a limit to the incident intensity in X-ray diffraction experiments before. At XFELs, though eventually destroying the investigated sample, no significant sample deterioration happens on the ultrashort timescale of the XFEL pulse and the measured diffraction pattern is due to an (almost) unharmed sample. In the framework of this thesis, the approach of utilizing the highly intense XFEL pulses for X-ray diffraction of weakly-scattering non-crystalline samples was taken to the limit of small isolated molecules. X-ray diffraction was

  1. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chen Bo; Berenguer, Felisa; Bean, Richard J; Robinson, Ian K; Zhang Fucai; Rodenburg, John M; Kewish, Cameron M; Vila-Comamala, Joan; Chu, Yong S

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens. (paper)

  2. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chu, Y.S.; Chen, B.; Zhang, F.; Berenguer, F.; Bean, R.; Kewish, C.; Vila-Comamala, J.; Rodenburg, J.; Robinson, I.

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens.

  3. High resolution double-sided diffractive optics for hard X-ray microscopy.

    Science.gov (United States)

    Mohacsi, Istvan; Vartiainen, Ismo; Guizar-Sicairos, Manuel; Karvinen, Petri; Guzenko, Vitaliy A; Müller, Elisabeth; Färm, Elina; Ritala, Mikko; Kewish, Cameron M; Somogyi, Andrea; David, Christian

    2015-01-26

    The fabrication of high aspect ratio metallic nanostructures is crucial for the production of efficient diffractive X-ray optics in the hard X-ray range. We present a novel method to increase their structure height via the double-sided patterning of the support membrane. In transmission, the two Fresnel zone plates on the two sides of the substrate will act as a single zone plate with added structure height. The presented double-sided zone plates with 30 nm smallest zone width offer up to 9.9% focusing efficiency at 9 keV, that results in a factor of two improvement over their previously demonstrated single-sided counterparts. The increase in efficiency paves the way to speed up X-ray microscopy measurements and allows the more efficient utilization of the flux in full-field X-ray microscopy.

  4. Determination of densities from chemical composition and X-Ray diffraction

    International Nuclear Information System (INIS)

    Azevedo, A.L.T. de

    1980-01-01

    X-ray diffraction method applied to retained austenite measurements gives volume per cent results, whereas the same kind of measurement made by Moessbauer Effect gives iron percentages. To compare both results one needs to convert the volume % to weight % or vice-versa. This necessitates, among other things, in determining the densities of the α and #betta# phases in the steel being studied. A method for calculating the densities, based on the application of the definition of density to just one unit cell, using X-ray diffraction and chemical results, are described. (Author) [pt

  5. Transmission diffraction-tomography system using a high-energy X-ray tube.

    Science.gov (United States)

    Garrity, D J; Jenneson, P M; Crook, R; Vincent, S M

    2010-01-01

    A high-energy bench-top energy dispersive X-ray diffraction (EDXRD) system for 3-dimensional mapping of the crystalline structure and phase transformations in steel is described, for which preliminary data and system development are presented here. The use of precision tungsten slit screens with up to 225 keV X-rays allows for diffraction through samples of 304 L austenitic stainless steel of thickness 3-10 mm, while sample positioning is carried out with a precision goniometer and translation stage system. Copyright 2009 Elsevier Ltd. All rights reserved.

  6. A Furnace for Diffraction Studies using Synchrotron X-Ray Radiation

    DEFF Research Database (Denmark)

    Buras, B.; Lebech, Bente; Kofoed, W.

    1984-01-01

    A furnace for diffraction studies using synchrotron X-ray radiation is described. The furnace can be operated between ambient temperature and 1 800 °C with a temperature stability better than 5 °C for temperatures above 300 °C. Kapton windows allow almost 360° access for the X-ray beam in the hor...... in the horizontal scattering plane and the furnace may be used in both conventional monochromatic beam angle-dispersive and white-beam energy-dispersive diffraction experiments. Details of the furnace windows, heating element, thermometry and sample mount are given....

  7. X-ray diffraction studies of chitosan acetate-based polymer electrolytes

    International Nuclear Information System (INIS)

    Osman, Z.; Ibrahim, Z.A.; Abdul Kariem Arof

    2002-01-01

    Chitosan is the product when partially deacetylated chitin dissolves in dilute acetic acid. This paper presents the x-ray diffraction patterns of chitosan acetate, plasticised chitosan acetate and plasticised-salted chitosan acetate films. The results show that the chitosan acetate based polymer electrolyte films are not completely amorphous but it is partially crystalline. X-ray diffraction study also confirms the occurrence of the complexation between chitosan and the salt and the interaction between salt and plasticizer. The salt-chitosan interaction is clearly justified by infrared spectroscopy. (Author)

  8. Modification of the x-ray diffraction efficiency of lithium fluoride crystals by surface treatment

    International Nuclear Information System (INIS)

    Sellick, B.O.

    1976-01-01

    Convex-curved crystals of lithium fluoride demonstrate good dispersion and efficiency when used in reflection for x-ray spectral analysis. The crystals are stable and reasonably unaffected by harsh environments. In addition, they are mechanically strong, easily cleavable or machinable, and plastically deformable with heat. In the present study, flat crystal wafers were left either clear as cleaved or were subjected to surface treatment by sandblasting or lapping. Some wafers were then bent in a press mold to obtain convex-curved crystals of differing radii. The diffraction efficiency data presented show how surface treatment affects the efficiency of these various crystals when used as x-ray diffracting agents

  9. Planar irregularities of texture and stress field in Ti detected by X-ray diffraction technique

    Science.gov (United States)

    Tarkowski, L.; Bonarski, J.; Alexandrov, I.

    2010-02-01

    Regardless of the origin of structure irregularities of materials, the recognition of their spatial distribution in a sample or constructing elements is a great research problem. One of the most effective and non-destructive tools used for this purpose is the X-ray diffraction technique, assisted by an appropriate experimental method and data processing. The work presents the results of investigations of planar distribution of crystallographic texture and stress irregularities manifested by changes of diffraction effects registered by the X-ray technique. As an example, the introduced method is tested on a titanium rod after severe plastic deformation process.

  10. Crystallization and preliminary X-ray diffraction study of porcine carboxypeptidase B

    Energy Technology Data Exchange (ETDEWEB)

    Akparov, V. Kh., E-mail: valery@akparov.ru [Scientific Center of Russian Federation Research Institute for Genetics and Selection of Industrial Microorganisms (Russian Federation); Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Kuranova, I. P., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-05-15

    Crystals of porcine pancreatic carboxypeptidase B have been grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction study showed that the crystals belong to sp. gr. P4{sub 1}2{sub 1}2 and have the following unit-cell parameters: a = b = 79.58 Å, c = 100.51 Å; α = β = γ = 90.00°. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one of the grown crystals at the SPring 8 synchrotron facility to 0.98 Å resolution.

  11. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    Science.gov (United States)

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  12. Diffraction crystals for sagittally focusing x-rays

    Science.gov (United States)

    Ice, G.E.; Sparks, C.J. Jr.

    1982-06-07

    The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

  13. X-ray grazing incidence diffraction from multilayers

    Energy Technology Data Exchange (ETDEWEB)

    Tixier, S.; Boeni, P.; Swygenhoven, H. van; Horisberger, M. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-09-01

    Grazing incidence scattering geometries using synchrotron radiation have been applied in order to characterise the roughness profiles and the structural coherence of multilayers. The lateral correlation length of the roughness profiles was evaluated using diffuse reflectivity in the `out of plane` geometry. This type of measurement is the only diffuse reflectivity technique allowing large lateral momentum transfer. It is typically suitable for correlation lengths smaller than 1000 A. The lateral structural coherence length of Ni{sub 3}Al/Ni multilayers as a function of the layer thickness was obtained by grazing incidence diffraction (GID). 3 figs., 1 ref.

  14. X-ray diffraction and imaging with a coherent beam: application to X-ray optical elements and to crystals exhibiting phase inhomogeneities

    International Nuclear Information System (INIS)

    Masiello, F.

    2011-05-01

    The exceptional properties of synchrotron light sources have been exploited in very different disciplines, from archaeology to chemistry, from material science to biology, from medicine to physics. Among these properties it is important to mention the high brilliance, continuum spectrum, high degree of polarization, time structure, small source size and divergence of the beam, the last resulting in a high transversal coherence of the produced radiation. This high transversal coherence of the synchrotron sources has permitted the development of new techniques, e.g. phase contrast imaging, X-ray photon correlation spectroscopy and coherent X-ray diffraction imaging (CXDI). This thesis work will consist essentially of three parts. In the first part it will be presented the work done as a member of the X-ray Optics Group of ESRF in the characterization of high quality diamond crystals foreseen as X-ray optical elements. The characterization has been done using different complementary X-ray techniques, such as high resolution diffraction, topography, grazing incidence diffraction, reflectivity and measurements of the coherence preservation using the Talbot effect. In the second part, I will show the result obtained in the study of the temperature behaviours of the domain in periodically poled ferroelectrics crystals. This type of measurements, based on Bragg-Fresnel diffraction, are possible only thanks to the high degree of coherence of the beam. In the third part, I will present the results obtained in the characterization of diamonds foreseen for applications other than X-ray optical elements. (author)

  15. The structure of liquid semiconductors, superionic conductors and glasses by neutron scattering, X-ray diffraction and extended X-ray absorption fine structure

    International Nuclear Information System (INIS)

    Buchanan, P.

    2001-09-01

    A study of the applicability of modern X-ray and neutron scattering techniques to the study of the structure of liquid semiconductors and glasses has been made. The results demonstrate how neutron scattering with isotopic substitution (NDIS), anomalous X-ray scattering and Extended X-ray Absorption Fine Structure (EXAFS) can be successfully used to elucidate the structure of materials that cannot be studied by NDIS alone. The local coordination structure of Ag 2 Se in its room temperature, superionic and liquid phases has been determined using the EXAFS technique. This EXAFS data have been combined with previously available neutron diffraction data to provide a refinement of the structure obtained through neutron diffraction alone. The structure of GeO 2 has been determined to the full partial structure factor level using a combination of anomalous X-ray scattering and neutron diffraction measurements. The data are in good agreement with previously obtained results. The partial structure factors of P 40 Se 60 and P 50 Se 50 have been determined to the first order difference level using the anomalous X-ray diffraction technique. The structure of liquid Ga 2 Te 3 has been determined to the partial structure factor level using combined neutron diffraction with isotopic substitution (NDIS) and anomalous X-ray diffraction. The structure of liquid FeSe 2 has been determined to the first order difference level using the NDIS technique alone. The structure of liquid FeTe 2 was determined at the total structure factor level using neutron diffraction in order to estimate the effect of chalcogenide ion size on the structure. The results demonstrate the feasibility of the additional structural determination techniques for disordered materials made possible through the development of third generation X-ray synchrotron sources. (author)

  16. Observation of parametric X-ray radiation in an anomalous diffraction region

    Energy Technology Data Exchange (ETDEWEB)

    Alexeyev, V.I., E-mail: vial@x4u.lebedev.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Eliseyev, A.N., E-mail: elisseev@pluton.lpi.troitsk.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Irribarra, E., E-mail: esteban.irribarra@epn.edu.ec [Escuela Politécnica Nacional, Ladrón de Guevara E11-253, Quito (Ecuador); Kishin, I.A., E-mail: ivan.kishin@mail.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Kubankin, A.S., E-mail: kubankin@bsu.edu.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Nazhmudinov, R.M., E-mail: fizeg@bk.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation)

    2016-08-19

    A new possibility to expand the energy region of diffraction processes based on the interaction of relativistic charged particles with crystalline structures is presented. Diffracted photons related to parametric X-ray radiation produced by relativistic electrons are detected below the low energy threshold for the X-ray diffraction mechanism in crystalline structures for the first time. The measurements were performed during the interaction of 7 MeV electrons with a textured polycrystalline tungsten foil and a highly oriented pyrolytic graphite crystal. The experiment results are in good agreement with a developed model based on the PXR kinematical theory. The developed experimental approach can be applied to separate the contributions of real and virtual photons to the total diffracted radiation generated during the interaction of relativistic charged particles with crystalline targets. - Highlights: • Parametric X-ray radiation below the low energy threshold for diffraction of free X-rays. • Experimental separation of the contributions from different radiation mechanisms. • PXR from relativistic electrons in mosaic crystals and textured polycrystlas.

  17. Femtosecond X-ray diffraction from two-dimensional protein crystals

    Directory of Open Access Journals (Sweden)

    Matthias Frank

    2014-03-01

    Full Text Available X-ray diffraction patterns from two-dimensional (2-D protein crystals obtained using femtosecond X-ray pulses from an X-ray free-electron laser (XFEL are presented. To date, it has not been possible to acquire transmission X-ray diffraction patterns from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permit a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy approach at the Linac Coherent Light Source, Bragg diffraction was acquired to better than 8.5 Å resolution for two different 2-D protein crystal samples each less than 10 nm thick and maintained at room temperature. These proof-of-principle results show promise for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.

  18. Coded diffraction system in X-ray crystallography using a boolean phase coded aperture approximation

    Science.gov (United States)

    Pinilla, Samuel; Poveda, Juan; Arguello, Henry

    2018-03-01

    Phase retrieval is a problem present in many applications such as optics, astronomical imaging, computational biology and X-ray crystallography. Recent work has shown that the phase can be better recovered when the acquisition architecture includes a coded aperture, which modulates the signal before diffraction, such that the underlying signal is recovered from coded diffraction patterns. Moreover, this type of modulation effect, before the diffraction operation, can be obtained using a phase coded aperture, just after the sample under study. However, a practical implementation of a phase coded aperture in an X-ray application is not feasible, because it is computationally modeled as a matrix with complex entries which requires changing the phase of the diffracted beams. In fact, changing the phase implies finding a material that allows to deviate the direction of an X-ray beam, which can considerably increase the implementation costs. Hence, this paper describes a low cost coded X-ray diffraction system based on block-unblock coded apertures that enables phase reconstruction. The proposed system approximates the phase coded aperture with a block-unblock coded aperture by using the detour-phase method. Moreover, the SAXS/WAXS X-ray crystallography software was used to simulate the diffraction patterns of a real crystal structure called Rhombic Dodecahedron. Additionally, several simulations were carried out to analyze the performance of block-unblock approximations in recovering the phase, using the simulated diffraction patterns. Furthermore, the quality of the reconstructions was measured in terms of the Peak Signal to Noise Ratio (PSNR). Results show that the performance of the block-unblock phase coded apertures approximation decreases at most 12.5% compared with the phase coded apertures. Moreover, the quality of the reconstructions using the boolean approximations is up to 2.5 dB of PSNR less with respect to the phase coded aperture reconstructions.

  19. Characterisation of microfocused beam for synchrotron powder diffraction using a new X-ray camera

    International Nuclear Information System (INIS)

    Thomas, C; Potter, J; Tang, C C; Lennie, A R

    2012-01-01

    The powder diffraction beamline I11, Diamond Light Source, is being continually upgraded as requirements of the user community evolve. Intensities of X-rays from the I11 in-vacuum electron undulator in the 3 GeV synchrotron fall off at higher energies. By focusing higher energy X-rays, we can overcome flux limitations, and open up new diffraction experiments. Here, we describe characterisation of microfocusing using compound refractive lenses (CRL). For a relatively modest outlay, we have developed an experimental setup and a novel X-ray camera with good sensitivity and a resolution specification suitable for characterising these focusing optics. We show that vertical oscillations in the focused beam compromise resolution of the source imaged by the CRL. Nevertheless, we have measured CRL focusing properties, and demonstrate the use of energy scanning to determine lens alignment. Real benefits of the intensity gain are illustrated.

  20. Soft x-ray resonant magnetic powder diffraction on PrNiO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Staub, U [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); GarcIa-Fernandez, M [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); Mulders, A M [Department of Applied Physics, Curtin University of Technology, GPO Box U1987, Perth WA 6845 (Australia); Bodenthin, Y [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); MartInez-Lope, M J [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, E-28049 Madrid (Spain); Alonso, J A [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, E-28049 Madrid (Spain)

    2007-03-07

    We report on the first soft x-ray resonant powder diffraction experiments performed at the Ni L{sub 2,3} edges of PrNiO{sub 3}. The temperature, polarization and energy dependence of the (1/2 0 1/2) reflection indicates a magnetic origin for the signal. This experiment demonstrates that x-ray resonant magnetic powder diffraction can be relatively easily performed in the soft x-ray regime due to the very large enhancement factors at the absorption edges. Such experiments allow us to extract important information on the electronic states of the d shell. Similar results can be anticipated from orbital reflections measured in a powder. (fast track communication)

  1. In situ laser heating and radial synchrotron X-ray diffraction ina diamond anvil cell

    Energy Technology Data Exchange (ETDEWEB)

    Kunz, Martin; Caldwell, Wendel A.; Miyagi, Lowell; Wenk,Hans-Rudolf

    2007-06-29

    We report a first combination of diamond anvil cell radialx-ray diffraction with in situ laser heating. The laser-heating setup ofALS beamline 12.2.2 was modified to allow one-sided heating of a samplein a diamond anvil cell with an 80 W yttrium lithium fluoride laser whileprobing the sample with radial x-ray diffraction. The diamond anvil cellis placed with its compressional axis vertical, and perpendicular to thebeam. The laser beam is focused onto the sample from the top while thesample is probed with hard x-rays through an x-ray transparentboron-epoxy gasket. The temperature response of preferred orientation of(Fe,Mg)O is probed as a test experiment. Recrystallization was observedabove 1500 K, accompanied by a decrease in stress.

  2. Cryogenic x-ray diffraction microscopy utilizing high-pressure cryopreservation

    Science.gov (United States)

    Lima, Enju; Chushkin, Yuriy; van der Linden, Peter; Kim, Chae Un; Zontone, Federico; Carpentier, Philippe; Gruner, Sol M.; Pernot, Petra

    2014-10-01

    We present cryo x-ray diffraction microscopy of high-pressure-cryofixed bacteria and report high-convergence imaging with multiple image reconstructions. Hydrated D. radiodurans cells were cryofixed at 200 MPa pressure into ˜10-μm-thick water layers and their unstained, hydrated cellular environments were imaged by phasing diffraction patterns, reaching sub-30-nm resolutions with hard x-rays. Comparisons were made with conventional ambient-pressure-cryofixed samples, with respect to both coherent small-angle x-ray scattering and the image reconstruction. The results show a correlation between the level of background ice signal and phasing convergence, suggesting that phasing difficulties with frozen-hydrated specimens may be caused by high-background ice scattering.

  3. Energy-scanning X-ray diffraction of synthetic multilayer structure

    International Nuclear Information System (INIS)

    Malaurent, J.C.; Duval, H.; Fert, A.

    1987-01-01

    An energy-scanning X-ray diffraction technique is used to study a synthetic periodic multilayer structure with two amorphous components. The source was the Bremsstrahlung from the X-ray tube, and the detector was a silicon-lithium diode. Experimental results obtained for a multilayer PdSi/MgCu with large period show a deviation from the classical Bragg's law. The deviation is produced by the variation of the refractive index of the multilayer with the wavelength of the incident X-ray. The period d was determined to within 1%. A measure of the refraction index enabled an estimate to be made of the width of each layer. It was also possible to estimate the fluctuation of the period along the multilayer from the full widths of the diffracted Bragg peaks at maximum intensities. The limits of the method are discussed. (orig.)

  4. Hydrothermal formation of tobermorite studied by in situ X-ray diffraction under autoclave condition.

    Science.gov (United States)

    Kikuma, Jun; Tsunashima, Masamichi; Ishikawa, Tetsuji; Matsuno, Shin-ya; Ogawa, Akihiro; Matsui, Kunio; Sato, Masugu

    2009-09-01

    Hydrothermal formation of tobermorite from a pre-cured cake has been investigated by transmission X-ray diffraction (XRD) using high-energy X-rays from a synchrotron radiation source in combination with a newly designed autoclave cell. The autoclave cell has a large and thin beryllium window for wide-angle X-ray diffraction; nevertheless, it withstands a steam pressure of more than 1.2 MPa, which enables in situ XRD measurements in a temperature range of 373 to 463 K under a saturated steam pressure. Formation and/or decomposition of several components has been successfully observed during 7.5 h of reaction time. From the intensity changes of the intermediate materials, namely non-crystalline C-S-H and hydroxylellestadite, two pathways for tobermorite formation have been confirmed. Thus, the newly developed autoclave cell can be used for the analyses of reaction mechanisms under specific atmospheres and temperatures.

  5. Crystallization kinetics of amorphous griseofulvin by pattern fitting procedure using X-ray diffraction data.

    Science.gov (United States)

    Yamamura, Shigeo; Takahira, Rieko; Momose, Yasunori

    2007-05-01

    A pattern fitting procedure using X-ray powder diffraction patterns was applied to study the crystallization kinetics of amorphous griseofulvin. From the optimized parameters obtained by pattern fitting, a change in the quantity and quality of griseofulvin crystals with crystallization was also investigated. Amorphous griseofulvin was prepared by cooling the melts followed by pulverization. X-ray diffraction patterns of amorphous griseofulvin were repeatedly measured every 20 h. The observed pattern was separated into crystalline diffraction intensity and amorphous scattering intensity by the nonlinear least-squares procedure. The fitting between the observed and simulated diffraction patterns was satisfactorily independent of the degree of crystallinity. Since a good linear relationship was found in a plot of amorphous scattering intensity against crystalline diffraction intensity, the degree of crystallinity can be determined according to Hermans' method. The diffraction peak width increased with higher diffraction angles with crystallization. The crystallization was biphasic: fast and slow crystallization with the growth of low disordered crystals and disordered crystals, respectively. The pattern fitting procedure is a powerful tool to analyze the X-ray diffraction patterns of semicrystalline materials. This procedure can simultaneously analyze the degree of crystallinity and crystal disorder in semicrystalline samples during crystallization.

  6. X-ray diffraction broadening effects in metallic alloys

    International Nuclear Information System (INIS)

    Kimmel, G.; Dayan, D.

    1996-01-01

    Although an extensive work had been done in the last decade in the field of line broadening analysis of XRPD there is still little agreement whether this method can be accepted as a characterization tool. The purpose of the present work is to demonstrate that a valuable information can be retrieved from line broadening effects in XRPD. In this work it was focused on the line broadening effects accompanied with typical processes in metallic systems. The following systems were studied:, pure iron, steels, and alloying effects in uranium alloys. The broadening analysis was linked to different variables like hardness, Izod notch toughness, amount of cold work, surface treatment, concentration of additional elements in solid solutions. The Williamson-Hall method was adopted providing fast and global view of resolved 'strain'-'size' effects, considering the entire diffraction spectrum. The size effect was occasionally approved by direct observations of STM or SEM for example. The results of the broadening analysis were well correlated with other measured parameters like toughness and hardness. It was found that alloying in metallic system is sometimes expressed by pure strain effect but cold work results in a mix of strain and size broadening. The complete view of our results lead us to believe that broadening effect can be quantified. Hence, it is recommended to establish a quantitative XRD line broadening analysis method as a novel tool for characterization of metallic materials. (author)

  7. X-ray diffraction investigation of cyclohexane derivatives at 293 K

    International Nuclear Information System (INIS)

    Drozdowski, Henryk; Nowakowski, Krzysztof; BLaszczak, ZdzisLaw

    2011-01-01

    This paper reports results of the X-ray diffraction structural studies of liquid cyclohexylamine C 6 H 11 -NH 2 and cyclohexanol C 6 H 11 -OH performed at 293 K. The method of X-ray scattering and Fourier analysis enabled the determination of the mean structural parameters of the liquids studied. The wide-angle X-ray scattering (WAXS) method provided new information on mutual arrangement and orientation of the molecules of the above mentioned compounds in the liquid phase. The measurements of scattered radiation intensity were performed in a wide range of wave vector (from S min =0.925 A -1 to S max =14.311 A -1 ), with the use of X-ray radiation MoK α (λ=0.71069 A). Angular distributions of X-ray scattered intensity were measured, and differential radial distribution functions of electron density (DRDFs) were calculated. The mean distances between the neighbouring molecules and the mean radii of coordination spheres were found. A simple model of short-range arrangement of the molecules was proposed, which seems to be valid for other polar monosubstituted cyclohexane derivatives in the liquid phase. - Highlights: → X-ray method enabled the determination of the structure of cyclohexane derivatives. → Determination of the mean parameters of the liquid structure has been discussed. → A simple model of short-range arrangement and orientation of the molecules was proposed. → Results are valid for a wide group of molecular liquids.

  8. Study of oxide precipitates in silicon using X-ray diffraction techniques

    Czech Academy of Sciences Publication Activity Database

    Caha, O.; Bernatová, S.; Meduňa, M.; Svoboda, Milan; Buršík, Jiří

    2011-01-01

    Roč. 208, č. 11 (2011), s. 2587-2590 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA202/09/1013 Institutional research plan: CEZ:AV0Z20410507 Keywords : high-resolution X-ray diffraction * oxide precipitates * silicon Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.463, year: 2011

  9. Mössbauer effect studies and X-ray diffraction analysis of cobalt ...

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Cobalt ferrite (CoxFe3–xO4) is prepared in powder form by thermal decomposition of iron and cobalt salts and is analysed by X-ray diffraction and Mössbauer spectroscopic techniques. The variation of. Mössbauer parameters, lattice parameters and crystallite size of the products formed with variation in the.

  10. Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling

    Energy Technology Data Exchange (ETDEWEB)

    Veluraja, K., E-mail: veluraja@msuniv.ac.in [Department of Physics, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012 (India); Vennila, K.N. [CAS in Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, Tamilnadu 600025 (India); Umamakeshvari, K.; Jasmine, A. [Department of Physics, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012 (India); Velmurugan, D. [CAS in Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, Tamilnadu 600025 (India)

    2011-03-25

    Research highlights: {yields} Techniques to get oriented mucin fibre. {yields} X-ray fibre diffraction pattern for mucin. {yields} Molecular modeling of mucin based on X-ray fibre diffraction pattern. -- Abstract: The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 A. The high intense d-spacing signal at 4.22 A is attributed to the antiparallel {beta}-sheet structure identified in the fraction of the homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 A reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule.

  11. Mössbauer effect studies and X-ray diffraction analysis of cobalt ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 26; Issue 5. Mössbauer effect studies and X-ray diffraction analysis of cobalt ferrite prepared in powder form by thermal decomposition method. M D Joseph Sebastian B Rudraswamy M C Radhakrishna Ramani. Magnetic Materials Volume 26 Issue 5 August 2003 pp ...

  12. High-pressure X-ray diffraction of L-ALANINE crystal

    DEFF Research Database (Denmark)

    Olsen, J.S.; Gerward, Leif; Souza, A.G.

    2006-01-01

    L-ALANINE has been studied by X-ray diffraction at ambient temperature and pressure up to 10.3 GPa. The material is found to transform to a tetragonal structure between 2 and 3 GPa. and to a monoclinic structure between 8 and 10 GPa. The experimental bulk modulus is 25(5) GPa for the orthorhombic...

  13. Small angles X-ray diffraction and Mössbauer characterization of ...

    Indian Academy of Sciences (India)

    The effect of thermal annealing on the structure and magnetic properties of crystalline Tb/Fe multilayers has been studied using conversion electron Mössbauer spectrometry and small-angle X-ray diffraction. The growth of Tb–Fe amorphous alloy from the interface is observed with increasing annealing temperature.

  14. Characterization, crystallization and preliminary X-ray diffraction studies of tomato nuclease I

    Czech Academy of Sciences Publication Activity Database

    Koval, Tomáš; Dohnálek, Jan; Lipovová, P.; Podzimek, T.; Matoušek, Jaroslav

    2009-01-01

    Roč. 16, 1a (2009), b33 ISSN 1211-5894. [Discussions in Structural Molecular Biology /7./. 12.03.2009-14.03.2009, Nové Hrady] Institutional research plan: CEZ:AV0Z40500505 Keywords : X-ray diffraction * tomato nuclease Subject RIV: CD - Macromolecular Chemistry

  15. Origin of nondetectable x-ray diffraction peaks in nanocomposite CuTiZr alloys

    DEFF Research Database (Denmark)

    Jiang, Jianzhong; Kato, H.; Ohsuna, T.

    2003-01-01

    Microscopic structures of Cu60Ti10+xZr30-x (x=0 and 10) alloys have been investigated by transmission electron microscopy, x-ray diffraction (XRD) and differential scanning calorimeter (DSC). In the Cu60Ti10Zr30 samples annealed at 708 K for times ranging from 0 to 130 min, where the enthalpy...

  16. Quantitative phase analysis of uranium carbide from x-ray diffraction data using the Rietveld method

    International Nuclear Information System (INIS)

    Singh Mudher, K.D.; Krishnan, K.

    2003-01-01

    Quantitative phase analysis of a uranium carbide sample was carried out from the x-ray diffraction data by Rietveld profile fitting method. The method does not require the addition of any reference material. The percentage of UC, UC 2 and UO 2 phases in the sample were determined. (author)

  17. High-pressure phases of uranium monophosphide studied by synchrotron x-ray diffraction

    DEFF Research Database (Denmark)

    Olsen, J. Staun; Gerward, Leif; Benedict, U.

    1988-01-01

    X-ray diffraction studies have been performed on UP powder for pressures up to 51 GPa using synchrotron radiation and a diamond-anvil cell. At ambient pressure UP has the rocksalt structure. The bulk modulus has been determined to B0=102(4) GPa and its pressure derivative to B0’=4.0(8). The cubic...

  18. Electrochemical cell for in situ x-ray diffraction under ultrapure conditions

    DEFF Research Database (Denmark)

    Koop, T.; Schindler, W.; Kazimirov, A.

    1998-01-01

    of the crystal using a Luggin capillary and a standard reference electrode. We demonstrate the performance of our cell by in situ synchrotron x-ray diffraction measurements on ultrathin Co layers electrodeposited on Cu(001) in an aqueous H(2)SO(4)/CoSO(4) solution. (C) 1998 American Institute of Physics....

  19. A greedy method for reconstructing polycrystals from three-dimensional X-ray diffraction data

    DEFF Research Database (Denmark)

    Kulshreshth, Arun Kumar; Alpers, Andreas; Herman, Gabor T.

    2009-01-01

    An iterative search method is proposed for obtaining orientation maps inside polycrystals from three-dimensional X-ray diffraction (3DXRD) data. In each step, detector pixel intensities are calculated by a forward model based on the current estimate of the orientation map. The pixel at which the ...

  20. X-ray and neutron diffraction line broadening measurements in a martensitic steel for fusion technology

    International Nuclear Information System (INIS)

    Coppola, R.; Lukas, P.; Vrana, M.; Montanari, R.; Rustichelli, F.

    1995-01-01

    X-ray and neutron diffraction line broadening measurements have been carried out on a modified martensitic steel DIN 1.4914 for fusion technology (MANET) after quenching followed by tempering treatments at 700C. The results of the two experiments are discussed with reference to Cr redistribution phenomena in the matrix

  1. Standing-wave effects in grazing-incidence x-ray diffraction from polycrystalline multilayers

    Czech Academy of Sciences Publication Activity Database

    Krčmář, J.; Holý, V.; Horák, L.; Metzger, T. H.; Sobota, Jaroslav

    2008-01-01

    Roč. 103, č. 3 (2008), 033504:1-7 ISSN 0021-8979 Institutional research plan: CEZ:AV0Z20650511 Keywords : acoustic wave interference * carbon * crystallites * interface structure * nickel * optical multilayers * superlattices * X-ray diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.201, year: 2008

  2. Applications of X-ray diffraction method III: determination of crystallite size and strain

    International Nuclear Information System (INIS)

    Majid, C.A.; Hussain, M.A.

    1995-01-01

    The broadening of X-ray diffraction powder pattern peaks of metals and/or alloys etc. is normally caused by small crystalline size and/or by distortions within the crystallites as a consequence of dislocation configurations. Thus measure the broadening of diffraction peaks provides a tool to determine the crystallite size and strain in the sample. It is well known that rates of reaction between solid particles and a gas phase depend on the particle size. The knowledge about crystallite size and strain is useful for the investigation of important phenomena in materials. X-ray profile analysis is useful for the investigation of processes like crystal growth, solid solution formation, stacking faults and radiation damage etc. X-ray diffraction is most widely used for the determination of crystallite size and strain. This important application of X-ray diffraction is reviewed in this paper. Results on aluminium bulk samples and thin films treated under conditions are reported. Application of the method to UO/sub 2/ powder is discussed. (author)

  3. An introduction to three-dimensional X-ray diffraction microscopy

    DEFF Research Database (Denmark)

    Poulsen, Henning Friis

    2012-01-01

    Three-dimensional X-ray diffraction microscopy is a fast and nondestructive structural characterization technique aimed at studies of the individual crystalline elements (grains or subgrains) within millimetre-sized polycrystalline specimens. It is based on two principles: the use of highly...

  4. An X-ray diffraction study of direct-bonded silicon interfaces

    DEFF Research Database (Denmark)

    Howes, P.B.; Benamara, M.; Grey, F.

    1998-01-01

    Semiconductor wafer bonding techniques have been used to create a giant twist grain boundary from two Si(001) wafers. We show, using X-ray diffraction measurements that after annealing the interface forms a highly ordered superstructure with relaxations extending to many layers into the crystals ...

  5. A logical explanation of structurally unfit X-ray diffraction peaks in ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Abstract. In the present paper we suggest the cause and solution of some unidentified X-ray diffraction (XRD) peaks in ferroelectric ... to some structurally unfit minor peaks of all three trail samples show good agreement to the values estimated from the .... This shows that the value of 2θ limits the (a + b) val-.

  6. A simple model for dynamic small-angle X-ray diffraction in colloidal crystals

    NARCIS (Netherlands)

    de Beer, A.G.F.; Petukhov, A.V.

    2007-01-01

    A simple model is presented that allows calculation of the small-angle X-ray diffraction patterns of perfect colloidal crystals. The model is based on the Wentzel–Kramers–Brillouin approximation and permits a straightforward evaluation of multibeam interactions. Results are illustrated by several

  7. Simultaneous X-ray diffraction from multiple single crystals of macromolecules

    DEFF Research Database (Denmark)

    Paithankar, Karthik S.; Sørensen, Henning Osholm; Wright, Jonathan P.

    2011-01-01

    The potential in macromolecular crystallography for using multiple crystals to collect X-ray diffraction data simultaneously from assemblies of up to seven crystals is explored. The basic features of the algorithms used to extract data and their practical implementation are described. The procedure...

  8. In situ X-ray diffraction environments for high-pressure reactions

    DEFF Research Database (Denmark)

    R. S. Hansen, Bjarne; Møller, Kasper Trans; Paskevicius, Mark

    2015-01-01

    New sample environments and techniques specifically designed for in situ powder X-ray diffraction studies up to 1000 bar (1 bar = 105 Pa) gas pressure are reported and discussed. The cells can be utilized for multiple purposes in a range of research fields. Specifically, investigations of gas–sol...

  9. High-pressure X-ray diffraction study of bulk- and nanocrystalline GaN

    DEFF Research Database (Denmark)

    Jorgensen, J.E.; Jakobsen, J.M.; Jiang, Jianzhong

    2003-01-01

    Bulk- and nanocrystalline GaN have been studied by high-pressure energy-dispersive X-ray diffraction. Pressure-induced structural phase transitions from the wurtzite to the NaCl phase were observed in both materials. The transition pressure was found to be 40 GPa for the bulk-crystalline GaN, whi...

  10. An x-ray diffraction study of interface roughness and diffusion in Ag/Pd superlattices

    NARCIS (Netherlands)

    Temst, K.; van Bael, M.J.; van Haesendonck, Ch.; Bruynseraede, Y.; de Groot, D.G.; Koeman, N.J.; Griessen, R.P.

    1999-01-01

    The influence of thermal annealing on the surface and interface roughness of epitaxial Ag/Pd superlattices has been quantitatively characterized by high-angle X-ray diffraction and atomic force microscopy. Although Ag and Pd form a continuous series of solid solutions, it is shown that thermal

  11. Electron Paramagnetic Resonance and X-ray Diffraction of Boron- and Phosphorus-Doped Nanodiamonds

    Science.gov (United States)

    Binh, Nguyen Thi Thanh; Dolmatov, V. Yu.; Lapchuk, N. M.; Shymanski, V. I.

    2017-11-01

    Powders of boron- and phosphorus-doped detonation nanodiamonds and sintered pellets of non-doped nanodiamond powders were studied using electron paramagnetic resonance and x-ray diffraction. Doping of detonation nanodiamond crystals with boron and phosphorus was demonstrated to be possible. These methods could be used to diagnose diamond nanocrystals doped during shock-wave synthesis.

  12. Revealing stacking sequences in inverse opals by microradian X-ray diffraction

    NARCIS (Netherlands)

    Sinitskii, A.; Abramova, V.; Grigorieva, N.; Grigoriev, S.; Snigirev, A.; Byelov, D.; Petukhov, A.V.

    2010-01-01

    We present the results of the structural analysis of inverse opal photonic crystals by microradian X-ray diffraction. Inverse opals based on different oxide materials (TiO2, SiO2 and Fe2O3) were fabricated by templating polystyrene colloidal crystal films grown by the vertical deposition technique.

  13. HIV protease inhibition seen by X-ray diffraction and molecular dynamics

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jindřich; Dohnálek, Jan; Skálová, Tereza; Dušková, Jarmila; Petroková, Hana; Vondráčková, Eva; Kolenko, P.; Zimmermann, K.

    2005-01-01

    Roč. 14, č. 1 (2005), s. 276 ISSN 0961-8368. [Symposium of the Protein Society /19./. 30.7.2005-3.8.2005, Boston] R&D Projects: GA AV ČR(CZ) KJB4050312 Keywords : HIV protease * X-ray diffraction * molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Determination of the X-ray diffraction pattern and the lattice parameters of the nickel ferricyanide

    International Nuclear Information System (INIS)

    Fernandez Miranda, J.; Herrera Palma, V.

    1981-01-01

    The X-ray diffraction pattern of the nickel ferricyanide was found by Debye-Scherrer method. The measurements were made in cameras of 57,3 mm and 114 mm diameter. The crystal structure of the compound has been determined. The lattice parameter was measured by the least square method. (author)

  15. A logical explanation of structurally unfit X-ray diffraction peaks in ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Abstract. In the present paper we suggest the cause and solution of some unidentified X-ray diffraction (XRD) peaks in ferroelectric nanoparticles. Indeed, a relationship between the structurally unfit XRD peaks and domains in the ferroelectric nanoparticles is suggested. BaTiO3, PbTiO3 and ...

  16. Caracterization of the crystalline phases by X-Ray diffraction in electrode coatings

    International Nuclear Information System (INIS)

    Neves, M.C.G.P.; Souza Caillaux, Z. de

    1981-01-01

    Some electrodes and their respective coatings were studied in order to verify their compatibility with their utilization in the welding of base metals appropriate for the equipment of sugar and alcohol plants. The carried out studies include the characterization, by X-ray diffraction, of crystaline phases, existent in electrodes coatings. (Author) [pt

  17. Tensile behavior of orthorhombic alpha ''-titanium alloy studied by in situ X-ray diffraction

    DEFF Research Database (Denmark)

    Wang, X.D.; Lou, H.B.; Ståhl, Kenny

    2010-01-01

    The tensile behavior of a Ti-11%Zr-14%Nb-10%Sn alloy with pure orthorhombic alpha '' phase was studied by in situ X-ray diffraction using synchrotron radiation. It is found that no phase transformation happens during the whole tensile process. The "double-yielding" platforms of this alloy...

  18. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Caroline M., E-mail: carolmattosb@yahoo.com.br [Instituto de Arqueologia Brasileira (IAB), Belford Roxo, RJ (Brazil); Azeredo, Soraia R.; Lopes, Ricardo T., E-mail: soraia@lin.ufrj.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/LIN/UFRJ), Rio de Janeiro, RJ (Brazil). Laboratorio de Instrumentacao Nuclear; Souza, Sheila M.F.M de, E-mail: sferraz@ensp.fiocruz.br [Fundacao Oswaldo Cruz (ENSP/FIOCRUZ), Rio de Janeiro, RJ (Brazil). Escola Nacional de Saude Publica Sergio Arouca

    2013-07-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I{sub rel}). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  19. X-ray diffraction studies of sucrose and sucrose irradiated with γ-radiation

    International Nuclear Information System (INIS)

    Prasad, Mahendra

    1981-01-01

    In order to understand and solve numerous problems related to sugar quality and its storage life, X-ray diffraction studies of sucrose and sucrose irradiated with γ-radiation have been made. It is observed that the interplanar spacing 'd' in irradiated sucrose is reduced indicating the partial damage of sucrose lattice. (author)

  20. Residual stress estimation of ceramic thin films by X-ray diffraction and indentation techniques

    International Nuclear Information System (INIS)

    Atar, Erdem; Sarioglu, Cevat; Demirler, Ugur; Sabri Kayali, E.; Cimenoglu, Huseyin

    2003-01-01

    The residual stresses in ceramic thin films obtained by the indentation method have been found to be three times higher than those of the X-ray diffraction method. This discrepancy can be eliminated by setting the geometrical factor for the Vickers pyramid indenter to 1 in the relevant equation of the indentation method

  1. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    International Nuclear Information System (INIS)

    Barbosa, Caroline M.; Azeredo, Soraia R.; Lopes, Ricardo T.; Souza, Sheila M.F.M de

    2013-01-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I rel ). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  2. Small angles X-ray diffraction and Mössbauer characterization of ...

    Indian Academy of Sciences (India)

    Abstract. The effect of thermal annealing on the structure and magnetic properties of crystalline Tb/Fe multilayers has been studied using conversion electron Mössbauer spectrometry and small-angle X-ray diffraction. The growth of Tb–Fe amorphous alloy from the interface is observed with increasing annealing ...

  3. Toward atomic resolution diffractive imaging of isolated molecules with x-ray free-electron lasers

    DEFF Research Database (Denmark)

    Stern, Stephan; Holmegaard, Lotte; Filsinger, Frank

    2014-01-01

    We give a detailed account of the theoretical analysis and the experimental results of an x-ray-diffraction experiment on quantum-state selected and strongly laser-aligned gas-phase ensembles of the prototypical large asymmetric rotor molecule 2,5-diiodobenzonitrile, performed at the Linac Cohere...

  4. High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

    Science.gov (United States)

    Smither, Robert K [Hinsdale, IL

    2011-05-17

    A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

  5. Characterization of calcium crystals in Abelia using x-ray diffraction and electron microscopes

    Science.gov (United States)

    Localization, chemical composition, and morphology of calcium crystals in leaves and stems of Abelia mosanensis and A. ×grandiflora were analyzed with a variable pressure scanning electron microscope (VP-SEM) equipped with an X-ray diffraction system, low temperature SEM (LT-SEM) and a transmission ...

  6. Temperature-dependent vibrational spectroscopic and X-ray diffraction investigation of nanosized nickel chromite

    Czech Academy of Sciences Publication Activity Database

    Matulková, Irena; Holec, Petr; Němec, I.; Kitazawa, H.; Furubayashi, T.; Vejpravová, Jana

    2015-01-01

    Roč. 1090, Jun SI (2015), s. 70-75 ISSN 0022-2860 R&D Projects: GA ČR GAP108/10/1250 Institutional support: RVO:68378271 ; RVO:61388980 Keywords : vibrational spectroscopy * nickel chromite * X-ray diffraction * size effect Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.780, year: 2015

  7. A X-ray diffraction analysis on graphene layers of Assam coal

    Indian Academy of Sciences (India)

    The so-called turbostatic structure of carbons in coal with randomly oriented stacking of the lamellae (graphene) produces intense peaks, which are the dominant features in its X-ray diffraction profiles. The diffractogram may be conveniently divided into two regions of reciprocal space, the medium S region (1 < S < 3 Å) and ...

  8. Advances in thin film diffraction instrumentation by X-ray optics

    International Nuclear Information System (INIS)

    Haase, A.

    1996-01-01

    The structural characterisation of thin films requires a parallel X-ray beam of high intensity. Parallel beam geometry is commonly used in high resolution and single crystal experiments, but also in the field of X-ray diffraction for polycrystalline material (e.g. in phase, texture and stress analysis). For grazing incidence diffraction (GID), the use of small slits on the primary side and of long soller slits with a flat monochromator on the secondary side is standard. New optical elements have been introduced with polychromatic or monochromatic radiation. By means of different applications the results are compared with those of classical beam optics. X-ray fiber optics utilize total external reflection of X-rays on smooth surfaces. Effects of monochromatization are presented. In many fields of application, fiber optics may replace conventional collimators. The use of primary and secondary channel cut crystals can also produce a high parallel monochromatic X-ray beam. A parabolically bent graded multilayer produces a monochromatic parallel beam of high intensity. Compared with classical Bragg-Brentano (focussing) geometry, excellent results have been obtained, especially for samples with an irregular shape. In combination with a channel cut monochromator there is a substantial gain in intensity leading to an increase of the dynamic intensity range of rocking curves

  9. Advances in thin film diffraction instrumentation by X-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Haase, A. [Rich. Seifert and Co., Analytical X-ray Systems, Ahrensburg (Germany)

    1996-09-01

    The structural characterisation of thin films requires a parallel X-ray beam of high intensity. Parallel beam geometry is commonly used in high resolution and single crystal experiments, but also in the field of X-ray diffraction for polycrystalline material (e.g. in phase, texture and stress analysis). For grazing incidence diffraction (GID), the use of small slits on the primary side and of long soller slits with a flat monochromator on the secondary side is standard. New optical elements have been introduced with polychromatic or monochromatic radiation. By means of different applications the results are compared with those of classical beam optics. X-ray fiber optics utilize total external reflection of X-rays on smooth surfaces. Effects of monochromatization are presented. In many fields of application, fiber optics may replace conventional collimators. The use of primary and secondary channel cut crystals can also produce a high parallel monochromatic X-ray beam. A parabolically bent graded multilayer produces a monochromatic parallel beam of high intensity. Compared with classical Bragg-Brentano (focussing) geometry, excellent results have been obtained, especially for samples with an irregular shape. In combination with a channel cut monochromator there is a substantial gain in intensity leading to an increase of the dynamic intensity range of rocking curves.

  10. Evaluation of the efficiency of clay stabilizers using X-ray diffraction

    International Nuclear Information System (INIS)

    Oliveira, Milena Ferreira de Siqueira; Lopes, Ricardo Tadeu

    2008-01-01

    The aim of this work was evaluate the effectiveness of six clay stabilizers polymeric cationic in inhibiting osmotic swelling in clays of montmorillonite group.Using the humid X-ray diffraction technique is possible to quantify the swelling clay by interlayer spacing that was obtained through survey of the diffraction trace of the clay in solution with stabilizer. The technique of efficiency analysis of the stabilizers using X-ray diffraction is done performing the diffraction trace of a sodium bentonite in solution with different concentrations of stabilizer, diluted in distilled water. The experimental results have shown that six stabilizers were analyzed, and only one was not efficient in the control of the osmotic swelling.The others were efficient, although in different concentration because of differences of chemical composition of each stabilizer. (author)

  11. Graphical method for analyzing wide-angle x-ray diffraction

    Science.gov (United States)

    Chen, XiaoHui; Xue, Tao; Liu, DongBing; Yang, QingGuo; Luo, BinQiang; Li, Mu; Li, XiaoYa; Li, Jun

    2018-01-01

    Wide-angle X-ray diffraction on large-scale laser facility is a well-established experimental method, which is used to study the shock response of single crystal materials by recording X-rays diffracted from numerous lattice planes. We present a three-dimensional graphical method for extracting physical understanding from the raw diffraction data in shocked experiments. This method advances beyond the previous iterative process by turning abstract diffraction theories in shock physics into mathematic issues, providing three-dimensional visualization and quick extraction of data characteristics. The capability and versatility of the method are exhibited by identifying lattice planes for single crystal samples with different orientations and quantitatively measuring the lattice compression and rotation under dynamic loading.

  12. X-ray diffraction measurements for solid methane at high pressures

    CERN Document Server

    Umemoto, S; Akahama, Y; Kawamura, H

    2002-01-01

    X-ray powder diffraction and Raman scattering experiments for solid methane were carried out at pressures up to 37 GPa and room temperature. The diffraction pattern of phase B at 16.9 GPa is assigned to a cubic lattice with lattice constant of 7.914 A (B. At the transition from phase B to the HP phase, the pressure-volume curve shows an anomaly without the structural change.

  13. REAL STRUCTURE AND RESIDUAL STRESSES IN ADVANCED WELDS DETERMINED BY X-RAY AND NEUTRON DIFFRACTION

    Directory of Open Access Journals (Sweden)

    Karel Trojan

    2017-07-01

    Full Text Available The paper outlines the capability of X-ray diffraction (XRD for evaluation of real structure changes and residual stresses (RS on cross-section of advanced thick welds due to the welding of ferromagnetic plates. The results of neutron diffraction describe a three-dimensional state of RS and also verify previous assumptions of RS redistribution as a result of the surface preparation for determination 2D maps measured by XRD.

  14. Ultrafast coherent diffractive imaging of nanoparticles using X-ray free-electron laser radiation

    International Nuclear Information System (INIS)

    Kassemeyer, Stephan

    2014-01-01

    Coherent diffractive imaging with X-ray free-electron lasers (X-FEL) promises high-resolution structure determination of single microscopic particles without the need for crystallization. The diffraction signal of small samples can be very weak, a difficulty that can not be countered by merely increasing the number of photons because the sample would be damaged by a high absorbed radiation dose. Traditional X-ray crystallography avoids this problem by bringing many sample particles into a periodic arrangement, which amplifies the individual signals while distributing the absorbed dose. Depending on the sample, however, crystallization can be very difficult or even impossible. This thesis presents algorithms for a new imaging approach using X-FEL radiation that works with single, non-crystalline sample particles. X-FELs can deliver X-rays with a peak brilliance many orders of magnitude higher than conventional X-ray sources, compensating for their weak interaction cross sections. At the same time, FELs can produce ultra-short pulses down to a few femtoseconds. In this way it is possible to perform ultra-fast imaging, essentially ''freezing'' the atomic positions in time and terminating the imaging process before the sample is destroyed by the absorbed radiation. This thesis primarily focuses on the three-dimensional reconstruction of single (and not necessarily crystalline) particles using coherent diffractive imaging at X-FELs: in order to extract three-dimensional information from scattering data, two-dimensional diffraction patterns from many different viewing angles must be combined. Therefore, the diffraction signal of many identical sample copies in random orientations is measured. The main result of this work is a globally optimal algorithm that can recover the sample orientations solely based on the diffraction signal, enabling three-dimensional imaging for arbitrary samples. The problem of finding three-dimensional orientations is

  15. X-ray detectors for diffraction studies and their use with synchrotron radiation

    International Nuclear Information System (INIS)

    Milch, J.

    1976-02-01

    All techniques for X-ray diffraction studies on biological materials exhibit certain limitations. The characteristics of several X-ray detection systems, namely film, multiwire proportional counter and image intensified TV, are discussed and compared for application to specific biological studies. For the high count-rate situation existing at a synchrotron, it is shown that film is a good choice, but that the image intensified TV exhibits significant advantages. The details of such a system now being used at Princeton with a low intensity source are given and current results presented

  16. Phases quantification in titanium oxides by means of X-ray diffraction

    International Nuclear Information System (INIS)

    Macias B, L.R.; Garcia C, R.M.; Ita T, A. de; Chavez R, A.

    2001-01-01

    In this work two phases of titanium oxides are quantified which belong to the same crystalline system and by means of a computer program named Quanto created by the first author, contains the information for calculating the absorption coefficients, it can be quantified phases having one of the pure phases and the problem samples. In order to perform this work different mixtures of different titanium oxides were prepared measuring by means of the X-ray diffraction technique in the Siemens X-ray diffractometer of ININ which were processed with the Peakfit package and also they were evaluated by means of the computer program with the necessary information finding acceptable results. (Author)

  17. Preliminary study of determination of UO2 grain size using X-ray diffraction method

    International Nuclear Information System (INIS)

    Mulyana, T.; Sambodo, G. D.; Juanda, D.; Fatchatul, B.

    1998-01-01

    The determination of UO 2 grain size has accomplished using x-ray diffraction method. The UO 2 powder is obtained from sol-gel process. A copper target as radiation source in the x-ray diffractometer was used in this experiment with CμKα characteristic wavelength 1.54433 Angstrom. The result indicate that the UO 2 mean grain size on presintered (temperature 800 o C) has the value 456.8500 Angstrom and the UO 2 mean grain size on sintered (temperature 1700 o C) has value 651.4934 Angstrom

  18. Reflection-mode x-ray powder diffraction cell for in situ studies of electrochemical reactions

    International Nuclear Information System (INIS)

    Roberts, G.A.; Stewart, K.D.

    2004-01-01

    The design and operation of an electrochemical cell for reflection-mode powder x-ray diffraction experiments are discussed. The cell is designed for the study of electrodes that are used in rechargeable lithium batteries. It is designed for assembly in a glove box so that air-sensitive materials, such as lithium foil electrodes and carbonate-based electrolytes with lithium salts, can be used. The cell uses a beryllium window for x-ray transmission and electrical contact. A simple mechanism for compressing the electrodes is included in the design. Sample results for the cell are shown with a Cu Kα source and a position-sensitive detector

  19. X-ray diffraction in laser-irradiated epsomite crystals grown in presence of borax

    International Nuclear Information System (INIS)

    Zaitseva, E.V.; Portnov, V.N.; Faddeev, M.A.; Chuprunov, E.V.

    1997-01-01

    Relative changes in the intensities ΔI/I of the (220) and (440) X-ray diffraction reflection during laser irradiation of epsomite (MgSO 2 ·7H 2 O) crystals grown from an aqueous solution in the presence of borax (Na 2 B 4 O 7 ·10H 2 O) were measured using the CoK α , CuK α , MoK α radiations. The intensities measured depend on the real crystal structure dependent on the borax content in the solution. The dependence of ΔI/I is studied as a function of borax in the solution and X-ray-radiation wavelength

  20. X-ray diffraction analysis of substructures in plastically deformed BCC materials

    International Nuclear Information System (INIS)

    Klimanek, P.

    1993-01-01

    A procedure for line-shape analysis of broadened X-ray (or neutron) diffraction peaks is presented and specified for b.c.c. materials, which takes into account the effect of interfaces, internal stress of the 2nd kind and a dislocation distribution with weak defect correlation. Application of the technique is demonstrated by the estimation of dislocation densities in plastically deformed α-iron and steel. The results confirm that X-ray line-broadening analysis is suitable for integrated substructure characterization, but it becomes also evident that local structural inhomogeneity and the texture of the sample material must carefully included into the interpretation of experimental data. (orig.)

  1. A sample holder for in-house X-ray powder diffraction studies of protein powders

    DEFF Research Database (Denmark)

    Frankær, Christian Grundahl; Harris, Pernille; Ståhl, Kenny

    2011-01-01

    A sample holder for handling samples of protein for in-house X-ray powder diffraction (XRPD) analysis has been made and tested on lysozyme. The use of an integrated pinhole reduced the background, and good signal-to-noise ratios were obtained from only 7 l of sample, corresponding to approximately...... 2-3 mg of dry protein. The sample holder is further adaptable to X-ray absorption spectroscopy (XAS) measurements. Both XRPD and XAS at the Zn K-edge were tested with hexameric Zn insulin....

  2. Qualitative and quantitative determination of sediments phases in Chillon River by x-ray diffraction

    International Nuclear Information System (INIS)

    Miramira Tipula, Biviano; Zeballos Velasquez, Elvira; Chui Betancur, Heber; Valencia Salazar, Edilberto; Huaypar Vasquez, Yesena; Olivera de Lescano, Paula

    2008-01-01

    With this paper, we pretend to contribute with the recovery of Chillon River from a characterization of sediments. The objectives are the identification of pollution places along the bed of the Chillon River, from the Canta Province to Lima Province (Comas) and the determination of the preponderant factors of pollution. The qualitative and semi-quantitative determination of the sediments components have been carried out using the x-ray diffraction and x-ray fluorescence techniques, both of them will allow us to identify the pollute elements, for example the lead level in the Chillon River. (author)

  3. Moessbauer spectroscopy and X-ray diffraction study of 304 L stainless steel thin films

    International Nuclear Information System (INIS)

    Boubeker, B.; Eymery, J.P.; Goudeau, P.; Sayouty, E.H.

    1994-01-01

    304 L stainless steel films (SS) were elaborated using an ion-beam sputtering technique. The target material was a sheet of commercial grade 304 L SS. The starting material was first analysed by both conversion electron Moessbauer spectroscopy (CEMS) and X-ray diffraction. The nonmagnetic state and f.c.c. structure of this material were confirmed. The films were deposited on various substrates with thicknesses in the 175-800 nm range. The films are found to have both b.c.c. structure and ferromagnetic character. X-ray diffraction technique was also used in order to determine the residual stresses developed during the deposition process. The second stage of the work is devoted to the evolution of the film structure as a function of annealing treatments. So isochronal and isothermal kinetics at temperatures higher than 913 K have allowed to follow the alpha --> gamma phase transformation using X-ray diffraction and CEMS technique.The X-ray diffractograms reveal the existence of both b.c.c. and f.c.c. phases. Similar results can be deduced from Moessbauer spectra due to the single line coming from the non-magnetic phase and the sextet coming from the ferromagnetic phase. In addition the CEMS spectra reveal that the ferromagnetic component is split into two parts which indicates the existence of two iron sites. 1 fig., 4 refs.(author)

  4. A laboratory based system for Laue micro x-ray diffraction

    Science.gov (United States)

    Lynch, P. A.; Stevenson, A. W.; Liang, D.; Parry, D.; Wilkins, S.; Tamura, N.

    2007-02-01

    A laboratory diffraction system capable of illuminating individual grains in a polycrystalline matrix is described. Using a microfocus x-ray source equipped with a tungsten anode and prefigured monocapillary optic, a micro-x-ray diffraction system with a 10 μm beam was developed. The beam profile generated by the ellipsoidal capillary was determined using the "knife edge" approach. Measurement of the capillary performance, indicated a beam divergence of 14 mrad and a useable energy bandpass from 5.5 to 19 keV. Utilizing the polychromatic nature of the incident x-ray beam and application of the Laue indexing software package X-Ray Micro-Diffraction Analysis Software, the orientation and deviatoric strain of single grains in a polycrystalline material can be studied. To highlight the system potential the grain orientation and strain distribution of individual grains in a polycrystalline magnesium alloy (Mg 0.2 wt % Nd) was mapped before and after tensile loading. A basal (0002) orientation was identified in the as-rolled annealed alloy; after tensile loading some grains were observed to undergo an orientation change of 30° with respect to (0002). The applied uniaxial load was measured as an increase in the deviatoric tensile strain parallel to the load axis.

  5. Rapid, low dose X-ray diffractive imaging of the malaria parasite Plasmodium falciparum

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Michael W.M., E-mail: michael.jones@latrobe.edu.au [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Dearnley, Megan K. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Biochemistry and Molecular Biology, Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia); Riessen, Grant A. van [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Abbey, Brian [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Melbourne Centre for Nanofabrication, Victoria 3168 (Australia); Putkunz, Corey T. [ARC Centre of Excellence for Coherent X-Ray Science, School of Physics, The University of Melbourne, Victoria 3010 (Australia); Junker, Mark D. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Vine, David J. [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); McNulty, Ian [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); Centre for Nanoscale Materials, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Nugent, Keith A. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Peele, Andrew G. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Australian Synchrotron, 800 Blackburn Road, Clayton 3168 (Australia); Tilley, Leann [ARC Centre of Excellence for Coherent X-Ray Science, Department of Biochemistry and Molecular Biology, Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia)

    2014-08-01

    Phase-diverse X-ray coherent diffractive imaging (CDI) provides a route to high sensitivity and spatial resolution with moderate radiation dose. It also provides a robust solution to the well-known phase-problem, making on-line image reconstruction feasible. Here we apply phase-diverse CDI to a cellular sample, obtaining images of an erythrocyte infected by the sexual stage of the malaria parasite, Plasmodium falciparum, with a radiation dose significantly lower than the lowest dose previously reported for cellular imaging using CDI. The high sensitivity and resolution allow key biological features to be identified within intact cells, providing complementary information to optical and electron microscopy. This high throughput method could be used for fast tomographic imaging, or to generate multiple replicates in two-dimensions of hydrated biological systems without freezing or fixing. This work demonstrates that phase-diverse CDI is a valuable complementary imaging method for the biological sciences and ready for immediate application. - Highlights: • Phase-diverse coherent X-ray diffraction microscopy provides high-resolution and high-contrast images of intact biological samples. • Rapid nanoscale resolution imaging is demonstrated at orders of magnitude lower dose than previously possible. • Phase-diverse coherent X-ray diffraction microscopy is a robust technique for rapid, quantitative, and correlative X-ray phase imaging.

  6. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    International Nuclear Information System (INIS)

    Van de Voorde, Lien; Vekemans, Bart; Verhaeven, Eddy; Tack, Pieter; De Wolf, Robin; Garrevoet, Jan; Vandenabeele, Peter; Vincze, Laszlo

    2015-01-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg–Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position. - Highlights: • New X-ray fluorescence and X-ray diffraction instrument for non-destructive analysis • Commercially available, mobile system • One of the lightest and most compact of its kind • Characterization, data acquisition and analysis are performed. • Results of measurements on pigment model samples and cultural heritage materials

  7. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    Energy Technology Data Exchange (ETDEWEB)

    Van de Voorde, Lien, E-mail: lien.vandevoorde@ugent.be [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Vekemans, Bart [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Verhaeven, Eddy [Antwerp University, Faculty of Design Sciences, Mutsaardstraat 31, B-2000 Antwerpen (Belgium); Tack, Pieter; De Wolf, Robin; Garrevoet, Jan [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Vandenabeele, Peter [Ghent University, Department of Archaeology, Archaeometry Research Group, Sint-Pietersnieuwstraat 35, B-9000 Gent (Belgium); Vincze, Laszlo [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium)

    2015-08-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg–Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position. - Highlights: • New X-ray fluorescence and X-ray diffraction instrument for non-destructive analysis • Commercially available, mobile system • One of the lightest and most compact of its kind • Characterization, data acquisition and analysis are performed. • Results of measurements on pigment model samples and cultural heritage materials.

  8. Simultaneous Femtosecond X-ray Spectroscopy and Diffraction of Photosystem II at Room Temperature

    Science.gov (United States)

    Kern, Jan; Alonso-Mori, Roberto; Tran, Rosalie; Hattne, Johan; Gildea, Richard J.; Echols, Nathaniel; Glöckner, Carina; Hellmich, Julia; Laksmono, Hartawan; Sierra, Raymond G.; Lassalle-Kaiser, Benedikt; Koroidov, Sergey; Lampe, Alyssa; Han, Guangye; Gul, Sheraz; DiFiore, Dörte; Milathianaki, Despina; Fry, Alan R.; Miahnahri, Alan; Schafer, Donald W.; Messerschmidt, Marc; Seibert, M. Marvin; Koglin, Jason E.; Sokaras, Dimosthenis; Weng, Tsu-Chien; Sellberg, Jonas; Latimer, Matthew J.; Grosse-Kunstleve, Ralf W.; Zwart, Petrus H.; White, William E.; Glatzel, Pieter; Adams, Paul D.; Bogan, Michael J.; Williams, Garth J.; Boutet, Sébastien; Messinger, Johannes; Zouni, Athina; Sauter, Nicholas K.; Yachandra, Vittal K.; Bergmann, Uwe; Yano, Junko

    2013-01-01

    Intense femtosecond X-ray pulses produced at the Linac Coherent Light Source (LCLS) were used for simultaneous X-ray diffraction (XRD) and X-ray emission spectroscopy (XES) of microcrystals of Photosystem II (PS II) at room temperature. This method probes the overall protein structure and the electronic structure of the Mn4CaO5 cluster in the oxygen-evolving complex of PS II. XRD data are presented from both the dark state (S1) and the first illuminated state (S2) of PS II. Our simultaneous XRD/XES study shows that the PS II crystals are intact during our measurements at the LCLS, not only with respect to the structure of PS II, but also with regard to the electronic structure of the highly radiation sensitive Mn4CaO5 cluster, opening new directions for future dynamics studies. PMID:23413188

  9. Femtosecond x-ray photoelectron diffraction on gas-phase dibromobenzene molecules

    International Nuclear Information System (INIS)

    Rolles, D; Boll, R; Epp, S W; Erk, B; Foucar, L; Hömke, A; Adolph, M; Gorkhover, T; Aquila, A; Chapman, H N; Coppola, N; Delmas, T; Gumprecht, L; Holmegaard, L; Bostedt, C; Bozek, J D; Coffee, R; Decleva, P; Filsinger, F; Johnsson, P

    2014-01-01

    We present time-resolved femtosecond photoelectron momentum images and angular distributions of dissociating, laser-aligned 1,4-dibromobenzene (C 6 H 4 Br 2 ) molecules measured in a near-infrared pump, soft-x-ray probe experiment performed at an x-ray free-electron laser. The observed alignment dependence of the bromine 2p photoelectron angular distributions is compared to density functional theory calculations and interpreted in terms of photoelectron diffraction. While no clear time-dependent effects are observed in the angular distribution of the Br(2p) photoelectrons, other, low-energy electrons show a pronounced dependence on the time delay between the near-infrared laser and the x-ray pulse. (paper)

  10. Optimizing Monocapillary Optics for Synchrotron X-ray Diffraction, Fluorescence Imaging, and Spectroscopy Applications

    International Nuclear Information System (INIS)

    Bilderback, Donald H.; Kazimirov, Alexander; Gillilan, Richard; Cornaby, Sterling; Woll, Arthur; Zha, Chang-Sheng; Huang Rong

    2007-01-01

    A number of synchrotron x-ray applications such as powder diffraction in diamond anvil cells, microbeam protein crystallography, x-ray fluorescence imaging, etc. can benefit from using hollow glass monocapillary optics to improve the flux per square micron on a sample. We currently draw glass tubing into the desired elliptical shape so that only one-bounce under total reflection conditions is needed to bring the x-ray beam to a focus at a 25 to 50 mm distance beyond the capillary tip. For modest focal spot sizes of 10 to 20 microns, we can increase the intensity per square micron by factors of 10 to 1000. We show some of the results obtained at CHESS and Hasylab with capillaries focusing 5 to 40 keV radiation, their properties, and how even better the experimental results could be if more ideal capillaries were fabricated in the future

  11. Study of properties of chemically modified samples of halloysite mineral with X-ray fluorescence and X-ray powder diffraction methods

    Science.gov (United States)

    Banaś, D.; Kubala-Kukuś, A.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.; Czech, K.; Garnuszek, M.; Słomkiewicz, P.; Szczepanik, B.

    2013-12-01

    Elemental and chemical composition of raw and activated samples of halloysite mineral using wavelength dispersive X-ray fluorescence (WDXRF), total reflection X-ray fluorescence (TXRF) and X-ray powder diffraction (XRPD) methods were determined. As the result, it has been shown that application of the complementary X-ray spectrometry techniques allows very precise observation of changes in composition of halloysite mineral samples caused by its chemical modifications. Sample preparation procedure and usability of the research methods applied are described in details. Procedure of activation of raw halloysite mineral samples by etching them in sulfuric acid of various concentrations has been described and discussed. The ability of the samples to adsorb lead from intentionally contaminated water was tested and confirmed.

  12. Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction

    International Nuclear Information System (INIS)

    Emamzadah, Soheila; Petty, Tom J.; De Almeida, Victor; Nishimura, Taisuke; Joly, Jacques; Ferrer, Jean-Luc; Halazonetis, Thanos D.

    2009-01-01

    A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction. Microfluidics is a promising technology for the rapid identification of protein crystallization conditions. However, most of the existing systems utilize silicone elastomers as the chip material which, despite its many benefits, is highly permeable to water vapour. This limits the time available for protein crystallization to less than a week. Here, the use of a cyclic olefin homopolymer-based microfluidics system for protein crystallization and in situ X-ray diffraction is described. Liquid handling in this system is performed in 2 mm thin transparent cards which contain 500 chambers, each with a volume of 320 nl. Microbatch, vapour-diffusion and free-interface diffusion protocols for protein crystallization were implemented and crystals were obtained of a number of proteins, including chicken lysozyme, bovine trypsin, a human p53 protein containing both the DNA-binding and oligomerization domains bound to DNA and a functionally important domain of Arabidopsis Morpheus’ molecule 1 (MOM1). The latter two polypeptides have not been crystallized previously. For X-ray diffraction analysis, either the cards were opened to allow mounting of the crystals on loops or the crystals were exposed to X-rays in situ. For lysozyme, an entire X-ray diffraction data set at 1.5 Å resolution was collected without removing the crystal from the card. Thus, cyclic olefin homopolymer-based microfluidics systems have the potential to further automate protein crystallization and structural genomics efforts

  13. Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Emamzadah, Soheila [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland); Petty, Tom J. [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Biomedical Graduate Studies Genomics and Computational Biology Group, University of Pennsylvania, Philadelphia, PA 19104 (United States); De Almeida, Victor [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland); Nishimura, Taisuke [Department of Plant Biology, University of Geneva, CH-1205 Geneva (Switzerland); Joly, Jacques; Ferrer, Jean-Luc [Institut de Biologie Structurale J.-P. Ebel, CEA-CNRS-University J. Fourier, 38027 Grenoble CEDEX 1 (France); Halazonetis, Thanos D., E-mail: thanos.halazonetis@unige.ch [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland)

    2009-09-01

    A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction. Microfluidics is a promising technology for the rapid identification of protein crystallization conditions. However, most of the existing systems utilize silicone elastomers as the chip material which, despite its many benefits, is highly permeable to water vapour. This limits the time available for protein crystallization to less than a week. Here, the use of a cyclic olefin homopolymer-based microfluidics system for protein crystallization and in situ X-ray diffraction is described. Liquid handling in this system is performed in 2 mm thin transparent cards which contain 500 chambers, each with a volume of 320 nl. Microbatch, vapour-diffusion and free-interface diffusion protocols for protein crystallization were implemented and crystals were obtained of a number of proteins, including chicken lysozyme, bovine trypsin, a human p53 protein containing both the DNA-binding and oligomerization domains bound to DNA and a functionally important domain of Arabidopsis Morpheus’ molecule 1 (MOM1). The latter two polypeptides have not been crystallized previously. For X-ray diffraction analysis, either the cards were opened to allow mounting of the crystals on loops or the crystals were exposed to X-rays in situ. For lysozyme, an entire X-ray diffraction data set at 1.5 Å resolution was collected without removing the crystal from the card. Thus, cyclic olefin homopolymer-based microfluidics systems have the potential to further automate protein crystallization and structural genomics efforts.

  14. Microscopy of biological sample through advanced diffractive optics from visible to X-ray wavelength regime.

    Science.gov (United States)

    Di Fabrizio, Enzo; Cojoc, Dan; Emiliani, Valentina; Cabrini, Stefano; Coppey-Moisan, Maite; Ferrari, Enrico; Garbin, Valeria; Altissimo, Matteo

    2004-11-01

    The aim of this report is to demonstrate a unified version of microscopy through the use of advanced diffractive optics. The unified scheme derives from the technical possibility of realizing front wave engineering in a wide range of electromagnetic spectrum. The unified treatment is realized through the design and nanofabrication of phase diffractive elements (PDE) through which wave front beam shaping is obtained. In particular, we will show applications, by using biological samples, ranging from micromanipulation using optical tweezers to X-ray differential interference contrast (DIC) microscopy combined with X-ray fluorescence. We report some details on the design and physical implementation of diffractive elements that besides focusing also perform other optical functions: beam splitting, beam intensity, and phase redistribution or mode conversion. Laser beam splitting is used for multiple trapping and independent manipulation of micro-beads surrounding a cell as an array of tweezers and for arraying and sorting microscopic size biological samples. Another application is the Gauss to Laguerre-Gauss mode conversion, which allows for trapping and transfering orbital angular momentum of light to micro-particles immersed in a fluid. These experiments are performed in an inverted optical microscope coupled with an infrared laser beam and a spatial light modulator for diffractive optics implementation. High-resolution optics, fabricated by means of e-beam lithography, are demonstrated to control the intensity and the phase of the sheared beams in x-ray DIC microscopy. DIC experiments with phase objects reveal a dramatic increase in image contrast compared to bright-field x-ray microscopy. Besides the topographic information, fluorescence allows detection of certain chemical elements (Cl, P, Sc, K) in the same setup, by changing the photon energy of the x-ray beam. (c) 2005 Wiley-Liss, Inc.

  15. Contained x-ray diffraction goniometer for examination of radioactive materials

    International Nuclear Information System (INIS)

    Smith, P.K.; Osgood, B.C.; Blaser, D.E.; Howell, R.E.; Stuhler, H.; Stauver, J.

    1987-11-01

    Radioactive materials are being characterized for chemical form and certain physical properties with an x-ray diffraction goniometer customized for containment in a shielded alpha glovebox. A Siemens D500 goniometer was customized by Siemens to locate the associated electronics and x-ray generator outside the glovebox to minimize corrosion and facilitate maintenance. A graphite monochromator is used with a shielded scintillation detector to separate diffracted x-radiation from nuclear radiation. The diffraction system is computer automated for data acquisition and reduction. The facility is designed to handle primarily alpha- and beta-emitting samples with moderate neutron and gamma radiation. Samples containing plutonium, enriched uranium, and other transuranic elements are analyzed in support of site nuclear operations and development programs on nuclear waste, chemical separations, reactor fuels, and product forms

  16. Single-particle structure determination by correlations of snapshot X-ray diffraction patterns

    Science.gov (United States)

    Starodub, D.; Aquila, A.; Bajt, S.; Barthelmess, M.; Barty, A.; Bostedt, C.; Bozek, J. D.; Coppola, N.; Doak, R. B.; Epp, S. W.; Erk, B.; Foucar, L.; Gumprecht, L.; Hampton, C. Y.; Hartmann, A.; Hartmann, R.; Holl, P.; Kassemeyer, S.; Kimmel, N.; Laksmono, H.; Liang, M.; Loh, N. D.; Lomb, L.; Martin, A. V.; Nass, K.; Reich, C.; Rolles, D.; Rudek, B.; Rudenko, A.; Schulz, J.; Shoeman, R. L.; Sierra, R. G.; Soltau, H.; Steinbrener, J.; Stellato, F.; Stern, S.; Weidenspointner, G.; Frank, M.; Ullrich, J.; Strüder, L.; Schlichting, I.; Chapman, H. N.; Spence, J. C. H.; Bogan, M. J.

    2012-12-01

    Diffractive imaging with free-electron lasers allows structure determination from ensembles of weakly scattering identical nanoparticles. The ultra-short, ultra-bright X-ray pulses provide snapshots of the randomly oriented particles frozen in time, and terminate before the onset of structural damage. As signal strength diminishes for small particles, the synthesis of a three-dimensional diffraction volume requires simultaneous involvement of all data. Here we report the first application of a three-dimensional spatial frequency correlation analysis to carry out this synthesis from noisy single-particle femtosecond X-ray diffraction patterns of nearly identical samples in random and unknown orientations, collected at the Linac Coherent Light Source. Our demonstration uses unsupported test particles created via aerosol self-assembly, and composed of two polystyrene spheres of equal diameter. The correlation analysis avoids the need for orientation determination entirely. This method may be applied to the structural determination of biological macromolecules in solution.

  17. NXDC-neutron and x-ray diffraction code for crystal structures calculations

    International Nuclear Information System (INIS)

    Abbas, Y.; El-Sherif, A.

    1982-01-01

    A computer program NXDC for the calculations of neutron diffraction and x-ray diffraction intensities is reported. The program is very flexible and allows the intensity of a reflection with a given Miller indices to be calculated if the unit cell and its contents are specified together with the equipement used Neutrons or X-rays-and if necessary introducing temperature and absorption factors corrections. For the refinement of crystal structures provision is made for the comparison of the calculated intensities and the intergrated intensities observed from the diffraction diagrams using the least-squares analysis to obtain the reliability factor R. The program is written in FORTRAN Iv and is very suitable for minicomputers

  18. Rosalind Franklin's X-ray photo of DNA as an undergraduate optical diffraction experiment

    Science.gov (United States)

    Thompson, J.; Braun, G.; Tierney, D.; Wessels, L.; Schmitzer, H.; Rossa, B.; Wagner, H. P.; Dultz, W.

    2018-02-01

    Rosalind Franklin's X-ray diffraction patterns of DNA molecules rendered the important clue that DNA has the structure of a double helix. The most famous X-ray photograph, Photo 51, is still printed in most Biology textbooks. We suggest two optical experiments for undergraduates that make this historic achievement comprehensible for students by using macromodels of DNA and visible light to recreate a diffraction pattern similar to Photo 51. In these macromodels, we replace the double helix both mathematically and experimentally with its two-dimensional (flat) projection and explain why this is permissible. Basic optical concepts are used to infer certain well-known characteristics of DNA from the diffraction pattern.

  19. Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

    Science.gov (United States)

    Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

    2000-01-01

    A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

  20. Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

    Science.gov (United States)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

    2017-11-01

    The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

  1. Correct interpretation of diffraction properties of quartz crystals for X-ray optics applications

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xian-Rong; Gog, Thomas; Kim, Jungho; Kasman, Elina; Said, Ayman H.; Casa, Diego M.; Wieczorek, Michael; Hönnicke, Marcelo G.; Assoufid, Lahsen

    2018-02-01

    Quartz has hundreds of strong Bragg reflections that may offer a great number of choices for making fixed-angle X-ray analyzers and polarizers at virtually any hard X-ray energies with selectable resolution. However, quartz crystals, unlike silicon and germanium, are chiral and may thus appear in two different forms of handedness that are mirror images. Furthermore, because of the threefold rotational symmetry along thecaxis, the {h1h2h3L} and {h2h1h3L} Bragg reflections may have quite different Darwin bandwidth, reflectivity and angular acceptance, although they have the same Bragg angle. The design of X-ray optics from quartz crystals therefore requires unambiguous determination of the orientation, handedness and polarity of the crystals. The Laue method and single-axis diffraction technique can provide such information, but the variety of conventions used in the literature to describe quartz structures has caused widespread confusion. The current studies give detailed guidelines for design and fabrication of quartz X-ray optics, with special emphasis on the correct interpretation of Laue patterns in terms of the crystallography and diffraction properties of quartz. Meanwhile, the quartz crystals examined were confirmed by X-ray topography to have acceptably low densities of dislocations and other defects, which is the foundation for developing high-resolution quartz-based X-ray optics.

  2. JMFA2—a graphically interactive Java program that fits microfibril angle X-ray diffraction data

    Science.gov (United States)

    Steve P. Verrill; David E. Kretschmann; Victoria L. Herian

    2006-01-01

    X-ray diffraction techniques have the potential to decrease the time required to determine microfibril angles dramatically. In this paper, we discuss the latest version of a curve-fitting toll that permits us to reduce the time required to evaluate MFA X-ray diffraction patterns. Further, because this tool reflects the underlying physics more accurately than existing...

  3. Strain fields in crystalline solids: prediction and measurement of X- ray diffraction patterns and electron diffraction contrast images

    NARCIS (Netherlands)

    Bor, Teunis Cornelis

    2000-01-01

    Lattice imperfections, such as dislocations and misfitting particles, shift and/or broaden X-ray diffraction (XRD) line profiles. Most of the present analysis methods of the shift and broadening of XRD line profiles do not provide the characteristics of lattice imperfections. The main part of this

  4. The CCP14 project: software for x-ray diffraction analysts

    International Nuclear Information System (INIS)

    Cranswick, L.

    2002-01-01

    Full text: The primary role of the UK EPSRC funded Collaborative Computational Project No 14 for Single Crystal and Powder Diffraction (CCP14) is to provide freely available crystallographic software to academics and students. While the CCP14 routinely concentrates on crystallographic applications (crystal structure solution and structure refinement), there is still a variety of software useful and freely available to X-ray analysts. As it is routinely important for X-ray analysts to keep up to date with effective new methods and time saving improvements, this presentation will concentrate on techniques relevant to most X-ray analysts - from data conversion to unit cell refinement to quantitative analysis and some structure refinement tools. Emphasis will also be put on the fact that crystallographic and powder diffraction programs are best not used as a black box. While point and click software tools are available, it can be very important to understand the theory behind what they are doing. Mentioned software can be downloaded via the CCP14 website in the UK (www.ccp14.ac.uk/mirror/), with full regional mirrors in the USA, Canada and Australia. Copyright (2002) Australian X-ray Analytical Association Inc

  5. Diffraction-enhanced imaging of musculoskeletal tissues using a conventional x-ray tube.

    Science.gov (United States)

    Muehleman, Carol; Li, Jun; Connor, Dean; Parham, Christopher; Pisano, Etta; Zhong, Zhong

    2009-08-01

    In conventional projection radiography, cartilage and other soft tissues do not produce enough radiographic contrast to be distinguishable from each other. Diffraction-enhanced imaging (DEI) uses a monochromatic x-ray beam and a silicon crystal analyzer to produce images in which attenuation contrast is greatly enhanced and x-ray refraction at tissue boundaries can be detected. The aim of this study was to test the efficacy of conventional x-ray tube-based DEI for the detection of soft tissues in experimental samples. Cadaveric human tali (normal and degenerated) and a knee and thumb were imaged with DEI using a conventional x-ray tube and DEI setup that included a double-silicon crystal monochromator and a silicon crystal analyzer positioned between the imaged object and the detector. Diffraction-enhanced images of the cadaveric tali allowed the visualization of cartilage and its specific level of degeneration for each specimen. There was a significant correlation between the grade of cartilage integrity as assessed on the tube diffraction-enhanced images and on their respective histologic sections (r = 0.97, P = .01). Images of the intact knee showed the articular cartilage edge of the femoral condyle, even when superimposed by the tibia. In the thumb image, it was possible to visualize articular cartilage, tendons, and other soft tissues. DEI based on a conventional x-ray tube allows the visualization of skeletal and soft tissues simultaneously. Although more in-depth testing and optimization of the DEI setup must be carried out, these data demonstrate a proof of principle for further development of the technology for future clinical imaging.

  6. X-ray plane-wave diffraction effects in a crystal with third-order nonlinearity

    Energy Technology Data Exchange (ETDEWEB)

    Balyan, M. K., E-mail: mbalyan@ysu.am [Yerevan State University, Faculty of Physics (Armenia)

    2016-12-15

    The two-wave dynamical diffraction in the Laue geometry has been theoretically considered for a plane X-ray wave in a crystal with a third-order nonlinear response to the external field. An analytical solution to the problem stated is found for certain diffraction conditions. A nonlinear pendulum effect is analyzed. The nonlinear extinction length is found to depend on the incident-wave intensity. A pendulum effect of a new type is revealed: the intensities of the transmitted and diffracted waves periodically depend on the incidentwave intensity at a fixed crystal thickness. The rocking curves and Borrmann nonlinear effect are numerically calculated.

  7. Spectral X-Ray Diffraction using a 6 Megapixel Photon Counting Array Detector.

    Science.gov (United States)

    Muir, Ryan D; Pogranichniy, Nicholas R; Muir, J Lewis; Sullivan, Shane Z; Battaile, Kevin P; Mulichak, Anne M; Toth, Scott J; Keefe, Lisa J; Simpson, Garth J

    2015-03-12

    Pixel-array array detectors allow single-photon counting to be performed on a massively parallel scale, with several million counting circuits and detectors in the array. Because the number of photoelectrons produced at the detector surface depends on the photon energy, these detectors offer the possibility of spectral imaging. In this work, a statistical model of the instrument response is used to calibrate the detector on a per-pixel basis. In turn, the calibrated sensor was used to perform separation of dual-energy diffraction measurements into two monochromatic images. Targeting applications include multi-wavelength diffraction to aid in protein structure determination and X-ray diffraction imaging.

  8. Influence of preferred orientation of minerals in the mineralogical identification process by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Amanda Luzia da; Oliveira, Arno H. de [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear; Fernandes, Maria Lourdes Souza, E-mail: lourdesfernandes@ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de GeoCiencias. Centro de Pesquisa Professor Manoel Teixeira da Costa

    2011-07-01

    The X-ray diffraction corresponds to one of the main techniques for characterization of microstructures in crystalline materials, widely used in the identification of minerals in samples of geological materials. Some minerals have a property called preferred orientation which corresponds to the orientation tendency of the crystals of ground minerals to orient themselves in certain directions according to a preferred crystallographic plane. This property affects the analysis by X-ray diffraction and this fact can generates erroneous results in the characterization. The purpose of this study is to identify the negative influence of the preferred orientation of a mineral in the generation of diffraction patterns obtained in the X-ray diffraction analysis. For this, a sample of muscovite, a mineral of mica group, was prepared by two different methods: the frontal method and the back loading method. In the analysis using the frontal method there was displacement of the XRD pattern in the abscissa axis, where it was observed changes in interplanar distance and angle 2{theta} values, which are essential information for characterization and identification of a mineral. In the analysis using the back loading method, the generated XRD pattern showed no displacement in the axis of abscissas and showed interplanar distance and angle 2{theta} values closer to the real values for the muscovite. The results showed that one can only make improvements to the process of sample preparation minimizing the effect of preferred orientation in the analysis. There is no need to change conditions of diffractometer measurements. (author)

  9. Apparatus development for high-pressure X-ray diffraction using synchrotron radiation

    International Nuclear Information System (INIS)

    Martinez, L.G.; Orlando, M.T.D.; Rossi, J.L.; Passamai Junior, J.L.; Melo, F.C.L.; Ferreira, F.F.

    2006-01-01

    Some phenomena in the field of condensed matter physics can be studied when the matter is submitted to extreme conditions of pressure, magnetic fields or temperatures. Once submitted to these conditions it is generally necessary to measure the properties of the matter in situ. The existence of a synchrotron light laboratory in Brazil opens up the chance of studying materials in extreme conditions by techniques like X-ray diffraction and absorption. However, when compared to high-energy synchrotrons accelerators, the Brazilian source offers a narrower energy range and lower flux. These facts impose limitation to perform diffraction experiments by energy dispersion and, consequently, the use of pressure cells with denser anvils like diamond. However, for a lower-pressure range, preliminary studies showed the viability of measurements in an angular dispersion configuration. This allows the use of silicon carbide anvils B 4C . In this work it is described the development of a hydrostatic pressure cell suitable for X-rays diffraction measurements in the Brazilian Synchrotron Light Laboratory using materials and technologies developed by the institutions and researchers involved in this project (IPEN, UFES, CTA and LNLS). This development can provide the scientific community with the possibility of performing X-ray diffraction measurements under hydrostatic pressure, initially up to 2 GPa, with possibilities of increasing the maximum pressure to higher values, with or without application of magnetic fields and high or low temperatures. (author)

  10. The structural analysis of zinc borate glass by laboratory EXAFS and X-ray diffraction measurements

    International Nuclear Information System (INIS)

    Kajinami, Akihiko; Harada, Yasushi; Inoue, Shinsuke; Deki, Shigehito; Umesaki, Norimasa

    1999-01-01

    The structure of zinc borate glass has been investigated by laboratory EXAFS and X-ray diffraction measurement as preliminary investigations for the detailed study in SPring-8. The zinc borate glass was prepared in the range from 40 to 65 mol% of zinc oxide content. The X-ray diffraction was measured by horizontal θ-θ goniometer with 60 kV and 300 mA output of Mo target. The EXAFS of zinc borate glass was measured by laboratory EXAFS system with 20 kV, 100 mA output of Mo target for the K absorption edge of zinc atom. From the X-ray diffraction and the EXAFS measurements, it is found that the zinc ion is surrounded by four oxygen atoms and formed a tetrahedral structure whose (Zn-O) distance is about 2 A and that the structure is unchanged with the zinc oxide content. The diffraction data show that the neighboring structure of boron atom transforms from BO 4 tetrahedra to BO 3 tetragonal planar structure with increasing of the zinc oxide content. (author)

  11. Identification of inversion domains in KTiOPO{sub 4}via resonant X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Fabrizi, Federica, E-mail: federica.fabrizi@diamond.ac.uk [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom); Thomas, Pamela A. [Department of Physics, University of Warwick, Coventry, CV4 7AL (United Kingdom); Nisbet, Gareth; Collins, Stephen P. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom)

    2015-05-14

    The identification and high-resolution mapping of the absolute crystallographic structure in multi-domain ferroelectric KTiOPO{sub 4} is achieved through a novel synchrotron X-ray diffraction method. On a single Bragg reflection, the intensity ratio in resonant diffraction below and above the Ti absorption K edge demonstrates a domain contrast up to a factor of ∼270, thus implementing a non-contact, non-destructive imaging technique with micrometre spatial resolution, applicable to samples of arbitrarily large dimensions. A novel method is presented for the identification of the absolute crystallographic structure in multi-domain polar materials such as ferroelectric KTiOPO{sub 4}. Resonant (or ‘anomalous’) X-ray diffraction spectra collected across the absorption K edge of Ti (4.966 keV) on a single Bragg reflection demonstrate a huge intensity ratio above and below the edge, providing a polar domain contrast of ∼270. This allows one to map the spatial domain distribution in a periodically inverted sample, with a resolution of ∼1 µm achieved with a microfocused beam. This non-contact, non-destructive technique is well suited for samples of large dimensions (in contrast with traditional resonant X-ray methods based on diffraction from Friedel pairs), and its potential is particularly relevant in the context of physical phenomena connected with an absence of inversion symmetry, which require characterization of the underlying absolute atomic structure (such as in the case of magnetoelectric coupling and multiferroics)

  12. Diffraction measurements of residual macrostress and microstress using x-rays, synchrotron and neutrons

    International Nuclear Information System (INIS)

    Tanaka, Keisuke; Akiniwa, Yoshiaki

    2004-01-01

    The present paper reviews some recent developments of the measurements of the macrostress and microstress by diffraction using X-rays, synchrotron and neutrons especially in Japan. These three methods are based on the same principle of the diffraction of crystals, and have different advantages. The conventional X-rays detect the stress very near the surface, while the neutron diffraction takes the stress in the interior of the materials. High-energy X-rays from synchrotron sources have the penetration depth in between and are suitable for the measurement of subsurface stresses. After describing the developments of the fundamentals of the methods, the paper covers the recent applications of the diffraction methods to the residual stress analysis in textured thin films, the nondestructive determination of the subsurface distribution of residual stress in shot-peened materials, local stress measurements near the crack tip, the stress measurements of single crystals, macrostress and microstress measurements in composites, and the determination of the internal distribution of the residual stress in welded joints. (author)

  13. Influence of preferred orientation of minerals in the mineralogical identification process by X-ray diffraction

    International Nuclear Information System (INIS)

    Silva, Amanda Luzia da; Oliveira, Arno H. de; Fernandes, Maria Lourdes Souza

    2011-01-01

    The X-ray diffraction corresponds to one of the main techniques for characterization of microstructures in crystalline materials, widely used in the identification of minerals in samples of geological materials. Some minerals have a property called preferred orientation which corresponds to the orientation tendency of the crystals of ground minerals to orient themselves in certain directions according to a preferred crystallographic plane. This property affects the analysis by X-ray diffraction and this fact can generates erroneous results in the characterization. The purpose of this study is to identify the negative influence of the preferred orientation of a mineral in the generation of diffraction patterns obtained in the X-ray diffraction analysis. For this, a sample of muscovite, a mineral of mica group, was prepared by two different methods: the frontal method and the back loading method. In the analysis using the frontal method there was displacement of the XRD pattern in the abscissa axis, where it was observed changes in interplanar distance and angle 2θ values, which are essential information for characterization and identification of a mineral. In the analysis using the back loading method, the generated XRD pattern showed no displacement in the axis of abscissas and showed interplanar distance and angle 2θ values closer to the real values for the muscovite. The results showed that one can only make improvements to the process of sample preparation minimizing the effect of preferred orientation in the analysis. There is no need to change conditions of diffractometer measurements. (author)

  14. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    Directory of Open Access Journals (Sweden)

    E. Han Dao

    2015-07-01

    Full Text Available In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  15. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals.

    Science.gov (United States)

    Dao, E Han; Sierra, Raymond G; Laksmono, Hartawan; Lemke, Henrik T; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L; Cohen, Aina E; Soltis, S Michael; DeMirci, Hasan

    2015-07-01

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  16. X-ray diffraction investigation of cyclohexane derivatives at 293 K

    Energy Technology Data Exchange (ETDEWEB)

    Drozdowski, Henryk, E-mail: riemann@amu.edu.pl [Department of Optics, Faculty of Physics, A. Mickiewicz University, ul. Umultowska 85, 61-614 Poznan (Poland); Nowakowski, Krzysztof; BLaszczak, ZdzisLaw [Department of Optics, Faculty of Physics, A. Mickiewicz University, ul. Umultowska 85, 61-614 Poznan (Poland)

    2011-10-15

    This paper reports results of the X-ray diffraction structural studies of liquid cyclohexylamine C{sub 6}H{sub 11}-NH{sub 2} and cyclohexanol C{sub 6}H{sub 11}-OH performed at 293 K. The method of X-ray scattering and Fourier analysis enabled the determination of the mean structural parameters of the liquids studied. The wide-angle X-ray scattering (WAXS) method provided new information on mutual arrangement and orientation of the molecules of the above mentioned compounds in the liquid phase. The measurements of scattered radiation intensity were performed in a wide range of wave vector (from S{sub min}=0.925 A{sup -1} to S{sub max}=14.311 A{sup -1}), with the use of X-ray radiation MoK{sub {alpha}} ({lambda}=0.71069 A). Angular distributions of X-ray scattered intensity were measured, and differential radial distribution functions of electron density (DRDFs) were calculated. The mean distances between the neighbouring molecules and the mean radii of coordination spheres were found. A simple model of short-range arrangement of the molecules was proposed, which seems to be valid for other polar monosubstituted cyclohexane derivatives in the liquid phase. - Highlights: > X-ray method enabled the determination of the structure of cyclohexane derivatives. > Determination of the mean parameters of the liquid structure has been discussed. > A simple model of short-range arrangement and orientation of the molecules was proposed. > Results are valid for a wide group of molecular liquids.

  17. Theoretical study of the properties of X-ray diffraction moiré fringes. I

    International Nuclear Information System (INIS)

    Yoshimura, Jun-ichi

    2015-01-01

    A detailed and comprehensive theoretical description of X-ray diffraction moiré fringes for a bicrystal specimen is given on the basis of a calculation by plane-wave dynamical diffraction theory, where the effect of the Pendellösung intensity oscillation on the moiré pattern is explained in detail. A detailed and comprehensive theoretical description of X-ray diffraction moiré fringes for a bicrystal specimen is given on the basis of a calculation by plane-wave dynamical diffraction theory. Firstly, prior to discussing the main subject of the paper, a previous article [Yoshimura (1997 ▸). Acta Cryst. A53, 810–812] on the two-dimensionality of diffraction moiré patterns is restated on a thorough calculation of the moiré interference phase. Then, the properties of moiré fringes derived from the above theory are explained for the case of a plane-wave diffraction image, where the significant effect of Pendellösung intensity oscillation on the moiré pattern when the crystal is strained is described in detail with theoretically simulated moiré images. Although such plane-wave moiré images are not widely observed in a nearly pure form, knowledge of their properties is essential for the understanding of diffraction moiré fringes in general

  18. X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase): perdeuteration of proteins for neutron diffraction

    International Nuclear Information System (INIS)

    Blum, Marc-Michael; Tomanicek, Stephen J.; John, Harald; Hanson, B. Leif; Rüterjans, Heinz; Schoenborn, Benno P.; Langan, Paul; Chen, Julian C.-H.

    2010-01-01

    The crystal structure of perdeuterated diisopropyl fluorophosphatase is reported and compared with the hydrogenated structure. Diffraction guidelines for neutron crystallography experiments are summarized. The signal-to-noise ratio is one of the limiting factors in neutron macromolecular crystallography. Protein perdeuteration, which replaces all H atoms with deuterium, is a method of improving the signal-to-noise ratio of neutron crystallography experiments by reducing the incoherent scattering of the hydrogen isotope. Detailed analyses of perdeuterated and hydrogenated structures are necessary in order to evaluate the utility of perdeuterated crystals for neutron diffraction studies. The room-temperature X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase) is reported at 2.1 Å resolution. Comparison with an independently refined hydrogenated room-temperature structure of DFPase revealed no major systematic differences, although the crystals of perdeuterated DFPase did not diffract neutrons. The lack of diffraction is examined with respect to data-collection and crystallographic parameters. The diffraction characteristics of successful neutron structure determinations are presented as a guideline for future neutron diffraction studies of macromolecules. X-ray diffraction to beyond 2.0 Å resolution appears to be a strong predictor of successful neutron structures

  19. Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling.

    Science.gov (United States)

    Veluraja, K; Vennila, K N; Umamakeshvari, K; Jasmine, A; Velmurugan, D

    2011-03-25

    The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 Å. The high intense d-spacing signal at 4.22 Å is attributed to the antiparallel β-sheet structure identified in the fraction of the homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 Å reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. High-pressure x-ray diffraction of icosahedral Zr-Al-Ni-Cu-Ag quasicrystals

    DEFF Research Database (Denmark)

    Jiang, Jianzhong; Saksl, Karel; Rasmussen, Helge Kildahl

    2001-01-01

    The effect of pressure on the structural stability of icosahedral Zr-Al-Ni-Cu-Ag quasicrystals forming from a Zr65Al7.5Ni10Cu7.5Ag10 metallic glass with a supercooled liquid region of 44 K has been investigated by in situ high-pressure angle-dispersive x-ray powder diffraction at ambient temperat......The effect of pressure on the structural stability of icosahedral Zr-Al-Ni-Cu-Ag quasicrystals forming from a Zr65Al7.5Ni10Cu7.5Ag10 metallic glass with a supercooled liquid region of 44 K has been investigated by in situ high-pressure angle-dispersive x-ray powder diffraction at ambient...

  1. The biomechanics of amnion rupture: an X-ray diffraction study.

    Directory of Open Access Journals (Sweden)

    Che J Connon

    2007-11-01

    Full Text Available Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

  2. Correlated microradiography, X-ray microbeam diffraction and electron probe microanalysis of calcifications in an odontoma

    International Nuclear Information System (INIS)

    Aoba, T.; Yoshioka, C.; Yagi, T.

    1980-01-01

    Using microradiography, X-ray microbeam diffraction and electron probe microanalysis, a correlated morphologic and crystallographic study was performed on dysplastic enamel in a compound odontoma. The tumor was found in the lateral incisor-canine region of the left mandible of a 36-year-old woman. A conspicuous feature was the presence of hypomineralized areas, which were situated in the proximity of enamel surface and distinctly demarcated from the adjacent enamel. X-ray microbeam diffraction and electron microanalysis showed that these lesions have a lower crystallinity and a higher concentration of magnesium as compared with the adjacent enamel. In addition, the present study revealed the presence of two other types of calcifications: 1) calcified structures within the fissure or on the enamel surface, which include lacunae of varying size and which resemble a form of coronal cementum, and 2) spherical calcifications which may be an epithelial product. (author)

  3. Synchrotron radiation X-ray powder diffraction techniques applied in hydrogen storage materials - A review

    Directory of Open Access Journals (Sweden)

    Honghui Cheng

    2017-02-01

    Full Text Available Synchrotron radiation is an advanced collimated light source with high intensity. It has particular advantages in structural characterization of materials on the atomic or molecular scale. Synchrotron radiation X-ray powder diffraction (SR-XRPD has been successfully exploited to various areas of hydrogen storage materials. In the paper, we will give a brief introduction on hydrogen storage materials, X-ray powder diffraction (XRPD, and synchrotron radiation light source. The applications of ex situ and in situ time-resolved SR-XRPD in hydrogen storage materials, are reviewed in detail. Future trends and proposals in the applications of the advanced XRPD techniques in hydrogen storage materials are also discussed.

  4. Power X-ray diffraction under extreme conditions of pressure and temperature

    International Nuclear Information System (INIS)

    Fiquet, G.; Andrault, D.

    1999-01-01

    An important work has been carried out in the field of X-ray diffraction in obtaining accurate structure information from materials at extreme conditions of pressure and temperature. An experimental set-up combining a diamond-anvil high-pressure cell and a laser-heating technique has been installed at the high-pressure beamline ID30 at the ESRF (Grenoble) to study two major constituents of the Earth's deep interior: MgSiO 3 perovskite and iron. Experiments carried out on MgSiO 3 perovskite up to 86 GPa and over 2000 K yielded detailed structural information on this compound under these conditions and thus important constraints for the lower mantle mineralogical model, favouring a mixture of perovskite and magnesiowuestite. X-ray diffraction patterns recorded on imaging plates with micro-focused monochromatic radiation revealed a new high-temperature structure of iron above 40 GPa. (au)

  5. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    Energy Technology Data Exchange (ETDEWEB)

    Kiyota, Eduardo [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Sousa, Sylvia Morais de [Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Santos, Marcelo Leite dos; Costa Lima, Aline da [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Menossi, Marcelo [Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas-SP (Brazil); Yunes, José Andrés [Laboratório de Biologia Molecular, Centro Infantil Boldrini, Campinas-SP (Brazil); Aparicio, Ricardo, E-mail: aparicio@iqm.unicamp.br [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil)

    2007-11-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.

  6. Applications of the Warren-Averbach method of X-ray diffraction line profile analysis

    International Nuclear Information System (INIS)

    Ichikawa, Rodrigo Uchida

    2013-01-01

    The objective of this work was to develop and implement a methodology of X-ray Line Profile Analysis (XLPA) for the study and determination of the mean crystallite sizes and microstrains in materials. A computer program was developed to speed up the treatment of diffraction peaks and perform the deconvolution utilizing the Stokes method to correct the instrumental contribution in the X-ray diffraction measurements. The XLPA methods used were the Scherrer, Williamson-Hall and Single-Line methods, which can be called real space methods, and the Fourier space method of Warren-Averbach. Furthermore, considering a mathematical modelling it was possible to calculate the crystallite size distribution, considering the log-normal distribution and spherical crystallites. It was possible to demonstrate the proposed theory can provide reliable results evaluating a dispersion parameter. The methodologies described above were applied in two distinct materials: in the alloy Zircaloy-4 and in ZnO. (author)

  7. Edge diffraction effect at the refraction of X rays in a diamond prism

    Science.gov (United States)

    Tur'yanskii, A. G.; Konovalov, O. V.; Gizha, S. S.; Beilin, N. D.

    2014-12-01

    The refraction of monochromatic X-ray radiation in an optically polished diamond prism has been studied. Measurements have been performed on the ID10 channel of the ESRF synchrotron (Grenoble). It has been found that parabolic geometric deviations of the profile of the refractive face of the prism from a plane are responsible for the interference pattern that is similar in the structure of oscillations to an edge diffraction effect. As a result, a diffraction pattern characteristic of the near-field Fresnel zone can be observed in the farfield zone. A high sensitivity to phase perturbations ensures the possibility of using this effect to analyze the parameters of an X-ray wavefront with a dimension of about 1 μm.

  8. Atomic structure of large angle grain boundaries determined by quantitative X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Fitzsimmons, M.R.; Sass, S.L.

    1988-01-01

    Quantitative X-ray diffraction techniques have been used to determine the atomic structure of the Σ = 5 and 13 [001] twist boundaries in Au with a resolution of 0.09 Angstrom or better. The reciprocal lattices of these boundaries were mapped out using synchrotron radiation. The atomic structures were obtained by testing model structures against the intensity observations with a chi square analysis. The boundary structure were modeled using polyhedra, including octahedra, special configurations of tetrahedra and Archimedian anti-prisms, interwoven together by the boundary symmetry. The results of this work point to the possibility of obtaining general rules for grain boundary structure based on X-ray diffraction observations that give the atomic positions with high resolution

  9. Setup for in situ x-ray diffraction study of swift heavy ion irradiated materials.

    Science.gov (United States)

    Kulriya, P K; Singh, F; Tripathi, A; Ahuja, R; Kothari, A; Dutt, R N; Mishra, Y K; Kumar, Amit; Avasthi, D K

    2007-11-01

    An in situ x-ray diffraction (XRD) setup is designed and installed in the materials science beam line of the Pelletron accelerator at the Inter-University Accelerator Centre for in situ studies of phase change in swift heavy ion irradiated materials. A high vacuum chamber with suitable windows for incident and diffracted X-rays is integrated with the goniometer and the beamline. Indigenously made liquid nitrogen (LN2) temperature sample cooling unit is installed. The snapshots of growth of particles with fluence of 90 MeV Ni ions were recorded using in situ XRD experiment, illustrating the potential of this in situ facility. A thin film of C60 was used to test the sample cooling unit. It shows that the phase of the C60 film transforms from a cubic lattice (at room temperature) to a fcc lattice at around T=255 K.

  10. Detectors for X-ray diffraction and scattering: current technology and future challenges

    International Nuclear Information System (INIS)

    Bahr, D.; Brugemann, L.; Gerndt, E.

    2003-01-01

    Full text: Detectors are crucial devices determining the quality, the reliability and the throughput of x-ray diffraction (XRD) and scattering investigations. This is of utmost importance in an industrial environment where in many cases untrained personnel or even without human intervention the experiments and data evaluations are running. The currently used technology of 0-dimensional to 2-dim XRD detectors is presented using selected examples. The application specific requirements on e.g. energy range and resolution, count rate limit, background and dynamic range, and size versus price are discussed. Due to the fact that x-ray diffraction investigations are becoming increasingly attractive in science, research and industry the advance in detector technology is pushed beyond existing limits. The discussion of the resultant market opportunities versus the cost of ownership and market entrance barrier is the final section of the presentation

  11. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    International Nuclear Information System (INIS)

    Kiyota, Eduardo; Sousa, Sylvia Morais de; Santos, Marcelo Leite dos; Costa Lima, Aline da; Menossi, Marcelo; Yunes, José Andrés; Aparicio, Ricardo

    2007-01-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR

  12. Quantitative strain analysis of surfaces and interfaces using extremely asymmetric x-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Akimoto, Koichi [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Emoto, Takashi, E-mail: akimoto@nagoya-u.j [Toyota National College of Technology, Toyota, Aichi 471-8525 (Japan)

    2010-12-01

    Strain can reduce carrier mobility and the reliability of electronic devices and affect the growth mode of thin films and the stability of nanometer-scale crystals. To control lattice strain, a technique for measuring the minute lattice strain at surfaces and interfaces is needed. Recently, an extremely asymmetric x-ray diffraction method has been developed for this purpose. By employing Darwin's dynamical x-ray diffraction theory, quantitative evaluation of strain at surfaces and interfaces becomes possible. In this paper, we review our quantitative strain analysis studies on native SiO{sub 2}/Si interfaces, reconstructed Si surfaces, Ni/Si(111)-H interfaces, sputtered III-V compound semiconductor surfaces, high-k/Si interfaces, and Au ion-implanted Si. (topical review)

  13. Analysis of diatomite sediments from a paleolake in central Mexico using PIXE, X-ray tomography and X-ray diffraction

    Science.gov (United States)

    Miranda, J.; Oliver, A.; Vilaclara, G.; Rico-Montiel, R.; Macías, V. M.; Ruvalcaba, J. L.; Zenteno, M. A.

    1994-03-01

    Diatomite samples from paleolake Tlaxcala, in Central Mexico, have been analyzed using proton induced X-ray emission (PIXE), X-ray tomography and X-ray diffraction. Chiseled blocks were scanned with a 0.7 MeV proton beam, 0.1 mm in diameter, in 0.25 mm steps across the sediments. X-ray tomography with the same step sizes was then applied, in order to compare the concentrations obtained with PIXE and the material density in the sediment layers. Three different kinds of layers were found, related to their colors: dark, white and gray. The composition of the layers is fairly uniform. The dark zone is enriched in Al, K, Ca, Ti, Mn, and Fe. This dark layer may be associated with eruptions of the Malitzin volcano. The white zone is found to contain diatomite of a high purity, with traces of K, Ca, and Fe, while the gray zones are also Al enriched, suggesting a clay contamination of the diatomite. X-ray diffraction of materials obtained from each main layer showed that the white and gray phases are highly amorphous, with a small component of cristobalite, as expected from the diatom sediment diagenesis, while the dark layer contains also important amounts of anorthite and orthoclase, supporting the volcanic origin of this layer.

  14. Sample cell for in-field X-ray diffraction experiments

    Directory of Open Access Journals (Sweden)

    Viktor Höglin

    2015-01-01

    Full Text Available A sample cell making it possible to perform synchrotron radiation X-ray powder diffraction experiments in a magnetic field of 0.35 T has been constructed. The device is an add-on to an existing sample cell and contains a strong permanent magnet of NdFeB-type. Experiments have shown that the setup is working satisfactory making it possible to perform in-field measurements.

  15. In situ x-ray diffraction studies of YBa2Cu3Ox

    International Nuclear Information System (INIS)

    Williams, S.; Zheng, J.Q.; Shih, M.C.; Wang, X.K.; Lee, S.J.; Rippert, E.D.; Maglic, S.; Kajiyama, H.; Segel, D.; Dutta, P.; Chang, R.P.H.; Ketterson, J.B.; Roberts, T.; Lin, Y.; Kampwirth, R.T.; Gray, K.

    1992-01-01

    Using a specially designed off-axis faced magnetron sputtering chamber we have performed in situ x-ray diffraction studies of the growth of YBa 2 Cu 3 O x films using a synchrotron light source. The orientation and rocking curve width were studied as a function of substrate temperature, O 2 /Ar partial pressures, and deposition rate. Growth rate was studied on SrTiO 3 , LaAlO 3 , and MgO

  16. Qualitative characterization by x-ray diffraction from soils: mineralogy conditions to benefit the environment

    International Nuclear Information System (INIS)

    Fujiyama, Bruna Sayuri; Tavares, Mauricio de Moraes

    2010-01-01

    Four samples were collected from four soil profiles located in the Rural Federal University of Amazonia. These, were analyzed parameters such as color, texture, consistency, granulometry, porosity and water absorption. We identified the following soil types: Distrofic Yellow Latosoil; Lateritic Concretionary; distrofic Low Humic Gley. The work was to continue the qualitative analysis by X-rays diffraction, identifying the mineralogical composition of each sample. Explaining the mineralogical conditions that affect or benefit the environment. (author)

  17. Sparse recovery of undersampled intensity patterns for coherent diffraction imaging at high X-ray energies

    OpenAIRE

    Maddali, Siddharth; Calvo-Almazan, Irene; Almer, Jonathan; Kenesei, Peter; Park, Jun-Sang; Harder, Ross; Nashed, Youssef; Hruszkewycz, Stephan

    2017-01-01

    Coherent X-ray photons with energies higher than 50 keV offer new possibilities for imaging nanoscale lattice distortions in bulk crystalline materials using Bragg peak phase retrieval methods. However, the compression of reciprocal space at high energies typically results in poorly resolved fringes on an area detector, rendering the diffraction data unsuitable for the three-dimensional reconstruction of compact crystals. To address this problem, we propose a method by which to recover fine f...

  18. Time and space domain separation of pulsed X-ray beams diffracted from vibrating crystals

    Energy Technology Data Exchange (ETDEWEB)

    Nosik, V. L., E-mail: v-nosik@yandex.ru, E-mail: nosik@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography, Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)

    2016-11-15

    It is known that a set of additional reflections (satellites) may arise on rocking curves in the case of X-ray diffraction in the Bragg geometry from crystals where high-frequency ultrasonic vibrations are excited. It is shown that, under certain conditions, the pulse wave fields of the satellites and main reflection may be intersected in space (playing the role of pump and probe beams) and in time (forming interference superlattices).

  19. X-ray diffraction studies of red tomato nuclease TBN1

    Czech Academy of Sciences Publication Activity Database

    Kovaľ, Tomáš; Dohnálek, Jan; Lipovová, P.; Podzimek, T.; Matoušek, Jaroslav; Dušková, Jarmila; Skálová, Tereza; Štěpánková, Andrea; Kolenko, Petr; Hašek, Jindřich

    2010-01-01

    Roč. 17, 1a (2010), b40 ISSN 1211-5894. [Discussions in Structural Molecular Biology /8./. 18.03.2010-20.03.2010, Nové Hrady] R&D Projects: GA ČR GA202/06/0757 Institutional research plan: CEZ:AV0Z10100521; CEZ:AV0Z40500505 Keywords : plant bifunctional nuclease * crystallization * x-ray diffraction analysis Subject RIV: BM - Solid Matter Physics ; Magnetism

  20. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    Directory of Open Access Journals (Sweden)

    M. S. Conconi

    2014-12-01

    Full Text Available The firing transformations of traditional (clay based ceramics are of technological and archeological interest, and are usually reported qualitatively or semiquantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite, the low crystalline (metakaolinite and/or spinel type pre-mullite and glassy phases evolution of a triaxial (clay-quartz-feldspar ceramic fired in a wide temperature range between 900 and 1300 ºC. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 ºC spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and

  1. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    Energy Technology Data Exchange (ETDEWEB)

    Conconi, M.S.; Gauna, M.R.; Serra, M.F. [Centro de Tecnologia de Recursos Minerales y Ceramica (CETMIC), Buenos Aires (Argentina); Suarez, G.; Aglietti, E.F.; Rendtorff, N.M., E-mail: rendtorff@cetmic.unlp.edu.ar [Universidad Nacional de La Plata (UNLP), Buenos Aires (Argentina). Fac. de Ciencias Exactas. Dept. de Quimica

    2014-10-15

    The firing transformations of traditional (clay based) ceramics are of technological and archaeological interest, and are usually reported qualitatively or semi quantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite), the low crystalline (metakaolinite and/or spinel type pre-mullite) and glassy phases evolution of a triaxial (clay-quartz-feldspar) ceramic fired in a wide temperature range between 900 and 1300 deg C. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 deg C) spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy) phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and materials

  2. Drug design based on x-ray diffraction and steered molecular dynamics

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jindřich; Skálová, Tereza; Dohnálek, Jan; Dušková, Jarmila; Petroková, Hana; Vondráčková, Eva; Zimmermann, K.

    2005-01-01

    Roč. 12, č. 3 (2005), s. 208-210 ISSN 1211-5894. [VUFB Conference on Modern Methods in Synthesis and Analysis of Active Pharmaceutical Substances /5./. Praha, 23.11.2005-24.11.2005] R&D Projects: GA AV ČR KJB4050312 Institutional research plan: CEZ:AV0Z40500505 Keywords : drug design * X-ray diffraction * steered molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry

  3. Qualitative mineralogical characterization of the sinter by X-ray diffraction

    International Nuclear Information System (INIS)

    Greca, M.C.; Pietroluongo, L.R.V.; Baliza, S.V.; Costa Pereira, E.A. da

    1987-01-01

    This paper aims the qualitative mineralogical characterization of sinters and raw materials employed on its fabrication, via X-ray diffraction technique. Thus, sample with constant coke breeze content and variable contents of sand, limestone, dunite and dolomite were prepared to obtain current sinter compositions, with variable basicity. The tests were performed at the research of the following institutions: Companhia Siderurgica Nacional, Centro de Tecnologia Mineral and Instituto Nacional de Tecnologia. (author) [pt

  4. Exploring the nanoworld in real and reciprocal space. Part 1 x-ray and electron diffractions

    International Nuclear Information System (INIS)

    Ng Inn Khuan; Kok Kuan Ying

    2003-01-01

    The articles highlight two of the main characterization techniques that are widely used in materials characterization laboratories, namely, X-ray Diffractometry (XRD) and Transmission Electron Microscopy (TEM). Part 1 of the article focuses on the diffraction while part 2 on imaging aspects of these techniques. The theoretical background for each technique is briefly covered and examples are given to illustrate the use of the techniques in solving some materials-related problem, particularly, for nanostructured systems. (Author)

  5. GaN quantum dot polarity determination by X-ray photoelectron diffraction

    Czech Academy of Sciences Publication Activity Database

    Romanyuk, Olexandr; Bartoš, Igor; Brault, J.; De Mierry, P.; Paskova, T.; Jiříček, Petr

    2016-01-01

    Roč. 389, Dec (2016), s. 1156-1160 ISSN 0169-4332 R&D Projects: GA ČR GA15-01687S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : GaN * semipolar GaN * quantum dots * X-ray photoelectron diffraction * surface polarity Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.387, year: 2016

  6. Diamond Thermal Expansion Measurement Using Transmitted X-ray Back-diffraction.

    OpenAIRE

    Giles, Carlos; Adriano, Cris; Lubambo, Adriana Freire; Cusatis, Cesar; Mazzaro, Irineu; Hönnicke, Marcelo Goncalves

    2015-01-01

    The linear thermal expansion coefficient of diamond has been measured using forward-diffracted profiles in X-ray backscattering. This experimental technique is presented as an alternative way of measuring thermal expansion coefficients of solids in the high-resolution Bragg backscattering geometry without the intrinsic difficulty of detecting the reflected beam. The temperature dependence of the lattice parameter is obtained from the high sensitivity of the transmitted profiles to the Bragg a...

  7. Calculated powder x-ray diffraction data for three tantalum tungstates

    International Nuclear Information System (INIS)

    Holcombe, C.E. Jr.

    1976-11-01

    A study was made of computer-simulated powder x-ray diffraction data for Ta 22 W 4 O 67 , Ta 2 WO 8 , and Ta 16 W 18 O 94 --the three compounds in the Ta 2 O 5 --WO 3 system from 27 to 69 mole percent WO 3 . The crystal structures of Ta 2 WO 8 and one form of Ta 16 W 18 O 94 (Type B) were deduced from reported data. 8 tables

  8. X-ray diffraction study of elemental erbium to 70 GPa

    International Nuclear Information System (INIS)

    Pravica, Michael G.; Romano, Edward; Quine, Zachary

    2005-01-01

    We have investigated phase transitions in elemental erbium in a diamond anvil cell (DAC) up to 70 GPa using angular-dispersive x-ray powder diffraction methods. We present evidence of a series of phase transitions that appear to follow the anticipated hcp→Sm-type→double hcp (dhcp)→distorted fcc sequence. In particular, we present evidence for the predicted dhcp→distorted fcc transition above 63 GPa. Equation of state data are also presented up to 70 GPa

  9. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    International Nuclear Information System (INIS)

    Conconi, M.S.; Gauna, M.R.; Serra, M.F.; Suarez, G.; Aglietti, E.F.; Rendtorff, N.M.

    2014-01-01

    The firing transformations of traditional (clay based) ceramics are of technological and archaeological interest, and are usually reported qualitatively or semi quantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite), the low crystalline (metakaolinite and/or spinel type pre-mullite) and glassy phases evolution of a triaxial (clay-quartz-feldspar) ceramic fired in a wide temperature range between 900 and 1300 deg C. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 deg C) spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy) phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and materials

  10. Measurement and Interpretation of Diffuse Scattering in X-Ray Diffraction for Macromolecular Crystallography

    Energy Technology Data Exchange (ETDEWEB)

    Wall, Michael E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-10-16

    X-ray diffraction from macromolecular crystals includes both sharply peaked Bragg reflections and diffuse intensity between the peaks. The information in Bragg scattering reflects the mean electron density in the unit cells of the crystal. The diffuse scattering arises from correlations in the variations of electron density that may occur from one unit cell to another, and therefore contains information about collective motions in proteins.

  11. Lattice Misfit Measurement in Inconel 625 by X-Ray Diffraction Technique

    OpenAIRE

    Mukherjee, P.; Sarkar, A.; Barat, P.; Jayakumar, T.; Mahadevan, S.; Rai, Sanjay K.

    2006-01-01

    Determination of lattice misfit and microstructural parameters of the coherent precipitates in Ni based alloy Inconel-625 is a challenging problem as their peaks are completely overlapping among themselves and also with the matrix. We have used a novel X-ray diffraction technique on the bulk samples of Inconel 625 at different heat-treated conditions to determine the lattice parameters, the lattice misfit of the coherent precipitates with the matrix and their microstructural parameters like s...

  12. Measuring the X-ray Resolving Power of Bent Potassium Acid Phthalate Diffraction Crystals

    Energy Technology Data Exchange (ETDEWEB)

    Haugh, M. J. [NSTec; Wu, M. [SNL; Jacoby, K. D. [NSTec; Loisel, G. P. [SNL

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals that we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories (SNL) in Albuquerque, NM. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a dual goniometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.

  13. Advancements in X-ray waveguides and their applications in coherent diffraction imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pelliccia, D. [Institut fuer Synchrotronstrahlung-ANKA Forschungszentrum Karlsruhe Herman-von-Helmholtz-Platz 1, D-76344 Eggenstein-Leopoldshafen (Germany)], E-mail: daniele.pelliccia@iss.fzk.de; Bukreeva, I. [Istituto di Fotonica e Nanotecnologie-CNR, Via Cineto Romano 42, 00156 Roma (Italy); Giannini, C.; De Caro, L. [Istituto di Cristallografia-CNR, Via Amendola 122/O, 70126 Bari (Italy); Cedola, A.; Scarinci, F.; Lagomarsino, S. [Istituto di Fotonica e Nanotecnologie-CNR, Via Cineto Romano 42, 00156 Roma (Italy)

    2009-10-15

    X-ray planar waveguides are currently used tools, in synchrotron radiation facilities, to produce a coherent beam with typical dimensions in the range of tens or hundreds of nanometers. The properties of waveguided beams such as divergence and coherence turns out to be very interesting for several applications both in synchrotron and in laboratory sources. These features will be reviewed in the present paper for different coupling methods of the radiation field with the waveguide channel. Details of fabrication procedures and experimental results concerning front coupling waveguide are reported. The waveguide properties can be estimated from the far-field diffracted beam by a Fourier analysis giving the autocorrelation function of the exit field. Due to the high degree of coherence of the exiting beam, X-ray waveguides can be successfully exploited in coherent diffraction imaging experiments. We review results concerning Fresnel coherent diffraction imaging experiments with hard X-rays, using planar waveguides as optical elements in one and two dimensions.

  14. Advancements in X-ray waveguides and their applications in coherent diffraction imaging

    International Nuclear Information System (INIS)

    Pelliccia, D.; Bukreeva, I.; Giannini, C.; De Caro, L.; Cedola, A.; Scarinci, F.; Lagomarsino, S.

    2009-01-01

    X-ray planar waveguides are currently used tools, in synchrotron radiation facilities, to produce a coherent beam with typical dimensions in the range of tens or hundreds of nanometers. The properties of waveguided beams such as divergence and coherence turns out to be very interesting for several applications both in synchrotron and in laboratory sources. These features will be reviewed in the present paper for different coupling methods of the radiation field with the waveguide channel. Details of fabrication procedures and experimental results concerning front coupling waveguide are reported. The waveguide properties can be estimated from the far-field diffracted beam by a Fourier analysis giving the autocorrelation function of the exit field. Due to the high degree of coherence of the exiting beam, X-ray waveguides can be successfully exploited in coherent diffraction imaging experiments. We review results concerning Fresnel coherent diffraction imaging experiments with hard X-rays, using planar waveguides as optical elements in one and two dimensions.

  15. In situ X-ray powder diffraction, synthesis, and magnetic properties of InVO3

    International Nuclear Information System (INIS)

    Lundgren, Rylan J.; Cranswick, Lachlan M.D.; Bieringer, Mario

    2006-01-01

    We report the first synthesis and high-temperature in situ X-ray diffraction study of InVO 3 . Polycrystalline InVO 3 has been prepared via reduction of InVO 4 using a carbon monoxide/carbon dioxide buffer gas. InVO 3 crystallizes in the bixbyite structure in space group Ia-3 (206) with a=9.80636(31) A with In 3+ /V 3+ disorder on the (8b) and (24d) cation sites. In situ powder X-ray diffraction experiments and thermal gravimetric analysis in a CO/CO 2 buffer gas revealed the existence of the metastable phase InVO 3 . Bulk samples with 98.5(2)% purity were prepared using low-temperature reduction methods. The preparative methods limited the crystallinity of this new phase to approximately 225(50) A. Magnetic susceptibility and neutron diffraction experiments suggest a spin-glass ground state for InVO 3 . - Graphical abstract: In situ powder X-ray diffractograms for the reduction of InVO 4 in CO/CO 2 . The three temperature regions show the conversion of InVO 4 to InVO 3 and final decomposition into In 2 O 3 and V 2 O 3

  16. AUSPEX: a graphical tool for X-ray diffraction data analysis.

    Science.gov (United States)

    Thorn, Andrea; Parkhurst, James; Emsley, Paul; Nicholls, Robert A; Vollmar, Melanie; Evans, Gwyndaf; Murshudov, Garib N

    2017-09-01

    In this paper, AUSPEX, a new software tool for experimental X-ray data analysis, is presented. Exploring the behaviour of diffraction intensities and the associated estimated uncertainties facilitates the discovery of underlying problems and can help users to improve their data acquisition and processing in order to obtain better structural models. The program enables users to inspect the distribution of observed intensities (or amplitudes) against resolution as well as the associated estimated uncertainties (sigmas). It is demonstrated how AUSPEX can be used to visually and automatically detect ice-ring artefacts in integrated X-ray diffraction data. Such artefacts can hamper structure determination, but may be difficult to identify from the raw diffraction images produced by modern pixel detectors. The analysis suggests that a significant portion of the data sets deposited in the PDB contain ice-ring artefacts. Furthermore, it is demonstrated how other problems in experimental X-ray data caused, for example, by scaling and data-conversion procedures can be detected by AUSPEX.

  17. Residual stress characterization of welds using x-ray diffraction techniques

    International Nuclear Information System (INIS)

    Pineault, J.A.; Brauss, M.E.

    1996-01-01

    Neglect of residual stresses created during processes lead to stress corrosion cracking, distortion, fatigue cracking, premature failures in components, and instances of over design. Automated residual stress mapping and truly portable equipment have now made the characterization of residual stresses using x-ray diffraction (XRI) practical. The nondestructive nature of the x-ray diffraction technique has made the tile residual stress characterization of welds a useful tool for process optimization and failure analysis, particularly since components can be measured before and after welding and post welding processes. This paper illustrates the importance of residual stress characterization in welds and presents examples where x-ray diffraction techniques were applied in the characterization of various kinds of welds. arc welds, TIG welds, resistance welds, laser welds and electron beam welds. Numerous techniques are available to help manage potentially harmfull residual stresses created during the welding process thus, the effects of a few example post weld processes such as grinding, heat treating and shot peening are also addressed

  18. Time-resolved x-ray diffraction techniques for bulk polycrystalline materials under dynamic loading

    International Nuclear Information System (INIS)

    Lambert, P. K.; Hustedt, C. J.; Zhao, M.; Ananiadis, A. G.; Hufnagel, T. C.; Vecchio, K. S.; Huskins, E. L.; Casem, D. T.; Gruner, S. M.; Tate, M. W.; Philipp, H. T.; Purohit, P.; Weiss, J. T.; Woll, A. R.; Kannan, V.; Ramesh, K. T.; Kenesei, P.; Okasinski, J. S.; Almer, J.

    2014-01-01

    We have developed two techniques for time-resolved x-ray diffraction from bulk polycrystalline materials during dynamic loading. In the first technique, we synchronize a fast detector with loading of samples at strain rates of ∼10 3 –10 4 s −1 in a compression Kolsky bar (split Hopkinson pressure bar) apparatus to obtain in situ diffraction patterns with exposures as short as 70 ns. This approach employs moderate x-ray energies (10–20 keV) and is well suited to weakly absorbing materials such as magnesium alloys. The second technique is useful for more strongly absorbing materials, and uses high-energy x-rays (86 keV) and a fast shutter synchronized with the Kolsky bar to produce short (∼40 μs) pulses timed with the arrival of the strain pulse at the specimen, recording the diffraction pattern on a large-format amorphous silicon detector. For both techniques we present sample data demonstrating the ability of these techniques to characterize elastic strains and polycrystalline texture as a function of time during high-rate deformation

  19. Time-resolved x-ray diffraction techniques for bulk polycrystalline materials under dynamic loading

    Energy Technology Data Exchange (ETDEWEB)

    Lambert, P. K.; Hustedt, C. J.; Zhao, M.; Ananiadis, A. G.; Hufnagel, T. C. [Department of Materials Science and Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Vecchio, K. S. [Department of NanoEngineering, University of California San Diego, La Jolla, California 92093 (United States); Huskins, E. L. [Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee 37830 (United States); US Army Research Laboratory, Aberdeen Proving Ground, Aberdeen, Maryland 21005 (United States); Casem, D. T. [US Army Research Laboratory, Aberdeen Proving Ground, Aberdeen, Maryland 21005 (United States); Gruner, S. M. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States); Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, New York 14853 (United States); Kavli Institute at Cornell for Nanoscale Science, Cornell University, Ithaca, New York 14853 (United States); Tate, M. W.; Philipp, H. T.; Purohit, P.; Weiss, J. T. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States); Woll, A. R. [Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, New York 14853 (United States); Kannan, V.; Ramesh, K. T. [Department of Mechanical Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Kenesei, P.; Okasinski, J. S.; Almer, J. [X-ray Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    2014-09-15

    We have developed two techniques for time-resolved x-ray diffraction from bulk polycrystalline materials during dynamic loading. In the first technique, we synchronize a fast detector with loading of samples at strain rates of ∼10{sup 3}–10{sup 4} s{sup −1} in a compression Kolsky bar (split Hopkinson pressure bar) apparatus to obtain in situ diffraction patterns with exposures as short as 70 ns. This approach employs moderate x-ray energies (10–20 keV) and is well suited to weakly absorbing materials such as magnesium alloys. The second technique is useful for more strongly absorbing materials, and uses high-energy x-rays (86 keV) and a fast shutter synchronized with the Kolsky bar to produce short (∼40 μs) pulses timed with the arrival of the strain pulse at the specimen, recording the diffraction pattern on a large-format amorphous silicon detector. For both techniques we present sample data demonstrating the ability of these techniques to characterize elastic strains and polycrystalline texture as a function of time during high-rate deformation.

  20. Solvent structure in crystals of trypsin determined by X-ray and neutron diffraction.

    Science.gov (United States)

    Finer-Moore, J S; Kossiakoff, A A; Hurley, J H; Earnest, T; Stroud, R M

    1992-03-01

    The solvent structure in orthorhombic crystals of bovine trypsin has been independently determined by X-ray diffraction to 1.35 A resolution and by neutron diffraction to 2.1 A resolution. A consensus model of the water molecule positions was obtained using oxygen positions identified in the electron density map determined by X-ray diffraction, which were verified by comparison to D2O-H2O difference neutron scattering density. Six of 184 water molecules in the X-ray structure, all with B-factors greater than 50 A2, were found to be spurious after comparison with neutron results. Roughly two-thirds of the water of hydration expected from thermodynamic data for proteins was localized by neutron diffraction; approximately one-half of the water of hydration was located by X-ray diffraction. Polar regions of the protein are well hydrated, and significant D2O-H2O difference density is seen for a small number of water molecules in a second shell of hydration. Hydrogen bond lengths and angles calculated from unconstrained refinement of water positions are distributed about values typically seen in small molecule structures. Solvent models found in seven other bovine trypsin and trypsinogen and rat trypsin structures determined by X-ray diffraction were compared. Internal water molecules are well conserved in all trypsin structures including anionic rat trypsin, which is 65% homologous to bovine trypsin. Of the 22 conserved waters in trypsin, 19 were also found in trypsinogen, suggesting that they are located in regions of the apoprotein that are structurally conserved in the transition to the mature protein. Seven waters were displaced upon activation of trypsinogen. Water structure at crystal contacts is not generally conserved in different crystal forms. Three groups of integral structural water molecules are highly conserved in all solvent structures, including a spline of water molecules inserted between two beta-strands, which may resemble an intermediate in the

  1. X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase): perdeuteration of proteins for neutron diffraction.

    Science.gov (United States)

    Blum, Marc Michael; Tomanicek, Stephen J; John, Harald; Hanson, B Leif; Rüterjans, Heinz; Schoenborn, Benno P; Langan, Paul; Chen, Julian C H

    2010-04-01

    The signal-to-noise ratio is one of the limiting factors in neutron macromolecular crystallography. Protein perdeuteration, which replaces all H atoms with deuterium, is a method of improving the signal-to-noise ratio of neutron crystallography experiments by reducing the incoherent scattering of the hydrogen isotope. Detailed analyses of perdeuterated and hydrogenated structures are necessary in order to evaluate the utility of perdeuterated crystals for neutron diffraction studies. The room-temperature X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase) is reported at 2.1 A resolution. Comparison with an independently refined hydrogenated room-temperature structure of DFPase revealed no major systematic differences, although the crystals of perdeuterated DFPase did not diffract neutrons. The lack of diffraction is examined with respect to data-collection and crystallographic parameters. The diffraction characteristics of successful neutron structure determinations are presented as a guideline for future neutron diffraction studies of macromolecules. X-ray diffraction to beyond 2.0 A resolution appears to be a strong predictor of successful neutron structures.

  2. X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase): perdeuteration of proteins for neutron diffraction

    Science.gov (United States)

    Blum, Marc-Michael; Tomanicek, Stephen J.; John, Harald; Hanson, B. Leif; Rüterjans, Heinz; Schoenborn, Benno P.; Langan, Paul; Chen, Julian C.-H.

    2010-01-01

    The signal-to-noise ratio is one of the limiting factors in neutron macromolecular crystallography. Protein perdeuteration, which replaces all H atoms with deuterium, is a method of improving the signal-to-noise ratio of neutron crystallography experiments by reducing the incoherent scattering of the hydrogen isotope. Detailed analyses of perdeuterated and hydrogenated structures are necessary in order to evaluate the utility of perdeuterated crystals for neutron diffraction studies. The room-temperature X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase) is reported at 2.1 Å resolution. Comparison with an independently refined hydrogenated room-temperature structure of DFPase revealed no major systematic differences, although the crystals of perdeuterated DFPase did not diffract neutrons. The lack of diffraction is examined with respect to data-collection and crystallo­graphic parameters. The diffraction characteristics of successful neutron structure determinations are presented as a guideline for future neutron diffraction studies of macromolecules. X-ray diffraction to beyond 2.0 Å resolution appears to be a strong predictor of successful neutron structures. PMID:20383004

  3. Computer simulation tools for X-ray analysis scattering and diffraction methods

    CERN Document Server

    Morelhão, Sérgio Luiz

    2016-01-01

    The main goal of this book is to break down the huge barrier of difficulties faced by beginners from many fields (Engineering, Physics, Chemistry, Biology, Medicine, Material Science, etc.) in using X-rays as an analytical tool in their research. Besides fundamental concepts, MatLab routines are provided, showing how to test and implement the concepts. The major difficult in analyzing materials by X-ray techniques is that it strongly depends on simulation software. This book teaches the users on how to construct a library of routines to simulate scattering and diffraction by almost any kind of samples. It provides to a young student the knowledge that would take more than 20 years to acquire by working on X-rays and relying on the available textbooks. In this book, fundamental concepts in applied X-ray physics are demonstrated through available computer simulation tools. Using MatLab, more than eighty routines are developed for solving the proposed exercises, most of which can be directly used in experimental...

  4. Effects of proton irradiation on structure of NdFeB permanent magnets studied by X-ray diffraction and X-ray absorption fine structure

    International Nuclear Information System (INIS)

    Yang, L.; Zhen, L.; Xu, C.Y.; Sun, X.Y.; Shao, W.Z.

    2011-01-01

    The effects of proton irradiation on the structure of NdFeB permanent magnet were investigated by X-ray diffraction and X-ray absorption fine structure (XAFS). The results reveal that proton irradiation has no effect on the long-range structure, but significantly affects the atomic local structure of the NdFeB magnet. The alignment degree of the magnet decreases and the internal stress of the lattice increases after proton irradiation. XAFS results show that the coordination number of Fe-Nd in the first neighboring coordination shell of the Fe atoms decreases and the disorder degree increases.

  5. Effects of proton irradiation on structure of NdFeB permanent magnets studied by X-ray diffraction and X-ray absorption fine structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang, L. [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China); Zhen, L., E-mail: lzhen@hit.edu.c [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China); Xu, C.Y.; Sun, X.Y.; Shao, W.Z. [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China)

    2011-01-15

    The effects of proton irradiation on the structure of NdFeB permanent magnet were investigated by X-ray diffraction and X-ray absorption fine structure (XAFS). The results reveal that proton irradiation has no effect on the long-range structure, but significantly affects the atomic local structure of the NdFeB magnet. The alignment degree of the magnet decreases and the internal stress of the lattice increases after proton irradiation. XAFS results show that the coordination number of Fe-Nd in the first neighboring coordination shell of the Fe atoms decreases and the disorder degree increases.

  6. X-ray diffraction and X-ray absorption of strained CoO and MnO thin films

    NARCIS (Netherlands)

    Csiszár, Szilárd Istvan; Tjeng, L.H

    2005-01-01

    The aim of this project was to study the influence of epitaxial strain on the electronic and magnetic structure of transition metal oxide layers. In the first part of the thesis the discovery of characteristic diffuse X-ray scattering patterns is reported. They are caused by the misfit dislocations,

  7. Ultrafast lattice dynamics in photoexcited nanostructures. Femtosecond X-ray diffraction with optimized evaluation schemes

    International Nuclear Information System (INIS)

    Schick, Daniel

    2013-01-01

    Within the course of this thesis, I have investigated the complex interplay between electron and lattice dynamics in nanostructures of perovskite oxides. Femtosecond hard X-ray pulses were utilized to probe the evolution of atomic rearrangement directly, which is driven by ultrafast optical excitation of electrons. The physics of complex materials with a large number of degrees of freedom can be interpreted once the exact fingerprint of ultrafast lattice dynamics in time-resolved X-ray diffraction experiments for a simple model system is well known. The motion of atoms in a crystal can be probed directly and in real-time by femtosecond pulses of hard X-ray radiation in a pump-probe scheme. In order to provide such ultrashort X-ray pulses, I have built up a laser-driven plasma X-ray source. The setup was extended by a stable goniometer, a two-dimensional X-ray detector and a cryogen-free cryostat. The data acquisition routines of the diffractometer for these ultrafast X-ray diffraction experiments were further improved in terms of signal-to-noise ratio and angular resolution. The implementation of a high-speed reciprocal-space mapping technique allowed for a two-dimensional structural analysis with femtosecond temporal resolution. I have studied the ultrafast lattice dynamics, namely the excitation and propagation of coherent phonons, in photoexcited thin films and superlattice structures of the metallic perovskite SrRuO 3 . Due to the quasi-instantaneous coupling of the lattice to the optically excited electrons in this material a spatially and temporally well-defined thermal stress profile is generated in SrRuO 3 . This enables understanding the effect of the resulting coherent lattice dynamics in time-resolved X-ray diffraction data in great detail, e.g. the appearance of a transient Bragg peak splitting in both thin films and superlattice structures of SrRuO 3 . In addition, a comprehensive simulation toolbox to calculate the ultrafast lattice dynamics and the

  8. Optimization of an X-ray diffraction imaging system for medical and security applications

    International Nuclear Information System (INIS)

    Marticke, Fanny

    2016-01-01

    X-ray diffraction imaging is a powerful noninvasive technique to identify or characterize different materials. Compared to traditional techniques using X-ray transmission, it allows to extract more material characteristic information, such as the Bragg peak positions for crystalline materials as well as the molecular form factor for amorphous materials. The potential of this technique has been recognized by many researchers and numerous applications such as luggage inspection, nondestructive testing, drug detection and biological tissue characterization have been proposed. The method of energy dispersive X-ray diffraction (EDXRD) is particularly suited for this type of applications as it allows the use of a conventional X-ray tube, the acquisition of the whole spectrum at the same time and parallelized architectures to inspect an entire object in a reasonable time. The purpose of the present work is to optimize the whole material characterization chain. Optimization comprises two aspects: optimization of the acquisition system and of data processing. The last one concerns especially the correction of diffraction pattern degraded by acquisition process. Reconstruction methods are proposed and validated on simulated and experimental spectra. System optimization is realized using figures of merit such as detective quantum efficiency (DQE), contrast to noise ratio (CNR) and receiver operating characteristic (ROC) curves.The first chosen application is XRD based breast imaging which aims to distinguish cancerous tissues from healthy tissues. Two non-multiplexed collimation configurations combining EDXRD and ADXRD are proposed after optimization procedure. A simulation study of the whole system and a breast phantom was realized to determine the required dose to detect a 4 mm carcinoma nodule. The second application concerns detection of illicit materials during security check. The possible benefit of a multiplexed collimation system was examined. (author) [fr

  9. X-ray diffraction studies on single and mixed confectionery fats using synchrotron radiation

    Energy Technology Data Exchange (ETDEWEB)

    MacMillan, S.C.; Roberts, K.J.; Wells, M.; Polgreen, M.; Smith, I. [Heriot-Watt University, Edinburgh, (United Kingdom). Department of Mechanical and Chemical Engineering, Centre for Molecular and Interface Engineering

    1999-12-01

    Full text: Understanding and refining the molecular-scale processes involved in the manufacture of structured materials such as long-chain hydrocarbon compounds is important in many commercial areas such as the petrochemical, biochemical, food, pharmaceutical and soap industries. In such processes crystallisation is an important separation, purification and preparation technique. Despite this our knowledge of the crystallisation process itself is surprisingly limited. In order to improve the crystallisation of confectionery fats, the crystallisation of it`s main component, cocoa butter fat, must be properly understood. Cocoa butter fat can exhibit up to 6 polymorphic forms of different crystallographic structures with melting points varying from 17.3 deg C to 36.3 deg C. During the production of chocolate it is essential to control the polymorphic form of fats present, in order to produce a final product with the correct physical and rheological properties. Both shear rate and temperature are thought to play a crucial role in this process. The most widely used method for studying polymorphism is X-ray diffraction. Typical X-ray diffraction patterns of fats exhibit two groups of diffraction lines corresponding to the long and short spacings. The long spacings correspond to the planes formed by the methyl end groups and are dependent on the chain length and the angle of tilt of the component fatty acids of the glyceride molecules. The short spacings refer to the cross sectional packing of the hydrocarbon chain and are independent of the chain length. The relationship between crystallisation rate, polymorphic form, shear and the fat composition has for the first time been quantified, which will enable more accurate control of the polymorhic form in chocolate production. This has been achieved by developing an improved in-situ cell for X-ray studies. The X-ray studies are necessary for the examination of on-line studies under well controlled conditions of temperature

  10. X-ray diffraction studies on single and mixed confectionery fats using synchrotron radiation

    International Nuclear Information System (INIS)

    MacMillan, S.C.; Roberts, K.J.; Wells, M.; Polgreen, M.; Smith, I.

    1999-01-01

    Full text: Understanding and refining the molecular-scale processes involved in the manufacture of structured materials such as long-chain hydrocarbon compounds is important in many commercial areas such as the petrochemical, biochemical, food, pharmaceutical and soap industries. In such processes crystallisation is an important separation, purification and preparation technique. Despite this our knowledge of the crystallisation process itself is surprisingly limited. In order to improve the crystallisation of confectionery fats, the crystallisation of it's main component, cocoa butter fat, must be properly understood. Cocoa butter fat can exhibit up to 6 polymorphic forms of different crystallographic structures with melting points varying from 17.3 deg C to 36.3 deg C. During the production of chocolate it is essential to control the polymorphic form of fats present, in order to produce a final product with the correct physical and rheological properties. Both shear rate and temperature are thought to play a crucial role in this process. The most widely used method for studying polymorphism is X-ray diffraction. Typical X-ray diffraction patterns of fats exhibit two groups of diffraction lines corresponding to the long and short spacings. The long spacings correspond to the planes formed by the methyl end groups and are dependent on the chain length and the angle of tilt of the component fatty acids of the glyceride molecules. The short spacings refer to the cross sectional packing of the hydrocarbon chain and are independent of the chain length. The relationship between crystallisation rate, polymorphic form, shear and the fat composition has for the first time been quantified, which will enable more accurate control of the polymorhic form in chocolate production. This has been achieved by developing an improved in-situ cell for X-ray studies. The X-ray studies are necessary for the examination of on-line studies under well controlled conditions of temperature

  11. Computer simulations of X-ray six-beam diffraction in a perfect silicon crystal. I

    Czech Academy of Sciences Publication Activity Database

    Kohn, V.G.; Khikhlukha, Danila

    2016-01-01

    Roč. 72, May (2016), s. 349-356 ISSN 2053-2733 R&D Projects: GA MŠk EF15_008/0000162; GA MŠk ED1.1.00/02.0061 Grant - others:ELI Beamlines(XE) CZ.02.1.01/0.0/0.0/15_008/0000162; ELI Beamlines(XE) CZ.1.05/1.1.00/02.0061 Institutional support: RVO:68378271 Keywords : X-ray diffraction * silicon crystal * six-beam diffraction * section topography * computer simulations Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 5.725, year: 2016

  12. Use of overlapped reflection for determining the retained austenite by X-ray diffraction

    International Nuclear Information System (INIS)

    Garin, J.L.; Gonzalez, C.F.

    1988-01-01

    Retainec austenite in high-carbon steels has been determined by means of new computation techniques applied to the processing of X-ray diffraction data. Instead of using the traditional procedure based on the weak (200) reflections of martensite and austenite, intensity measurements of the overlapped (110) peak of martensite and (111) peak of austenite were performed. The separation of the peaks was based on a Pearson VII function, which is capable of describing all diffraction profiles. The accuracy of integrated intensities was then improved with the beneficial effects of higher precision in the calculation of the amount of retained austenite. (author) [pt

  13. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    International Nuclear Information System (INIS)

    Nascimento, Alessandro S.; Ferrarezi, Thiago; Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A.; Polikarpov, Igor

    2006-01-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP + reductase. Ferredoxin-NADP + reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source

  14. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Alessandro S.; Ferrarezi, Thiago [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil); Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A. [Facultad de Ciencias Bioquímicas y Farmacéuticas, Molecular Biology Division, Instituto de Biología Molecular y Celular de Rosario (IBR), CONICET, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario (Argentina); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil)

    2006-07-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP{sup +} reductase. Ferredoxin-NADP{sup +} reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source.

  15. Real Structure and Resudal Stresses in Advanced Welds Determined by X-ray and Neutron Diffraction

    Czech Academy of Sciences Publication Activity Database

    Trojan, K.; Hervoches, Charles; Ganev, N.; Mikula, Pavol; Čapek, J.

    2017-01-01

    Roč. 9, SEP (2017), s. 32-38 E-ISSN 2336-5382 R&D Projects: GA MŠk LM2015056; GA ČR GB14-36566G Institutional support: RVO:61389005 Keywords : laser and MAG welding * residual stresses * X-ray diffraction * neutron diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) https://ojs.cvut.cz/ojs/index.php/APP/article/view/4401/4298

  16. Influence of the transverse and longitudinal coherence in the dynamical theory of x-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Mocella, V.; Guigay, J.P.; Haertwig, J.; Baruchel, J.; Mazuelas, A. [European Synchrotron Radiation Facility BP 220, Grenoble (France); Epelboin, Y. [Laboratoire de Mineralogie-Cristallographie, URA 009 CNRS, Universites PM Curie et D Diderot, Case 115, Paris (France)

    1999-05-21

    We investigate dynamical diffraction phenomena of a quasi-monochromatic x-ray beam emitted by a small source at a large distance from the sample. Under certain conditions of coherence the diffraction intensity profile in a recording plane reproduces the angular profile of the rocking curve of the crystal. The coherence requirements are stronger for thicker crystals. This has been verified in experiments at the ESRF. In these experiments the effective crystal thickness was varied by rotating the crystal around an axis perpendicular to the reflecting planes. (author)

  17. Synchrotron Powder X-ray Diffraction Study of the Structure and Dehydration Behavior of Sepiolite

    Science.gov (United States)

    Post, J. E.; Bish, D. L.; Heaney, P. J.

    2006-05-01

    Sepiolite is a hydrous Mg-silicate clay mineral with fibrous morphology that typically occurs as fine-grained, poorly crystalline masses. It occurs in a wide variety of geological environments and has been mined for centuries because of its many uses, e.g. in the pharmaceutical, fertilizer, and pesticide industries. Its versatile functionality derives from the large surface area and microporosity that are characteristic of the material. In recent years, sepiolite has received considerable attention with regard to the adsorption of organics, for use as a support for catalysts, as a molecular sieve, and as an inorganic membrane for ultrafiltration. Because of its fine-grained and poorly crystalline nature, it has not been possible to study sepiolite's crystal structure using single-crystal X-ray diffraction methods, and consequently many details of the structure are still not well known. In this study, Rietveld refinements using synchrotron powder X-ray diffraction data were used to investigate the crystal structure and dehydration behavior of sepiolite from Durango, Mexico. The room- temperature (RT) sepiolite structure in air compares well with previous models but reveals an additional zeolitic water site. The RT structure under vacuum retained only ~1/8 of the zeolitic water and the volume decreased 1.3%. Real-time, temperature-resolved synchrotron powder X-ray diffraction data and Rietveld refinements were used to investigate the behavior of the sepiolite structure from 300 to 925 K. Rietveld refinements revealed that most of the zeolitic water is lost by ~390 K, accompanied by a decrease in the a and c unit-cell parameters. Above ~600 K the sepiolite structure folds as one-half of the crystallographically bound water is lost. Rietveld refinements of the "anhydrous" sepiolite structure reveal that, in general, unit-cell parameters a, b, â and volume steadily decrease with increasing temperature; there is an obvious change in slope at ~820 K suggesting a phase

  18. Characterization of ion beam sputtered deposited W/Si multilayers by grazing incidence x-ray diffraction and x-ray reflectivity technique

    Science.gov (United States)

    Dhawan, Rajnish; Rai, Sanjay

    2016-05-01

    W/Si multilayers four samples have been deposited on silicon substrate using ion beam sputtering system. Thickness of tungsten (W) varies from around 10 Å to 40 Å while the silicon (Si) thickness remains constant at around 30 Å in multilayers [W-Si]x4. The samples have been characterized by grazing incidence X-ray diffraction (GIXRD) and X-ray reflectivity technique (XRR). GIXRD study shows the crystalline behaviour of W/Si multilayer by varying W thickness and it is found that above 20 Å the W film transform from amorphous to crystalline phase and X-ray reflectivity data shows that the roughnesses of W increases on increasing the W thicknesses in W/Si multilayers.

  19. Digital Image Correlation of 2D X-ray Powder Diffraction Data for Lattice Strain Evaluation

    Directory of Open Access Journals (Sweden)

    Hongjia Zhang

    2018-03-01

    Full Text Available High energy 2D X-ray powder diffraction experiments are widely used for lattice strain measurement. The 2D to 1D conversion of diffraction patterns is a necessary step used to prepare the data for full pattern refinement, but is inefficient when only peak centre position information is required for lattice strain evaluation. The multi-step conversion process is likely to lead to increased errors associated with the ‘caking’ (radial binning or fitting procedures. A new method is proposed here that relies on direct Digital Image Correlation analysis of 2D X-ray powder diffraction patterns (XRD-DIC, for short. As an example of using XRD-DIC, residual strain values along the central line in a Mg AZ31B alloy bar after 3-point bending are calculated by using both XRD-DIC and the conventional ‘caking’ with fitting procedures. Comparison of the results for strain values in different azimuthal angles demonstrates excellent agreement between the two methods. The principal strains and directions are calculated using multiple direction strain data, leading to full in-plane strain evaluation. It is therefore concluded that XRD-DIC provides a reliable and robust method for strain evaluation from 2D powder diffraction data. The XRD-DIC approach simplifies the analysis process by skipping 2D to 1D conversion, and opens new possibilities for robust 2D powder diffraction data analysis for full in-plane strain evaluation.

  20. ENDIX. A computer program to simulate energy dispersive X-ray and synchrotron powder diffraction diagrams

    International Nuclear Information System (INIS)

    Hovestreydt, E.; Karlsruhe Univ.; Parthe, E.; Benedict, U.

    1987-01-01

    A Fortran 77 computer program is described which allows the simulation of energy dispersive X-ray and synchrotron powder diffraction diagrams. The input consists of structural data (space group, unit cell dimensions, atomic positional and displacement parameters) and information on the experimental conditions (chosen Bragg angle, type of X-ray tube and applied voltage or operating power of synchrotron radiation source). The output consists of the normalized intensities of the diffraction lines, listed by increasing energy (in keV), and of an optional intensity-energy plot. The intensities are calculated with due consideration of the wave-length dependence of both the anomalous dispersion and the absorption coefficients. For a better agreement between observed and calculated spectra provision is made to optionally superimpose, on the calculated diffraction line spectrum, all additional lines such as fluorescence and emission lines and escape peaks. The different effects which have been considered in the simulation are discussed in some detail. A sample calculation of the energy dispersive powder diffraction pattern of UPt 3 (Ni 3 Sn structure type) is given. Warning: the user of ENDIX should be aware that for a successful application it is necessary to adapt the program to correspond to the actual experimental conditions. Even then, due to the only approximately known values of certain functions, the agreement between observed and calculated intensities will not be as good as for angle dispersive diffraction methods

  1. Risk and benefit of diffraction in Energy Dispersive X-ray fluorescence mapping

    Science.gov (United States)

    Nikonow, Wilhelm; Rammlmair, Dieter

    2016-11-01

    Energy dispersive X-ray fluorescence mapping (μ-EDXRF) is a fast and non-destructive method for chemical quantification and therefore used in many scientific fields. The combination of spatial and chemical information is highly valuable for understanding geological processes. Problems occur with crystalline samples due to diffraction, which appears according to Bragg's law, depending on the energy of the X-ray beam, the incident angle and the crystal parameters. In the spectra these peaks can overlap with element peaks suggesting higher element concentrations. The aim of this study is to investigate the effect of diffraction, the possibility of diffraction removal and potential geoscientific applications for X-ray mapping. In this work the μ-EDXRF M4 Tornado from Bruker was operated with a Rh-tube and polychromatic beam with two SDD detectors mounted each at ± 90° to the tube. Due to the polychromatic beam the Bragg condition fits for several mineral lattice planes. Since diffraction depends on the angle, it is shown that a novel correction approach can be applied by measuring from two different angles and calculating the minimum spectrum of both detectors gaining a better limit of quantification for this method. Furthermore, it is possible to use the diffraction information for separation of differently oriented crystallites within a monomineralic aggregate and obtain parameters like particle size distribution for the sample, as it is done by thin section image analysis in cross-polarized light. Only with μ-EDXRF this can be made on larger samples without preparation of thin sections.

  2. Room temperature femtosecond X-ray diffraction of photosystem II microcrystals

    Science.gov (United States)

    Kern, Jan; Alonso-Mori, Roberto; Hellmich, Julia; Tran, Rosalie; Hattne, Johan; Laksmono, Hartawan; Glöckner, Carina; Echols, Nathaniel; Sierra, Raymond G.; Sellberg, Jonas; Lassalle-Kaiser, Benedikt; Gildea, Richard J.; Glatzel, Pieter; Grosse-Kunstleve, Ralf W.; Latimer, Matthew J.; McQueen, Trevor A.; DiFiore, Dörte; Fry, Alan R.; Messerschmidt, Marc; Miahnahri, Alan; Schafer, Donald W.; Seibert, M. Marvin; Sokaras, Dimosthenis; Weng, Tsu-Chien; Zwart, Petrus H.; White, William E.; Adams, Paul D.; Bogan, Michael J.; Boutet, Sébastien; Williams, Garth J.; Messinger, Johannes; Sauter, Nicholas K.; Zouni, Athina; Bergmann, Uwe; Yano, Junko; Yachandra, Vittal K.

    2012-01-01

    Most of the dioxygen on earth is generated by the oxidation of water by photosystem II (PS II) using light from the sun. This light-driven, four-photon reaction is catalyzed by the Mn4CaO5 cluster located at the lumenal side of PS II. Various X-ray studies have been carried out at cryogenic temperatures to understand the intermediate steps involved in the water oxidation mechanism. However, the necessity for collecting data at room temperature, especially for studying the transient steps during the O–O bond formation, requires the development of new methodologies. In this paper we report room temperature X-ray diffraction data of PS II microcrystals obtained using ultrashort (< 50 fs) 9 keV X-ray pulses from a hard X-ray free electron laser, namely the Linac Coherent Light Source. The results presented here demonstrate that the ”probe before destroy” approach using an X-ray free electron laser works even for the highly-sensitive Mn4CaO5 cluster in PS II at room temperature. We show that these data are comparable to those obtained in synchrotron radiation studies as seen by the similarities in the overall structure of the helices, the protein subunits and the location of the various cofactors. This work is, therefore, an important step toward future studies for resolving the structure of the Mn4CaO5 cluster without any damage at room temperature, and of the reaction intermediates of PS II during O–O bond formation. PMID:22665786

  3. In situ X-ray diffraction studies on the piezoelectric response of PZT thin films

    Energy Technology Data Exchange (ETDEWEB)

    Davydok, A., E-mail: davydok@mpie.de [Aix Marseille Université, CNRS, Université de Toulon, IM2NP UMR 7334, 13397 Marseille (France); Max-Planck-Institut für Eisenforschung, Department Structure and Nano-/Micromechanics of Materials, D-40237 Düsseldorf (Germany); Cornelius, T.W. [Aix Marseille Université, CNRS, Université de Toulon, IM2NP UMR 7334, 13397 Marseille (France); Mocuta, C. [SOLEIL Synchrotron, DiffAbs beamline, L' Orme des Merisiers, Saint-Aubin - BP 48, 91192 Gif-sur-Yvette Cedex (France); Lima, E.C. [Universidade Federal do Tocantins, 77500-000 Porto Nacional, TO (Brazil); Araujo, E.B. [Departamento de Fisica e Quimica, Universidade Estadual Paulista, Av. Brasil, 56 Centro, 15385-000 Ilha Solteira, SP (Brazil); Thomas, O. [Aix Marseille Université, CNRS, Université de Toulon, IM2NP UMR 7334, 13397 Marseille (France)

    2016-03-31

    Piezoelectric properties of randomly oriented self-polarized PbZr{sub 0.50}Ti{sub 0.50}O{sub 3} (PZT) thin films were investigated using in situ synchrotron X-ray diffraction. Possibilities for investigating the piezoelectric effect using micro-sized hard X-ray beams are demonstrated and perspectives for future dynamical measurements on PZT samples with variety of compositions and thicknesses are given. Studies performed on the crystalline [100, 110] directions evidenced piezoelectric anisotropy. The piezoelectric coefficient d{sub 33} was calculated in terms of the lab reference frame (d{sub perp}) and found to be two times larger along the [100] direction than along the [110] direction. The absolute values for the d{sub perp} amount to 120 and 230 pm/V being in good agreement with experimental and theoretical values found in literature for bulk PZT ceramics. - Highlights: • We performed in situ synchrotron X-ray diffraction studies on (PZT) thin films. • We discuss anisotropy of piezo effect in different crystallographic directions. • Perpendicular component Piezo coefficient of thin PZT layer is defined.

  4. A standardless method of quantitative ceramic analysis using X-ray powder diffraction

    International Nuclear Information System (INIS)

    Mazumdar, S.

    1999-01-01

    A new procedure using X-ray powder diffraction data for quantitative estimation of the crystalline as well as the amorphous phase in ceramics is described. Classification of the crystalline and amorphous X-ray scattering was achieved by comparison of the slopes at two successive points of the powder pattern at scattering angles at which the crystalline and amorphous phases superimpose. If the second slope exceeds the first by a stipulated value, the intensity is taken as crystalline; otherwise the scattering is considered as amorphous. Crystalline phase analysis is obtained by linear programming techniques using the concept that each observed X-ray diffraction peak has contributions from n component phases, the proportionate analysis of which is required. The method does not require the measurement of calibration data for use as an internal standard, but knowledge of the approximate crystal structure of each phase of interest in the mixture is necessary. The technique is also helpful in qualitative analysis because each suspected phase is characterized by the probability that it will be present when a reflection zone is considered in which the suspected crystalline phase could contribute. The amorphous phases are determined prior to the crystalline ones. The method is applied to ceramic materials and some results are presented. (orig.)

  5. Investigation of electronic order using resonant soft X-ray diffraction

    International Nuclear Information System (INIS)

    Schlappa, J.

    2006-01-01

    The aim of this PhD work was the application of resonant soft X-ray diffraction technique for the investigation of electronic order in transition metal oxides at the TM L 2,3 -edge, trying to obtain a quantitative understanding of the data. The method was first systematically explored through application to a model system in order to test the feasibility of the technique and to understand of how X-ray optical effects have to be taken into account. Two more complex systems were investigated; stripe order in La 1.8 Sr 0.2 NiO 4 and charge and orbital order in Fe 3 O 4 . The main focus of the work was on the spectroscopic potential of the technique, trying to obtain a level of quantitative description of the data. For X-ray absorption spectroscopy (XAS) from transition metal oxides, cluster configuration interaction calculation provides a powerful and realistic microscopic theory. In the frame work of this thesis cluster theory, considering explicit hybridization effects between the TM-ion and the surrounding oxygen ligands, has been applied for the first time to describe resonant diffraction data. (orig.)

  6. Crystallization and preliminary X-ray diffraction experiments of arylmalonate decarboxylase from Alcaligenes bronchisepticus

    International Nuclear Information System (INIS)

    Nakasako, Masayoshi; Obata, Rika; Okubo, Ryosuke; Nakayama, Shyuichi; Miyamoto, Kenji; Ohta, Hiromichi

    2008-01-01

    Crystals of arylmalonate decarboxylase from A. bronchisepticus were obtained which diffracted X-rays to a resolution of at least 3.0 Å. Arylmalonate decarboxylase catalyses the enantioselective decarboxylation of α-aryl-α-methylmalonates to produce optically pure α-arylpropionates. The enzyme was crystallized with ammonium sulfate under alkaline pH conditions with the aim of understanding the mechanism of the enantioselective reaction. X-ray diffraction data collected to a resolution of 3.0 Å at cryogenic temperature showed that the crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 83.13, b = 99.62, c = 139.64 Å. This suggested that the asymmetric unit would contain between four and six molecules. Small-angle X-ray scattering revealed that the enzyme exists as a monomer in solution. Thus, the assembly of molecules in the asymmetric unit was likely to have been induced during the crystallization process

  7. Quantitative determination of minerals in Nevada Test Site samples by x-ray diffraction

    International Nuclear Information System (INIS)

    Pawloski, G.A.

    1983-07-01

    The external standard intensity ratio technique has been developed into a routine procedure for quantitatively determining mineralogic compositions of Nevada Test Site (NTS) samples by x-ray diffraction. This technique used ratios of x-ray intensity peaks from the same run which eliminates many possible errors. Constants have been determined for each of thirteen minerals commonly found in NTS samples - quartz, montmorillonite, illite, clinoptilolite, cristobalite, feldspars, calcite, dolomite, hornblende, kaolinite, muscovite, biotite, and amorphous glass. Ratios of the highest intensity peak of each mineral to be quantified in the sample and the highest intensity peak of quartz are used to calculate sample composition. The technique has been tested on samples with three to eleven components representative of geologic environments at NTS, and is accurate to 7.0 wt % of the total sample. The minimum amount of each of these minerals detectable by x-ray diffraction has also been determined. QUANTS is a computer code that calculates mineral contents and produces a report sheet. Constants for minerals in NTS samples other than those listed above can easily be determined, and added to QUANTS at any time

  8. A Graphene-Based Microfluidic Platform for Electrocrystallization and In Situ X-ray Diffraction

    Directory of Open Access Journals (Sweden)

    Shuo Sui

    2018-02-01

    Full Text Available Here, we describe a novel microfluidic platform for use in electrocrystallization experiments. The device incorporates ultra-thin graphene-based films as electrodes and as X-ray transparent windows to enable in situ X-ray diffraction analysis. Furthermore, large-area graphene films serve as a gas barrier, creating a stable sample environment over time. We characterize different methods for fabricating graphene electrodes, and validate the electrical capabilities of our device through the use of methyl viologen, a redox-sensitive dye. Proof-of-concept electrocrystallization experiments using an internal electric field at constant potential were performed using hen egg-white lysozyme (HEWL as a model system. We observed faster nucleation and crystal growth, as well as a higher signal-to-noise for diffraction data obtained from crystals prepared in the presence of an applied electric field. Although this work is focused on the electrocrystallization of proteins for structural biology, we anticipate that this technology should also find utility in a broad range of both X-ray technologies and other applications of microfluidic technology.

  9. Investigation of electronic order using resonant soft X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Schlappa, J.

    2006-12-01

    The aim of this PhD work was the application of resonant soft X-ray diffraction technique for the investigation of electronic order in transition metal oxides at the TM L{sub 2,3}-edge, trying to obtain a quantitative understanding of the data. The method was first systematically explored through application to a model system in order to test the feasibility of the technique and to understand of how X-ray optical effects have to be taken into account. Two more complex systems were investigated; stripe order in La{sub 1.8}Sr{sub 0.2}NiO{sub 4} and charge and orbital order in Fe{sub 3}O{sub 4}. The main focus of the work was on the spectroscopic potential of the technique, trying to obtain a level of quantitative description of the data. For X-ray absorption spectroscopy (XAS) from transition metal oxides, cluster configuration interaction calculation provides a powerful and realistic microscopic theory. In the frame work of this thesis cluster theory, considering explicit hybridization effects between the TM-ion and the surrounding oxygen ligands, has been applied for the first time to describe resonant diffraction data. (orig.)

  10. Electron density study of urea using TDS-corrected X-ray diffraction data: quantitative comparison of experimental theoretical results

    NARCIS (Netherlands)

    Zavodnik, Valery; Stash, Adam; Tsirelson, Vladimir; Feil, D.; de Vries, R.Y.; Feil, Dirk

    1999-01-01

    The electron-density distribution in urea, CO(NH2)2, was studied by high-precision single-crystal X-ray diffraction analysis at 148 (1) K. An experimental correction for TDS was applied to the X-ray intensities. Rmerge(F2) = 0.015. The displacement parameters agree quite well with results from

  11. Microelemental and mineral compositions of pathogenic biomineral concrements: SRXFA, X-ray powder diffraction and vibrational spectroscopy data

    Energy Technology Data Exchange (ETDEWEB)

    Moroz, T.N. [Institute of Geology and Mineralogy, SB RAS, Pr. Akad. Koptyuga, 3, 630090 Novosibirsk (Russian Federation)], E-mail: moroz@uiggm.nsc.ru; Palchik, N.A.; Dar' in, A.V. [Institute of Geology and Mineralogy, SB RAS, Pr. Akad. Koptyuga, 3, 630090 Novosibirsk (Russian Federation)

    2009-05-11

    X-ray fluorescence analysis using synchrotron radiation (SRXRF), X-ray powder diffraction, infrared and Raman spectroscopy had been applied for determination of microelemental and mineral composition of the kidney stones, gallstones and salivalities from natives of Novosibirsk and Novosibirsk region, Russia. The relationship between mineral, organic and microelemental composition of pathogenic calcilus was shown.

  12. Fig .1. X-ray diffraction (XRD) patterns of Ag2Se-G-TiO2 composites.

    Indian Academy of Sciences (India)

    32

    Abstract. The present work deals with the development of a new ternary composite, Ag2Se-G -TiO2, using ultrasonic techniques as well as X-ray diffraction (XRD), scanning electron microscopy (SEM), high transmission electron microscopy (HTEM), X-ray photoelectron spectroscopy (XPS),. Raman spectroscopy, and UV-vis ...

  13. Study of properties of chemically modified samples of halloysite mineral with X-ray fluorescence and X-ray powder diffraction methods

    International Nuclear Information System (INIS)

    Banaś, D.; Kubala-Kukuś, A.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.; Czech, K.; Garnuszek, M.; Słomkiewicz, P.; Szczepanik, B.

    2013-01-01

    Elemental and chemical composition of raw and activated samples of halloysite mineral using wavelength dispersive X-ray fluorescence (WDXRF), total reflection X-ray fluorescence (TXRF) and X-ray powder diffraction (XRPD) methods were determined. As the result, it has been shown that application of the complementary X-ray spectrometry techniques allows very precise observation of changes in composition of halloysite mineral samples caused by its chemical modifications. Sample preparation procedure and usability of the research methods applied are described in details. Procedure of activation of raw halloysite mineral samples by etching them in sulfuric acid of various concentrations has been described and discussed. The ability of the samples to adsorb lead from intentionally contaminated water was tested and confirmed. - Author-Highlights: • We measured elemental and chemical composition of raw and activated halloysite mineral samples. • We showed that X-ray techniques allow precise study of changes in the sample composition. • We describe procedure of activation of the samples by etching them in sulfuric acid. • We tested ability of halloysite mineral to absorb lead from contaminated water

  14. Time-resolved X-ray diffraction with accelerator- and laser-plasma-based X-ray sources

    Energy Technology Data Exchange (ETDEWEB)

    Nicoul, Matthieu

    2010-09-01

    Femtosecond X-ray pulses are a powerful tool to investigate atomic motions triggered by femtosecond pump pulses. This thesis is dedicated to the production of such pulses and their use in optical pump - X-ray probe measurement. This thesis describes the laser-plasma-based sources available at the University of Duisburg-Essen. Part of it consists of the description of the design, built-up and characterization of a new ''modular'' X-ray source dedicated to optimize the X-ray flux onto the sample under investigation. The acoustic wave generation in femtosecond optically excited semiconductor (gallium arsenide) and metal (gold) was performed using the sources of the University of Duisburg-Essen. The physical answer of the material was modeled by a simple strain model for the semiconductor, pressure model for the metal, in order to gain information on the interplay of the electronic and thermal pressures rising after excitation. Whereas no reliable information could be obtain in gallium arsenide (principally due to the use of a bulk), the model for gold achieved very good agreement, providing useful information. The relaxation time of the electron to lattice energy was found to be (5.0{+-}0.3) ps, and the ratio of the Grueneisen parameters was found to be {gamma}{sub e} / {gamma}{sub i} = (0.5{+-}0.1). This thesis also describes the Sub-Picosecond Pulse Source (SPPS) which existed at the (formally) Stanford Linear Accelerator Center, an accelerator-based X-ray source, and two measurements performed with it. The first one is the detailed investigation of the phonon softening of the A{sub 1g} mode launch in bismuth upon fluence excitation. Detailed information concerning the new equilibrium position and phonon frequency were obtained over extended laser pump fluences. The second measurement concerned the study of the liquid phase dynamics in a newly formed liquid phase following ultrafast melting in indium antimonide. The formation of the liquid phase

  15. Time-resolved X-ray diffraction with accelerator- and laser-plasma-based X-ray sources

    International Nuclear Information System (INIS)

    Nicoul, Matthieu

    2010-01-01

    Femtosecond X-ray pulses are a powerful tool to investigate atomic motions triggered by femtosecond pump pulses. This thesis is dedicated to the production of such pulses and their use in optical pump - X-ray probe measurement. This thesis describes the laser-plasma-based sources available at the University of Duisburg-Essen. Part of it consists of the description of the design, built-up and characterization of a new ''modular'' X-ray source dedicated to optimize the X-ray flux onto the sample under investigation. The acoustic wave generation in femtosecond optically excited semiconductor (gallium arsenide) and metal (gold) was performed using the sources of the University of Duisburg-Essen. The physical answer of the material was modeled by a simple strain model for the semiconductor, pressure model for the metal, in order to gain information on the interplay of the electronic and thermal pressures rising after excitation. Whereas no reliable information could be obtain in gallium arsenide (principally due to the use of a bulk), the model for gold achieved very good agreement, providing useful information. The relaxation time of the electron to lattice energy was found to be (5.0±0.3) ps, and the ratio of the Grueneisen parameters was found to be γ e / γ i = (0.5±0.1). This thesis also describes the Sub-Picosecond Pulse Source (SPPS) which existed at the (formally) Stanford Linear Accelerator Center, an accelerator-based X-ray source, and two measurements performed with it. The first one is the detailed investigation of the phonon softening of the A 1g mode launch in bismuth upon fluence excitation. Detailed information concerning the new equilibrium position and phonon frequency were obtained over extended laser pump fluences. The second measurement concerned the study of the liquid phase dynamics in a newly formed liquid phase following ultrafast melting in indium antimonide. The formation of the liquid phase and its development for excitations close to the

  16. In situ X-ray diffraction studies of (de)lithiation mechanism in silicon nanowire anodes.

    Science.gov (United States)

    Misra, Sumohan; Liu, Nian; Nelson, Johanna; Hong, Seung Sae; Cui, Yi; Toney, Michael F

    2012-06-26

    Silicon is a promising anode material for Li-ion batteries due to its high theoretical specific capacity. From previous work, silicon nanowires (SiNWs) are known to undergo amorphorization during lithiation, and no crystalline Li-Si product has been observed. In this work, we use an X-ray transparent battery cell to perform in situ synchrotron X-ray diffraction on SiNWs in real time during electrochemical cycling. At deep lithiation voltages the known metastable Li(15)Si(4) phase forms, and we show that avoiding the formation of this phase, by modifying the SiNW growth temperature, improves the cycling performance of SiNW anodes. Our results provide insight on the (de)lithiation mechanism and a correlation between phase evolution and electrochemical performance for SiNW anodes.

  17. Structural and microstructural characterization of U3Si2 nuclear fuel using X-ray diffraction

    International Nuclear Information System (INIS)

    Ichikawa, Rodrigo U.; Garcia, Rafael H.L.; Silva, Andre S.B. da; Saliba-Silva, Adonis M.; Lima, Nelson B.; Martinez, Luis G.; Turrillas, Xavier

    2017-01-01

    In this work, two uranium silicide powdered samples, containing 67% and 42 mol% of Si, were analyzed using X-ray diffraction (named as 67 Si and 42 Si). For structural characterization, Rietveld refinement was used to estimate cell parameters, volume fraction (weight percent) of crystalline phases and atomic positions. For the main phases, X-ray line profile analysis (XLPA) was used to estimate mean crystallite sizes and micro strains. The 67 Si sample presents higher content of USi 2( tetragonal) and the 42 Si sample presents higher content of U 3 Si 2 (tetragonal) as identified and calculated from the XRD profiles. Overall there are no appreciable structural changes and the parameters refined are in good accordance with the ones reported in the literature. Mean crystallite sizes determined by XLPA revealed small crystallites of the order of 10 1 nm and low micro strain for all samples. (author)

  18. Reactor for nano-focused x-ray diffraction and imaging under catalytic in situ conditions

    Science.gov (United States)

    Richard, M.-I.; Fernández, S.; Hofmann, J. P.; Gao, L.; Chahine, G. A.; Leake, S. J.; Djazouli, H.; De Bortoli, Y.; Petit, L.; Boesecke, P.; Labat, S.; Hensen, E. J. M.; Thomas, O.; Schülli, T.

    2017-09-01

    A reactor cell for in situ studies of individual catalyst nanoparticles or surfaces by nano-focused (coherent) x-ray diffraction has been developed. Catalytic reactions can be studied in flow mode in a pressure range of 10-2-103 mbar and temperatures up to 900 °C. This instrument bridges the pressure and materials gap at the same time within one experimental setup. It allows us to probe in situ the structure (e.g., shape, size, strain, faceting, composition, and defects) of individual nanoparticles using a nano-focused x-ray beam. Here, the setup was used to observe strain and facet evolution of individual model Pt catalysts during in situ experiments. It can be used for heating other (non-catalytically active) nanoparticles (e.g., nanowires) in inert or reactive gas atmospheres or vacuum as well.

  19. Automated high pressure cell for pressure jump x-ray diffraction

    International Nuclear Information System (INIS)

    Brooks, Nicholas J.; Gauthe, Beatrice L. L. E.; Templer, Richard H.; Ces, Oscar; Seddon, John M.; Terrill, Nick J.; Rogers, Sarah E.

    2010-01-01

    A high pressure cell for small and wide-angle x-ray diffraction measurements of soft condensed matter samples has been developed, incorporating a fully automated pressure generating network. The system allows both static and pressure jump measurements in the range of 0.1-500 MPa. Pressure jumps can be performed as quickly as 5 ms, both with increasing and decreasing pressures. Pressure is generated by a motorized high pressure pump, and the system is controlled remotely via a graphical user interface to allow operation by a broad user base, many of whom may have little previous experience of high pressure technology. Samples are loaded through a dedicated port allowing the x-ray windows to remain in place throughout an experiment; this facilitates accurate subtraction of background scattering. The system has been designed specifically for use at beamline I22 at the Diamond Light Source, United Kingdom, and has been fully integrated with the I22 beamline control systems.

  20. Source assemblage types for cratonic diamonds from X-ray synchrotron diffraction

    Science.gov (United States)

    Nestola, F.; Alvaro, M.; Casati, M. N.; Wilhelm, H.; Kleppe, A. K.; Jephcoat, A. P.; Domeneghetti, M. C.; Harris, J. W.

    2016-11-01

    Three single crystals of clinopyroxene trapped within three different gem-quality diamonds from the Udachnaya kimberlite (Siberia, Russia) were analysed in situ by single-crystal synchrotron X-ray diffraction in order to obtain information on their chemical composition and infer source assemblage type. A non-destructive approach was used with high-energy (≈ 60 keV; λ ≈ 0.206 Å) at I15, the extreme-conditions beamline at Diamond Light Source. A dedicated protocol was used to center the mineral inclusions located deep inside the diamonds in the X-ray beam. Our results reveal that two of the inclusions can be associated with peridotitic paragenesis whereas the third is eclogitic. This study also demonstrates that this non-destructive experimental approach is extremely efficient in evaluating the origin of minerals trapped in their diamond hosts.

  1. RASOR: an advanced instrument for soft x-ray reflectivity and diffraction.

    Science.gov (United States)

    Beale, T A W; Hase, T P A; Iida, T; Endo, K; Steadman, P; Marshall, A R; Dhesi, S S; van der Laan, G; Hatton, P D

    2010-07-01

    We report the design and construction of a novel soft x-ray diffractometer installed at Diamond Light Source. The beamline endstation RASOR is constructed for general users and designed primarily for the study of single crystal diffraction and thin film reflectivity. The instrument is comprised of a limited three circle (theta, 2theta, and chi) diffractometer with an additional removable rotation (phi) stage. It is equipped with a liquid helium cryostat, and post-scatter polarization analysis. Motorized motions are provided for the precise positioning of the sample onto the diffractometer center of rotation, and for positioning the center of rotation onto the x-ray beam. The functions of the instrument have been tested at Diamond Light Source, and initial test measurements are provided, demonstrating the potential of the instrument.

  2. Automated high pressure cell for pressure jump x-ray diffraction.

    Science.gov (United States)

    Brooks, Nicholas J; Gauthe, Beatrice L L E; Terrill, Nick J; Rogers, Sarah E; Templer, Richard H; Ces, Oscar; Seddon, John M

    2010-06-01

    A high pressure cell for small and wide-angle x-ray diffraction measurements of soft condensed matter samples has been developed, incorporating a fully automated pressure generating network. The system allows both static and pressure jump measurements in the range of 0.1-500 MPa. Pressure jumps can be performed as quickly as 5 ms, both with increasing and decreasing pressures. Pressure is generated by a motorized high pressure pump, and the system is controlled remotely via a graphical user interface to allow operation by a broad user base, many of whom may have little previous experience of high pressure technology. Samples are loaded through a dedicated port allowing the x-ray windows to remain in place throughout an experiment; this facilitates accurate subtraction of background scattering. The system has been designed specifically for use at beamline I22 at the Diamond Light Source, United Kingdom, and has been fully integrated with the I22 beamline control systems.

  3. X-ray Diffraction Results from Mars Science Laboratory: Mineralogy of Rocknest at Gale Crater

    Science.gov (United States)

    Bish, D. L.; Blake, D. F.; Vaniman, D. T.; Chipera, S. J.; Morris, R. V.; Ming, D. W.; Treiman, A. H.; Sarrazin, P.; Morrison, S. M.; Downs, R. T.; Achilles, C. N.; Yen, A. S.; Bristow, T. F.; Crisp, J. A.; Morookian, J. M.; Farmer, J. D.; Rampe, E. B.; Stolper, E. M.; Spanovich, N.; Achilles, Cherie; Agard, Christophe; Verdasca, José Alexandre Alves; Anderson, Robert; Anderson, Ryan; Archer, Doug; Armiens-Aparicio, Carlos; Arvidson, Ray; Atlaskin, Evgeny; Atreya, Sushil; Aubrey, Andrew; Baker, Burt; Baker, Michael; Balic-Zunic, Tonci; Baratoux, David; Baroukh, Julien; Barraclough, Bruce; Bean, Keri; Beegle, Luther; Behar, Alberto; Bell, James; Bender, Steve; Benna, Mehdi; Bentz, Jennifer; Berger, Gilles; Berger, Jeff; Berman, Daniel; Bish, David; Blake, David F.; Avalos, Juan J. Blanco; Blaney, Diana; Blank, Jen; Blau, Hannah; Bleacher, Lora; Boehm, Eckart; Botta, Oliver; Böttcher, Stephan; Boucher, Thomas; Bower, Hannah; Boyd, Nick; Boynton, Bill; Breves, Elly; Bridges, John; Bridges, Nathan; Brinckerhoff, William; Brinza, David; Bristow, Thomas; Brunet, Claude; Brunner, Anna; Brunner, Will; Buch, Arnaud; Bullock, Mark; Burmeister, Sönke; Cabane, Michel; Calef, Fred; Cameron, James; Campbell, John "Iain"; Cantor, Bruce; Caplinger, Michael; Rodríguez, Javier Caride; Carmosino, Marco; Blázquez, Isaías Carrasco; Charpentier, Antoine; Chipera, Steve; Choi, David; Clark, Benton; Clegg, Sam; Cleghorn, Timothy; Cloutis, Ed; Cody, George; Coll, Patrice; Conrad, Pamela; Coscia, David; Cousin, Agnès; Cremers, David; Crisp, Joy; Cros, Alain; Cucinotta, Frank; d'Uston, Claude; Davis, Scott; Day, Mackenzie "Kenzie"; Juarez, Manuel de la Torre; DeFlores, Lauren; DeLapp, Dorothea; DeMarines, Julia; DesMarais, David; Dietrich, William; Dingler, Robert; Donny, Christophe; Downs, Bob; Drake, Darrell; Dromart, Gilles; Dupont, Audrey; Duston, Brian; Dworkin, Jason; Dyar, M. Darby; Edgar, Lauren; Edgett, Kenneth; Edwards, Christopher; Edwards, Laurence; Ehlmann, Bethany; Ehresmann, Bent; Eigenbrode, Jen; Elliott, Beverley; Elliott, Harvey; Ewing, Ryan; Fabre, Cécile; Fairén, Alberto; Farley, Ken; Farmer, Jack; Fassett, Caleb; Favot, Laurent; Fay, Donald; Fedosov, Fedor; Feldman, Jason; Feldman, Sabrina; Fisk, Marty; Fitzgibbon, Mike; Flesch, Greg; Floyd, Melissa; Flückiger, Lorenzo; Forni, Olivier; Fraeman, Abby; Francis, Raymond; François, Pascaline; Franz, Heather; Freissinet, Caroline; French, Katherine Louise; Frydenvang, Jens; Gaboriaud, Alain; Gailhanou, Marc; Garvin, James; Gasnault, Olivier; Geffroy, Claude; Gellert, Ralf; Genzer, Maria; Glavin, Daniel; Godber, Austin; Goesmann, Fred; Goetz, Walter; Golovin, Dmitry; Gómez, Felipe Gómez; Gómez-Elvira, Javier; Gondet, Brigitte; Gordon, Suzanne; Gorevan, Stephen; Grant, John; Griffes, Jennifer; Grinspoon, David; Grotzinger, John; Guillemot, Philippe; Guo, Jingnan; Gupta, Sanjeev; Guzewich, Scott; Haberle, Robert; Halleaux, Douglas; Hallet, Bernard; Hamilton, Vicky; Hardgrove, Craig; Harker, David; Harpold, Daniel; Harri, Ari-Matti; Harshman, Karl; Hassler, Donald; Haukka, Harri; Hayes, Alex; Herkenhoff, Ken; Herrera, Paul; Hettrich, Sebastian; Heydari, Ezat; Hipkin, Victoria; Hoehler, Tori; Hollingsworth, Jeff; Hudgins, Judy; Huntress, Wesley; Hurowitz, Joel; Hviid, Stubbe; Iagnemma, Karl; Indyk, Steve; Israël, Guy; Jackson, Ryan; Jacob, Samantha; Jakosky, Bruce; Jensen, Elsa; Jensen, Jaqueline Kløvgaard; Johnson, Jeffrey; Johnson, Micah; Johnstone, Steve; Jones, Andrea; Jones, John; Joseph, Jonathan; Jun, Insoo; Kah, Linda; Kahanpää, Henrik; Kahre, Melinda; Karpushkina, Natalya; Kasprzak, Wayne; Kauhanen, Janne; Keely, Leslie; Kemppinen, Osku; Keymeulen, Didier; Kim, Myung-Hee; Kinch, Kjartan; King, Penny; Kirkland, Laurel; Kocurek, Gary; Koefoed, Asmus; Köhler, Jan; Kortmann, Onno; Kozyrev, Alexander; Krezoski, Jill; Krysak, Daniel; Kuzmin, Ruslan; Lacour, Jean Luc; Lafaille, Vivian; Langevin, Yves; Lanza, Nina; Lasue, Jeremie; Le Mouélic, Stéphane; Lee, Ella Mae; Lee, Qiu-Mei; Lees, David; Lefavor, Matthew; Lemmon, Mark; Malvitte, Alain Lepinette; Leshin, Laurie; Léveillé, Richard; Lewin-Carpintier, Éric; Lewis, Kevin; Li, Shuai; Lipkaman, Leslie; Little, Cynthia; Litvak, Maxim; Lorigny, Eric; Lugmair, Guenter; Lundberg, Angela; Lyness, Eric; Madsen, Morten; Mahaffy, Paul; Maki, Justin; Malakhov, Alexey; Malespin, Charles; Malin, Michael; Mangold, Nicolas; Manhes, Gérard; Manning, Heidi; Marchand, Geneviève; Jiménez, Mercedes Marín; García, César Martín; Martin, Dave; Martin, Mildred; Martínez-Frías, Jesús; Martín-Soler, Javier; Martín-Torres, F. Javier; Mauchien, Patrick; Maurice, Sylvestre; McAdam, Amy; McCartney, Elaina; McConnochie, Timothy; McCullough, Emily; McEwan, Ian; McKay, Christopher; McLennan, Scott; McNair, Sean; Melikechi, Noureddine; Meslin, Pierre-Yves; Meyer, Michael; Mezzacappa, Alissa; Miller, Hayden; Miller, Kristen; Milliken, Ralph; Ming, Douglas; Minitti, Michelle; Mischna, Michael; Mitrofanov, Igor; Moersch, Jeff; Mokrousov, Maxim; Jurado, Antonio Molina; Moores, John; Mora-Sotomayor, Luis; Morookian, John Michael; Morris, Richard; Morrison, Shaunna; Mueller-Mellin, Reinhold; Muller, Jan-Peter; Caro, Guillermo Muñoz; Nachon, Marion; López, Sara Navarro; Navarro-González, Rafael; Nealson, Kenneth; Nefian, Ara; Nelson, Tony; Newcombe, Megan; Newman, Claire; Newsom, Horton; Nikiforov, Sergey; Niles, Paul; Nixon, Brian; Dobrea, Eldar Noe; Nolan, Thomas; Oehler, Dorothy; Ollila, Ann; Olson, Timothy; Owen, Tobias; Hernández, Miguel Ángel de Pablo; Paillet, Alexis; Pallier, Etienne; Palucis, Marisa; Parker, Timothy; Parot, Yann; Patel, Kiran; Paton, Mark; Paulsen, Gale; Pavlov, Alex; Pavri, Betina; Peinado-González, Verónica; Pepin, Robert; Peret, Laurent; Perez, Rene; Perrett, Glynis; Peterson, Joe; Pilorget, Cedric; Pinet, Patrick; Pla-García, Jorge; Plante, Ianik; Poitrasson, Franck; Polkko, Jouni; Popa, Radu; Posiolova, Liliya; Posner, Arik; Pradler, Irina; Prats, Benito; Prokhorov, Vasily; Purdy, Sharon Wilson; Raaen, Eric; Radziemski, Leon; Rafkin, Scot; Ramos, Miguel; Rampe, Elizabeth; Raulin, François; Ravine, Michael; Reitz, Günther; Rennó, Nilton; Rice, Melissa; Richardson, Mark; Robert, François; Robertson, Kevin; Manfredi, José Antonio Rodriguez; Romeral-Planelló, Julio J.; Rowland, Scott; Rubin, David; Saccoccio, Muriel; Salamon, Andrew; Sandoval, Jennifer; Sanin, Anton; Fuentes, Sara Alejandra Sans; Saper, Lee; Sarrazin, Philippe; Sautter, Violaine; Savijärvi, Hannu; Schieber, Juergen; Schmidt, Mariek; Schmidt, Walter; Scholes, Daniel "Dan"; Schoppers, Marcel; Schröder, Susanne; Schwenzer, Susanne; Martinez, Eduardo Sebastian; Sengstacken, Aaron; Shterts, Ruslan; Siebach, Kirsten; Siili, Tero; Simmonds, Jeff; Sirven, Jean-Baptiste; Slavney, Susie; Sletten, Ronald; Smith, Michael; Sánchez, Pablo Sobrón; Spanovich, Nicole; Spray, John; Squyres, Steven; Stack, Katie; Stalport, Fabien; Steele, Andrew; Stein, Thomas; Stern, Jennifer; Stewart, Noel; Stipp, Susan Louise Svane; Stoiber, Kevin; Stolper, Ed; Sucharski, Bob; Sullivan, Rob; Summons, Roger; Sumner, Dawn; Sun, Vivian; Supulver, Kimberley; Sutter, Brad; Szopa, Cyril; Tan, Florence; Tate, Christopher; Teinturier, Samuel; ten Kate, Inge; Thomas, Peter; Thompson, Lucy; Tokar, Robert; Toplis, Mike; Redondo, Josefina Torres; Trainer, Melissa; Treiman, Allan; Tretyakov, Vladislav; Urqui-O'Callaghan, Roser; Van Beek, Jason; Van Beek, Tessa; VanBommel, Scott; Vaniman, David; Varenikov, Alexey; Vasavada, Ashwin; Vasconcelos, Paulo; Vicenzi, Edward; Vostrukhin, Andrey; Voytek, Mary; Wadhwa, Meenakshi; Ward, Jennifer; Webster, Chris; Weigle, Eddie; Wellington, Danika; Westall, Frances; Wiens, Roger Craig; Wilhelm, Mary Beth; Williams, Amy; Williams, Joshua; Williams, Rebecca; Williams, Richard B. "Mouser"; Wilson, Mike; Wimmer-Schweingruber, Robert; Wolff, Mike; Wong, Mike; Wray, James; Wu, Megan; Yana, Charles; Yen, Albert; Yingst, Aileen; Zeitlin, Cary; Zimdar, Robert; Mier, María-Paz Zorzano

    2013-09-01

    The Mars Science Laboratory rover Curiosity scooped samples of soil from the Rocknest aeolian bedform in Gale crater. Analysis of the soil with the Chemistry and Mineralogy (CheMin) x-ray diffraction (XRD) instrument revealed plagioclase (~An57), forsteritic olivine (~Fo62), augite, and pigeonite, with minor K-feldspar, magnetite, quartz, anhydrite, hematite, and ilmenite. The minor phases are present at, or near, detection limits. The soil also contains 27 ± 14 weight percent x-ray amorphous material, likely containing multiple Fe3+- and volatile-bearing phases, including possibly a substance resembling hisingerite. The crystalline component is similar to the normative mineralogy of certain basaltic rocks from Gusev crater on Mars and of martian basaltic meteorites. The amorphous component is similar to that found on Earth in places such as soils on the Mauna Kea volcano, Hawaii.

  4. Refraction angle and edge visibility in X-ray diffraction enhanced imaging

    International Nuclear Information System (INIS)

    Chen Yu; Jia Quanjie; Li Gang; Wang Yuzhu; Xue Xianying; Jiang Xiaoming

    2007-01-01

    Diffraction-enhanced X-ray imaging could extract accurately the refraction angles of the sample, which is very important to increase the image contrast of low Z samples. In this paper, the DEI experiments with X-rays of different energies were performed both on wedge-shaped and rounded model samples. Refraction angles of the two samples were all obtained accurately, and the results agreed well with the calculations. Quantitative analyses based on Edge Visibility were performed for the wedge-shaped model sample. The results revealed that the calculated positions for the Best Edge Visibility of the slope with fixed refraction angle were calculable in good agreement with the experimental results. A quantitative research on the Edge Visibility of real tissues sample was carried out and the optimal condition for best contrast of DEI images were discussed. (authors)

  5. PIXE and X-ray diffraction studies in ceramics of the Cuitzeo basin

    International Nuclear Information System (INIS)

    Bucio, L.; Ruvalcaba, J.L.; Filini, A.

    2005-01-01

    The methodology used to carry out the characterization of the ceramic material is based on the employment of two analytical techniques. The first one, X-ray diffraction (XRD), it is used to determine the composition of the present minerals and the general composition of the pastes. The second, X-ray emission induced by protons (PIXE), it is used to determine the composition of trace elements and bigger elements. The combined use of these techniques even allows to differ among ceramic pastes of very similar compositions. Although these techniques can be used in a non destructive way, in the case of ceramic studies it is required of taking a small quantity of sample of the potsherd, this is pulverized to homogenize the material and to carry out the XRD analysis. The same powder can be used to prepare a pellet and to carry out the PIXE analysis. (Author)

  6. In Situ X-ray Diffraction Studies of (De)lithiation Mechanism in Silicon Nanowire Anodes

    KAUST Repository

    Misra, Sumohan

    2012-06-26

    Figure Persented: Silicon is a promising anode material for Li-ion batteries due to its high theoretical specific capacity. From previous work, silicon nanowires (SiNWs) are known to undergo amorphorization during lithiation, and no crystalline Li-Si product has been observed. In this work, we use an X-ray transparent battery cell to perform in situ synchrotron X-ray diffraction on SiNWs in real time during electrochemical cycling. At deep lithiation voltages the known metastable Li 15Si 4 phase forms, and we show that avoiding the formation of this phase, by modifying the SiNW growth temperature, improves the cycling performance of SiNW anodes. Our results provide insight on the (de)lithiation mechanism and a correlation between phase evolution and electrochemical performance for SiNW anodes. © 2012 American Chemical Society.

  7. Investigating stacking faults in nonpolar gallium nitride films using X-ray diffraction

    International Nuclear Information System (INIS)

    Moram, M.A.; Johnston, C.F.; Kappers, M.J.; Humphreys, C.J.

    2009-01-01

    Nonpolar (11-20) GaN films with different basal-plane stacking fault (BSF) densities (determined using transmission electron microscopy) were investigated using X-ray diffraction. Diffuse streaking from I 1 and I 2 BSFs was observed in reciprocal space maps of the 10-10 and 20-20 reflections. X-ray calibration curves for BSF density determination can be plotted using the diffusely scattered intensity of open detector 10-10 or 20-20 ω-scans measured at a fixed, large separation from the peak maximum. However, ab initio determination of stacking fault densities is not possible due to additional broadening from other defects. Similarly, ω-scan peak widths are poor indicators of BSF densities.

  8. Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

    Science.gov (United States)

    Leal, Ricardo M F; Callow, Shirley; Callow, Phil; Blakeley, Matthew P; Cardin, Christine J; Denny, William A; Teixeira, Susana C M; Mitchell, Edward P; Forsyth, V Trevor

    2010-11-01

    Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

  9. X-ray diffraction during study of short-range order in amorphous alloys (Review)

    International Nuclear Information System (INIS)

    Shelekhov, E.V.; Skakov, Yu.A.

    1988-01-01

    Conditions for amorphous solidification of metallic system many alloys have been investigated and material compositions with peculiar set of properties have been chosen due to the intensive researches, conducted recently. Amorphous alloys, which combine magnetically soft properties with high wear resistance, are used more extensively among these materials. Analysis of X-ray diffuse scattering by amorphous alloys, using diffractometer, is more available and popular in spite of the presence of energy-dispersion method and neutron diffraction analysis. It should be noted, that low-cost isotopes with neutrons scattering amplitude, which differs essentially from that of their natural mixture, do not exist for all these elements. That is why, it is necessary to use X-ray diffractometry to separate distribution partial functions as well

  10. X-Ray Diffraction Study of Plasma Exposed and Annealed AlSb Bilayer Thin Film

    International Nuclear Information System (INIS)

    Kareem, T. Abdul; Kaliani, A. Anu

    2013-01-01

    Aluminum antimony seems to be a promising semiconducting material for high temperature applications, especially for transistors and P-N junction diodes. Additionally, it is a highly efficient solar material. This paper discusses the plasma induced bilayer diffusion of AlSb bilayer thin films using X-ray diffractogram. AlSb bilayer thin films were prepared on a glass substrate by vacuum evaporation technique. The effect of plasma exposure time and annealing temperature on the micro-structural parameters were investigated. X-ray diffraction studies show that the cubic crystals of Al orient along the (111) plane and the hexagonal crystals of Sb orient along the (003) plane. Newly formed cubic crystals of AlSb are oriented along the (200) plane and they are formed due to the simultaneous growth of Al and Sb crystals during plasma exposure. (plasma technology)

  11. Characterization of AlGaInN layers using X-ray diffraction and fluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Groh, Lars; Hums, Christoph; Blaesing, Juergen; Krost, Alois; Dadgar, Armin [Institute of Experimental Physics, Otto-von-Guericke-Universitaet Magdeburg, Universitaetsplatz 2, 39106 Magdeburg (Germany)

    2011-03-15

    Quantum well structures for nitride-based LEDs are mainly grown in c-direction, whereby the quantum confined Stark-effect (QCSE) reduces the overlap of the electron and hole wave function and with it the internal quantum efficiency. The reason for that is the difference in polarization of the quantum well and barrier materials. In order to balance these polarizations, quaternary (AlGaIn)N layers for the later use as barrier material have been grown. In addition to the bandgap energy, another parameter, the polarization, can be controlled in this way. As a standard characterization method X-ray diffraction measurements have been performed. Due to the impossibility of fully determining the composition using this method, total reflection X-ray-fluorescence (TXRF) has been used to get the missing information. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. Probing local order in glasses from limited-volume electron and x-ray diffraction

    Science.gov (United States)

    Liu, A. C. Y.; Tabor, R. F.; Bourgeois, L.; de Jonge, M. D.; Mudie, S. T.; Petersen, T. C.

    2016-05-01

    It has long been recognised that spatial fluctuations in local order in disordered assemblies of particles can be probed using limited-volume diffraction measurements. These measurements have unique advantages over broad-beam diffraction experiments that isotropically average over many structural configurations and result in one-dimensional intensity curves, requiring modelling to interpret. Despite the advantages of limiting illumination to a low number of particle configurations, obtaining quantitative measurements of local order from such experiments remains a challenge. The effects on the diffraction pattern of changing the beam energy, lateral size, aberrations and coherence and the specimen thickness have only recently been clarified. We review theoretical and experimental efforts in this direction in the fields of both electron and x-ray diffraction and identify promising areas of future development.

  13. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    International Nuclear Information System (INIS)

    Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.; Vo, Huy; Uervirojnangkoorn, Monarin; Brunger, Axel T.; Berger, James M.

    2015-01-01

    A highly X-ray-transparent, silicon nitride-based device has been designed and fabricated to harvest protein microcrystals for high-resolution X-ray diffraction data collection using microfocus beamlines and XFELs. Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called ‘fixed-target’ sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs

  14. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    Energy Technology Data Exchange (ETDEWEB)

    Murray, Thomas D. [University of California, Berkeley, CA 94720 (United States); Johns Hopkins University School of Medicine, Baltimore, MD 21205 (United States); Lyubimov, Artem Y. [Stanford University, Stanford, CA 94305 (United States); Ogata, Craig M. [Argonne National Laboratory, Argonne, IL 60439 (United States); Vo, Huy [Johns Hopkins University, Baltimore, MD 21205 (United States); Uervirojnangkoorn, Monarin; Brunger, Axel T., E-mail: brunger@stanford.edu [Stanford University, Stanford, CA 94305 (United States); Berger, James M., E-mail: brunger@stanford.edu [Johns Hopkins University School of Medicine, Baltimore, MD 21205 (United States); University of California, Berkeley, CA 94720 (United States)

    2015-09-26

    A highly X-ray-transparent, silicon nitride-based device has been designed and fabricated to harvest protein microcrystals for high-resolution X-ray diffraction data collection using microfocus beamlines and XFELs. Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called ‘fixed-target’ sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.

  15. Calculated efficiencies of three-material low stress coatings for diffractive x-ray transmission optics

    International Nuclear Information System (INIS)

    Kubec, Adam; Braun, Stefan; Gawlitza, Peter; Menzel, Maik; Leson, Andreas

    2016-01-01

    Diffractive X-ray optical elements made by thin film coating techniques such as multilayer Laue lenses (MLL) and multilayer zone plates (MZP) are promising approaches to achieve resolutions in hard X-ray microscopy applications of less than 10 nm. The challenge is to make a lens with a large numerical aperture on the one hand and a decent working distance on the other hand. One of the limiting factors with the coated structures is the internal stress in the films, which can lead to significant bending of the substrate and various types of unwanted diffraction effects. Several approaches have been discussed to overcome this challenge. One of these is a three-material combination such as Mo/MoSi 2 /Si, where four single layers per period are deposited. Mo and Si represent the absorber and spacer in this case while MoSi 2 forms a diffusion barrier; in addition the thicknesses of absorber and spacer are chosen to minimize residual stress of the overall coating. Here the diffraction efficiency as well as the profile of the beam in the focal plane are discussed in order to find a tradeoff between lowest residual stress and best diffraction properties.

  16. Calculated efficiencies of three-material low stress coatings for diffractive x-ray transmission optics

    Energy Technology Data Exchange (ETDEWEB)

    Kubec, Adam, E-mail: adam.kubec@iws.fraunhofer.de; Braun, Stefan; Gawlitza, Peter; Menzel, Maik; Leson, Andreas [Fraunhofer IWS Dresden, Winterbergstr. 28, 01277 Dresden (Germany)

    2016-07-27

    Diffractive X-ray optical elements made by thin film coating techniques such as multilayer Laue lenses (MLL) and multilayer zone plates (MZP) are promising approaches to achieve resolutions in hard X-ray microscopy applications of less than 10 nm. The challenge is to make a lens with a large numerical aperture on the one hand and a decent working distance on the other hand. One of the limiting factors with the coated structures is the internal stress in the films, which can lead to significant bending of the substrate and various types of unwanted diffraction effects. Several approaches have been discussed to overcome this challenge. One of these is a three-material combination such as Mo/MoSi{sub 2}/Si, where four single layers per period are deposited. Mo and Si represent the absorber and spacer in this case while MoSi{sub 2} forms a diffusion barrier; in addition the thicknesses of absorber and spacer are chosen to minimize residual stress of the overall coating. Here the diffraction efficiency as well as the profile of the beam in the focal plane are discussed in order to find a tradeoff between lowest residual stress and best diffraction properties.

  17. Revisit of alpha-chitin crystal structure using high resolution X-ray diffraction data.

    Science.gov (United States)

    Sikorski, Pawel; Hori, Ritsuko; Wada, Masahisa

    2009-05-11

    High resolution synchrotron X-ray fiber diffraction data recorded from crab tendon chitin have been used to describe the crystal structure of alpha-chitin. Crystal structures at 100 and 300 K have been solved using restrained crystallographic refinement against diffraction intensities measured from the fiber diffraction patterns. The unit cell contains two polymer chains in a 2(1) helix conformation and in the antiparallel orientation. The best agreement between predicated and observed X-ray diffraction intensities is obtained for a model that includes two distinctive conformations of C6-O6 hydroxymethl group. Those conformations are different from what is proposed in the generally accepted alpha-chitin crystal structure (J. Mol. Biol. 1978, 120, 167-181). Based on refined positions of the O6 atoms, a network of hydrogen bonds involving O6 is proposed. This network of hydrogen bonds can explain the main features of the polarized FTIR spectra of alpha-chitin and sheds some light on the origin of splitting of the amide I band observed on alpha-chitin IR spectra.

  18. Improved X-ray diffraction from Bacillus megaterium penicillin G acylase crystals through long cryosoaking dehydration

    International Nuclear Information System (INIS)

    Rojviriya, Catleya; Pratumrat, Thunyaluck; Saper, Mark A.; Yuvaniyama, Jirundon

    2011-01-01

    Penicillin G acylase from the Gram-positive bacterium B. megaterium was crystallized and X-ray diffraction from these crystals could be substantially improved by slight dehydration through a long cryo-soak. Penicillin G acylase from Bacillus megaterium (BmPGA) is currently used in the pharmaceutical industry as an alternative to PGA from Escherichia coli (EcPGA) for the hydrolysis of penicillin G to produce 6-aminopenicillanic acid (6-APA), a penam nucleus for semisynthetic penicillins. Despite the significant differences in amino-acid sequence between PGAs from Gram-positive and Gram-negative bacteria, a representative PGA structure of Gram-positive origin has never been reported. In this study, crystallization and diffraction studies of BmPGA are described. Poor diffraction patterns with blurred spots at higher resolution were typical for BmPGA crystals cryocooled after a brief immersion in cryoprotectant solution. Overnight soaking in the same cryo-solution substantially improved both the mosaicity and resolution limit through the establishment of a new crystal-packing equilibrium. A crystal of BmPGA diffracted X-rays to 2.20 Å resolution and belonged to the monoclinic space group P2 1 with one molecule of BmPGA in the asymmetric unit

  19. Experimental coherent X-ray diffractive imaging: capabilities and limitations of the technique

    International Nuclear Information System (INIS)

    Schropp, Andreas

    2008-08-01

    The investigations pursued during this work were focused on the testing of the applicability of the coherent X-ray diffractive imaging(CXDI)-method in the hard X-ray regime and different measurements were carried out at photon energies between 7 keV and 10 keV. The samples investigated were lithographically prepared two-dimensional gold structures with a size ranging from 3 μm to 10 μm as well as a cluster of gold spheres with a lateral extension of about 3.5 μm. Continuous diffraction patterns were recorded in small angle scattering geometry. In some of the measurements a scattering signal up to the edge of the detector could be measured which corresponds to a lateral resolution of about 30 nm. For certain samples it was possible to reconstruct the object from the measured diffraction data. Since the scattered intensity of non-periodic objects is weak at large scattering angles, the available photon flux is finally the main limitation of the method with regard to the achievable resolution. The experimental data were used to get an estimate of photon flux required for sub-nanometer resolution. The ptychographic iterative phase retrieval algorithm proposed by J. M. Rodenburg et al. (2004) was implemented and tested on simulated diffraction data. Additionally, a genetic algorithm has been developed and implemented for phase retrieval. This algorithm is very different from state-of-the-art algorithms and allows to introduce further experimentally important parameters such as a certain illumination function and partial coherence of the X-ray light. (orig.)

  20. Preparation and characterization of gold nanocrystals and nanomultilayer mirrors for X-ray diffraction experiments

    International Nuclear Information System (INIS)

    Slieh, Jawad

    2009-03-01

    In order to make possible studies on the dynamics of protein molecules in their natural environment Sasaki has developed in the last years a new X-ray diffraction procedure. In this procedure, which is called dynamical X-ray tracking (DXT), the diffraction occurs not directly on the protein molecule, but on a nanomirror rigidly bound to the protein molecule. Measured is hereby the time variation od the alignment of the nanocrystal, which is determined by means of the position of the Laue-diffraction points. By means of these position variations statements on structure variations of the studied protein can be derived with a high spatial accuracy in the time domain. The scientific aim of this thesis is the construction of a DXT measuring place as well as the preparation of the requireds nanocrystalline X-ray diffracting protein labels including their characterization. First a short survey about the foundations of the X radiation and their interactions with matter, especially under regardment of X-ray diffraction on crystals, is given. The measuring methods for the determination of the crystal alignment as well as the vertical and lateral crystal size are presented. In the following chapter a comprehensive survey about the different devices and analysis methods used for the fabrication and characterization of gold crystals is presented. Additionally with precise technical statements the self-constructed MBE apparature is described. This apparature has the purpose to fabricate gold nanocrystals by means of the molecular-beam-epitaxy (MBE) procedure. In the fourth chapter the construction of the DXT laboratory are presented and its beam profile in the focus, its divergence, and its beam spectrum determined. Based on this in the fifth chapter the study of the radiation damage of 2 cysteine-peroxyredoxine (2CP) proteins and the detection of this radiation damage without Au colloids and with Au colloids are presented. The main content of the sixth chapter is the precise

  1. Contribution of neutron diffraction to the study of the texture function of recrystallized titanium, comparison with X-ray diffraction

    International Nuclear Information System (INIS)

    Mardon, J.P.; Pernot, M.; Dervin, P.; Penelle, R.; Englander, M.

    1977-01-01

    Neutron diffraction has been used to obtain complete and formalized direct pole figures of recrystallized titanium sheets; only the transmission method was used for two kinds of samples, the first spherical and the second cylindrical with diameter equal to the height. The orientation distribution function of the crystallites was computed from four measured pole figures. Results of pole figures and of distribution functions are compared with those obtained by X-ray diffraction, by a reflexion-transmission method on a thin sample, and only in reflexion on a composite sample. (Auth.)

  2. Quantitative mineralogical analysis of sandstones using x-ray diffraction techniques

    International Nuclear Information System (INIS)

    Ward, C.R.; Taylor, J.C.

    1999-01-01

    Full text: X-ray diffraction has long been used as a definitive technique for mineral identification based on the measuring the internal atomic or crystal structures present in powdered rocks; soils and other mineral mixtures. Recent developments in data gathering and processing, however, have provided an improved basis for its use as a quantitative tool, determining not only the nature of the minerals but also the relative proportions of the different minerals present. The mineralogy of a series of sandstone samples from the Sydney and Bowen Basins of eastern Australia has been evaluated by X-ray diffraction (XRD) on a quantitative basis using the Australian-developed SIROQUANT data processing technique. Based on Rietveld principles, this technique generates a synthetic X-ray diffractogram by adjusting and combining full-profile patterns of minerals nominated as being present in the sample and interactively matches the synthetic diffractogram under operator instructions to the observed diffractogram of the sample being analysed. The individual mineral patterns may be refined in the process, to allow for variations in crystal structure of individual components or for factors such as preferred orientation in the sample mount. The resulting output provides mass percentages of the different minerals in the mixture, and an estimate of the error associated with each individual percentage determination. The chemical composition of the mineral mixtures indicated by SIROQUANT for each individual sandstone studied was estimated using a spreadsheet routine, and the indicated proportion of each oxide in each sample compared to the actual chemical analysis of the same sandstone as determined independently by X-ray fluorescence spectrometry. The results show a high level of agreement for all major chemical constituents, indicating consistency between the SIROQUANT XRD data and the whole-rock chemical composition. Supplementary testing with a synthetic corundum spike further

  3. Simultaneous X-ray imaging and diffraction study of shock propagation and phase transition in silicon

    Science.gov (United States)

    Galtier, Eric

    2017-06-01

    X-ray phase contrast imaging technique using a free electron laser have observed the propagation of laser-driven shock waves directly inside materials. While providing images with few hundred nanometers spatial resolution, access to more quantitative information like the material density and the various shock front speeds remain challenging due to imperfections in the images limiting the convergence in the reconstruction algorithm. Alternatively, pump-probe X-ray diffraction (XRD) is a robust technique to extract atomic crystalline structure of compressed matter, providing insight into the kinetics of phase transformation and material response to stress. However, XRD by itself is not sufficient to extract the equation of state of the material under study. Here we report on the use of the LCLS free electron laser as a source of a high-resolution X-ray microscopy enabling the direct imaging of shock waves and phase transitions in optically opaque silicon. In this configuration, no algorithm is necessary to extract the material density and the position of the shock fronts. Simultaneously, we probed the crystalline structure via XRD of the various phases in laser compressed silicon. E. Galtier, B. Nagler, H. J. Lee, S. Brown, E. Granados, A. Hashim, E. McBride, A. Mackinnon, I. Nam, J. Zimmerman (SLAC) A. Gleason (Stanford, LANL) A. Higginbotham (University of York) A. Schropp, F. Seiboth (DESY).

  4. Plutonium-uranium mixed oxide characterization by coupling micro-X-ray diffraction and absorption investigations

    Science.gov (United States)

    Degueldre, C.; Martin, M.; Kuri, G.; Grolimund, D.; Borca, C.

    2011-09-01

    Plutonium-uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The potential differences of metal redox state and microstructural developments of the matrix before and after irradiation are commonly analysed by electron probe microanalysis. In this work the structure and next-neighbor atomic environments of Pu and U oxide features within unirradiated homogeneous MOX and irradiated (60 MW d kg -1) MOX samples was analysed by micro-X-ray fluorescence (μ-XRF), micro-X-ray diffraction (μ-XRD) and micro-X-ray absorption fine structure (μ-XAFS) spectroscopy. The grain properties, chemical bonding, valences and stoichiometry of Pu and U are determined from the experimental data gained for the unirradiated as well as for irradiated fuel material examined in the center of the fuel as well as in its peripheral zone (rim). The formation of sub-grains is observed as well as their development from the center to the rim (polygonization). In the irradiated sample Pu remains tetravalent (>95%) and no (oxidation in the rim zone. Any slight potential plutonium oxidation is buffered by the uranium dioxide matrix while locally fuel cladding interaction could also affect the redox of the fuel.

  5. Time-resolved X-ray diffraction on laser-excited metal nano-particles

    CERN Document Server

    Plech, A; Kurbitz, S; Berg, K J; Graener, H; Berg, G; Gresillon, S; Kaempfe, M; Feldmann, J; Von Plessen, G

    2003-01-01

    The lattice expansion and relaxation of noble-metal nano-particles heated by intense femtosecond laser pulses are measured by pump-probe time-resolved X-ray scattering. Following the laser pulse, shape and angular shift of the (111) Bragg reflection from crystalline silver and gold particles with diameters from 20 to 100 nm are resolved stroboscopically using 100 ps X-ray- pulses from a synchrotron. We observe a transient lattice expansion that corresponds to a laser-induced temperature rise of up to 200 K, and a subsequent lattice relaxation. The relaxation occurs within several hundred picoseconds for embedded silver particles, and several nanoseconds for supported free gold particles. The relaxation time shows a strong dependence on particle size. The relaxation rate appears to be limited by the thermal coupling of the particles to the matrix and substrate; respectively, rather than by bulk thermal diffusion. Furthermore, X-ray diffraction can resolve the internal strain state of the nano-particles to sepa...

  6. X-ray diffraction analysis of residual stress in zirconia dental composites

    Science.gov (United States)

    Allahkarami, Masoud

    Dental restoration ceramic is a complex system to be characterized. Beside its essential biocompatibility, and pleasant appearance, it requires being mechanically strong in a catastrophic loading environment. Any design is restricted with geometry boundary and material property limits. Inspired by natural teeth, a multilayer ceramic is a smart way of achieving an enhanced restoration. Bi-layers of zirconia core covered by porcelain are known as one of the best multilayer restorations. Residual stresses may be introduced into a bi-layer dental ceramic restoration during its entire manufacturing process due to thermal expansion and elastic property mismatch. It is impossible to achieve a free of residual stresses bi-layer zirconia-porcelain restoration. The idea is to take the advantage of residual stress in design in such a way to prevent the crack initiation and progression. The hypothesis is a compressive residual stress at external contact surface would be enabling the restoration to endure a greater tensile stress. Optimizing the layers thickness, manufacturing process, and validating 3D simulations require development of new techniques of thickness, residual stresses and phase transformation measurement. In the present work, a combined mirco-tomography and finite element based method were adapted for thickness measurement. Two new 2D X-ray diffraction based techniques were adapted for phase transformation area mapping and combined phase transformation and residual stress measurement. Concerning the complex geometry of crown, an efficient method for X-ray diffraction data collection mapping on a given curved surface was developed. Finally a novel method for 3D dimensional x-ray diffraction data collection and visualization were introduced.

  7. X-ray diffraction microstructural analysis of bimodal size distribution MgO nano powder

    International Nuclear Information System (INIS)

    Suminar Pratapa; Budi Hartono

    2009-01-01

    Investigation on the characteristics of x-ray diffraction data for MgO powdered mixture of nano and sub-nano particles has been carried out to reveal the crystallite-size-related microstructural information. The MgO powders were prepared by co-precipitation method followed by heat treatment at 500 degree Celsius and 1200 degree Celsius for 1 hour, being the difference in the temperature was to obtain two powders with distinct crystallite size and size-distribution. The powders were then blended in air to give the presumably bimodal-size- distribution MgO nano powder. High-quality laboratory X-ray diffraction data for the powders were collected and then analysed using Rietveld-based MAUD software using the lognormal size distribution. Results show that the single-mode powders exhibit spherical crystallite size (R) of 20(1) nm and 160(1) nm for the 500 degree Celsius and 1200 degree Celsius data respectively with the nano metric powder displays narrower crystallite size distribution character, indicated by lognormal dispersion parameter of 0.21 as compared to 0.01 for the sub-nano metric powder. The mixture exhibits relatively more asymmetric peak broadening. Analysing the x-ray diffraction data for the latter specimen using single phase approach give unrealistic results. Introducing two phase models for the double-phase mixture to accommodate the bimodal-size-distribution characteristics give R = 100(6) and σ = 0.62 for the nano metric phase and R = 170(5) and σ= 0.12 for the σ sub-nano metric phase. (author)

  8. Comparison of dissimilarity measures for cluster analysis of X-ray diffraction data from combinatorial libraries

    Science.gov (United States)

    Iwasaki, Yuma; Kusne, A. Gilad; Takeuchi, Ichiro

    2017-12-01

    Machine learning techniques have proven invaluable to manage the ever growing volume of materials research data produced as developments continue in high-throughput materials simulation, fabrication, and characterization. In particular, machine learning techniques have been demonstrated for their utility in rapidly and automatically identifying potential composition-phase maps from structural data characterization of composition spread libraries, enabling rapid materials fabrication-structure-property analysis and functional materials discovery. A key issue in development of an automated phase-diagram determination method is the choice of dissimilarity measure, or kernel function. The desired measure reduces the impact of confounding structural data issues on analysis performance. The issues include peak height changes and peak shifting due to lattice constant change as a function of composition. In this work, we investigate the choice of dissimilarity measure in X-ray diffraction-based structure analysis and the choice of measure's performance impact on automatic composition-phase map determination. Nine dissimilarity measures are investigated for their impact in analyzing X-ray diffraction patterns for a Fe-Co-Ni ternary alloy composition spread. The cosine, Pearson correlation coefficient, and Jensen-Shannon divergence measures are shown to provide the best performance in the presence of peak height change and peak shifting (due to lattice constant change) when the magnitude of peak shifting is unknown. With prior knowledge of the maximum peak shifting, dynamic time warping in a normalized constrained mode provides the best performance. This work also serves to demonstrate a strategy for rapid analysis of a large number of X-ray diffraction patterns in general beyond data from combinatorial libraries.

  9. Analysis of the retained austenite stability in TRIP steels by X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Son, Dong Min; Choi, Il Dong; Shin, Eun Joo

    2005-01-01

    The energy absorption of an automotive sheet steel during crash, that is, at a high speed deformation is very important to the safety of passengers. Therefore, property data and deformation mechanisms of materials under high strain rate conditions are needed to choose proper materials for automobiles. Dynamic mechanical properties of low carbon TRIP steels with varying retained austenite stabilities were evaluated over a wide range of strain rates using a high-velocity hydraulic tensile testing machine. The effect of retained austenite stability on high speed deformation behavior can be evaluated by the proper estimation of transformation in retained austenite. The quantity of transformed retained austenite after deformation was analyzed by X-ray diffraction and high resolution neutron diffraction and compared the results from two test methods. The carbon in retained austenite was analyzed by neutron diffraction. High stability retained austenite has higher carbon content than low stability retained austenite and transformed slowly

  10. Setup for in situ X-ray diffraction studies of thin film growth by magnetron sputtering

    CERN Document Server

    Ellmer, K; Weiss, V; Rossner, H

    2001-01-01

    A novel method is described for the in situ-investigation of nucleation and growth of thin films during magnetron sputtering. Energy dispersive X-ray diffraction with synchrotron light is used for the structural analysis during film growth. An in situ-magnetron sputtering chamber was constructed and installed at a synchrotron radiation beam line with a bending magnet. The white synchrotron light (1-70 keV) passes the sputtering chamber through Kapton windows and hits one of the substrates on a four-fold sample holder. The diffracted beam, observed under a fixed diffraction angle between 3 deg. and 10 deg., is energy analyzed by a high purity Ge-detector. The in situ-EDXRD setup is demonstrated for the growth of tin-doped indium oxide (ITO) films prepared by reactive magnetron sputtering from a metallic target.

  11. Performance characteristics needed for protein crystal diffraction x-ray detectors.

    Energy Technology Data Exchange (ETDEWEB)

    Westbrook, E. M.

    1999-09-21

    During the 1990's, macromolecular crystallography became progressively more dependent on synchrotrons X-ray sources for diffraction data collection. Detectors of this diffraction data at synchrotrons beamlines have evolved over the decade, from film to image phosphor plates, and then to CCD systems. These changes have been driven by the data quality and quantity improvements each newer detector technology provided. The improvements have been significant. It is likely that newer detector technologies will be adopted at synchrotron beamlines for crystallographic diffraction data collection in the future, but these technologies will have to compete with existing CCD detector systems which are already excellent and are getting incrementally better in terms of size, speed, efficiency, and resolving power. Detector development for this application at synchrotrons must concentrate on making systems which are bigger and faster than CCDs and which can capture weak data more efficiently. And there is a need for excellent detectors which are less expensive than CCD systems.

  12. Performance characteristics needed for protein crystal diffraction x-ray detectors

    International Nuclear Information System (INIS)

    Westbrook, E. M.

    1999-01-01

    During the 1990's, macromolecular crystallography became progressively more dependent on synchrotrons X-ray sources for diffraction data collection. Detectors of this diffraction data at synchrotrons beamlines have evolved over the decade, from film to image phosphor plates, and then to CCD systems. These changes have been driven by the data quality and quantity improvements each newer detector technology provided. The improvements have been significant. It is likely that newer detector technologies will be adopted at synchrotron beamlines for crystallographic diffraction data collection in the future, but these technologies will have to compete with existing CCD detector systems which are already excellent and are getting incrementally better in terms of size, speed, efficiency, and resolving power. Detector development for this application at synchrotrons must concentrate on making systems which are bigger and faster than CCDs and which can capture weak data more efficiently. And there is a need for excellent detectors which are less expensive than CCD systems

  13. Determination of Gamma-Prime Site Occupancies in Nickel Superalloys Using Atom Probe Tomography and X-Ray Diffraction (Preprint)

    Science.gov (United States)

    2012-08-01

    AFRL-RX-WP-TP-2012-0390 DETERMINATION OF γ’SITE OCCUPANCIES IN NICKEL SUPERALLOYS USING ATOM PROBE TOMOGRAPHY AND X-RAY DIFFRACTION...IN NICKEL SUPERALLOYS USING ATOM PROBE TOMOGRAPHY AND X-RAY DIFFRACTION (PREPRINT) 5a. CONTRACT NUMBER FA8650-08-C-5226 5b. GRANT NUMBER 5c...sublattice sites while cobalt is likely to occupy both the aluminum and nickel sublattice sites. The x-ray results on the chromium occupancy disagree with

  14. X-Ray Evaluation of Pulse-Plated Crack-Free Cr Layer(Materials Evaluation by X-ray and Neutron Diffractions)

    OpenAIRE

    Yuichi, KOBAYASHI; Jun-ichi, NAGASAWA; Kazuo, WATANABE; Toshihiko, SASAKI; Yukio, HIROSE; Research Laboratory, Tokico Ltd.; Research Laboratory, Tokico Ltd.; GMF Business Division, Atotech Japan K.K.; Department of Material Science and Engineering, Kanazawa University; Department of Material Science and Engineering, Kanazawa University

    2002-01-01

    Several crack-free Cr plating processes using pulse-current electrolysis have been proposed for improving corrosion resistance. However, industrial applications of crack-free Cr platings are very few since these Cr layers are subjected to tensile residual stress and easily form macrocracks after plating operations, particularly at temperatures higher than 373K. The residual stress of crack-free Cr layers deposited by pulse-current electrolysis was evaluated by the X-ray diffraction method. Wi...

  15. Analysis of synchrotron X-ray diffraction patterns from fluorotic enamel samples

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Ana P.G.; Braz, Delson, E-mail: anapaulagalmeida@gmail.co [Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Instrumentacao Nuclear; Colaco, Marcos V.; Barroso, Regina C., E-mail: cely@uerj.b [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Inst. de Fisica; Porto, Isabel M., E-mail: belporto@ig.com.b [Universidade Estadual de Campinas (UNICAMP), Piracicaba, SP (Brazil). Faculdade de Odontologia; Gerlach, Raquel F., E-mail: rfgerlach@forp.usp.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Odontologia; Droppa Junior, Roosevelt, E-mail: rdroppa@lnls.b [Associacao Brasileira de Tecnologia de Luz Sincrotron (ABTLuS), Campinas, SP (Brazil)

    2009-07-01

    With the introduction of fluoride as the main anticaries agent used in preventive dentistry, and perhaps an increase in fluoride in our food chain, dental fluorosis has become an increasing world-wide problem. Visible signs of fluorosis begin to become obvious on the enamel surface as opacities, implying some porosity in the tissue. The mechanisms that conduct the formation of fluorotic enamel are unknown, but should involve modifications in the basics physical-chemistry reactions of demineralisation and remineralisation of the enamel of the teeth, which is the same reaction of formation of the enamel's hydroxyapatite (HAp) in the maturation phase. The increase of the amount of fluoride inside of the apatite will result in gradual increase of the lattice parameters. The hexagonal symmetry seems to work well with the powder diffraction data, and the crystal structure of HAp is usually described in space group P63/m. The aim of this work is to characterize the healthy and fluorotic enamel in human tooth using technique Synchrotron X-ray diffraction in order to determine the crystal structure and crystallinity of on fluoroapatite (FAp) crystal present in fluoritic enamel. All the scattering profile measurements was carried out at the X-ray diffraction beamline (XRD1) at the National Synchrotron Light Laboratory - LNLS, Campinas, Brazil. (author)

  16. X-ray diffraction of mineralogical composition of mudstones from eastern Gadaref area, Sudan

    International Nuclear Information System (INIS)

    Karimeldin, Yassin Ahmed A.

    1996-09-01

    This study reviews the theoretical and experimental aspects of X-ray diffraction (XRD) technique. Moreover, the mineralogical composition of some mudstones from Gadarif region has been investigated using DIFFRAC-AT software package, by means of searching and matching procedure in the standard XRD patterns edited by International Center for Diffraction Data (ICDD). The X-ray diffraction analysis of the Gadarif mudstones revealed that quartz, kaolinite and tridymite are the major mineral constitutes of these rocks. Whereas other minerals like alunite, coalingate, cristabolite, gutsvechite, hematite, meta-alungen, minamite, monteponite, samarskite, chlorie, illite and smectite represent minor constituents in some samples. Most of the mudstone samples investigated have kaolinite content between 71-100%. This most properly indicates that these rocks were subjected to intense weathering and leaching under warm humid climate. These conditions seems to be less favourable for the formation of clay minerals chlorite, illite and smectite. Generally, the clay mineral types, abundances and distribution appear to be influenced mainly by source rock geology, local environment and climate. Moreover, the high silica content of mudstones reflects the influence of both hydrothermal and weathering process. The high haolinite of these mudstone might suggest a good potential for economic exploitation of the kaoline deposits. Further studies, however, might be needed to investigate other technical properties. Suggestions for further work by XRD are given, and include further additions to the refinement procedures and the purchasing of new computer facilities.(Author)

  17. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Leandra; Nascimento, Alessandro S. [Instituto de Física de São Carlos, Departamento de Física e Informática, Universidade de São Paulo, Avenida Trabalhador São Carlense 400, CEP 13566-590 São Carlos, SP (Brazil); Zamorano, Laura S. [Departamento de Química Física, Facultad de Química, Universidad de Salamanca, 37008 Salamanca (Spain); Shnyrov, Valery L. [Departamento de Bioquímica y Biología Molecular, Facultad de Biología, Universidad de Salamanca, 37007 Salamanca (Spain); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Departamento de Física e Informática, Universidade de São Paulo, Avenida Trabalhador São Carlense 400, CEP 13566-590 São Carlos, SP (Brazil); Laboratório Nacional de Luz Síncrotron, Campinas, SP (Brazil)

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.

  18. Fatigue life assessment for pipeline welds by x-ray diffraction technique

    International Nuclear Information System (INIS)

    Lee, Sang Guk; Yoo, Keun Bong

    2006-01-01

    The objective of this study is to estimate the feasibility of X-ray diffraction method application for fatigue life assessment of the high-temperature pipeline steel such as main steam pipe, re-heater pipe and header etc. in power plant. In this study, X-ray diffraction tests using various types of specimen simulated low cycle fatigue damage were performed in order to analyze fatigue properties when fatigue damage conditions become various stages such as 1/4, l/2 and 3/4 of fatigue life, respectively. As a result off-ray diffraction tests for specimens simulated fatigue damages, we conformed that the variation of the full width at half maximum intensity decreased in proportion to the increase of fatigue life ratio. And also, He ratio of the full width at half maximum intensity due to fatigue damage has linear relationship with fatigue life ratio algebraically. From this relationship, it was suggested that direct expectation of the life consumption rate was feasible.

  19. Quantitative 3D imaging of whole, unstained cells by using X-ray diffraction microscopy.

    Science.gov (United States)

    Jiang, Huaidong; Song, Changyong; Chen, Chien-Chun; Xu, Rui; Raines, Kevin S; Fahimian, Benjamin P; Lu, Chien-Hung; Lee, Ting-Kuo; Nakashima, Akio; Urano, Jun; Ishikawa, Tetsuya; Tamanoi, Fuyuhiko; Miao, Jianwei

    2010-06-22

    Microscopy has greatly advanced our understanding of biology. Although significant progress has recently been made in optical microscopy to break the diffraction-limit barrier, reliance of such techniques on fluorescent labeling technologies prohibits quantitative 3D imaging of the entire contents of cells. Cryoelectron microscopy can image pleomorphic structures at a resolution of 3-5 nm, but is only applicable to thin or sectioned specimens. Here, we report quantitative 3D imaging of a whole, unstained cell at a resolution of 50-60 nm by X-ray diffraction microscopy. We identified the 3D morphology and structure of cellular organelles including cell wall, vacuole, endoplasmic reticulum, mitochondria, granules, nucleus, and nucleolus inside a yeast spore cell. Furthermore, we observed a 3D structure protruding from the reconstructed yeast spore, suggesting the spore germination process. Using cryogenic technologies, a 3D resolution of 5-10 nm should be achievable by X-ray diffraction microscopy. This work hence paves a way for quantitative 3D imaging of a wide range of biological specimens at nanometer-scale resolutions that are too thick for electron microscopy.

  20. Atomic motion of resonantly vibrating quartz crystal visualized by time-resolved X-ray diffraction

    International Nuclear Information System (INIS)

    Aoyagi, Shinobu; Osawa, Hitoshi; Sugimoto, Kunihisa; Fujiwara, Akihiko; Takeda, Shoichi; Moriyoshi, Chikako; Kuroiwa, Yoshihiro

    2015-01-01

    Transient atomic displacements during a resonant thickness-shear vibration of AT-cut α-quartz are revealed by time-resolved X-ray diffraction under an alternating electric field. The lattice strain resonantly amplified by the alternating electric field is ∼10 4 times larger than that induced by a static electric field. The resonantly amplified lattice strain is achieved by fast displacements of oxygen anions and collateral resilient deformation of Si−O−Si angles bridging rigid SiO 4 tetrahedra, which efficiently transduce electric energy into elastic energy

  1. Synthesis, X-ray Diffraction Study and Antimicrobial Activity of Calcium Sulphate Nanocomposites from Plant Charcoal

    Directory of Open Access Journals (Sweden)

    Pinak P. N. Choudhury

    2009-04-01

    Full Text Available Calcium sulphate nanocomposite materials (CB have been synthesised from plant charcoal. Crushed charcoal powder was heated to red hot over a Bunsen burner flame and produced a white material which has been isolated. The surface morphology of the material has been studied by Scanning Electron Microscopy (SEM and the elements were analyzed by Energy Dispersion Spectroscopy (EDS. To explore the structural features of the materials X-Ray Diffraction (XRD patterns were recorded. The material showed pronounced inhibitory effects against Streptococcus faecaelis, Bacillus subtilis, Klebsilla pneumoni, E. coli, Proteus vulgaris and Pseudomonas aeruginosa.

  2. Effects of Fluoride on NiTi Orthodontic Archwires: An X-ray Diffraction Study

    Directory of Open Access Journals (Sweden)

    Sumit Kumar Yadav

    2013-01-01

    Results: Unloading force values of NiTi orthodontic wires were significantly decreased after exposure to both fluoride solutions (p < 0.001. Corrosive changes in surface topography were observed for both fluoride solutions. Wires exposed to acidic fluoride appeared as more severely affected. X-ray diffraction analysis showed no change in crystal lattice of NiTi wires in both solutions. Conclusion: The results suggest that using topical fluoride agents with NiTi wire could decrease the functional unloading mechanical properties of the wire and contribute to prolonged orthodontic treatment.

  3. Determination of Ni(II) crystal structure by powder x-ray diffraction ...

    African Journals Online (AJOL)

    X-ray powder diffraction pattern was used to determine the length of the unit cell, “a”, the lattice structure type, and the number of atoms per unit cell of Ni(II) crystal. The “a” value was determined to be 23.66 ± 0.005 Å, particle size of 34.87 nm, volume 13.24 Å and Strain value ε = 9.8 x 10-3. The cell search on PXRD patterns ...

  4. Investigation of hepatic fibrosis in rats with x-ray diffraction enhanced imaging

    International Nuclear Information System (INIS)

    Li Hui; Zhang Lu; Wang Xueyan; Luo Shuqian; Wang Tailing; Wang Baoen; Zhao Xinyan

    2009-01-01

    X-ray diffraction enhanced imaging (DEI) is a phase contrast technique that generates excellent contrast of biological soft tissues compared to conventional absorption radiography. We explore the application of DEI in the diagnosis of hepatic fibrosis. The produced refraction contrast images of fibrous rat liver samples show clearly abnormal liver architectures. Moreover, by comparing to histological pictures, different stages of fibrosis are discriminated, and the corresponding morphological features are analyzed. Besides, quantitative analyses of texture features are presented. The results reported herein show that DEI can be a potential noninvasive technique to diagnose and stage hepatic fibrosis

  5. An experimental system for high temperature X-ray diffraction studies with in situ mechanical loading

    OpenAIRE

    Oswald, Benjamin B.; Schuren, Jay C.; Pagan, Darren C.; Miller, Matthew P.

    2013-01-01

    An experimental system with in situ thermomechanical loading has been developed to enable high energy synchrotron x-ray diffraction studies of crystalline materials. The system applies and maintains loads of up to 2250 N in uniaxial tension or compression at a frequency of up to 100 Hz. The furnace heats the specimen uniformly up to a maximum temperature of 1200 °C in a variety of atmospheres (oxidizing, inert, reducing) that, combined with in situ mechanical loading, can be used to mimic pro...

  6. Structure of the Si(1 1 3) surface studied by surface X-ray diffraction

    International Nuclear Information System (INIS)

    Mizuno, Yoshihito; Akimoto, Koichi; Aoyama, Tomohiro; Suzuki, Hidetoshi; Nakahara, Hitoshi; Ichimiya, Ayahiko; Sumitani, Kazushi; Takahashi, Toshio; Zhang Xiaowei; Sugiyama, Hiroshi; Kawata, Hiroshi

    2004-01-01

    We carried out a grazing incidence X-ray diffraction analysis of the Si(1 1 3) 3 x 1 surface using synchrotron radiation. We compared the experimental structure factors obtained from the integrated intensities of the fractional-order reflections with the calculated structure factors of the dimerized structure model of Ranke. By minimizing the R-factor, we determined the position and the size of the pentagon in the 3 x 1 dimerized structure model of Ranke. In addition, we found that a model with randomly distributed interstitial atoms at the center of the pentagon gives a smaller R-factor value

  7. The microscopic structure of liquid mercury from neutron and x-ray diffraction

    International Nuclear Information System (INIS)

    Bafile, U.

    1999-01-01

    Complete text of publication follows. New neutron and X-ray diffraction investigations of the microscopic structure of liquid mercury were recently carried out. The direct comparison of the structure factors S(Q) measured with the two techniques showing a very good agreement, is reported here. It is also shown that, by exploiting the very good stability of the D20 neutron diffractometer at ILL, Grenoble, the very small density effects due to pressurization of mercury up to 2 kbar can be detected to obtain the first neutron measurement of the isothermal density derivative of S(Q), which is a very sensitive probe of the interaction law in liquid systems. (author)

  8. Determination of UO2 little quantity in UF4 by X-rays diffraction

    International Nuclear Information System (INIS)

    Costa, M.I.; Sato, I.M.; Imakuma, K.

    1977-01-01

    In the fluorination process, the final product UF 4 contain different levels of UO 2 as a contaminant. A routine method for quantitative analysis by x-ray diffraction has been developed. Standard curves have been plotted using mixtures of UO 2 /UF 4 with measures of intensity of (III) peak of UO 2 by the step scanning process. The integrated intensity versus UO 2 concentration curves present a linear behavior in the range from 0 to 4%. A good reprodutibility of measuring process has been observed through statistical analysis which permits to determine low fractions of UO 2 in UF 4 with +- 0,08% of accuracy [pt

  9. X-ray diffraction studies of NiTi shape memory alloys

    OpenAIRE

    E. Łągiewka; Z. Lekston

    2007-01-01

    Purpose: The purpose of this paper is to present the results of the investigations of phase transitions of TiNiCo and Ni-rich NiTi shape memory alloys designed for medical applications.Design/methodology/approach: Temperature X-ray diffraction (TXRD), differential scanning calorimetry (DSC), electrical resistivity (ER) and the temperature shape recovery measurements in three-point bending ASTM 2082-01 tests were used.Findings: It has been found in this work that ageing after solution treatme...

  10. X-ray diffraction and molecular-dynamics studies: Structural analysis of phases in diglyceride monolayers

    DEFF Research Database (Denmark)

    Peters, Günther H.J.; Larsen, Niels Bent; Bjørnholm, T.

    1998-01-01

    We report a detailed structural analysis of the phases of 1,2-sn-dipalmitoylglycerol Langmuir monolayers at room temperature. Pressure-induced transitions have been investigated by combination of molecular-dynamics simulations and grazing-incidence x-ray diffraction (XRD). The diglyceride film......; At the lowest pressure the tilt angle reaches approximate to 14 degrees in a direction close to a nearest neighbor direction. Both arrangements of the alkyl chains are confirmed by XRD. For higher order and fractional order Bragg peaks, simulations predict higher intensities than observed with XRD. This may...

  11. Non-destructive synchrotron X-ray diffraction mapping of a Roman painting

    International Nuclear Information System (INIS)

    Dooryhee, E.; Anne, M.; Hodeau, J.-L.; Martinetto, P.; Rondot, S.; Bardies, I.; Salomon, J.; Walter, P.; Vaughan, G.B.M.

    2005-01-01

    The history and the properties of materials are deduced not only from their elemental and molecular signatures, but also from their exact phase compositions, and from the structures and the defects of their constituents. Here we implement a non-destructive synchrotron X-ray based method, which combines both the quantitative structural content of diffraction and the imaging mode. As a demonstration case, the pigments of a Roman wall painting are examined. The joined elemental and mineral maps mimic the major features of the painting. Different structural phases made of common atomic elements are differentiated. Textures and graininess are measured and related to the artist's know-how. (orig.)

  12. High Pressure X-ray Diffraction Study on Icosahedral Boron Arsenide (B12As2)

    Energy Technology Data Exchange (ETDEWEB)

    J Wu; H Zhu; D Hou; C Ji; C Whiteley; J Edgar; Y Ma

    2011-12-31

    The high pressure properties of icosahedral boron arsenide (B12As2) were studied by in situ X-ray diffraction measurements at pressures up to 25.5 GPa at room temperature. B12As2 retains its rhombohedral structure; no phase transition was observed in the pressure range. The bulk modulus was determined to be 216 GPa with the pressure derivative 2.2. Anisotropy was observed in the compressibility of B12As2-c-axis was 16.2% more compressible than a-axis. The boron icosahedron plays a dominant role in the compressibility of boron-rich compounds.

  13. High pressure behaviour of TbN: an X-ray diffraction and computational study

    DEFF Research Database (Denmark)

    Jakobsen, J.M.; Madsen, G.K.H.; Jorgensen, J.E.

    2002-01-01

    In the present work, we report an X-ray powder diffraction study of TbN up to an applied hydrostatic pressure of 43 GPa. TbN was found to be stable in the 131 (NaCl structure) within the examined pressure interval, and the zero pressure bulk modulus was determined to be 176(7) GPa. The electronic...... to be itinerant and well described by standard DFT functionals. No pressure-induced phase transitions were found below 250 GPa with the LDA + U and GGA + U methods....

  14. Final Report for X-ray Diffraction Sample Preparation Method Development

    Energy Technology Data Exchange (ETDEWEB)

    Ely, T. M. [Hanford Site (HNF), Richland, WA (United States); Meznarich, H. K. [Hanford Site (HNF), Richland, WA (United States); Valero, T. [Hanford Site (HNF), Richland, WA (United States)

    2018-01-30

    WRPS-1500790, “X-ray Diffraction Saltcake Sample Preparation Method Development Plan/Procedure,” was originally prepared with the intent of improving the specimen preparation methodology used to generate saltcake specimens suitable for XRD-based solid phase characterization. At the time that this test plan document was originally developed, packed powder in cavity supports with collodion binder was the established XRD specimen preparation method. An alternate specimen preparation method less vulnerable, if not completely invulnerable to preferred orientation effects, was desired as a replacement for the method.

  15. Instability of cyclic superelastic deformation of NiTi investigated by synchrotron X-ray diffraction

    Czech Academy of Sciences Publication Activity Database

    Sedmák, P.; Šittner, Petr; Pilch, Jan; Curfs, C.

    2015-01-01

    Roč. 94, Aug (2015), s. 257-270 ISSN 1359-6454 R&D Projects: GA ČR GB14-36566G; GA ČR GPP108/12/P111; GA ČR GA14-15264S; GA ČR GAP107/12/0800 Institutional support: RVO:68378271 Keywords : shape memory alloy * NiTi * superelasticity * cyclic deformation * in situ X-ray diffraction Subject RIV: JG - Metallurgy Impact factor: 5.058, year: 2015

  16. Residual stress determination in a 1000 A tungsten thin film by X-rays diffraction

    International Nuclear Information System (INIS)

    Badawi, K.F.; Declemy, A.; Naudon, A.; Goudeau, P.

    1992-01-01

    In this study, we have determined the complete residual stress tensor by X-rays diffraction, using the sin 2 ψ method, in a 1000 A tungsten thin film deposited on a silicon monocrystal. Stresses are tension wise of big magnitude (1.5 GPa). They are almost isotropic in the film plane. Shear stresses are low but not negligeable. After a bombardment by a 320 keV Xe ++ ion beam, the stresses became compressive (about -1.3 GPa). These results demonstrate the feasability of stress determination by the sin 2 ψ method in films as thin as 1000 A and open interesting areas for future research. (orig.)

  17. A three-dimensional X-ray diffraction microscope for deformation studies of polycrystals

    DEFF Research Database (Denmark)

    Fæster Nielsen, Søren; Lauridsen, E.M.; Juul Jensen, D.

    2001-01-01

    -dimensional X-ray diffraction (3DXRD) microscope installed at the European Synchrotron Radiation Facility in Grenoble provides a fast and non-destructive technique for mapping the embedded grains within thick samples in three dimensions. All essential features like the position, volume, orientation, stress......-state of the grains can be determined, including the morphology of the grain boundaries. The accuracy of this novel tracking technique is compared with electron microscopy (EBSP), and its 3-D capacity is demonstrated. (C) 2001 Elsevier Science B.V. All rights reserved....

  18. Synthesis, X-ray Diffraction Study and Antimicrobial Activity of Calcium Sulphate Nanocomposites from Plant Charcoal

    Science.gov (United States)

    Bhattacharjee, Chira R.; Paul, Satya B.; Nath, Abhijit; Choudhury, Pinak P. N.; Choudhury, Sudip

    2009-01-01

    Calcium sulphate nanocomposite materials (CB) have been synthesised from plant charcoal. Crushed charcoal powder was heated to red hot over a Bunsen burner flame and produced a white material which has been isolated. The surface morphology of the material has been studied by Scanning Electron Microscopy (SEM) and the elements were analyzed by Energy Dispersion Spectroscopy (EDS). To explore the structural features of the materials X-Ray Diffraction (XRD) patterns were recorded. The material showed pronounced inhibitory effects against Streptococcus faecaelis, Bacillus subtilis, Klebsilla pneumoni, E. coli, Proteus vulgaris and Pseudomonas aeruginosa.

  19. Massive Submandibular Sialolith: Complete Radiographic Registration and Biochemical Analysis through X-Ray Diffraction

    Directory of Open Access Journals (Sweden)

    Ademir Franco

    2014-01-01

    Full Text Available Sialolithiasis is a pathologic condition that affects 60 million people per year, which is caused by the presence of calcified structures, named sialoliths, inside the salivary glands and their salivary ducts. Despite the large incidence of sialolithiasis, its etiology is still unknown. In the present case report, a 47-year-old female patient, presenting with local pain and hampered mouth opening, underwent a surgical approach for the removal of a 20 mm sialolith, which was further analyzed through X-ray diffraction. In parallel, a radiographic registration of 8 years, covering all the period for sialolith formation, is presented along the case report.

  20. X-ray diffraction studies of the structure and orientations of thiophene and fluorenone based molecule

    International Nuclear Information System (INIS)

    Porzio, William; Pasini, Mariacecilia; Destri, Silvia; Giovanella, Umberto; Fontaine, Philippe

    2006-01-01

    The crystal structure of a conjugated molecule containing thiophene and fluorenone residues has been determined from powder X-ray diffraction (XRD). Thin films ( -5 Pa) onto oxidized silicon substrates, are oriented along with different crystallographic directions. A comparison of XRD in both Grazing Incidence and Bragg-Brentano geometries allowed to perform a quantitative analysis of the various orientations. This approach is generally applicable in the case of multi-oriented films. The results fully account for the poor performance of this molecule in p-type field effect transistor devices

  1. Scanning three-dimensional x-ray diffraction microscopy using a high-energy microbeam

    Energy Technology Data Exchange (ETDEWEB)

    Hayashi, Y., E-mail: y-hayashi@mosk.tytlabs.co.jp; Hirose, Y.; Seno, Y. [Toyota Central R& D Toyota Central R& D Labs., Inc., 41-1 Nagakute Aichi 480-1192 Japan (Japan)

    2016-07-27

    A scanning three-dimensional X-ray diffraction (3DXRD) microscope apparatus with a high-energy microbeam was installed at the BL33XU Toyota beamline at SPring-8. The size of the 50 keV beam focused using Kirkpatrick-Baez mirrors was 1.3 μm wide and 1.6 μm high in full width at half maximum. The scanning 3DXRD method was tested for a cold-rolled carbon steel sheet sample. A three-dimensional orientation map with 37 {sup 3} voxels was obtained.

  2. High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals

    Science.gov (United States)

    Smither, Robert K [Hinsdale, IL

    2008-12-23

    A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

  3. Application of the X-ray fluorescence analysis and X-ray diffraction in geochemical studies of the Pleistocene tills from Holy Cross Mountains

    Science.gov (United States)

    Kubala-Kukuś, A.; Ludwikowska-Kȩdzia, M.; Banaś, D.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.

    2013-12-01

    X-ray fluorescence analysis methods (wavelength dispersive X-ray fluorescence analysis (WDXRF) and total reflection X-ray fluorescence (TXRF)) and X-ray powder diffraction (XRPD) have been applied in complementary geochemical studies of the Pleistocene till samples. The XRPD technique gave information about the mineral composition of the analyzed samples while the WDXRF and TXRF studies allowed the fast elemental analysis. The till samples were collected from different regions of Holy Cross Mountains (located in central Poland) which are still not unambiguously described in the context of the geochemical studies of the Quaternary sediments. The analysis was concentrated on the geochemical composition of the till samples both for materials occurring on the surface (characterized by continuous weathering processes) and for samples taken from core borehole. The overriding purpose of these studies is determination of the local lithotype of the tills and its lithologic and petrographic diagnostic properties, including the chemical composition of clay and minerals found in the clay. In the presented work the experimental sets up, sample preparation procedure and measurements programme will be discussed in details. Finally, the elemental and mineral compositions will be presented for studied different groups of the samples.

  4. Structure determination of modulated structures by powder X-ray diffraction and electron diffraction

    Czech Academy of Sciences Publication Activity Database

    Zhou, Z.Y.; Palatinus, Lukáš; Sun, J.L.

    2016-01-01

    Roč. 3, č. 11 (2016), s. 1351-1362 ISSN 2052-1553 Institutional support: RVO:68378271 Keywords : electron diffraction * incommensurate structure * powder diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.036, year: 2016

  5. In situ hydration of sulphoaluminate cement mixtures monitored by synchrotron x-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Turrillas, X. [Institut de Ciencia de Materials de Barcelona (ICMAB-CSIC), Barcelona (Spain); Martinez, L.G.; Carvalho, A.M.; Carezzato, G.L. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Rossetto, C.M. [Faculdade de Tecnologia de Sao Paulo (FATEC), SP (Brazil)

    2016-07-01

    Full text: The hydration of calcium sulpho-aluminate cement mixtures was studied in situ by synchrotron X-ray diffraction at the XRD1 beamline of the Laboratorio Nacional de Luz Sincrotron (LNLS) in Campinas, SP. The powder specimens were introduced in borosilicate glass capillary tubes of 0.7 mm of internal diameter and imbued with deionized water. As the hydration reaction is very fast the capillaries were placed on the goniometer and the data collection was started after two minutes of mixing with water. The X-ray energy chosen to get an adequate flux for these short time acquisitions was 12 keV or more precisely 1.033258 Å, determined with polycrystalline corundum standard. Diffraction patterns were collected sequentially every 35 seconds for several hours at temperatures ranging from 40 degC to 55 degC with an accuracy better than 0.1 degC attained with the help of a hot air blower. The diffracted signal was collected with an array of twenty-four Mythen detectors at 760 mm from the capillary tube. The diffraction patterns had appropriate statistics to determine the kinetics of the reaction either by quantitative Rietveld analysis or by fitting isolated diffraction peaks to Gaussian curves as a function of time. The most important phases involved in the hydration are Klein´s salt, also known as Ye’elimite, Ca4(AlO2)6SO4, and gypsum, CaSO4.2H2O to yield Ettringite, Ca6Al2(SO4)3(OH)12 - 26H2O, phase responsible for the mechanical properties. (author)

  6. Non-conventional applications of a noninvasive portable X-ray diffraction/fluorescence instrument

    Energy Technology Data Exchange (ETDEWEB)

    Chiari, Giacomo [Getty Conservation Institute, Science Department, Los Angeles, CA (United States); Sarrazin, Philippe [Examinart LLC, Sunnyvale, CA (United States); Heginbotham, Arlen [The J. Paul Getty Museum, Sculpture and Decorative Arts Conservation, Los Angeles, CA (United States)

    2016-11-15

    Noninvasive techniques have become widespread in the cultural heritage analytical domain. The popular handheld X-ray fluorescence (XRF) devices give the elemental composition of all the layers that X-rays can penetrate, but no information on how atoms are bound together or at which depth they are located. A noninvasive portable X-ray powder diffraction/X-ray fluorescence (XRD/XRF) device may offer a solution to these limitations, since it can provide information on the composition of crystalline materials. This paper introduces applications of XRD beyond simple phase recognition. The two fundamental principles for XRD are: (1) the crystallites should be randomly oriented, to ensure proper intensity to all the diffraction peaks, and (2) the material should be positioned exactly in the focal plane of the instrument, respecting its geometry, as any displacement of the sample would results in 2θ shifts of the diffraction peaks. In conventional XRD, the sample is ground and set on the properly positioned sample holder. Using a noninvasive portable instrument, these two requirements are seldom fulfilled. The position, size and orientation of a given crystallite within a layered structure depend on the object itself. Equation correlating the displacement (distance from the focal plane) versus peak shift (angular difference in 2θ from the standard value) is derived and used to determine the depth at which a given substance is located. The quantitative composition of two binary Cu/Zn alloys, simultaneously present, was determined measuring the cell volume and using Vegard's law. The analysis of the whole object gives information on the texture and possible preferred orientations of the crystallites, which influences the peak intensity. This allows for the distinction between clad and electroplated daguerreotypes in the case of silver and between ancient and modern gilding for gold. Analyses of cross sections can be carried out successfully. Finally, beeswax, used in

  7. Probing deformation substructure by synchrotron X-ray diffraction and dislocation dynamics modelling.

    Science.gov (United States)

    Korsunsky, Alexander M; Hofmann, Felix; Song, Xu; Eve, Sophie; Collins, Steve P

    2010-09-01

    Materials characterization at the nano-scale is motivated by the desire to resolve the structural aspects and deformation behavior at length scales relevant to those mechanisms that define the novel and unusual properties of nano-structured materials. A range of novel techniques has recently become accessible with the help of synchrotron X-ray beams that can be focused down to spot sizes of less than a few microns on the sample. The unique combination of tunability (energy selection), parallelism and brightness of synchrotron X-ray beams allows their use for high resolution diffraction (determination of crystal structure and transformations, analysis of dislocation sub-structures, orientation and texture analysis, strain mapping); small angle X-ray scattering (analysis of nano-scale voids and defects; orientation analysis) and imaging (radiography and tomography). After a brief review of the state-of-the-art capabilities for monochromatic and white beam synchrotron diffraction, we consider the usefulness of these techniques for the task of bridging the gap between experiment and modeling. Namely, we discuss how the experiments can be configured to provide information relevant to the validation and improvement of modeling approaches, and also how the results of various simulations can be post-processed to improve the possibility of (more or less) direct comparison with experiments. Using the example of some recent experiments carried out on beamline 116 at Diamond Light Source near Oxford, we discuss how such experimental results can be interpreted in view and in conjunction with numerical deformation models, particularly those incorporating dislocation effects, e.g., finite-element based pseudo-continuum strain gradient formulations, and discrete dislocation simulations. Post-processing of FE and discrete dislocation simulations is described, illustrating the kind of information that can be extracted from comparisons between modeling and experimental data.

  8. X-ray diffraction study of the polymorphism of hydrated diacyl- and dialkylphosphatidylethanolamines.

    Science.gov (United States)

    Seddon, J M; Cevc, G; Kaye, R D; Marsh, D

    1984-06-05

    The structure and polymorphism of a homologous series of diacyl- and of dialkylphosphatidylethanolamines have been investigated by X-ray diffraction, calorimetry, and density measurement. The compositional dependence of the repeat spacings of the gel (L beta or L beta'), fluid bilayer (L alpha), and inverted hexagonal (HII) phases has been determined both for the short chain length (di-C12) dialkyl didodecylphosphatidylethanolamine (DDPE) and for the long chain length (di-C20) diacyl diarachinoylphosphatidylethanolamine (DAPE). These data, in conjunction with the measured phase transition temperatures obtained both by X-ray diffraction and by differential scanning calorimetry, have been used to construct phase diagrams for the two lipids. DDPE exhibits metastable behavior in the L beta and L alpha phases below 44 degrees C at all water contents and forms cubic and other nonlamellar phases between the L alpha and HII phases. At low water contents, crystalline and fluid phases coexist at temperatures up to 83 degrees C. For DAPE, the behavior is simpler. In the gel phase, the hydrocarbon chains are tilted at 29 degrees to the bilayer normal, and metastability is only observed at water contents below 3 wt %. The L alpha phase is adopted within a narrow temperature range and then transforms directly to the HII phase. The structural parameters of the L beta (L beta'), L alpha, and HII phases of DDPE and DAPE have been calculated from the X-ray data, in conjunction with the measured values of lipid partial specific volume. In addition, the chain-length dependence of the repeat spacings of the phases has been measured for the homologous series of diacyl and dialkyl lipids. Taken together, the results allow a detailed description of the effects of temperature, hydration, and chain length on the polymorphism of the saturated phosphatidylethanolamines.

  9. X-ray diffraction and absorption spectroscopic studies on plastic sheets used in green houses

    International Nuclear Information System (INIS)

    Braik, N.

    1987-01-01

    A study of the morphology and light-transmissivity in nine commercial samples of low-density polyethylene sheets (LDPE) was carried out. The sheets were of the qualities prepared for use in agricultural green houses and tunnels. The sheets were produced by the plastic-film extrusion process in five Jordanian plastic factories. The variations in the samples were determined in terms of crystallinity, crystallite size, crystallite orientation, heat of fusion, and melting point. X-ray diffraction, UV/visible absorption spectroscopy, and differential scanning calorimetry (DSC) techniques were used. The nine samples had relatively small x-ray crystallinity (20-41%) and low DSC crystallinity (21-29%); the crystallite size were relatively large (8.4-13.4 nm), but the crystallites were not well-oriented relative to the extrusion direction. The melting point was in the temperature range 112.7-118.9 degrees celsius, and the heat of fusion was in the range 60.3 - 83.7 J/g. There was no relation between the crystallinity, which was relatively low in all the samples, and the transmissivity of visible light. Annealing of LDPE sheets in vacuum improved the crystallinity especially at temperatures below the melting point. Free annealing resulted in better crystallization than annealing at constant length. Drawing of LDPE sheets improved the crystallinity and crystallite orientation, and samples with higher crystallinity and crystallite orientation showed better transmissivity of visible light. The UV absorption difference among the samples was not remarkable, and x-ray diffraction crystallinity revealed the variations in the morphology more sensitively than the DSC method. 56 refs., 17 figs., 12 tabs. (A.M.H.)

  10. Characterization of nanowires by coherent X-ray diffractive imaging and ptychography

    International Nuclear Information System (INIS)

    Dzhigaev, Dmitry

    2017-03-01

    Imaging techniques are of paramount importance for our understanding of the universe. From galaxies and stars explored by huge telescopes down to micro and nanostructures studied by microscopes, imaging systems provide invaluable scientific information. When an object under investigation has a size of about 100 nanometers, X-rays become a perfect probe for non-destructive imaging. The manufacturing process of image forming lenses for X-rays becomes much more complicated comparing to optical ones. Therefore, ''lensless'' techniques which rely on the coherent properties of radiation were developed. With third generation of synchrotron sources highly coherent and intense X-ray beams became widely accessible. They are used in new imaging methods such as coherent X-ray diffractive imaging (CXDI) and X-ray ptychography. Modern nanotechnology opens a wide spectrum of possible applications in different branches of physics, chemistry, biology and engineering. At the nanoscale, matter has different physical and chemical properties compared to the macroscale bulk material. The continuing trend of miniaturization of functional components in semiconductor industry brings new challenges both in growth and characterization methods. This Thesis is focused on application of coherent diffractive imaging methods to reveal the structure of single semiconductor nanowires (NWs). They have been attracting significant attention for a couple of decades due to their efficient strain relaxation properties. And since the strain plays a significant role in NW performance the projects carried out in this work are oriented on Bragg CXDI approaches. Three distinct projects were carried out during my research activity at DESY research center of the Helmholtz Association. Experimental work was performed at P06 and P10 beamlines at PETRA III synchrotron. The first part of this Thesis extends the application of the three-dimensional (3D) Bragg CXDI to strain field mapping in a

  11. Characterization of nanowires by coherent X-ray diffractive imaging and ptychography

    Energy Technology Data Exchange (ETDEWEB)

    Dzhigaev, Dmitry

    2017-03-15

    Imaging techniques are of paramount importance for our understanding of the universe. From galaxies and stars explored by huge telescopes down to micro and nanostructures studied by microscopes, imaging systems provide invaluable scientific information. When an object under investigation has a size of about 100 nanometers, X-rays become a perfect probe for non-destructive imaging. The manufacturing process of image forming lenses for X-rays becomes much more complicated comparing to optical ones. Therefore, ''lensless'' techniques which rely on the coherent properties of radiation were developed. With third generation of synchrotron sources highly coherent and intense X-ray beams became widely accessible. They are used in new imaging methods such as coherent X-ray diffractive imaging (CXDI) and X-ray ptychography. Modern nanotechnology opens a wide spectrum of possible applications in different branches of physics, chemistry, biology and engineering. At the nanoscale, matter has different physical and chemical properties compared to the macroscale bulk material. The continuing trend of miniaturization of functional components in semiconductor industry brings new challenges both in growth and characterization methods. This Thesis is focused on application of coherent diffractive imaging methods to reveal the structure of single semiconductor nanowires (NWs). They have been attracting significant attention for a couple of decades due to their efficient strain relaxation properties. And since the strain plays a significant role in NW performance the projects carried out in this work are oriented on Bragg CXDI approaches. Three distinct projects were carried out during my research activity at DESY research center of the Helmholtz Association. Experimental work was performed at P06 and P10 beamlines at PETRA III synchrotron. The first part of this Thesis extends the application of the three-dimensional (3D) Bragg CXDI to strain field mapping in a

  12. The Use of Small-Angle X-Ray Diffraction Studies for the Analysis of Structural Features in Archaeological Samples

    DEFF Research Database (Denmark)

    Wess, T. J.; Drakopoulos, M.; Snigirev, A.

    2001-01-01

    the potential of a laboratory source is also described. Specific examples of analysis using X-ray diffraction of historic parchment, archaeological bone, a Central Mexico style pictograph and microdiffraction of calcified tissues are used to show the scope and versatility of the technique. Diffraction data......X-ray diffraction or scattering analysis provides a powerful non-destructive technique capable of providing important information about the state of archaeological samples in the nanometer length scale. Small-angle diffraction facilities are usually found at synchrotron sources, although...

  13. High energy white beam x-ray diffraction studies of residual strains in engineering components

    Science.gov (United States)

    Zhang, S. Y.; Vorster, W.; Jun, T. S.; Song, X.; Golshan, M.; Laundy, D.; Walsh, M. J.; Korsunsky, A. M.

    2008-09-01

    In order to predict the durability of engineering components and improve performance, it is mandatory to understand residual stresses. The last decade has witnessed a significant increase of residual stress evaluation using diffraction of penetrating radiation, such as neutrons or high energy X-rays. They provide a powerful non-destructive method for determining the level of residual stresses in engineering components through precise characterisation of interplanar crystal lattice spacing. The unique non-destructive nature of these measurement techniques is particularly beneficial in the context of engineering design, since it allows the evaluation of a variety of structural and deformational parameters inside real components without material removal, or at worst with minimal interference. However, while most real engineering components have complex shape and are often large in size, leading to measurement and interpretation difficulties, since experimental facilities usually have limited space for mounting the sample, limited sample travel range, limited loading capacity of the sample positioning system, etc. Consequently, samples often have to be sectioned, requiring appropriate corrections on measured data; or facilities must be improved. Our research group has contributed to the development of engineering applications of high-energy X-ray diffraction methods for residual stress evaluation, both at synchrotron sources and in the lab setting, including multiple detector setup, large engineering component manipulation and measurement at the UK Synchrotron Radiation Source (SRS Daresbury), and in our lab at Oxford. A nickel base superalloy combustion casing and a large MIG welded Al alloy plate were successfully studied.

  14. Quantitative description of microstructure defects in hexagonal boron nitrides using X-ray diffraction analysis

    International Nuclear Information System (INIS)

    Schimpf, C.; Motylenko, M.; Rafaja, D.

    2013-01-01

    A routine for simultaneous quantification of turbostratic disorder, amount of puckering and the dislocation and stacking fault density in hexagonal materials was proposed and tested on boron nitride powder samples that were synthesised using different methods. The routine allows the individual microstructure defects to be recognised according to their effect on the anisotropy of the X-ray diffraction line broadening. For quantification of the microstructure defects, the total line broadening is regarded as a linear combination of the contributions from the particular defects. The total line broadening is obtained from the line profile fitting. As testing material, graphitic boron nitride (h-BN) was employed in the form of hot-isostatically pressed h-BN, pyrolytic h-BN or a h-BN, which was chemically vapour deposited at a low temperature. The kind of the dominant microstructure defects determined from the broadening of the X-ray diffraction lines was verified by high resolution transmission electron microscopy. Their amount was attempted to be verified by alternative methods. - Highlights: • Reliable method for quantification of microstructure defects in BN was suggested. • The method is based on the analysis of anisotropic XRD line broadening. • This XRD line broadening is unique and characteristic of the respective defect. • Thus, the quantification of coexistent microstructure defects is possible. • The method was tested on hexagonal BN, which was produced by different techniques

  15. Crystallization and preliminary X-ray diffraction analysis of recombinant hepatitis E virus-like particle

    International Nuclear Information System (INIS)

    Wang, Che-Yen; Miyazaki, Naoyuki; Yamashita, Tetsuo; Higashiura, Akifumi; Nakagawa, Atsushi; Li, Tian-Cheng; Takeda, Naokazu; Xing, Li; Hjalmarsson, Erik; Friberg, Claes; Liou, Der-Ming; Sung, Yen-Jen; Tsukihara, Tomitake; Matsuura, Yoshiharu; Miyamura, Tatsuo; Cheng, R. Holland

    2008-01-01

    A recombinant virus-like particle that is a potential oral hepatitis E vaccine was crystallized. Diffraction data were collected to 8.3 Å resolution and the X-ray structure was phased with the aid of a low-resolution density map determined using cryo-electron microscopy data. Hepatitis E virus (HEV) accounts for the majority of enterically transmitted hepatitis infections worldwide. Currently, there is no specific treatment for or vaccine against HEV. The major structural protein is derived from open reading frame (ORF) 2 of the viral genome. A potential oral vaccine is provided by the virus-like particles formed by a protein construct of partial ORF3 protein (residue 70–123) fused to the N-terminus of the ORF2 protein (residues 112–608). Single crystals obtained by the hanging-drop vapour-diffusion method at 293 K diffract X-rays to 8.3 Å resolution. The crystals belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 337, b = 343, c = 346 Å, α = β = γ = 90°, and contain one particle per asymmetric unit

  16. Analysis of urinary stone composition in Eastern India by X-ray diffraction crystallography

    Directory of Open Access Journals (Sweden)

    Tarun Jindal

    2014-01-01

    Full Text Available Background: Stones in the urinary system are common in our country. This study was done to assess the composition of the urinary stones in eastern part of India. Materials and Methods: A prospective study was done over a period of thirty months. A total of 90 stones were analyzed in this time period by using X-ray diffraction crystallography. Results: Of the 90 stones analyzed, 77 were renal stones, 12 were ureteric stones and one was a bladder stone. Six stones (all renal did not have properties to be represented by X-ray diffraction crystallography. The overall prevalence of the oxalate containing stones was 85.7% with calcium oxalate monohydrate (COM being the major constituent. Calcium oxalate dihydrate (COD was the next most common constituent. Struvite stones constituted 9.5% of the stones analyzed. Pure calcium phosphate stones were found in 4.7% of the cases. Conclusion: Our study reveals that the stone composition in the eastern part of India is different from that in other parts of the country. We have a comparatively lower prevalence of oxalate stones while a higher prevalence of phosphate and struvite stones.

  17. Time-Resolved Soft X-ray Diffraction Reveals Transient Structural Distortions of Ternary Liquid Crystals

    Directory of Open Access Journals (Sweden)

    Klaus Mann

    2009-11-01

    Full Text Available Home-based soft X-ray time-resolved scattering experiments with nanosecond time resolution (10 ns and nanometer spatial resolution were carried out at a table top soft X-ray plasma source (2.2–5.2 nm. The investigated system was the lyotropic liquid crystal C16E7/paraffin/glycerol/formamide/IR 5. Usually, major changes in physical, chemical, and/or optical properties of the sample occur as a result of structural changes and shrinking morphology. Here, these effects occur as a consequence of the energy absorption in the sample upon optical laser excitation in the IR regime. The liquid crystal shows changes in the structural response within few hundred nanoseconds showing a time decay of 182 ns. A decrease of the Bragg peak diffracted intensity of 30% and a coherent macroscopic movement of the Bragg reflection are found as a response to the optical pump. The Bragg reflection movement is established to be isotropic and diffusion controlled (1 μs. Structural processes are analyzed in the Patterson analysis framework of the time-varying diffraction peaks revealing that the inter-lamellar distance increases by 2.7 Å resulting in an elongation of the coherently expanding lamella crystallite. The present studies emphasize the possibility of applying TR-SXRD techniques for studying the mechanical dynamics of nanosystems.

  18. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    Energy Technology Data Exchange (ETDEWEB)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru; Kuranova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp. gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.

  19. High temperature X-ray and neutron diffraction studies on zirconium oxide systems

    International Nuclear Information System (INIS)

    Turner, D.R.

    1980-04-01

    High and room temperature X-ray powder diffraction studies have been made on the monoclinic and tetragonal forms of zirconium dioxide (zirconia). The formation of low temperature tetragonal zirconia from pure and doped zirconium hydroxides has been studied as has the formation of high temperature tetragonal zirconia from monoclinic zirconia. The thermal expansions of monoclinic and high temperature tetragonal zirconia have been measured at temperatures up to 1100 deg C for monoclinic and 1300 deg C for tetragonal zirconia. Neutron powder diffraction profile analysis has been performed on monoclinic zirconia using the PANDA diffractometer at AERE Harwell. Data were collected at liquid helium temperature, room temperature and at up to 800 deg C. The results confirm the thermal expansion results from the X-ray study. In addition, the changes with temperature in fractional atomic coordinates and cell parameters have been used to compute the changes in relative atomic positions and interpreted in accordance with a proposed mechanism for the monoclinic to tetragonal transformation. The major movement is that of the Osub(II) (3-coordinate) oxygen atom. (author)

  20. In-line holography and coherent diffractive imaging with x-ray waveguides

    International Nuclear Information System (INIS)

    De Caro, L.; Giannini, C.; Guagliardi, A.; Pelliccia, D.; Mocuta, C.; Metzger, T. H.; Cedola, A.; Burkeeva, I.; Lagomarsino, S.

    2008-01-01

    A Fresnel coherent diffraction imaging experiment with hard x rays is here presented, using two planar crossed waveguides as optical elements, leading to a virtual pointlike source. The coherent wave field obtained with this setup is used to illuminate a micrometric single object having the shape of a butterfly. A digital two-dimensional in-line holographic reconstruction of the unknown object at low resolution (200 nm) has been obtained directly via fast Fourier transform (FFT) of the raw data. The object and its twin image are well separated because suitable geometrical conditions are satisfied. A good estimate of the incident wave field phase has been extracted directly from the FFT of the raw data. A partial object reconstruction with 50 nm spatial resolution was achieved by fast iterative phase retrieval, the major limitation for a full reconstruction being the nonideal structure of the guided beam. The method offers a route for fast and reliable phase retrieval in x-ray coherent diffraction