WorldWideScience

Sample records for single-nucleotide polymorphisms snps

  1. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  2. Novel single nucleotide polymorphisms (SNPs) of the bovine STAT4 ...

    African Journals Online (AJOL)

    USER

    2010-06-28

    Jun 28, 2010 ... 2College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, 210095, China. Accepted 8 ... molecular marker for the differentiation of various cattle populations and selection of the milk yield and fat content in ... polymorphism information contents; He, heterozygosites; Ea, effective ...

  3. Analysis of two single-nucleotide polymorphisms (SNPs) located in ...

    African Journals Online (AJOL)

    Administrator

    2011-06-13

    Jun 13, 2011 ... horse, donkey and zebra was done only on a 400 bp long fragment belonging to exon 4 of CSN3 gene (Hobor et al., 2008). No data concerning CSN3/PstI and CSN3/. BseYI gene polymorphisms in Equus asinus is available in literature yet. In the past, donkey breeding was a useful economical activity in ...

  4. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...

  5. Single nucleotide polymorphisms (SNPs) that map to gaps in the human SNP map

    OpenAIRE

    Tsui, Circe; Coleman, Laura E.; Griffith, Jacqulyn L.; Bennett, E. Andrew; Goodson, Summer G.; Scott, Jason D.; Pittard, W. Stephen; Devine, Scott E.

    2003-01-01

    An international effort is underway to generate a comprehensive haplotype map (HapMap) of the human genome represented by an estimated 300 000 to 1 million ‘tag’ single nucleotide polymorphisms (SNPs). Our analysis indicates that the current human SNP map is not sufficiently dense to support the HapMap project. For example, 24.6% of the genome currently lacks SNPs at the minimal density and spacing that would be required to construct even a conservative tag SNP map containing 300 000 SNPs. In...

  6. Single nucleotide polymorphisms (SNPs in coding regions of canine dopamine- and serotonin-related genes

    Directory of Open Access Journals (Sweden)

    Lingaas Frode

    2008-01-01

    Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.

  7. Profiling single nucleotide polymorphisms (SNPs) across intracellular folate metabolic pathway in healthy Indians.

    Science.gov (United States)

    Ghodke, Yogita; Chopra, Arvind; Shintre, Pooja; Puranik, Amrutesh; Joshi, Kalpana; Patwardhan, Bhushan

    2011-03-01

    Many pharmacologically-relevant polymorphisms show variability among different populations. Though limited, data from Caucasian subjects have reported several single nucleotide polymorphism (SNPs) in folate biosynthetic pathway. These SNPs may be subjected to racial and ethnic differences. We carried out a study to determine the allelic frequencies of these SNPs in an Indian ethnic population. Whole blood samples were withdrawn from 144 unrelated healthy subjects from west India. DNA was extracted and genotyping was performed using PCR-RFLP and Real-time Taqman allelic discrimination for 12 polymorphisms in 9 genes of folate-methotrexate (MTX) metabolism. Allele frequencies were obtained for MTHFR 677T (10%) and 1298 C (30%), TS 3UTR 0bp (46%), MDR1 3435T and 1236T (62%), RFC1 80A (57%), GGH 401T (61%), MS 2756G (34%), ATIC 347G (52%) and SHMT1 1420T (80%) in healthy subjects (frequency of underlined SNPs were different from published study data of European and African populations). The current study describes the distribution of folate biosynthetic pathway SNPs in healthy Indians and validates the previous finding of differences due to race and ethnicity. Our results pave way to study the pharmacogenomics of MTX in the Indian population.

  8. Identification and analysis of Single Nucleotide Polymorphisms (SNPs in the mosquito Anopheles funestus, malaria vector

    Directory of Open Access Journals (Sweden)

    Hemingway Janet

    2007-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common source of genetic variation in eukaryotic species and have become an important marker for genetic studies. The mosquito Anopheles funestus is one of the major malaria vectors in Africa and yet, prior to this study, no SNPs have been described for this species. Here we report a genome-wide set of SNP markers for use in genetic studies on this important human disease vector. Results DNA fragments from 50 genes were amplified and sequenced from 21 specimens of An. funestus. A third of specimens were field collected in Malawi, a third from a colony of Mozambican origin and a third form a colony of Angolan origin. A total of 494 SNPs including 303 within the coding regions of genes and 5 indels were identified. The physical positions of these SNPs in the genome are known. There were on average 7 SNPs per kilobase similar to that observed in An. gambiae and Drosophila melanogaster. Transitions outnumbered transversions, at a ratio of 2:1. The increased frequency of transition substitutions in coding regions is likely due to the structure of the genetic code and selective constraints. Synonymous sites within coding regions showed a higher polymorphism rate than non-coding introns or 3' and 5'flanking DNA with most of the substitutions in coding regions being observed at the 3rd codon position. A positive correlation in the level of polymorphism was observed between coding and non-coding regions within a gene. By genotyping a subset of 30 SNPs, we confirmed the validity of the SNPs identified during this study. Conclusion This set of SNP markers represents a useful tool for genetic studies in An. funestus, and will be useful in identifying candidate genes that affect diverse ranges of phenotypes that impact on vector control, such as resistance insecticide, mosquito behavior and vector competence.

  9. Single nucleotide polymorphisms (SNPs) that map to gaps in the human SNP map

    Science.gov (United States)

    Tsui, Circe; Coleman, Laura E.; Griffith, Jacqulyn L.; Bennett, E. Andrew; Goodson, Summer G.; Scott, Jason D.; Pittard, W. Stephen; Devine, Scott E.

    2003-01-01

    An international effort is underway to generate a comprehensive haplotype map (HapMap) of the human genome represented by an estimated 300 000 to 1 million ‘tag’ single nucleotide polymorphisms (SNPs). Our analysis indicates that the current human SNP map is not sufficiently dense to support the HapMap project. For example, 24.6% of the genome currently lacks SNPs at the minimal density and spacing that would be required to construct even a conservative tag SNP map containing 300 000 SNPs. In an effort to improve the human SNP map, we identified 140 696 additional SNP candidates using a new bioinformatics pipeline. Over 51 000 of these SNPs mapped to the largest gaps in the human SNP map, leading to significant improvements in these regions. Our SNPs will be immediately useful for the HapMap project, and will allow for the inclusion of many additional genomic intervals in the final HapMap. Nevertheless, our results also indicate that additional SNP discovery projects will be required both to define the haplotype architecture of the human genome and to construct comprehensive tag SNP maps that will be useful for genetic linkage studies in humans. PMID:12907734

  10. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    and briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing......Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... technologies (also called next generation sequencing or NGS) have the potential to completely transform forensic genetic investigations as we know them today. Here, we will make a short introduction to NGS and explain how NGS may combine analysis of the traditional forensic genetic markers with analysis...

  11. Identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp.

    Science.gov (United States)

    Fernández-No, I C; Böhme, K; Caamaño-Antelo, S; Barros-Velázquez, J; Calo-Mata, P

    2015-04-01

    The main goal of this work was the identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp. that may be useful for typing purposes. These species include, among others, Bacillus cereus, an important pathogenic species involved in food poisoning, and Bacillus licheniformis, Bacillus subtilis and Bacillus pumilus, which are causative agents of food spoilage described as responsible for foodborne disease outbreaks. With this purpose in mind, 52 Bacillus strains isolated from culture collections and fresh and processed food were considered. SNP type "Y" at sites 212 and 476 appeared in the majority of B. licheniformis studied strains. SNP type "R" at site 278 was detected in many strains of the B. subtilis/Bacillus amyloliquefaciens group, while polymorphism "Y" at site 173 was characteristic of the majority of strains of B. cereus/Bacillus thuringiensis group. The analysis of SNPs provided more intra-specific information than phylogenetic analysis in the cases of B. cereus and B. subtilis. Moreover, this study describes novel SNPs that should be considered when designing 16S rRNA-based primers and probes for multiplex-PCR, Real-Time PCR and microarray systems for foodborne Bacillus spp. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Optimisation and validation of methods to assess single nucleotide polymorphisms (SNPs) in archival histological material

    DEFF Research Database (Denmark)

    Andreassen, C N; Sørensen, Flemming Brandt; Overgaard, J

    2004-01-01

    only archival specimens are available. This study was conducted to validate protocols optimised for assessment of SNPs based on paraffin embedded, formalin fixed tissue samples. PATIENTS AND METHODS: In 137 breast cancer patients, three TGFB1 SNPs were assessed based on archival histological specimens...... precipitation). RESULTS: Assessment of SNPs based on archival histological material is encumbered by a number of obstacles and pitfalls. However, these can be widely overcome by careful optimisation of the methods used for sample selection, DNA extraction and PCR. Within 130 samples that fulfil the criteria...

  13. Screening of 134 single nucleotide polymorphisms (SNPs) previously associated with type 2 diabetes replicates association with 12 SNPs in nine genes.

    Science.gov (United States)

    Willer, Cristen J; Bonnycastle, Lori L; Conneely, Karen N; Duren, William L; Jackson, Anne U; Scott, Laura J; Narisu, Narisu; Chines, Peter S; Skol, Andrew; Stringham, Heather M; Petrie, John; Erdos, Michael R; Swift, Amy J; Enloe, Sareena T; Sprau, Andrew G; Smith, Eboni; Tong, Maurine; Doheny, Kimberly F; Pugh, Elizabeth W; Watanabe, Richard M; Buchanan, Thomas A; Valle, Timo T; Bergman, Richard N; Tuomilehto, Jaakko; Mohlke, Karen L; Collins, Francis S; Boehnke, Michael

    2007-01-01

    More than 120 published reports have described associations between single nucleotide polymorphisms (SNPs) and type 2 diabetes. However, multiple studies of the same variant have often been discordant. From a literature search, we identified previously reported type 2 diabetes-associated SNPs. We initially genotyped 134 SNPs on 786 index case subjects from type 2 diabetes families and 617 control subjects with normal glucose tolerance from Finland and excluded from analysis 20 SNPs in strong linkage disequilibrium (r(2) > 0.8) with another typed SNP. Of the 114 SNPs examined, we followed up the 20 most significant SNPs (P < 0.10) on an additional 384 case subjects and 366 control subjects from a population-based study in Finland. In the combined data, we replicated association (P < 0.05) for 12 SNPs: PPARG Pro12Ala and His447, KCNJ11 Glu23Lys and rs5210, TNF -857, SLC2A2 Ile110Thr, HNF1A/TCF1 rs2701175 and GE117881_360, PCK1 -232, NEUROD1 Thr45Ala, IL6 -598, and ENPP1 Lys121Gln. The replication of 12 SNPs of 114 tested was significantly greater than expected by chance under the null hypothesis of no association (P = 0.012). We observed that SNPs from genes that had three or more previous reports of association were significantly more likely to be replicated in our sample (P = 0.03), although we also replicated 4 of 58 SNPs from genes that had only one previous report of association.

  14. Genome-wide single nucleotide polymorphisms (SNPs) for a model invasive ascidian Botryllus schlosseri.

    Science.gov (United States)

    Gao, Yangchun; Li, Shiguo; Zhan, Aibin

    2018-04-01

    Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.

  15. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    Science.gov (United States)

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p caries occurrence in Polish children.

  16. Impact of Single Nucleotide Polymorphisms (SNPs on Immunosuppressive Therapy in Lung Transplantation

    Directory of Open Access Journals (Sweden)

    Jesus Ruiz

    2015-08-01

    Full Text Available Lung transplant patients present important variability in immunosuppressant blood concentrations during the first months after transplantation. Pharmacogenetics could explain part of this interindividual variability. We evaluated SNPs in genes that have previously shown correlations in other kinds of solid organ transplantation, namely ABCB1 and CYP3A5 genes with tacrolimus (Tac and ABCC2, UGT1A9 and SLCO1B1 genes with mycophenolic acid (MPA, during the first six months after lung transplantation (51 patients. The genotype was correlated to the trough blood drug concentrations corrected for dose and body weight (C0/Dc. The ABCB1 variant in rs1045642 was associated with significantly higher Tac concentration, at six months post-transplantation (CT vs. CC. In the MPA analysis, CT patients in ABCC2 rs3740066 presented significantly lower blood concentrations than CC or TT, three months after transplantation. Other tendencies, confirming previously expected results, were found associated with the rest of studied SNPs. An interesting trend was recorded for the incidence of acute rejection according to NOD2/CARD15 rs2066844 (CT: 27.9%; CC: 12.5%. Relevant SNPs related to Tac and MPA in other solid organ transplants also seem to be related to the efficacy and safety of treatment in the complex setting of lung transplantation.

  17. Gene therapy for the circumvention of inborn errors of metabolism (IEM) caused by single-nucleotide-polymorphisms (SNPs).

    Science.gov (United States)

    Wiseman, Alan

    2004-01-01

    Single nucleotide polymorphisms (SNPs) are the result of point mutations in nuclear (and mitochondrial) DNA. Such localised damage to DNA (and its replicative mechanisms) may not be excised fully by the DNA repair mechanism in the genome: and therefore can become inheritable; subsequently to manifest later as an inborn error of metabolism (IEM). Causes of mutagenic damage to the DNA can include background radiation (such as emitted by radon gas), and by reactive oxygen species (ROS): and also by mutagenic chemicals that occur naturally (inter alia in the diet). Other causes of DNA damage are variable environmental hazards such as solar-derived short wave ultraviolet light A. Gene therapy involves the placement of missing genes into particular tissues by the harnessing of suitable vectors (originally these were animal viruses such as SV40). For example, gene therapy in the rat for diabetes has succeeded by liver-production of insulin (using genes obtained from pancreatic Islets of Langerhans cells). Many inborn errors of metabolism could be treated in this way: examples may include 100 haemoglobinopathies (such as sickle cell anaemia), phenylketonuria; and other diseases caused by lack of tissue-production of a particular enzyme (in its catalytically-active conformation).

  18. Transcriptome profiling and validation of gene based single nucleotide polymorphisms (SNPs) in sorghum genotypes with contrasting responses to cold stress.

    Science.gov (United States)

    Chopra, Ratan; Burow, Gloria; Hayes, Chad; Emendack, Yves; Xin, Zhanguo; Burke, John

    2015-12-09

    Sorghum is a versatile cereal crop, with excellent heat and drought tolerance. However, it is susceptible to early-season cold stress (12-15 °C) which limits stand-establishment and seedling growth. To gain further insights on the molecular mechanism of cold tolerance in sorghum we performed transcriptome profiling between known cold sensitive and tolerant sorghum lines using RNA sequencing technology under control and cold stress treatments. Here we report on the identification of differentially expressed genes (DEGs) between contrasting sorghum genotypes, HongkeZi (cold tolerant) and BTx623 (cold sensitive) under cool and control temperatures using RNAseq approach to elucidate the molecular basis of sorghum response to cold stress. Furthermore, we validated bi-allelic variants in the form of single nucleotide polymorphism (SNPs) between the cold susceptible and tolerant lines of sorghum. An analysis of transcriptome profile showed that in response to cold, a total of 1910 DEGs were detected under cold and control temperatures in both genotypes. We identified a subset of genes under cold stress for downstream analysis, including transcription factors that exhibit differential abundance between the sensitive and tolerant genotypes. We identified transcription factors including Dehydration-responsive element-binding factors, C-repeat binding factors, and Ethylene responsive transcription factors as significantly upregulated during cold stress in cold tolerant HKZ. Additionally, specific genes such as plant cytochromes, glutathione s-transferases, and heat shock proteins were found differentially regulated under cold stress between cold tolerant and susceptible genotype of sorghum. A total of 41,603 SNP were identified between the cold sensitive and tolerant genotypes with minimum read of four. Approximately 89 % of the 114 SNP sites selected for evaluation were validated using endpoint genotyping technology. A new strategy which involved an integrated analysis of

  19. Single-nucleotide polymorphisms in peroxisome proliferator ...

    Indian Academy of Sciences (India)

    Prakash

    the metabolic syndrome (MS) and type 2 diabetes. We also investigated the correlation of these two single-nucleotide polymorphisms (SNPs) with plasma resistin levels. The C1431T SNP was associated with higher levels of plasma resistin (P = 0.017). Furthermore, C1431T was associated with resistin in different tertiles.

  20. Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

    Directory of Open Access Journals (Sweden)

    Kourosh Bamdad

    2016-12-01

    Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

  1. Identification of single nucleotide polymorphisms (SNPs) at candidate genes involved in abiotic stress in two Prosopis species of hybrids

    OpenAIRE

    Maria F. Pomponio; Susana Marcucci Poltri; Diego Lopez Lauenstein; Susana Torales

    2014-01-01

    Aim of the study: Identify and compare SNPs on candidate genes related to abiotic stress in Prosopis chilensis, Prosopis flexuosa and interspecific hybridsArea of the study: Chaco árido, Argentina. Material and Methods: Fragments from 6 candidate genes were sequenced in 60 genotypes. DNA polymorphisms were analyzed.Main Results: The analysis revealed that the hybrids had the highest rate of polymorphism, followed by P. flexuosa and P. chilensis, the values found are comparable to other forest...

  2. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  3. Identification of single nucleotide polymorphisms (SNPs at candidate genes involved in abiotic stress in two Prosopis species of hybrids

    Directory of Open Access Journals (Sweden)

    Maria F. Pomponio

    2014-12-01

    Full Text Available Aim of the study: Identify and compare SNPs on candidate genes related to abiotic stress in Prosopis chilensis, Prosopis flexuosa and interspecific hybridsArea of the study: Chaco árido, Argentina. Material and Methods: Fragments from 6 candidate genes were sequenced in 60 genotypes. DNA polymorphisms were analyzed.Main Results: The analysis revealed that the hybrids had the highest rate of polymorphism, followed by P. flexuosa and P. chilensis, the values found are comparable to other forest tree species.Research highlights: This approach will help to study genetic diversity variation on natural populations for assessing the effects of environmental changes.Keywords: SNPs; abiotic stress; interspecific variation; molecular markers. 

  4. Transcriptome-Wide Single Nucleotide Polymorphisms (SNPs for Abalone (Haliotis midae: Validation and Application Using GoldenGate Medium-Throughput Genotyping Assays

    Directory of Open Access Journals (Sweden)

    Rouvay Roodt-Wilding

    2013-09-01

    Full Text Available Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and Single Nucleotide Polymorphisms (SNPs . Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%−69% conversion rate (percentage polymorphic markers with a global genotyping success rate of 76%−85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174 were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50 located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

  5. Validation of a single nucleotide polymorphism (SNP) typing assay with 49 SNPs for forensic genetic testing in a laboratory accredited according to the ISO 17025 standard

    DEFF Research Database (Denmark)

    Børsting, Claus; Rockenbauer, Eszter; Morling, Niels

    2009-01-01

    cases and 33 twin cases were typed at least twice for the 49 SNPs. All electropherograms were analysed independently by two expert analysts prior to approval. Based on these results, detailed guidelines for analysis of the SBE products were developed. With these guidelines, the peak height ratio...... of a heterozygous allele call or the signal to noise ratio of a homozygous allele call is compared with previously obtained ratios. A laboratory protocol for analysis of SBE products was developed where allele calls with unusual ratios were highlighted to facilitate the analysis of difficult allele calls......A multiplex assay with 49 autosomal single nucleotide polymorphisms (SNPs) developed for human identification was validated for forensic genetic casework and accredited according to the ISO 17025 standard. The multiplex assay was based on the SNPforID 52plex SNP assay [J.J. Sanchez, C. Phillips, C...

  6. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Science.gov (United States)

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  7. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse - gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same ...

  8. Evaluation of a microarray-hybridization based method applicable for discovery of single nucleotide polymorphisms (SNPs) in the Pseudomonas aeruginosa genome

    Science.gov (United States)

    Dötsch, Andreas; Pommerenke, Claudia; Bredenbruch, Florian; Geffers, Robert; Häussler, Susanne

    2009-01-01

    Background Whole genome sequencing techniques have added a new dimension to studies on bacterial adaptation, evolution and diversity in chronic infections. By using this powerful approach it was demonstrated that Pseudomonas aeruginosa undergoes intense genetic adaptation processes, crucial in the development of persistent disease. The challenge ahead is to identify universal infection relevant adaptive bacterial traits as potential targets for the development of alternative treatment strategies. Results We developed a microarray-based method applicable for discovery of single nucleotide polymorphisms (SNPs) in P. aeruginosa as an easy and economical alternative to whole genome sequencing. About 50% of all SNPs theoretically covered by the array could be detected in a comparative hybridization of PAO1 and PA14 genomes at high specificity (> 0.996). Variations larger than SNPs were detected at much higher sensitivities, reaching nearly 100% for genetic differences affecting multiple consecutive probe oligonucleotides. The detailed comparison of the in silico alignment with experimental hybridization data lead to the identification of various factors influencing sensitivity and specificity in SNP detection and to the identification of strain specific features such as a large deletion within the PA4684 and PA4685 genes in the Washington Genome Center PAO1. Conclusion The application of the genome array as a tool to identify adaptive mutations, to depict genome organizations, and to identify global regulons by the "ChIP-on-chip" technique will expand our knowledge on P. aeruginosa adaptation, evolution and regulatory mechanisms of persistence on a global scale and thus advance the development of effective therapies to overcome persistent disease. PMID:19152677

  9. Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

    International Nuclear Information System (INIS)

    Kerns, Sarah L.; Ostrer, Harry; Stock, Richard; Li, William; Moore, Julian; Pearlman, Alexander; Campbell, Christopher; Shao Yongzhao; Stone, Nelson; Kusnetz, Lynda; Rosenstein, Barry S.

    2010-01-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score ≤7) and 52 control subjects (post-treatment SHIM score ≥16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, located in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10 -8 , Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value -6 . Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened. This study demonstrates

  10. Review Single nucleotide polymorphism in genome-wide ...

    African Journals Online (AJOL)

    Genome-wide patterns of variation across individuals provide most powerful source of data for uncovering the history of migration, expansion, and adaptation of the human population. The arrival of new technologies that type more than millions of the single nucleotide polymorphisms (SNPs) in a single experiment has ...

  11. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    2015-11-28

    Nov 28, 2015 ... SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same region of human KRAS. We ... and Merkulova TI 2015 Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human KRAS gene. J. Biosci. .... Membranes were blocked with 5% nonfat dried milk,.

  12. Single nucleotide polymorphisms in ghrelin gene and the resulting ...

    African Journals Online (AJOL)

    Ghrelin is a growth hormone releasing peptide which also affects feed intake in chickens. Ghrelin is encoded by chicken ghrelin gene (cGHRL) found in chromosome 7. Single nucleotide polymorphisms (SNPs) have been reported in cGHRL in Chinese native chickens, but such studies have not been carried out in chickens ...

  13. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  14. Secreted protein gene derived-single nucleotide polymorphisms (SP-SNPs) reveal population diversity and differentiation of Puccinia striiformis f. sp. tritici in the United States.

    Science.gov (United States)

    Xia, Chongjing; Wan, Anmin; Wang, Meinan; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2016-05-01

    Single nucleotide polymorphism (SNP) is a powerful molecular marker technique that has been widely used in population genetics and molecular mapping studies for various organisms. However, the technique has not been used for studying Puccinia striiformis f. sp. tritici (Pst), the wheat stripe rust pathogen. In this study, we developed over a hundred secreted protein gene-derived SNP (SP-SNP) markers and used 92 markers to study the population structure of Pst. From 352 isolates collected in the United States, we identified 242 multi-locus genotypes. The SP-SNP genotypes had a moderate, but significant correlation with the virulence phenotype data. Clustering of the multi-locus genotypes was consistent by various analyses, revealing distinct genetic groups. Analysis of molecular variance detected significant differences between the eastern and western US Pst populations. High heterozygosity was found in the US population with significant differences identified among epidemiological regions. Analysis of population differentiation revealed that populations between the eastern and western US were highly differentiated while moderate differentiation was found in populations within the western or eastern US. Isolates from the western US were more diverse than isolates from the eastern US. The information is useful for guiding the disease management in different epidemiological regions. Published by Elsevier Ltd.

  15. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  16. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  17. Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

    International Nuclear Information System (INIS)

    Shi, Jinna; Song, Tao; Jiao, Xiaohui; Qin, Chunlin; Zhou, Jin

    2011-01-01

    Highlights: → IRF6 rs642961 polymorphism is intensively associated with NSCLP. → IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. → This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene in several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern

  18. Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Jinna, E-mail: kqkjk@yahoo.com.cn [Department of Periodontology, The First Affiliated Hospital, Harbin Medical University, Harbin (China); Song, Tao; Jiao, Xiaohui [Department of Oral Maxillofacial Surgery, The First Affiliated Hospital, Harbin Medical University, Harbin (China); Qin, Chunlin [Department of Biomedical Sciences, Texas A and M Health Science Center, Baylor College of Dentistry, Dallas, TX (United States); Zhou, Jin [Department of Hematology, The First Affiliated Hospital, Harbin Medical University, Harbin (China)

    2011-07-15

    Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene in several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this

  19. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Iatsyshyna A. P.

    2013-09-01

    Full Text Available High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs on the MGMT gene expression and activity of the enzyme. SNPs have been suggested to be the factors which influence the levels of interindividual variability of the MGMT expression. Therefore, the aim of this paper was to review the experimental data on SNPs of the human MGMT gene, which are associated with cancer, as well as on location of MGMT-SNPs in regulatory and protein-coding regions of the gene in relation to its regulation. Lots of MGMT SNPs, which could affect the gene expression and result in interindividual MGMT variability or the enzyme resistance to pseudosubstrate inhibitors, have been re- vealed within the promoter and enhancer regions, the 5'- and 3'-UTRs and introns of the MGMT gene, as well as within the protein-coding region. Many of them may have regulatory effect.

  20. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  1. Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

    Science.gov (United States)

    Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

    2017-06-01

    Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

  2. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  3. Three novel single-nucleotide polymorphisms of the bovine LHX3 ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    In this study, polymerase chain reaction-single strand conformation polymorphism. (PCR-SSCP) and DNA sequencing methods were employed to screen the genetic variations within the bovine LHX3 gene in 802 Chinese indigenous cattle. The results revealed three novel single-nucleotide polymorphisms (SNPs):.

  4. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Larsen, A.V.; Poulsen, L.; Birgens, H.

    2008-01-01

    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices...... and 5.6 mu m were functionalized with biotin-labeled oligonucleotides for the detection of a mutant (Mt) or wild-type (Wt) DNA sequence in the HBB gene, respectively. Hybridization to functionalized beads was performed with fluorescent targets comprising synthetic DNA oligonucleotides or amplified RNA......, synthesized using human DNA samples from individuals with point mutations in the HBB gene. Following a stringent wash, the beads were separated in a PFF device and the fluorescent signal from the beads was analyzed. Patients being wildtypes, heterozygotes or mutated respectively for the investigated mutation...

  5. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...

  6. Determining Candidate Single Nucleotide Polymorphisms in Acquired Laryngotracheal Stenosis.

    Science.gov (United States)

    Anis, Mursalin M; Krynetskaia, Natalia; Zhao, Zhigen; Krynetskiy, Evgeny; Soliman, Ahmed M S

    2018-03-01

    Despite wide adoption of strategies to prevent injury from prolonged intubation and tracheotomy, acquired laryngotracheal stenosis (ALTS) has not disappeared. ALTS' persistence may be due to patient factors that confer unique susceptibility for some. We sought to identify genetic markers in genes associated with wound healing that could be associated with ALTS. Case-control study. One hundred thirty-eight patients were recruited, 53 patients with ALTS and 85 control patients who underwent intubation or tracheotomy without evidence of ALTS. The patients' DNA was isolated from whole blood. Custom primers were designed, and the TaqMan assay employing allele-specific polymerase chain reaction was used to interrogate single nucleotide polymorphisms (SNPs) rs1799750, rs522616, rs2276109, rs2569190, rs1800469, and rs1024611 of candidate wound healing genes MMP1, MMP3, MMP12, CD14, TGFβ1, and MCP1, respectively. A logistic regression model was used to examine the association of candidate gene polymorphisms with the presence or absence of ALTS. All 138 patients were successfully genotyped. No significant association was found between candidate SNPs and development of ALTS in the overall group. However, subgroup analysis within each ethnicity identified SNPs that are associated with ALTS depending upon the ethnic background. Patient factors such as variations in wound healing due to functional SNPs may shed light on the development of ALTS. There may be a difference in susceptibility to developing ALTS in different ethnic backgrounds. These preliminary findings need to be corroborated in larger population studies. 3b. Laryngoscope, 128:E111-E116, 2018. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

  7. Single nucleotide polymorphisms (SNPs) distribution patterns in ...

    African Journals Online (AJOL)

    Administrator

    2011-09-21

    Sep 21, 2011 ... Pit-1 is a pituitary-specific transcription factor responsible for pituitary development and hormone expression in ... It was shown that this group of proteins control the transcription of the growth hormone (GH), the prolactin (PRL), the ..... genomic structure of the bovine Pit-1 gene and characterization of a.

  8. Single nucleotide polymorphisms (SNPs at CDH1 promoter region in familial gastric cancer Polimorfismos de nucleótido único (SNPs en la región promotora CDH1 en cáncer gástrico familiar

    Directory of Open Access Journals (Sweden)

    A. Ramos-de la Medina

    2006-01-01

    Full Text Available Introduction: gastric cancer is the most frequent gastrointestinal malignancy in Mexico and the proportion of patients younger than 40 years is one of the highest reported in the world literature. Recently several families with familial diffuse gastric cancer have been identified at the National Institute of Medical Sciences and Nutrition. Germline mutations in the E-cadherin gene (CHD1 have been described that result in the development of diffuse hereditary gastric cancer in young patients. Methods: the complete coding sequence at exons 1 to 16 and the promoter region of CDH1 was amplified by polymerase chain reaction in peripheral blood samples of two patients with early onset familial diffuse gastric cancer. Results: no germline inactivating mutations of CHD1 were found on either patient. Single nucleotide polymorphisms -160 C→A were detected in the promoter region of CDH1 in both patients. Conclusions: the polymorphism -160 C→A theoretically confers an increased risk of developing diffuse gastric cancer. The relatives of these patients may an increased risk of gastric cancer among other tumors. There is presently not enough evidence to consider the -160 C→A polymorphism an etiologic factor of diffuse gastric cancer in these patients since the frequency and type of genetic alterations of CDH1 are largely unknown in the Mexican population. It will be necessary to conduct epidemiologic studies in the Mexican population to determine the influence that genetic alterations have on the genesis of diffuse gastric carcinoma.Introducción: el cáncer gástrico es la neoplasia más frecuente del tracto gastrointestinal en México y la proporción de pacientes menores de 40 años es una de las más altas reportadas en la literatura mundial. Recientemente se han identificado en el Instituto Nacional de Ciencias Médicas y Nutrición varias familias con cáncer gástrico difuso familiar. Múltiples mutaciones germinales del gene de E-cadherina (CHD1

  9. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  10. Evolutionary algorithms for the selection of single nucleotide polymorphisms.

    Science.gov (United States)

    Hubley, Robert M; Zitzler, Eckart; Roach, Jared C

    2003-07-23

    Large databases of single nucleotide polymorphisms (SNPs) are available for use in genomics studies. Typically, investigators must choose a subset of SNPs from these databases to employ in their studies. The choice of subset is influenced by many factors, including estimated or known reliability of the SNP, biochemical factors, intellectual property, cost, and effectiveness of the subset for mapping genes or identifying disease loci. We present an evolutionary algorithm for multiobjective SNP selection. We implemented a modified version of the Strength-Pareto Evolutionary Algorithm (SPEA2) in Java. Our implementation, Multiobjective Analyzer for Genetic Marker Acquisition (MAGMA), approximates the set of optimal trade-off solutions for large problems in minutes. This set is very useful for the design of large studies, including those oriented towards disease identification, genetic mapping, population studies, and haplotype-block elucidation. Evolutionary algorithms are particularly suited for optimization problems that involve multiple objectives and a complex search space on which exact methods such as exhaustive enumeration cannot be applied. They provide flexibility with respect to the problem formulation if a problem description evolves or changes. Results are produced as a trade-off front, allowing the user to make informed decisions when prioritizing factors. MAGMA is open source and available at http://snp-magma.sourceforge.net. Evolutionary algorithms are well suited for many other applications in genomics.

  11. Evolutionary algorithms for the selection of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zitzler Eckart

    2003-07-01

    Full Text Available Abstract Background Large databases of single nucleotide polymorphisms (SNPs are available for use in genomics studies. Typically, investigators must choose a subset of SNPs from these databases to employ in their studies. The choice of subset is influenced by many factors, including estimated or known reliability of the SNP, biochemical factors, intellectual property, cost, and effectiveness of the subset for mapping genes or identifying disease loci. We present an evolutionary algorithm for multiobjective SNP selection. Results We implemented a modified version of the Strength-Pareto Evolutionary Algorithm (SPEA2 in Java. Our implementation, Multiobjective Analyzer for Genetic Marker Acquisition (MAGMA, approximates the set of optimal trade-off solutions for large problems in minutes. This set is very useful for the design of large studies, including those oriented towards disease identification, genetic mapping, population studies, and haplotype-block elucidation. Conclusion Evolutionary algorithms are particularly suited for optimization problems that involve multiple objectives and a complex search space on which exact methods such as exhaustive enumeration cannot be applied. They provide flexibility with respect to the problem formulation if a problem description evolves or changes. Results are produced as a trade-off front, allowing the user to make informed decisions when prioritizing factors. MAGMA is open source and available at http://snp-magma.sourceforge.net. Evolutionary algorithms are well suited for many other applications in genomics.

  12. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  13. Three novel single-nucleotide polymorphisms of the bovine LHX3 ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Keywords. Bovine; genetic variation; LHX3 gene; PCR-SSCP; single-nucleotide polymorphisms (SNPs). Abbreviations used: ACTH, adrenocorticotrophic hormone; CPHD, combined pituitary hormone deficiency; CNS, central nervous system; FSH, follicle-stimulating hormone; GH, growth hormone; LH, luteotrophic hormone ...

  14. Single nucleotide polymorphism discovery in elite north american potato germplasm

    Directory of Open Access Journals (Sweden)

    De Jong Walter S

    2011-06-01

    Full Text Available Abstract Background Current breeding approaches in potato rely almost entirely on phenotypic evaluations; molecular markers, with the exception of a few linked to disease resistance traits, are not widely used. Large-scale sequence datasets generated primarily through Sanger Expressed Sequence Tag projects are available from a limited number of potato cultivars and access to next generation sequencing technologies permits rapid generation of sequence data for additional cultivars. When coupled with the advent of high throughput genotyping methods, an opportunity now exists for potato breeders to incorporate considerably more genotypic data into their decision-making. Results To identify a large number of Single Nucleotide Polymorphisms (SNPs in elite potato germplasm, we sequenced normalized cDNA prepared from three commercial potato cultivars: 'Atlantic', 'Premier Russet' and 'Snowden'. For each cultivar, we generated 2 Gb of sequence which was assembled into a representative transcriptome of ~28-29 Mb for each cultivar. Using the Maq SNP filter that filters read depth, density, and quality, 575,340 SNPs were identified within these three cultivars. In parallel, 2,358 SNPs were identified within existing Sanger sequences for three additional cultivars, 'Bintje', 'Kennebec', and 'Shepody'. Using a stringent set of filters in conjunction with the potato reference genome, we identified 69,011 high confidence SNPs from these six cultivars for use in genotyping with the Infinium platform. Ninety-six of these SNPs were used with a BeadXpress assay to assess allelic diversity in a germplasm panel of 248 lines; 82 of the SNPs proved sufficiently informative for subsequent analyses. Within diverse North American germplasm, the chip processing market class was most distinct, clearly separated from all other market classes. The round white and russet market classes both include fresh market and processing cultivars. Nevertheless, the russet and round

  15. Single nucleotide polymorphism in genome-wide association of ...

    African Journals Online (AJOL)

    Mohd Fareed

    2012-09-25

    Sep 25, 2012 ... The arrival of new technologies that type more than millions of the single nucleotide polymor- phisms (SNPs) in .... Rapid advances in technology ...... carriers. Neuron. 2007;54:713–20. [97] Baum AE, Akula N, Cabanero M, et al. A genome-wide association study implicates diacylglycerol kinase eta (DGKH).

  16. Detection of MspI polymorphism and the single nucleotide ...

    African Journals Online (AJOL)

    The aim of this study was to detect the genetic polymorphism of GH gene in five camel breeds reared in Egypt which are Sudany, Somali, Mowaled, Maghrabi and Falahy, using polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) technique. Also, this work aimed to identify the single nucleotide ...

  17. Compositions and methods for detecting single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  18. Single-nucleotide polymorphisms in peroxisome proliferator ...

    Indian Academy of Sciences (India)

    However, association of these polymorphisms with the metabolic syndrome and its individual components has not been well investigated in the Indian population. The Indian population harbours the maximum number of diabetics in the world who are thus more susceptible to metabolic disorders. We screened a South ...

  19. An overview on single nucleotide polymorphism studies in mastitis research

    Directory of Open Access Journals (Sweden)

    V. N. Muhasin Asaf

    2014-06-01

    Full Text Available Mastitis is an inflammatory condition of the mammary gland caused by microorganisms as diverse as bacteria, viruses, mycoplasma, yeasts and algae. Mastitis is an economically devastating disease mainly affecting the crossbred cattle in India. Control strategies against mastitis includes antibiotic therapy, vaccination, improvements in dairy cattle husbandry, farm and feeding management etc. but has met with little success.. Mastitis tolerance/susceptibility is difficult to measure directly and hence milk somatic cell count (SCC or milk somatic cell score (SCS is used as an indicator trait for mastitis as both traits are highly positively correlated. Single nucleotide polymorphism (SNP marker is a single base change in a DNA sequence at a given position. SNP markers are the most preferred genetic markers nowadays. Currently most researches worldwide have been targeting molecular high density SNP markers that are linked to mastitis tolerance in an attempt to incorporate to understand the genetics of host resistance to mastitis and this knowledge will be helpful in formulating breeding programmes in an attempt to control mastitis. This article reviews various SNPs which are reported to be significantly associated with mastitis tolerance/susceptibility.

  20. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  1. Identification of sixteen single-nucleotide polymorphism markers in ...

    Indian Academy of Sciences (India)

    [Huang X., Wu S., Guan Y., Li Y. and He M. 2014 Development of sixteen single nucleotide polymorphism markers in the pearl oyster,. Pinctada fucata for .... P value. (. ◦. C) product allele and size (bp) frequency. PM5. As1: GCGGGCAGGGCGGCTGTGACTGCAGTGCATTAGGGT. 60. T 207. T. 0.3846 0.4212 0.5843.

  2. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  3. The association of single nucleotide polymorphism of interleukin-21 ...

    African Journals Online (AJOL)

    Yasmin Mohamed Ahmed

    2016-05-08

    May 8, 2016 ... duced by activated CD4+ T cells, natural killer T cells and T helper (Th) cells. There is increasing evidence that IL-21 contributes to the pathogenesis of SLE due to its biological activity. Aim of the study: To investigate the association between single nucleotide polymorphism (SNP) of IL-21 rs2221903 gene ...

  4. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the se...

  5. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

    DEFF Research Database (Denmark)

    Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael

    2002-01-01

    Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

  6. Myosin individualized: single nucleotide polymorphisms in energy transduction

    Directory of Open Access Journals (Sweden)

    Wieben Eric D

    2010-03-01

    Full Text Available Abstract Background Myosin performs ATP free energy transduction into mechanical work in the motor domain of the myosin heavy chain (MHC. Energy transduction is the definitive systemic feature of the myosin motor performed by coordinating in a time ordered sequence: ATP hydrolysis at the active site, actin affinity modulation at the actin binding site, and the lever-arm rotation of the power stroke. These functions are carried out by several conserved sub-domains within the motor domain. Single nucleotide polymorphisms (SNPs affect the MHC sequence of many isoforms expressed in striated muscle, smooth muscle, and non-muscle tissue. The purpose of this work is to provide a rationale for using SNPs as a functional genomics tool to investigate structurefunction relationships in myosin. In particular, to discover SNP distribution over the conserved sub-domains and surmise what it implies about sub-domain stability and criticality in the energy transduction mechanism. Results An automated routine identifying human nonsynonymous SNP amino acid missense substitutions for any MHC gene mined the NCBI SNP data base. The routine tested 22 MHC genes coding muscle and non-muscle isoforms and identified 89 missense mutation positions in the motor domain with 10 already implicated in heart disease and another 8 lacking sequence homology with a skeletal MHC isoform for which a crystallographic model is available. The remaining 71 SNP substitutions were found to be distributed over MHC with 22 falling outside identified functional sub-domains and 49 in or very near to myosin sub-domains assigned specific crucial functions in energy transduction. The latter includes the active site, the actin binding site, the rigid lever-arm, and regions facilitating their communication. Most MHC isoforms contained SNPs somewhere in the motor domain. Conclusions Several functional-crucial sub-domains are infiltrated by a large number of SNP substitution sites suggesting these

  7. Association between single-nucleotide polymorphisms and early spontaneous hepatitis B virus e antigen seroconversion in children

    OpenAIRE

    Komatsu, Haruki; Murakami, Jun; Inui, Ayano; Tsunoda, Tomoyuki; Sogo, Tsuyoshi; Fujisawa, Tomoo

    2014-01-01

    Background The disease progression following hepatitis B virus (HBV) infection is associated with single-nucleotide polymorphisms (SNPs). However, the role of SNPs in chronic HBV infection in children remains unclear. Here, we investigate the association between SNPs and early spontaneous hepatitis B e antigen (HBeAg) seroconversion in children with chronic hepatitis B infection. Methods This was a retrospective cohort study. We genotyped seven SNPs in the following genes, interleukin (IL)-10...

  8. Intracranial Aneurysm-Associated Single-Nucleotide Polymorphisms Alter Regulatory DNA in the Human Circle of Willis

    NARCIS (Netherlands)

    Laarman, Melanie D; Vermunt, Marit W; Kleinloog, Rachel; de Boer-Bergsma, Jelkje J; Huitinga, I.; Rinkel, Gabriël J E; Creyghton, Menno P; Mokry, Michal; Bakkers, Jeroen; Ruigrok, Ynte M

    BACKGROUND AND PURPOSE: Genome-wide association studies significantly link intracranial aneurysm (IA) to single-nucleotide polymorphisms (SNPs) in 6 genomic loci. To gain insight into the relevance of these IA-associated SNPs, we aimed to identify regulatory regions and analyze overall gene

  9. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    Real time polymerase chain reaction (RT-PCR) is a new technique in molecular genetics which allows quantifica- tion of polymorphic DNA regions and genotyping of sin- gle nucleotide polymorphisms (SNPs) in one run. A by- product of real time PCR is the opportunity to identify new SNPs in the proximity of gene loci of ...

  10. Modelling the contribution of family history and variation in single nucleotide polymorphisms to risk of schizophrenia

    DEFF Research Database (Denmark)

    Agerbo, Esben; Mortensen, Preben Bo; Wiuf, Carsten

    2012-01-01

    Epidemiological studies indicate that having any family member with schizophrenia increases the risk of schizophrenia in the probands. However, genome-wide association studies (GWAS) have accounted for little of this variation. The aim of this study was to use a population-based sample to explore...... the influence of single-nucleotide polymorphisms (SNPs) on the excess schizophrenia risk in offspring of parents with a psychotic, bipolar affective or other psychiatric disorder....

  11. Prediction of serotonin transporter promoter polymorphism genotypes from single nucleotide polymorphism arrays using machine learning methods.

    Science.gov (United States)

    Lu, Ake Tzu-Hui; Bakker, Steven; Janson, Esther; Cichon, Sven; Cantor, Rita M; Ophoff, Roel A

    2012-08-01

    The serotonin transporter gene (SLC6A4) and its promoter (5-HTTLPR) polymorphism have been the focus of a large number of association studies of behavioral traits and psychiatric disorders. However, large-scale genotyping of the polymorphism has been very difficult. We report the development and validation of a 5-HTTLPR genotype prediction model. The single nucleotide polymorphisms (SNPs) from the 2000 kb region surrounding 5-HTTLPR were used to construct a prediction model through a newly developed machine learning method, multicategory vertex discriminant analysis with 2147 individuals from the Northern Finnish Birth Cohort genotyped with the Illumina 370K SNP array and manually genotyped for 5-HTTLPR polymorphism. The prediction model was applied to SNP genotypes in a Dutch/German schizophrenia case-control sample of 3318 individuals to test the association of the polymorphism with schizophrenia. The prediction model of eight SNPs achieved a 92.4% accuracy rate and a 0.98±0.01 area under the receiving operating characteristic. Evidence for an association of the polymorphism with schizophrenia was observed (P=0.05, odds ratio=1.105). This prediction model provides an effective substitute of manually genotyped 5-HTTLPR alleles, providing a new approach for large scale association studies of this polymorphism.

  12. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  13. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  14. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  15. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  16. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  17. Single nucleotide polymorphisms of ADH1B, ADH1C and ALDH2 genes and esophageal cancer: A population-based case-control study in China

    NARCIS (Netherlands)

    Wu, M.; Chang, S.C.; Kampman, E.; Yang, J.; Wang, X.S.; Gu, X.P.; Han, R.Q.; Liu, A.M.; Wallar, G.; Zhou, J.Y.; Kok, F.J.; Zhao, J.K.; Zhang, Z.F.

    2013-01-01

    Alcohol drinking is a major risk factor for esophageal cancer (EC) and the metabolism of ethanol has been suggested to play an important role in esophageal carcinogenesis. Epidemiologic studies, including genomewide association studies (GWAS), have identified single nucleotide polymorphisms (SNPs)

  18. Exploration of deleterious single nucleotide polymorphisms in late-onset Alzheimer disease susceptibility genes.

    Science.gov (United States)

    Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A; Talluri, Venkateswar Rao

    2013-01-10

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are considered as biomarkers to disease susceptibility. In the present study, nsSNPs in CLU, PICALM and BIN1 genes were screened for their functional impact on concerned proteins and their plausible role in Alzheimer disease (AD) susceptibility. Initially, SNPs were retrieved from dbSNP database, followed by identification of potentially deleterious nsSNPs and prediction of their effect on proteins by PolyPhen and SIFT. Protein stability and the probability of mutation occurrence were predicted using I-Mutant and PANTHER respectively. SNPs3D and FASTSNP were used for the functional analysis of nsSNPs. The functional impact on the 3D structure of proteins was evaluated by SWISSPDB viewer and NOMAD-Ref server. On analysis, 3 nsSNPs with IDs rs12800974 (T158P) of PICALM and rs11554585 (R397C) and rs11554585 (N106D) of BIN1 were predicted to be functionally significant with higher scores of I-Mutant, SIFT, PolyPhen, PANTHER, FASTSNP and SNPs3D. The mutant models of these nsSNPs also showed very high energies and RMSD values compared to their native structures. Current study proposes that the three nsSNPs identified in this study constitute a unique resource of potential genetic factors for AD susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Association of polycystic ovary syndrome susceptibility single nucleotide polymorphism rs2479106 and PCOS in Caucasian patients with PCOS or hirsutism as referral diagnosis

    DEFF Research Database (Denmark)

    Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne

    2012-01-01

    Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women.......Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women....

  20. Detection of Single-Nucleotide Polymorphisms in Plasmodium falciparum by PCR Primer Extension and Lateral Flow Immunoassay

    NARCIS (Netherlands)

    Moers, A. P. H. A.; Hallett, R. L.; Burrow, R.; Schallig, H. D. F. H.; Sutherland, C. J.; van Amerongen, A.

    2015-01-01

    The resistance of Plasmodium falciparum to some antimalarial drugs is linked to single-nucleotide polymorphisms (SNPs). Currently, there are no methods for the identification of resistant parasites that are sufficiently simple, cheap, and fast enough to be performed at point-of-care, i.e., in local

  1. Single-nucleotide polymorphisms in the Toll-like receptor pathway increase susceptibility to infections in severely injured trauma patients

    NARCIS (Netherlands)

    M.W.G.A. Bronkhorst (Maarten); N.D.A. Boyé (Nicole); M.A.Z. Lomax (Miranda); R. Vossen (Rolf); J. Bakker (Jan); P. Patka (Peter); E.M.M. van Lieshout (Esther)

    2013-01-01

    textabstractBackground: Sepsis and subsequent multiple-organ failure are the predominant causes of late mortality in trauma patients. Susceptibility and response to infection is, in part, heritable. Single-nucleotide polymorphisms (SNPs) in Toll-like receptor (TLR) and cluster of differentiation 14

  2. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  3. Detection, Validation, and Application of Genotyping-by-Sequencing Based Single Nucleotide Polymorphisms in Upland Cotton

    Directory of Open Access Journals (Sweden)

    M. Sariful Islam

    2015-03-01

    Full Text Available The presence of two closely related subgenomes in the allotetraploid Upland cotton, combined with a narrow genetic base of the cultivated varieties, has hindered the identification of polymorphic genetic markers and their use in improving this important crop. Genotyping-by-sequencing (GBS is a rapid way to identify single nucleotide polymorphism (SNP markers; however, these SNPs may be specific to the sequenced cotton lines. Our objective was to obtain a large set of polymorphic SNPs with broad applicability to the cultivated cotton germplasm. We selected 11 diverse cultivars and their random-mated recombinant inbred progeny for SNP marker development via GBS. Two different GBS methodologies were used by Data2Bio (D2B and the Institute for Genome Diversity (IGD to identify 4441 and 1176 polymorphic SNPs with minor allele frequency of ≥0.1, respectively. We further filtered the SNPs and aligned their sequences to the diploid reference genome. We were able to use homeologous SNPs to assign 1071 SNP loci to the At subgenome and 1223 to the Dt subgenome. These filtered SNPs were located in genic regions about twice as frequently as expected by chance. We tested 111 of the SNPs in 154 diverse Upland cotton lines, which confirmed the utility of the SNP markers developed in such approach. Not only were the SNPs identified in the 11 cultivars present in the 154 cotton lines, no two cultivars had identical SNP genotypes. We conclude that GBS can be easily used to discover SNPs in Upland cotton, which can be converted to functional genotypic assays for use in breeding and genetic studies.

  4. A global perspective on hepatitis B-related single nucleotide polymorphisms and evolution during human migration.

    Science.gov (United States)

    Tai, Dar-In; Jeng, Wen-Juei; Lin, Chun-Yen

    2017-12-01

    Genome-wide association studies have indicated that human leukocyte antigen (HLA)-DP and HLA-DQ play roles in persistent hepatitis B virus (HBV) infection in Asia. To understand the evolution of HBV-related single nucleotide polymorphisms (SNPs) and to correlate these SNPs with chronic HBV infection among different populations, we conducted a global perspective study on hepatitis-related SNPs. We selected 12 HBV-related SNPs on the HLA locus and two HBV and three hepatitis C virus immune-related SNPs for analysis. Five nasopharyngeal carcinoma-related SNPs served as controls. All SNP data worldwide from 26 populations were downloaded from 1,000 genomes. We found a dramatic difference in the allele frequency in most of the HBV- and HLA-related SNPs in East Asia compared to the other continents. A sharp change in allele frequency in 8 of 12 SNPs was found between Bengali populations in Bangladesh and Chinese Dai populations in Xishuangbanna, China ( P human migration to East Asia. The prevalence of chronic HBV infection in Africa is as high as in Asia; however, the HBV-related SNP genotypes are not present in Africa, and so the genetic mechanism of chronic HBV infection in Africa needs further exploration. Conclusion: Two stages of genetic changes toward a weak immune response occurred when humans migrated out of Africa. These changes could be a survival strategy for avoiding cytokine storms and surviving in new environments. ( Hepatology Communications 2017;1:1005-1013).

  5. Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

    Science.gov (United States)

    Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

    2016-01-01

    Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

  6. A new single nucleotide polymorphisms typing method and device by bioluminometric assay coupled with a photodiode array

    Science.gov (United States)

    Kamahori, Masao; Harada, Kunio; Kambara, Hideki

    2002-11-01

    Easy and inexpensive single nucleotide polymorphisms (SNPs) typing systems are required for the practice of genetic testing as well as genetic medicine. Most of the SNPs typing systems use laser-induced fluorescence detection coupled with fluorophore tagging on DNA, which are expensive. A new simple and inexpensive SNPs typing system is presented. It uses a bioluminometric assay coupled with modified primer extension reactions and an inexpensive photodiode array for the luminometric detection. The reagents consumed in the assay are also inexpensive. Although the system is very small, simple and inexpensive, it gives enough sensitivity for detecting target DNAs as small as 10 fmol, which is good enough for SNPs typing.

  7. Bulk segregant analysis using single nucleotide polymorphism microarrays.

    Directory of Open Access Journals (Sweden)

    Anthony Becker

    2011-01-01

    Full Text Available Bulk segregant analysis (BSA using microarrays, and extreme array mapping (XAM have recently been used to rapidly identify genomic regions associated with phenotypes in multiple species. These experiments, however, require the identification of single feature polymorphisms (SFP between the cross parents for each new combination of genotypes, which raises the cost of experiments. The availability of the genomic polymorphism data in Arabidopsis thaliana, coupled with the efficient designs of Single Nucleotide Polymorphism (SNP genotyping arrays removes the requirement for SFP detection and lowers the per array cost, thereby lowering the overall cost per experiment. To demonstrate that these approaches would be functional on SNP arrays and determine confidence intervals, we analyzed hybridizations of natural accessions to the Arabidopsis ATSNPTILE array and simulated BSA or XAM given a variety of gene models, populations, and bulk selection parameters. Our results show a striking degree of correlation between the genotyping output of both methods, which suggests that the benefit of SFP genotyping in context of BSA can be had with the cheaper, more efficient SNP arrays. As a final proof of concept, we hybridized the DNA from bulks of an F2 mapping population of a Sulfur and Selenium ionomics mutant to both the Arabidopsis ATTILE1R and ATSNPTILE arrays, which produced almost identical results. We have produced R scripts that prompt the user for the required parameters and perform the BSA analysis using the ATSNPTILE1 array and have provided them as supplemental data files.

  8. SNPer: an R library for quantitative variant analysis on single nucleotide polymorphisms among influenza virus populations.

    Directory of Open Access Journals (Sweden)

    Unitsa Sangket

    Full Text Available Influenza virus (IFV can evolve rapidly leading to genetic drifts and shifts resulting in human and animal influenza epidemics and pandemics. The genetic shift that gave rise to the 2009 influenza A/H1N1 pandemic originated from a triple gene reassortment of avian, swine and human IFVs. More minor genetic alterations in genetic drift can lead to influenza drug resistance such as the H274Y mutation associated with oseltamivir resistance. Hence, a rapid tool to detect IFV mutations and the potential emergence of new virulent strains can better prepare us for seasonal influenza outbreaks as well as potential pandemics. Furthermore, identification of specific mutations by closely examining single nucleotide polymorphisms (SNPs in IFV sequences is essential to classify potential genetic markers associated with potentially dangerous IFV phenotypes. In this study, we developed a novel R library called "SNPer" to analyze quantitative variants in SNPs among IFV subpopulations. The computational SNPer program was applied to three different subpopulations of published IFV genomic information. SNPer queried SNPs data and grouped the SNPs into (1 universal SNPs, (2 likely common SNPs, and (3 unique SNPs. SNPer outperformed manual visualization in terms of time and labor. SNPer took only three seconds with no errors in SNP comparison events compared with 40 hours with errors using manual visualization. The SNPer tool can accelerate the capacity to capture new and potentially dangerous IFV strains to mitigate future influenza outbreaks.

  9. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    2015-01-01

    Full Text Available Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature.

  10. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  11. Genotyping of single nucleotide polymorphisms related to attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Tortajada-Genaro, Luis A; Mena, Salvador; Niñoles, Regina; Puigmule, Marta; Viladevall, Laia; Maquieira, Ángel

    2016-03-01

    Pharmacological treatment of several diseases, such as attention-deficit hyperactivity disorder (ADHD), presents marked variability in efficiency and its adverse effects. The genotyping of specific single nucleotide polymorphisms (SNPs) can support the prediction of responses to drugs and the genetic risk of presenting comorbidities associated with ADHD. This study presents two rapid and affordable microarray-based strategies to discriminate three clinically important SNPs in genes ADRA2A, SL6CA2, and OPRM1 (rs1800544, rs5569, and rs1799971, respectively). These approaches are allele-specific oligonucleotide hybridization (ASO) and a combination of allele-specific amplification (ASA) and solid-phase hybridization. Buccal swab and blood samples taken from ADHD patients and controls were analyzed by ASO, ASA, and a gold-reference method. The results indicated that ASA is superior in genotyping capability and analytical performance.

  12. Mitochondrial localization of the OAS1 p46 isoform associated with a common single nucleotide polymorphism

    DEFF Research Database (Denmark)

    Kjær, Karina Hansen; Pahus, Jytte; Hansen, Mariann Fagernæs

    2014-01-01

    cellular RNAs which in turn inhibits protein translation and induces apoptosis. Several single nucleotide polymorphisms (SNPs) in the OAS1 gene have been associated with disease. We have investigated the functional effect of two common SNPs in the OAS1 gene. The SNP rs10774671 affects splicing to one...... vacuoles/lysosomes. By using recombinantly expressed OAS1 mutant proteins, we found that the OAS1 SNP rs1131454 (former rs3741981) did not affect the enzymatic OAS1 activity. Conclusions: The SNP rs10774671 determines differential expression of the OAS1 isoforms. In Daudi and HT1080 cells the p46 isoform......Abstract Background: The expression of 2′-5′-Oligoadenylate synthetases (OASs) is induced by type 1 Interferons (IFNs) in response to viral infection. The OAS proteins have a unique ability to produce 2′-5′ Oligoadenylates, which bind and activate the ribonuclease RNase L. The RNase L degrades...

  13. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

    Science.gov (United States)

    2013-01-01

    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  14. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    Summary We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jka/Jkb, Fya/Fyb, S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.–, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine. PMID:21113257

  15. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  16. Evaluating melanocytic lesions with single nucleotide polymorphism (SNP) chromosomal microarray.

    Science.gov (United States)

    Hedayat, Amin A; Linos, Konstantinos; Jung, Hou-Sung; Tafe, Laura J; Yan, Shaofeng; LeBlanc, Robert E; Lefferts, Joel A

    2017-12-01

    Histopathology is the gold standard for diagnosing melanocytic lesions; however, distinguishing benign versus malignant is not always clear histologically. Single nucleotide polymorphism (SNP) microarray analysis may help in making a definitive diagnosis. Here, we share our experience with the Oncoscan FFPE Assay and demonstrate its diagnostic utility in the context of ambiguous melanocytic lesions. Eleven archival melanocytic lesions, including three benign nevi, four melanomas, three BAP1-deficient Spitzoid nevi and one nevoid melanoma were selected for validation. SNP-array was performed according to the manufacturer's protocol, using the recommended 80ng of DNA; however, as little as 15ng was used if the extraction yield was lower. Concordance was assessed with H&E and various combinations of BAP1 and p16 immunohistochemical stains (IHC) and external reference laboratory chromosomal microarray results. After validation, the SNP array was utilized to make definitive diagnoses in four challenging cases. Oncoscan SNP array findings were in concordance with H&E, IHC, and reference laboratory chromosomal microarray testing. The SNP-based microarray can accurately detect copy number changes and aid in making a more definitive diagnosis of challenging melanocytic lesions. This can be accomplished using significantly less DNA than is required by other microarray technologies. Copyright © 2017. Published by Elsevier Inc.

  17. Association of the DIO2 gene single nucleotide polymorphisms with recurrent depressive disorder.

    Science.gov (United States)

    Gałecka, Elżbieta; Talarowska, Monika; Orzechowska, Agata; Górski, Paweł; Bieńkiewicz, Małgorzata; Szemraj, Janusz

    2015-01-01

    Genetic factors may play a role in the etiology of depressive disorder. The type 2 iodothyronine deiodinase gene (DIO2) encoding the enzyme catalyzing the conversion of T4 to T3 is suggested to play a role in the recurrent depressive disorder (rDD). The current study investigates whether a specific single nucleotide polymorphism (SNP) of the DIO2 gene, Thr92Ala (T/C); rs 225014 or ORFa-Gly3Asp (C/T); rs 12885300, correlate with the risk for recurrent depression. Genotypes for these two single nucleotide polymorphisms (SNPs) were determined in 179 patients meeting the ICD-10 criteria for rDD group and in 152 healthy individuals (control group) using a polymerase chain reaction (PCR) based method. The specific variant of the DIO2 gene, namely the CC genotype of the Thr92Ala polymorphism, was more frequently found in healthy subjects than in patients with depression, what suggests that it could potentially serve as a marker of a lower risk for recurrent depressive disorder. The distribution of four haplotypes was also significantly different between the two study groups with the TC (Thr-Gly) haplotype more frequently detected in patients with depression. In conclusion, data generated from this study suggest for the first time that DIO2 gene may play a role in the etiology of the disease, and thus should be further investigated.

  18. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    OpenAIRE

    Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto

    2010-01-01

    Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T > C and GQ183900:g.156T > C, the latter loc...

  19. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J; Lu, Xiangyi; Ruden, Douglas M

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w(1118); iso-2; iso-3 strain and the reference y(1); cn(1) bw(1) sp(1) strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5'UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5' and 3' UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory.

  20. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...... constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF......, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10...

  1. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    Science.gov (United States)

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Single nucleotide polymorphism discovery in albacore and Atlantic bluefin tuna provides insights into worldwide population structure.

    Science.gov (United States)

    Albaina, A; Iriondo, M; Velado, I; Laconcha, U; Zarraonaindia, I; Arrizabalaga, H; Pardo, M A; Lutcavage, M; Grant, W S; Estonba, A

    2013-12-01

    The optimal management of the commercially important, but mostly over-exploited, pelagic tunas, albacore (Thunnus alalunga Bonn., 1788) and Atlantic bluefin tuna (BFT; Thunnus thynnus L., 1758), requires a better understanding of population structure than has been provided by previous molecular methods. Despite numerous studies of both species, their population structures remain controversial. This study reports the development of single nucleotide polymorphisms (SNPs) in albacore and BFT and the application of these SNPs to survey genetic variability across the geographic ranges of these tunas. A total of 616 SNPs were discovered in 35 albacore tuna by comparing sequences of 54 nuclear DNA fragments. A panel of 53 SNPs yielded FST values ranging from 0.0 to 0.050 between samples after genotyping 460 albacore collected throughout the distribution of this species. No significant heterogeneity was detected within oceans, but between-ocean comparisons (Atlantic, Pacific and Indian oceans along with Mediterranean Sea) were significant. Additionally, a 17-SNP panel was developed in Atlantic BFT by cross-species amplification in 107 fish. This limited number of SNPs discriminated between samples from the two major spawning areas of Atlantic BFT (FST  = 0.116). The SNP markers developed in this study can be used to genotype large numbers of fish without the need for standardizing alleles among laboratories. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  3. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  4. Relationship between pancreatic intraepithelial neoplasias, pancreatic ductal adenocarcinomas, and single nucleotide polymorphisms in autopsied elderly patients.

    Science.gov (United States)

    Matsuda, Yoko; Tanaka, Masashi; Sawabe, Motoji; Mori, Seijiro; Muramatsu, Masaaki; Mieno, Makiko Naka; Furukawa, Toru; Arai, Tomio

    2018-01-01

    We comparatively analyzed serially autopsied, elderly Japanese patients (n = 2205) with pancreatic intraepithelial neoplasias (PanINs) and pancreatic ductal adenocarcinomas (PDACs) on the basis of their pancreatic lesions, clinical information, and single nucleotide polymorphisms (SNPs). The incidence of PanIN-1, -2, -3, and PDACs in these patients was 55%, 12%, 1.4%, and 2.4%, respectively. The occurrence of PanINs was associated with female sex, increasing age, and lower body mass index. We did not identify any common SNPs between PanINs and PDACs. There were no common SNPs associated with PanINs and PDACs between men and women. In previously reported pancreatic cancer-associated SNPs, rs3790844 (NR5A2) showed a significant correlation with PDAC in our cohort. Six SNPs (rs7016880, rs10096633, rs10503669, rs12678919, rs17482753, rs328) that were correlated with blood lipid levels were associated with the risk for PDACs. Our data suggest that different clinicopathological characteristics and predispositions may affect pancreatic carcinogenesis in elderly Japanese patients. © 2017 Wiley Periodicals, Inc.

  5. Associations between single nucleotide polymorphisms in iron-related genes and iron status in multiethnic populations.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    Full Text Available The existence of multiple inherited disorders of iron metabolism suggests genetic contributions to iron deficiency. We previously performed a genome-wide association study of iron-related single nucleotide polymorphisms (SNPs using DNA from white men aged ≥ 25 y and women ≥ 50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF ≤ 12 µg/L (cases and controls (SF >100 µg/L in men, SF >50 µg/L in women. We report a follow-up study of white, African-American, Hispanic, and Asian HEIRS participants, analyzed for association between SNPs and eight iron-related outcomes. Three chromosomal regions showed association across multiple populations, including SNPs in the TF and TMPRSS6 genes, and on chromosome 18q21. A novel SNP rs1421312 in TMPRSS6 was associated with serum iron in whites (p = 3.7 × 10(-6 and replicated in African Americans (p = 0.0012.Twenty SNPs in the TF gene region were associated with total iron-binding capacity in whites (p<4.4 × 10(-5; six SNPs replicated in other ethnicities (p<0.01. SNP rs10904850 in the CUBN gene on 10p13 was associated with serum iron in African Americans (P = 1.0 × 10(-5. These results confirm known associations with iron measures and give unique evidence of their role in different ethnicities, suggesting origins in a common founder.

  6. Associations of Two Obesity-Related Single-Nucleotide Polymorphisms with Adiponectin in Chinese Children

    Directory of Open Access Journals (Sweden)

    Lijun Wu

    2017-01-01

    Full Text Available Purpose. Genome-wide association studies have found two obesity-related single-nucleotide polymorphisms (SNPs, rs17782313 near the melanocortin-4 receptor (MC4R gene and rs6265 near the brain-derived neurotrophic factor (BDNF gene, but the associations of both SNPs with other obesity-related traits are not fully described, especially in children. The aim of the present study is to investigate the associations between the SNPs and adiponectin that has a regulatory role in glucose and lipid metabolism. Methods. We examined the associations of the SNPs with adiponectin in Beijing Child and Adolescent Metabolic Syndrome (BCAMS study. A total of 3503 children participated in the study. Results. The SNP rs6265 was significantly associated with adiponectin under an additive model (P=0.02 and 0.024, resp. after adjustment for age, gender, and BMI or obesity statuses. The SNP rs17782313 was significantly associated with low adiponectin under a recessive model. No statistical significance was found between the two SNPs and low adiponectin after correction for multiple testing. Conclusion. We demonstrate for the first time that the SNP rs17782313 near MC4R and the SNP rs6265 near BDNF are associated with adiponectin in Chinese children. These novel findings provide important evidence that adiponectin possibly mediates MC4R and BDNF involved in obesity.

  7. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    Directory of Open Access Journals (Sweden)

    Tess V Clendenen

    Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  8. The role of single nucleotide polymorphisms of cytokine genes in viral infections

    Directory of Open Access Journals (Sweden)

    Ćupić Maja

    2014-01-01

    Full Text Available Gene polymorphisms result from evolutionary processes representing mutations that survive in the population with a frequency higher than 1%. The most investigated type of gene polymorphisms are single nucleotide polymorphisms (SNPs. The SNPs of IL-12B (rs 3212227 A/C among a population of kidney graft CMV-seropositive recipients have an impact on a clinical events in cytomegalovirus (CMV disease. Constitutive -308 G/A TNF-α polymorphism (rs1800629 is related to the susceptibility of HR-HPV-associated cervical dysplasia and cancer. SNP located 3 kb upstream of the IL- 28B gene (rs12979860 seems to be the strongest host genetic predictor of sustained virologic response (SVR in hepatitis C genotype 1 patients. It is very important to identify viral and host genetic markers that may facilitate the risk of developing viral disease or some viral-associated cancers. In addition, these markers could be useful in the choice of effective treatments and preventive strategies against virally induced infection. [Projekat Ministarstva nauke Republike Srbije, br. 175073 i br. 175038

  9. KRAS and VEGF gene 3'-UTR single nucleotide polymorphisms predicted susceptibility in colorectal cancer.

    Science.gov (United States)

    Yang, Minnan; Xiao, Xiuli; Xing, Xiaorui; Li, Xin; Xia, Tian; Long, Hanan

    2017-01-01

    Single nucleotide polymorphisms (SNPs) in tumor-related genes have been reported to play important roles in cancer development. Recent studies have shown that 3'-untranslated regions (UTR) polymorphisms are associated with the occurrence and prognosis of cancers. The aim of this study is to analyze the association between KRAS and VEGF gene 3'-UTR SNPs and genetic susceptibility to colorectal cancer (CRC). In this case-control study of 371 CRC cases and 246 healthy controls, we analyzed the association between one SNP (rs1137188G > A) in the KRAS gene and four SNPs (rs3025039C > T, rs3025040C > T, rs3025053G > A and rs10434A > G) in the VEGF gene and CRC susceptibility by the improved multiplex ligase detection reaction (iMLDR) method. We checked the selected SNPs' minor allele frequency and its distribution in the frequency of Chinese people by Hap-map database and Hardy-Weinberg equilibrium, and used multivariate logistic regression models to estimate adjusted odds ratios (AORs) and 95% confidence intervals (95% CIs). We found that the rs3025039C variant genotype in the VEGF gene was associated with a significant protection for CRC (AOR = 0.693, 95% CI = 0.485-0.989; P = 0.043 for CC and CT+TT). Nevertheless, the difference was no longer significant after Bonferroni correction (Bonferroni-adjusted P = 0.172). In genetic polymorphisms analysis, we found that the KRAS rs1137188 variant AA genotype had higher portion of tumor size (≥ 5 cm) (P = 0.01; Bonferroni-adjusted P = 0.04), which suggested that the rs1137188 variant AA genotype may significantly be associated with increased progression of CRC. In conclusion, our study suggested that these five SNPs in the KRAS gene and the VEGF gene were not associated with CRC susceptibility in Han Chinese in Sichuan province.

  10. KRAS and VEGF gene 3'-UTR single nucleotide polymorphisms predicted susceptibility in colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Minnan Yang

    Full Text Available Single nucleotide polymorphisms (SNPs in tumor-related genes have been reported to play important roles in cancer development. Recent studies have shown that 3'-untranslated regions (UTR polymorphisms are associated with the occurrence and prognosis of cancers. The aim of this study is to analyze the association between KRAS and VEGF gene 3'-UTR SNPs and genetic susceptibility to colorectal cancer (CRC. In this case-control study of 371 CRC cases and 246 healthy controls, we analyzed the association between one SNP (rs1137188G > A in the KRAS gene and four SNPs (rs3025039C > T, rs3025040C > T, rs3025053G > A and rs10434A > G in the VEGF gene and CRC susceptibility by the improved multiplex ligase detection reaction (iMLDR method. We checked the selected SNPs' minor allele frequency and its distribution in the frequency of Chinese people by Hap-map database and Hardy-Weinberg equilibrium, and used multivariate logistic regression models to estimate adjusted odds ratios (AORs and 95% confidence intervals (95% CIs. We found that the rs3025039C variant genotype in the VEGF gene was associated with a significant protection for CRC (AOR = 0.693, 95% CI = 0.485-0.989; P = 0.043 for CC and CT+TT. Nevertheless, the difference was no longer significant after Bonferroni correction (Bonferroni-adjusted P = 0.172. In genetic polymorphisms analysis, we found that the KRAS rs1137188 variant AA genotype had higher portion of tumor size (≥ 5 cm (P = 0.01; Bonferroni-adjusted P = 0.04, which suggested that the rs1137188 variant AA genotype may significantly be associated with increased progression of CRC. In conclusion, our study suggested that these five SNPs in the KRAS gene and the VEGF gene were not associated with CRC susceptibility in Han Chinese in Sichuan province.

  11. Genetic susceptibility to chronic otitis media with effusion: candidate gene single nucleotide polymorphisms.

    Science.gov (United States)

    MacArthur, Carol J; Wilmot, Beth; Wang, Linda; Schuller, Michael; Lighthall, Jessyka; Trune, Dennis

    2014-05-01

    The genetic factors leading to a predisposition to otitis media are not well understood. The objective of the current study was to develop a tag-single nucleotide polymorphism (SNP) panel to determine if there is an association between candidate gene polymorphisms and the development of chronic otitis media with effusion. A 1:1 case/control design of 100 cases and 100 controls was used. The study was limited to the chronic otitis media with effusion phenotype to increase the population homogeneity. A panel of 192 tag-SNPs was selected. Saliva for DNA extraction was collected from 100 chronic otitis media with effusion cases and 100 controls. After quality control, 100 case and 79 control samples were available for hybridization. Genomic DNA from each subject was hybridized to the SNP probes, and genotypes were generated. Quality control across all samples and SNPs reduced the final SNPs used for analysis to 170. Each SNP was then analyzed for statistical association with chronic otitis media with effusion. Eight SNPs from four genes had an unadjusted P value of otitis media with effusion phenotype (TLR4, MUC5B, SMAD2, SMAD4); five of these polymorphisms were in the TLR4 gene. Even though these results need to be replicated in a novel population, the presence of five SNPs in the TLR4 gene having association with chronic otitis media with effusion in our study population lends evidence for the possible role of this gene in the susceptibility to otitis media. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  12. Homocysteine concentration in coronary artery disease: Influence of three common single nucleotide polymorphisms.

    Science.gov (United States)

    Bickel, C; Schnabel, R B; Zengin, E; Lubos, E; Rupprecht, H; Lackner, K; Proust, C; Tregouet, D; Blankenberg, S; Westermann, D; Sinning, C

    2017-02-01

    Whether single nucleotide polymorphisms (SNPs) of homocysteine metabolism enzymes influence the rate of cardiovascular (CV) events in coronary artery disease (CAD) patients remains controversial. In this analysis, 1126 subjects from the AtheroGene study with CAD and 332 control subjects without known CAD were included. The following SNPs were investigated: methylentetrahydrofolate reductase (MTHFR-C667T), methionin synthetase (MS-D919G), and cystathionin beta synthetase (CBS-I278T). The endpoint was the combination of cardiovascular death, stroke, and non-fatal myocardial infarction (N = 286). The median follow-up time was 6.4 years. Kaplan-Meier curve analysis showed an increasing event rate with rising homocysteine levels (p homocysteine was a predictor of the endpoint with a hazard ratio (HR) of 6.5 (95% CI: 2.9-14.6, p homocysteine levels significantly in patients with CAD and individuals without CAD (both p homocysteine levels in CAD patients or controls. The different SNPs of MTHFR, MS, and CBS were not related to an increased event rate. Homocysteine level is a strong predictor of CV events. Subjects with and without CAD and SNPs in the enzyme MTHFR had increased homocysteine levels. This was not observed for MS and CBS SNPs. Although MTHFR SNPs alter homocysteine levels in patients and controls, these polymorphisms had no impact on prognosis in CAD patients. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  13. Mitochondrial DNA single nucleotide polymorphism associated with weight estimated breeding values in Nelore cattle (Bos indicus

    Directory of Open Access Journals (Sweden)

    Fernando Henrique Biase

    2007-01-01

    Full Text Available We sampled 119 Nelore cattle (Bos indicus, 69 harboring B. indicus mtDNA plus 50 carrying Bos taurus mtDNA, to estimate the frequencies of putative mtDNA single nucleotide polymorphisms (SNPs and investigate their association with Nelore weight and scrotal circumference estimated breeding values (EBVs. The PCR restriction fragment length polymorphism (PCR-RFLP method was used to detect polymorphisms in the mitochondrial asparagine, cysteine, glycine, leucine and proline transporter RNA (tRNA genes (tRNAasn, tRNAcys, tRNAgly, tRNAleu and tRNApro. The 50 cattle carrying B. taurus mtDNA were monomorphic for all the tRNA gene SNPs analyzed, suggesting that they are specific to mtDNA from B. indicus cattle. No tRNAcys or tRNAgly polymorphisms were detected in any of the cattle but we did detect polymorphic SNPs in the tRNAasn, tRNAleu and tRNApro genes in the cattle harboring B. indicus mtDNA, with the same allele observed in the B. taurus sequence being present in the following percentage of cattle harboring B. indicus mtDNA: 72.46% for tRNAasn, 95.23% for tRNAleu and 90.62% for tRNApro. Analyses of variance using the tRNAasn SNP as the independent variable and EBVs as the dependent variable showed that the G -> T SNP was significantly associated (p < 0.05 with maternal EBVs for weight at 120 and 210 days (p < 0.05 and animal's EBVs for weight at 210, 365 and 455 days. There was no association of the tRNAasn SNP with the scrotal circumference EBVs. These results confirm that mtDNA can affect weight and that mtDNA polymorphisms can be a source of genetic variation for quantitative traits.

  14. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Directory of Open Access Journals (Sweden)

    Puji Rianti

    2015-10-01

    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  15. Single-nucleotide polymorphism analysis of GH, GHR, and IGF-1 genes in minipigs

    Directory of Open Access Journals (Sweden)

    Y.G. Tian

    2014-09-01

    Full Text Available Tibetan (TB and Bama (BM miniature pigs are two popular pig breeds that are used as experimental animals in China due to their small body size. Here, we analyzed single-nucleotide polymorphisms (SNPs in gene fragments that are closely related to growth traits [growth hormone (GH, growth hormone receptor (GHR, and insulin-like growth factor (IGF-1] in these pig breeds and a large white (LW control pig breed. On the basis of the analysis of 100 BMs, 108 TBs, and 50 LWs, the polymorphic distribution levels of GH, GHR, and IGF-1 were significantly different among these three pig breeds. According to correlation analyses between SNPs and five growth traits - body weight (BW, body length (BL, withers height (WH, chest circumference (CC, and abdomen circumference (AC - three SNP loci in BMs and four SNP loci in TBs significantly affected growth traits. Three SNP sites in BMs and four SNP sites in TBs significantly affected growth traits. SNPs located in the GH gene fragment significantly affected BL and CC at locus 12 and BL at locus 45 in BMs, and also BW, WH, CC, and AC at locus 45 and WH and CC at locus 93 in TBs. One SNP at locus 85 in the BM GHR gene fragment significantly affected all growth traits. All indices were significantly reduced with a mixture of alleles at locus 85. These results provide more information regarding the genetic background of these minipig species and indicate useful selection markers for pig breeding programs.

  16. Single nucleotide polymorphisms in ZNF208 are associated with increased risk for HBV in Chinese people.

    Science.gov (United States)

    Li, Hengxin; Chen, Jun; Zhang, RuiZhi; Xu, Ran; Zhang, Zhe; Ren, Le; Yang, Qi; Tian, Yumei; Li, Daxu

    2017-12-22

    Single nucleotide polymorphisms (SNPs) in ZNF208 may be associated with susceptibility to Hepatitis B virus (HBV). In the current study, we analyzed the association between ZNF208 SNPs and risk of HBV in 242 HBV patients and 300 healthy subjects from the Xi'an area of Chinese Han Population. Of the five SNPs examined, rs2188971 (OR: 1.36, 95% CI: 1.04-1.76, P = 0.022), rs8103163 (OR: 1.40, 95% CI: 1.08-1.82, P = 0.010) and rs7248488 (OR: 1.38, 95% CI: 1.07-1.79, P = 0.014) were correlated with HBV susceptibility based on Chi-square tests. After the P -values were adjusted by Bonferroni correction, there only rs8103163 ( P = 0.050) was slightly with increased HBV risk. Additionally, haplotype A rs2188972 T rs2188971 A rs8103163 A rs7248488 (OR = 1.42; 95% C I, 1.10-1.85; P = 0.008) was found to increase susceptibility of suffering from HBV. These findings suggest that ZNF208 polymorphisms may contribute to the development of HBV.

  17. From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

    Directory of Open Access Journals (Sweden)

    Raghavan Chinnadurai

    2013-01-01

    Full Text Available The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS, linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs.

  18. From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

    Science.gov (United States)

    Galipeau, Jacques; Nooka, Ajay K.

    2013-01-01

    The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

  19. Analysis of healthy cohorts for single nucleotide polymorphisms in C1q gene cluster

    Directory of Open Access Journals (Sweden)

    MARIA A. RADANOVA

    2015-12-01

    Full Text Available C1q is the first component of the classical pathway of complement activation. The coding region for C1q is localized on chromosome 1p34.1–36.3. Mutations or single nucleotide polymorphisms (SNPs in C1q gene cluster can cause developing of Systemic lupus erythematosus (SLE because of C1q deficiency or other unknown reason. We selected five SNPs located in 7.121 kbp region on chromosome 1, which were previously associated with SLE and/or low C1q level, but not causing C1q deficiency and analyzed them in terms of allele frequencies and genotype distribution in comparison with Hispanic, Asian, African and other Caucasian cohorts. These SNPs were: rs587585, rs292001, rs172378, rs294179 and rs631090. One hundred eighty five healthy Bulgarian volunteers were genotyped for the selected five C1q SNPs by quantative real-time PCR methods. International HapMap Project has been used for information about genotype distribution and allele frequencies of the five SNPs in, Hispanics, Asians, Africans and others Caucasian cohorts. Bulgarian healthy volunteers and another pooled Caucasian cohort had similar frequencies of genotypes and alleles of rs587585, rs292001, rs294179 and rs631090 SNPs. Nevertheless, genotype AA of rs172378 was significantly overrepresented in Bulgarians when compared to other healthy Caucasians from USA and UK (60% vs 31%. Genotype distribution of rs172378 in Bulgarians was similar to Greek-Cyriot Caucasians. For all Caucasians the major allele of rs172378 was A. This is the first study analyzing the allele frequencies and genotype distribution of C1q gene cluster SNPs in Bulgarian healthy population.

  20. Human coding synonymous single nucleotide polymorphisms at ramp regions of mRNA translation.

    Science.gov (United States)

    Li, Quan; Qu, Hui-Qi

    2013-01-01

    According to the ramp model of mRNA translation, the first 50 codons favor rare codons and have slower speed of translation. This study aims to detect translational selection on coding synonymous single nucleotide polymorphisms (sSNP) to support the ramp theory. We investigated fourfold degenerate site (FFDS) sSNPs with A ↔ G or C ↔ T substitutions in human genome for distribution bias of synonymous codons (SC), grouped by CpG or non-CpG sites. Distribution bias of sSNPs between the 3(rd) ~50(th) codons and the 51(st) ~ remainder codons at non-CpG sites were observed. In the 3(rd) ~50(th) codons, G → A sSNPs at non-CpG sites are favored than A → G sSNPs [P = 2.89 × 10(-3)], and C → T at non-CpG sites are favored than T → C sSNPs [P = 8.50 × 10(-3)]. The favored direction of SC usage change is from more frequent SCs to less frequent SCs. The distribution bias is more obvious in synonymous substitutions CG(G → A), AC(C → T), and CT(C → T). The distribution bias of sSNPs in human genome, i.e. frequent SCs to less frequent SCs is favored in the 3(rd) ~50(th) codons, indicates translational selection on sSNPs in the ramp regions of mRNA templates.

  1. Human coding synonymous single nucleotide polymorphisms at ramp regions of mRNA translation.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available According to the ramp model of mRNA translation, the first 50 codons favor rare codons and have slower speed of translation. This study aims to detect translational selection on coding synonymous single nucleotide polymorphisms (sSNP to support the ramp theory. We investigated fourfold degenerate site (FFDS sSNPs with A ↔ G or C ↔ T substitutions in human genome for distribution bias of synonymous codons (SC, grouped by CpG or non-CpG sites. Distribution bias of sSNPs between the 3(rd ~50(th codons and the 51(st ~ remainder codons at non-CpG sites were observed. In the 3(rd ~50(th codons, G → A sSNPs at non-CpG sites are favored than A → G sSNPs [P = 2.89 × 10(-3], and C → T at non-CpG sites are favored than T → C sSNPs [P = 8.50 × 10(-3]. The favored direction of SC usage change is from more frequent SCs to less frequent SCs. The distribution bias is more obvious in synonymous substitutions CG(G → A, AC(C → T, and CT(C → T. The distribution bias of sSNPs in human genome, i.e. frequent SCs to less frequent SCs is favored in the 3(rd ~50(th codons, indicates translational selection on sSNPs in the ramp regions of mRNA templates.

  2. Confirmation of an Association Between Single Nucleotide Polymorphisms in the VDR Gene With Respiratory Syncytial Virus Related Disease in South African Children

    NARCIS (Netherlands)

    Kresfelder, T. L.; Janssen, R.; Bont, L.; Venter, M.

    2011-01-01

    Respiratory syncytial virus is a leading cause of lower respiratory tract infection in infants. Disease severity has been linked to host immune responses and polymorphisms in genes associated with innate immunity. A large-scale genetics study of single nucleotide polymorphisms (SNPs) in children in

  3. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technology...

  4. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  5. DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.

    Directory of Open Access Journals (Sweden)

    Inês Soares

    Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.

  6. Multiplex single nucleotide polymorphism (SNP) assay for detection of soybean mosaic virus resistance genes in soybean.

    Science.gov (United States)

    Shi, Ainong; Chen, Pengyin; Vierling, Richard; Zheng, Cuming; Li, Dexiao; Dong, Dekun; Shakiba, Ehsan; Cervantez, Innan

    2011-02-01

    Soybean mosaic virus (SMV) is one of the most destructive viral diseases in soybean (Glycine max). Three independent loci for SMV resistance have been identified in soybean germplasm. The use of genetic resistance is the most effective method of controlling this disease. Marker assisted selection (MAS) has become very important and useful in the effort of selecting genes for SMV resistance. Single nucleotide polymorphism (SNP), because of its abundance and high-throughput potential, is a powerful tool in genome mapping, association studies, diversity analysis, and tagging of important genes in plant genomics. In this study, a 10 SNPs plus one insert/deletion (InDel) multiplex assay was developed for SMV resistance: two SNPs were developed from the candidate gene 3gG2 at Rsv1 locus, two SNPs selected from the clone N11PF linked to Rsv1, one 'BARC' SNP screened from soybean chromosome 13 [linkage group (LG) F] near Rsv1, two 'BARC' SNPs from probe A519 linked to Rsv3, one 'BARC' SNP from chromosome 14 (LG B2) near Rsv3, and two 'BARC' SNPs from chromosome 2 (LG D1b) near Rsv4, plus one InDel marker from expressed sequence tag (EST) AW307114 linked to Rsv4. This 11 SNP/InDel multiplex assay showed polymorphism among 47 diverse soybean germplasm, indicating this assay can be used to investigate the mode of inheritance in a SMV resistant soybean line carrying Rsv1, Rsv3, and/or Rsv4 through a segregating population with phenotypic data, and to select a specific gene or pyramid two or three genes for SMV resistance through MAS in soybean breeding program. The presence of two SMV resistance genes (Rsv1 and Rsv3) in J05 soybean was confirmed by the SNP assay.

  7. Single nucleotide polymorphisms concordant with the horned/polled trait in Holsteins

    Directory of Open Access Journals (Sweden)

    Nissing Nick J

    2008-12-01

    Full Text Available Abstract Background Cattle that naturally do not grow horns are referred to as polled, a trait inherited in a dominant Mendelian fashion. Previous studies have localized the polled mutation (which is unknown to the proximal end of bovine chromosome 1 in a region approximately 3 Mb in size. While a polled genetic test, Tru-Polled™, is commercially available from MetaMorphix Inc., Holsteins are not a validated breed for this test. Findings Approximately 160 kb were sequenced within the known polled region from 12 polled and 12 horned Holsteins. Analysis of the polymorphisms identified 13 novel single nucleotide polymorphisms (SNPs that are concordant with the horned/polled trait. Three of the 13 SNPs are located in gene coding or regulatory regions (e.g., the untranslated region, or UTR where one is located in the 3'UTR of a gene and the other two are located in the 5'UTR and coding region (synonymous SNP of another gene. The 3'UTR of genes have been shown to be targets of microRNAs regulating gene expression. In silico analysis indicates the 3'UTR SNP may disrupt a microRNA target site. Conclusion These 13 novel SNPs concordant with the horned/polled trait in Holsteins represent a test panel for the breed and this is the first report to the authors' knowledge of SNPs within gene coding or regulatory regions concordant with the horned/polled trait in cattle. These SNPs will require further testing for verification and further study to determine if the 3'UTR SNP may have a functional effect on the polled trait in Holsteins.

  8. Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes.

    Directory of Open Access Journals (Sweden)

    Claire Chewapreecha

    2014-08-01

    Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.

  9. Interaction of iron status with single nucleotide polymorphisms on incidence of type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Jihye Kim

    Full Text Available The objective of this study is to find single nucleotide polymorphisms (SNPs associated with a risk of Type 2 diabetes (T2D in Korean adults and to investigate the longitudinal association between these SNPs and T2D and the interaction effects of iron intake and average hemoglobin level. Data from the KoGES_Ansan and Ansung Study were used. Gene-iron interaction analysis was conducted using a two-step approach. To select candidate SNPs associated with T2D, a total of 7,935 adults at baseline were included in genome-wide association analysis (step one. After excluding T2D prevalent cases, prospective analyses were conducted with 7,024 adults aged 40-69 (step two. The association of selected SNPs and iron status with T2D and their interaction were determined using a Cox proportional hazard model. A total of 3 SNPs [rs9465871 (CDKAL1, rs10761745 (JMJD1C, and rs163177 (KCNQ1] were selected as candidate SNPs related to T2D. Among them, rs10761745 (JMJD1C and rs163177 (KCNQ1 were prospectively associated with T2D. High iron intake was also prospectively associated with the risk of T2D after adjusting for covariates. Average hemoglobin level was positively associated with T2D after adjusting for covariates in women. We also found significant interaction effects between rs10761745 (JMJD1C and average hemoglobin levels on the risk of T2D among women with normal inflammation and without anemia at baseline. In conclusion, KCNQ1 and JMJD1C may prospectively contribute to the risk of T2D incidence among adults over the age of 40 and JMJD1C, but CDKAL1 may not, and iron status may interactively contribute to T2D incidence in women.

  10. Analysis of single nucleotide polymorphisms in uridine/cytidine kinase gene encoding metabolic enzyme of 3'-ethynylcytidine.

    Science.gov (United States)

    Hasegawa, Takako; Futagami, Michiko; Kim, Hey-Sook; Matsuda, Akira; Wataya, Yusuke

    2002-01-01

    We investigated single nucleotide polymorphisms (SNPs) in uck2 gene encoding metabolic enzyme of 3'-ethynylcytidine (ECyd) which were associated with drug response of ECyd, and the newly synthesized antitumor ribonucleoside analog. We analized that on exon-intron junction and exon region to affect the qualitative alteration of gene product directly in ECyd sensitive and resistant human cancer cell lines. As the results, cSNP and sSNP were detected in exon 4. In the promoter region, 3 SNPs were detected. Our data seem to be able to give an important knowledge, when ECyd is applied clinically.

  11. Social cognition, face processing, and oxytocin receptor single nucleotide polymorphisms in typically developing children

    Directory of Open Access Journals (Sweden)

    Mylissa M. Slane

    2014-07-01

    Full Text Available Recent research has provided evidence of a link between behavioral measures of social cognition (SC and neural and genetic correlates. Differences in face processing and variations in the oxytocin receptor (OXTR gene have been associated with SC deficits and autism spectrum disorder (ASD traits. Much work has examined the qualitative differences between those with ASD and typically developing (TD individuals, but very little has been done to quantify the natural variation in ASD-like traits in the typical population. The present study examines this variation in TD children using a multidimensional perspective involving behavior assessment, neural electroencephalogram (EEG testing, and OXTR genotyping. Children completed a series of neurocognitive assessments, provided saliva samples for sequencing, and completed a face processing task while connected to an EEG. No clear pattern emerged for EEG covariates or genotypes for individual OXTR single nucleotide polymorphisms (SNPs. However, SNPs rs2254298 and rs53576 consistently interacted such that the AG/GG allele combination of these SNPs was associated with poorer performance on neurocognitive measures. These results suggest that neither SNP in isolation is risk-conferring, but rather that the combination of rs2254298(A/G and rs53576(G/G confers a deleterious effect on SC across several neurocognitive measures.

  12. EnsembleGASVR: A novel ensemble method for classifying missense single nucleotide polymorphisms

    KAUST Repository

    Rapakoulia, Trisevgeni

    2014-04-26

    Motivation: Single nucleotide polymorphisms (SNPs) are considered the most frequently occurring DNA sequence variations. Several computational methods have been proposed for the classification of missense SNPs to neutral and disease associated. However, existing computational approaches fail to select relevant features by choosing them arbitrarily without sufficient documentation. Moreover, they are limited to the problem ofmissing values, imbalance between the learning datasets and most of them do not support their predictions with confidence scores. Results: To overcome these limitations, a novel ensemble computational methodology is proposed. EnsembleGASVR facilitates a twostep algorithm, which in its first step applies a novel evolutionary embedded algorithm to locate close to optimal Support Vector Regression models. In its second step, these models are combined to extract a universal predictor, which is less prone to overfitting issues, systematizes the rebalancing of the learning sets and uses an internal approach for solving the missing values problem without loss of information. Confidence scores support all the predictions and the model becomes tunable by modifying the classification thresholds. An extensive study was performed for collecting the most relevant features for the problem of classifying SNPs, and a superset of 88 features was constructed. Experimental results show that the proposed framework outperforms well-known algorithms in terms of classification performance in the examined datasets. Finally, the proposed algorithmic framework was able to uncover the significant role of certain features such as the solvent accessibility feature, and the top-scored predictions were further validated by linking them with disease phenotypes. © The Author 2014.

  13. Evolutionary history of DLA class II haplotypes in canine diabetes mellitus through single nucleotide polymorphism genotyping.

    Science.gov (United States)

    Seddon, J M; Berggren, K T; Fleeman, L M

    2010-03-01

    Strong linkage disequilibrium (LD) is a characteristic of the major histocompatibility complex (MHC) region, as well as the genome in general in dogs as a consequence of demographic changes with domestication. Disease association studies of MHC haplotypes may be affected by high LD and the resultant shared genetic backgrounds of haplotypes giving associations with linked but non-causative mutations, and also by convergent haplotypes, in which combinations of alleles have arisen independently. This study provides preliminary tools for dog leukocyte antigen (DLA) class II haplotype analysis with 102 single nucleotide polymorphisms (SNPs) identified in 14.6 kb and genotyping of 20 of these SNPs to tag haplotypes in 60 dogs with diabetes mellitus and in 49 non-diabetic dogs. The pattern of LD and analysis of SNP patterns indicated combinations of exon 2 alleles have arisen through both recombination and convergence. For exon 2 haplotypes associated with susceptibility or protection from diabetes mellitus, a region of fixed differences in SNPs across the DQ region was observed, suggesting a region outside exon 2 may be implicated in disease association. Four new DQB1 promoter alleles restricted to diabetic dogs were identified, as well as a substitution difference in the X1 box of the DQB1 promoter that will potentially modify the effect of the protective haplotypes within diabetic dogs.

  14. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

    Science.gov (United States)

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

    2012-11-10

    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Association of ENAM gene single nucleotide polymorphisms with dental caries in Polish children.

    Science.gov (United States)

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michal

    2016-04-01

    The objective of this study was to prove the association between dental caries and single nucleotide polymorphisms (SNPs) in the ENAM gene. The research was carried out in 96 children (48 with caries and 48 counterparts free of this disease), aged 20-42 months, with 11-20 erupted teeth. All children were from four day nurseries located in Poznan. The study included the dental examination to select individuals to the research and oral swab collection for molecular evaluation. Seven selected SNPs markers of the ENAM gene were genotyped, five using TaqMan probe assay (rs2609428, rs7671281, rs36064169, rs3796704, and rs12640848) and two by Sanger sequencing (rs144929717 and rs139228330). Statistically significant higher prevalence of the alternative G allele and the alternative GG homozygote in the control group in comparison with the caries group in SNP rs12640848 was observed, respectively, p = 0.0062 and 0.0010. Although the prevalence of the AG heterozygote was higher for the caries subjects in comparison with controls (OR = 2.9), and the result was statistically significant (p = 0.0010), the overall prevalence of the G allele for this SNP was significantly higher in control group (OR = 2.3; p = 0.0062). The study revealed the strong association between rs12640848 marker of ENAM gene and caries susceptibility in primary teeth in children from Poznan. The presence of SNPs in the ENAM gene may be important as suspected predictive factor of dental caries occurrence in children.

  16. Single nucleotide polymorphisms and unacceptable late toxicity in breast cancer adjuvant radiotherapy: a case report

    Directory of Open Access Journals (Sweden)

    Lazzari G

    2017-05-01

    Full Text Available Grazia Lazzari,1 Maria Iole Natalicchio,2 Angela Terlizzi,3 Francesco Perri,4 Giovanni Silvano1 1Radiation Oncology Unit, San Giuseppe Moscati Hospital, Taranto, 2Molecular Biology Laboratory, Pathological Anatomy Department, Ospedali Riuniti, Foggia, 3Medical Physic Unit, San Giuseppe Moscati Hospital, 4Medical Oncology Unit, Presidio Ospedaliero Centrale - Santissima Annunziata, Taranto, Italy Background: There has recently been a strong interest in the inter-individual variation in normal tissue and tumor response to radiotherapy (RT, because tissue radiosensitivity seems to be under genetic control. Evidence is accumulating on the role of polymorphic genetic variants, such as single nucleotide polymorphisms (SNPs that could influence normal tissue response after radiation. The most studied SNPs include those in genes involved in DNA repair (single- and double-strand breaks, and base excision and those active in the response to oxidative stress.Case report: We present the case report of a 60-year-old woman with early breast cancer who underwent adjuvant hormone therapy and conventional radiotherapy, and subsequently developed unacceptable cosmetic toxicities of the irradiated breast requiring a genetic test of genes involved in DNA repair mechanisms. The patient was found to be heterozygous for G28152A (T/C and C18067T (A/G mutations in X-ray repair cross-complementing group 1 (XRCC1 and 3 (XRCC3, respectively, homozygous for A313G (G/G mutation in glutathione S transferase Pi 1 (GSTP1, and wild-type for A4541G (A/A in XRCC3 and G135C (G/G in RAD51 recombinase.Conclusion: The role of SNPs should be taken into account when a severe phenomenon appears in normal tissues after radiation treatment, because understanding the molecular basis of individual radiosensitivity may be useful for identifying moderately or extremely radiosensitive patients who may need tailored therapeutic strategies. Keywords: radiosensitivity, SNPs, fibrosis, DNA repair

  17. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).

    Science.gov (United States)

    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco

    2013-04-01

    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Whole Genome Association Study to Detect Single Nucleotide Polymorphisms for Behavior in Sapsaree Dog (

    Directory of Open Access Journals (Sweden)

    J. H. Ha

    2015-07-01

    Full Text Available The purpose of this study was to characterize genetic architecture of behavior patterns in Sapsaree dogs. The breed population (n = 8,256 has been constructed since 1990 over 12 generations and managed at the Sapsaree Breeding Research Institute, Gyeongsan, Korea. Seven behavioral traits were investigated for 882 individuals. The traits were classified as a quantitative or a categorical group, and heritabilities (h2 and variance components were estimated under the Animal model using ASREML 2.0 software program. In general, the h2 estimates of the traits ranged between 0.00 and 0.16. Strong genetic (rG and phenotypic (rP correlations were observed between nerve stability, affability and adaptability, i.e. 0.9 to 0.94 and 0.46 to 0.68, respectively. To detect significant single nucleotide polymorphism (SNP for the behavioral traits, a total of 134 and 60 samples were genotyped using the Illumina 22K CanineSNP20 and 170K CanineHD bead chips, respectively. Two datasets comprising 60 (Sap60 and 183 (Sap183 samples were analyzed, respectively, of which the latter was based on the SNPs that were embedded on both the 22K and 170K chips. To perform genome-wide association analysis, each SNP was considered with the residuals of each phenotype that were adjusted for sex and year of birth as fixed effects. A least squares based single marker regression analysis was followed by a stepwise regression procedure for the significant SNPs (p<0.01, to determine a best set of SNPs for each trait. A total of 41 SNPs were detected with the Sap183 samples for the behavior traits. The significant SNPs need to be verified using other samples, so as to be utilized to improve behavior traits via marker-assisted selection in the Sapsaree population.

  19. Detecting high-order interactions of single nucleotide polymorphisms using genetic programming.

    Science.gov (United States)

    Nunkesser, Robin; Bernholt, Thorsten; Schwender, Holger; Ickstadt, Katja; Wegener, Ingo

    2007-12-15

    Not individual single nucleotide polymorphisms (SNPs), but high-order interactions of SNPs are assumed to be responsible for complex diseases such as cancer. Therefore, one of the major goals of genetic association studies concerned with such genotype data is the identification of these high-order interactions. This search is additionally impeded by the fact that these interactions often are only explanatory for a relatively small subgroup of patients. Most of the feature selection methods proposed in the literature, unfortunately, fail at this task, since they can either only identify individual variables or interactions of a low order, or try to find rules that are explanatory for a high percentage of the observations. In this article, we present a procedure based on genetic programming and multi-valued logic that enables the identification of high-order interactions of categorical variables such as SNPs. This method called GPAS cannot only be used for feature selection, but can also be employed for discrimination. In an application to the genotype data from the GENICA study, an association study concerned with sporadic breast cancer, GPAS is able to identify high-order interactions of SNPs leading to a considerably increased breast cancer risk for different subsets of patients that are not found by other feature selection methods. As an application to a subset of the HapMap data shows, GPAS is not restricted to association studies comprising several 10 SNPs, but can also be employed to analyze whole-genome data. Software can be downloaded from http://ls2-www.cs.uni-dortmund.de/~nunkesser/#Software

  20. Prediction of functionally significant single nucleotide polymorphisms in PTEN tumor suppressor gene: An in silico approach.

    Science.gov (United States)

    Khan, Imran; Ansari, Irfan A; Singh, Pratichi; Dass J, Febin Prabhu

    2017-09-01

    The phosphatase and tensin homolog (PTEN) gene plays a crucial role in signal transduction by negatively regulating the PI3K signaling pathway. It is the most frequent mutated gene in many human-related cancers. Considering its critical role, a functional analysis of missense mutations of PTEN gene was undertaken in this study. Thirty five nonsynonymous single nucleotide polymorphisms (nsSNPs) within the coding region of the PTEN gene were selected for our in silico investigation, and five nsSNPs (G129E, C124R, D252G, H61D, and R130G) were found to be deleterious based on combinatorial predictions of different computational tools. Moreover, molecular dynamics (MD) simulation was performed to investigate the conformational variation between native and all the five mutant PTEN proteins having predicted deleterious nsSNPs. The results of MD simulation of all mutant models illustrated variation in structural attributes such as root-mean-square deviation, root-mean-square fluctuation, radius of gyration, and total energy; which depicts the structural stability of PTEN protein. Furthermore, mutant PTEN protein structures also showed a significant variation in the solvent accessible surface area and hydrogen bond frequencies from the native PTEN structure. In conclusion, results of this study have established the deleterious effect of the all the five predicted nsSNPs on the PTEN protein structure. Thus, results of the current study can pave a new platform to sort out nsSNPs that can be undertaken for the confirmation of their phenotype and their correlation with diseased status in case of control studies. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  1. Evidence for single nucleotide polymorphisms and their association with bipolar disorder

    Directory of Open Access Journals (Sweden)

    Szczepankiewicz A

    2013-10-01

    Full Text Available Aleksandra Szczepankiewicz1,21Laboratory of Molecular and Cell Biology, 2Department of Psychiatric Genetics, Poznan University of Medical Sciences, Poznan, PolandAbstract: Bipolar disorder (BD is a complex disorder with a number of susceptibility genes and environmental risk factors involved in its pathogenesis. In recent years, huge progress has been made in molecular techniques for genetic studies, which have enabled identification of numerous genomic regions and genetic variants implicated in BD across populations. Despite the abundance of genetic findings, the results have often been inconsistent and not replicated for many candidate genes/single nucleotide polymorphisms (SNPs. Therefore, the aim of the review presented here is to summarize the most important data reported so far in candidate gene and genome-wide association studies. Taking into account the abundance of association data, this review focuses on the most extensively studied genes and polymorphisms reported so far for BD to present the most promising genomic regions/SNPs involved in BD. The review of association data reveals evidence for several genes (SLC6A4/5-HTT [serotonin transporter gene], BDNF [brain-derived neurotrophic factor], DAOA [D-amino acid oxidase activator], DTNBP1 [dysbindin], NRG1 [neuregulin 1], DISC1 [disrupted in schizophrenia 1] to be crucial candidates in BD, whereas numerous genome-wide association studies conducted in BD indicate polymorphisms in two genes (CACNA1C [calcium channel, voltage-dependent, L type, alpha 1C subunit], ANK3 [ankyrin 3] replicated for association with BD in most of these studies. Nevertheless, further studies focusing on interactions between multiple candidate genes/SNPs, as well as systems biology and pathway analyses are necessary to integrate and improve the way we analyze the currently available association data.Keywords: candidate gene, genome-wide association study, SLC6A4, BDNF, DAOA, DTNBP1, NRG1, DISC1

  2. A 1204-single nucleotide polymorphism and insertion-deletion polymorphism panel for massively parallel sequencing analysis of DNA mixtures.

    Science.gov (United States)

    Hwa, Hsiao-Lin; Chung, Wan-Chia; Chen, Pei-Lung; Lin, Chih-Peng; Li, Huei-Ying; Yin, Hsiang-I; Lee, James Chun-I

    2018-01-01

    Massively parallel sequencing (MPS) technology enables the simultaneous analysis of a huge number of single nucleotide polymorphisms (SNPs) and insertion-deletion polymorphisms (indels). MPS also enables the detection of the alleles of minor contributors in a highly unbalanced DNA mixture. In this study, we established a 1204-marker panel optimized for MPS consisting of 987 autosomal markers (964 SNPs and 23 indels), 27 X-chromosome SNPs, 61 Y-chromosome markers (56 SNPs and 5 indels), and 129 mitochondrial SNPs. The DNA samples of six unrelated individuals (two men and four women), 26 nondegraded DNA mixtures (with minor to major ratios of 1:29, 1:39, 1:79, and 1:99), and eight highly artificially degraded DNA mixtures (with minor to major ratios of 1:29, 1:39, 1:79, and 1:99) were analyzed through MPS by using the panel. A scoring system was developed to determine the minor contributors in DNA mixtures based on the genotypes identified using MPS. The genotypes of the 1204 markers were successfully profiled through MPS by using the custom-designed panel. The efficiency of MPS for analyzing these highly degraded samples was lower than that for analyzing nondegraded samples. All minor contributors in the 26 nondegraded and 8 degraded DNA mixtures were accurately assigned using this scoring system based on 964 autosomal SNPs. An association between the observed reads ratio and theoretical ratio of the minor component was noted for nondegraded mixtures. In conclusion, we established a 1204-marker individual identification panel for MPS that successfully analyzed autosomal, X-chromosome, Y-chromosome, and mitochondrial SNPs and indels simultaneously. In combination with the newly developed scoring system, the panel can accurately identify minor contributors in nondegraded and highly degraded DNA mixtures. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. A multiplex bead-based suspension array assay for interrogation of phylogenetically informative single nucleotide polymorphisms for Bacillus anthracis

    DEFF Research Database (Denmark)

    Thierry, Simon; Hamidjaja, Raditijo A.; Girault, Guillaume

    2013-01-01

    Single nucleotide polymorphisms (SNPs) are abundant in genomes of all species and represent informative DNA markers extensively used to analyze phylogenetic relationships between strains. Medium to high throughput, open methodologies able to test many SNPs in a minimum time are therefore in great...... been modified and adapted for simultaneous interrogation of 13 biallelic canonical SNPs in a 13-plex assay. Changes made to the originally published method include the design of allele-specific dual-priming-oligonucleotides (DPOs) as competing detection probes (MOLigo probes) and use of asymmetric PCR...... laboratories. While cost-effective compared to other singleplex methods, the present MOL-PCR method offers a high degree of flexibility and scalability. It can easily accommodate newly identified SNPs to increase resolving power to the canSNP typing of B. anthracis....

  4. Single-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites.

    Science.gov (United States)

    Gutacker, Michaela M; Mathema, Barun; Soini, Hanna; Shashkina, Elena; Kreiswirth, Barry N; Graviss, Edward A; Musser, James M

    2006-01-01

    We studied genetic relationships among 5069 Mycobacterium tuberculosis strains recovered from patients enrolled in 4 population-based studies in the United States and Europe, by analysis of 36 synonymous single-nucleotide polymorphisms (SNPs). All strains were assigned to 1 of 9 major genetic clusters based on sSNP profile. The same 9 genetic clusters were revealed by analysis of 227 nonsynonymous SNPs, 121 intergenic SNPs, and concatenated profiles of 578 SNPs available for a subset of 48 representative strains. IS6110 profiles, spoligotypes, and mycobacterial interspersed repetitive unit patterns were nonrandomly associated with SNP-based phylogenetic lineages, together indicating a strongly clonal population structure. Isolates of the 9 genetic clusters were not distributed with equal frequency in all localities, reflecting geographic subdivision. The SNP-based phylogenetic framework provides new insight into the worldwide evolution of M. tuberculosis and a gateway for investigating genotype-disease phenotype relationships in large samples of strains.

  5. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    Directory of Open Access Journals (Sweden)

    Karim El-Sabrout

    2017-01-01

    Full Text Available Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF] as specific primers for two rabbit lines (V-line, Alexandria using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP of these genes and body weight (BW at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C and nucleotide 35 (T-G in MC4R gene (sense mutation of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C at nucleotide 27 was identified by MC4R gene (sense mutation and another one (A-C at nucleotide 14 was identified by GHR gene (nonsense mutation of Alexandria line. The results of individual BW at market (63 days indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R.

  6. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

    Science.gov (United States)

    Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

    2015-12-01

    Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three

  7. Analysis of two single-nucleotide polymorphisms (SNPs) located in ...

    African Journals Online (AJOL)

    Martina Franca donkey was derived from the Catalan donkey brought to Apulia at the time of the Spanish rule. This donkey is tall and well built and has good temperament. Both considered loci were found to be monomorphic in the considered population. At CSN3/PstI locus, all the animals were genotyped as AA since no ...

  8. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    use

    2011-12-21

    Dec 21, 2011 ... innate immunity against pathogen infection and bridge the innate and adaptive immunity. It had been shown that in mammals, TLR7 could be an important recognizing receptor of the single-stranded RNA viruses and activated the innate immune responses through a signal transduction pathway (Kadowaki ...

  9. Two novel single nucleotide polymorphisms (SNPs) and 4-bp ...

    Indian Academy of Sciences (India)

    CHU-ZHAO LEI1 and HONG CHEN1∗. 1College of Animal Science and Technology, Northwest A & F University, Shaanxi Key Laboratory of Molecular Biology for. Agriculture, Yangling, Shaanxi 712100, People's Republic of China. 2Research Center of Cattle Engineering Technology in Henan, Zhengzhou, Henan 450003, ...

  10. Two novel single nucleotide polymorphisms (SNPs) and 4-bp ...

    Indian Academy of Sciences (India)

    vated in plasma of diabetic patients and were higher in those with microalbuminuria (Raila et al. 2007). The result sug- gests that plasma RBP4 levels in patients with type 2 diabetes mellitus are affected by nephropathy. To date .... C>G, T mutation led to the 15th amino acid of the Rbp4 exon. 3 being changed: C-C-G (Pro) ...

  11. Common single nucleotide polymorphisms and keratoconus in the Han Chinese population.

    Science.gov (United States)

    Wang, Yani; Jin, Tianbo; Zhang, Xuehui; Wei, Wei; Cui, Yan; Geng, Tingting; Liu, Qianping; Gao, Jing; Liu, Ming; Chen, Chao; Zhang, Changning; Zhu, Xiuping

    2013-09-01

    To investigate whether the tag single nucleotide polymorphisms (tSNPs) in VSX1, COL4A3, COL4A4, IL1A and IL1B genes were associated with keratoconus (KTCN) in the Han Chinese population. Ninety-seven KTCN patients and 101 healthy controls were enrolled in this study. All cases were diagnosed on the basis of clinical examination. Twenty-one tSNPs were selected for association study in five genes. SNP genotyping was performed by Sequenom MassARRAY RS1000. Sequenom Typer 4.0 Software, PLINK, Haploview and SHEsis software platform were used to perform data management and analyses. Three tSNPs in the VSX1 gene were observed to be associated with KTCN risk at a 5% level by χ(2) test (rs56157240 and rs12480307, p = 0.0499, OR: 6.42, 95% CI: 0.77-53.78; rs6050307, p = 1.22 × 10(-7), OR: 0.05, 95% CI: 0.01-0.23). Rs2071376 in the IL1A gene was also associated with KTCN (p = 0.0487, OR: 1.51, 95% CI: 1.00-2.26). Three haplotypes in the VSX1 gene were found to be associated with risk of KTCN (p < 0.05). Our findings confirmed previous reports that polymorphisms of VSX1 and IL1A genes were associated with risk of KTCN in the Chinese population, suggesting an important determinant of KTCN development by VSX1 and IL1A genes.

  12. Single Nucleotide Polymorphisms in HSP17.8 and Their Association with Agronomic Traits in Barley

    Science.gov (United States)

    Ning, Zhengxiang; Bai, Guihua; Siddique, Kadambot H. M.; Yan, Guijun; Baum, Michael; Varshney, Rajeev K.; Guo, Peiguo

    2013-01-01

    Small heat shock protein 17.8 (HSP17.8) is produced abundantly in plant cells under heat and other stress conditions and may play an important role in plant tolerance to stress environments. However, HSP17.8 may be differentially expressed in different accessions of a crop species exposed to identical stress conditions. The ability of different genotypes to adapt to various stress conditions resides in their genetic diversity. Allelic variations are the most common forms of genetic variation in natural populations. In this study, single nucleotide polymorphisms (SNPs) of the HSP17.8 gene were investigated across 210 barley accessions collected from 30 countries using EcoTILLING technology. Eleven SNPs including 10 from the coding region of HSP17.8 were detected, which form nine distinguishable haplotypes in the barley collection. Among the 10 SNPs in the coding region, six are missense mutations and four are synonymous nucleotide changes. Five of the six missense changes are predicted to be deleterious to HSP17.8 function. The accessions from Middle East Asia showed the higher nucleotide diversity of HSP17.8 than those from other regions and wild barley (H. spontaneum) accessions exhibited greater diversity than the cultivated barley (H. vulgare) accessions. Four SNPs in HSP17.8 were found associated with at least one of the agronomic traits evaluated except for spike length, namely number of grains per spike, thousand kernel weight, plant height, flag leaf area and leaf color. The association between SNP and these agronomic traits may provide new insight for study of the gene's potential contribution to drought tolerance of barley. PMID:23418603

  13. Identification of single nucleotide polymorphisms associated with hyperproduction of alpha-toxin in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Xudong Liang

    2011-04-01

    Full Text Available The virulence factor α-toxin (hla is needed by Staphylococcus aureus in order to cause infections in both animals and humans. Although the complicated regulation of hla expression has been well studied in human S. aureus isolates, the mechanisms of of hla regulation in bovine S. aureus isolates remain undefined. In this study, we found that many bovine S. aureus isolates, including the RF122 strain, generate dramatic amounts of α-toxin in vitro compared with human clinical S. aureus isolates, including MRSA WCUH29 and MRSA USA300. To elucidate potential regulatory mechanisms, we analyzed the hla promoter regions and identified predominant single nucleotide polymorphisms (SNPs at positions -376, -483, and -484 from the start codon in α-toxin hyper-producing isolates. Using site-directed mutagenesis and hla promoter-gfp-luxABCDE dual reporter approaches, we demonstrated that the SNPs contribute to the differential control of hla expression among bovine and human S. aureus isolates. Using a DNA affinity assay, gel-shift assays and a null mutant, we identified and revealed that an hla positive regulator, SarZ, contributes to the involvement of the SNPs in mediating hla expression. In addition, we found that the bovine S. aureus isolate RF122 exhibits higher transcription levels of hla positive regulators, including agrA, saeR, arlR and sarZ, but a lower expression level of hla repressor rot compared to the human S. aureus isolate WCUH29. Our results indicate α-toxin hyperproduction in bovine S. aureus is a multifactorial process, influenced at both the genomic and transcriptional levels. Moreover, the identification of predominant SNPs in the hla promoter region may provide a novel method for genotyping the S. aureus isolates.

  14. Single nucleotide polymorphism barcoding to evaluate oral cancer risk using odds ratio-based genetic algorithms

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    2012-07-01

    Full Text Available Cancers often involve the synergistic effects of gene–gene interactions, but identifying these interactions remains challenging. Here, we present an odds ratio-based genetic algorithm (OR-GA that is able to solve the problems associated with the simultaneous analysis of multiple independent single nucleotide polymorphisms (SNPs that are associated with oral cancer. The SNP interactions between four SNPs—namely rs1799782, rs2040639, rs861539, rs2075685, and belonging to four genes (XRCC1, XRCC2, XRCC3, and XRCC4—were tested in this study, respectively. The GA decomposes the SNPs sets into different SNP combinations with their corresponding genotypes (called SNP barcodes. The GA can effectively identify a specific SNP barcode that has an optimized fitness value and uses this to calculate the difference between the case and control groups. The SNP barcodes with a low fitness value are naturally removed from the population. Using two to four SNPs, the best SNP barcodes with maximum differences in occurrence between the case and control groups were generated by GA algorithm. Subsequently, the OR provides a quantitative measure of the multiple SNP synergies between the oral cancer and control groups by calculating the risk related to the best SNP barcodes and others. When these were compared to their corresponding non-SNP barcodes, the estimated ORs for oral cancer were found to be great than 1 [approx. 1.72–2.23; confidence intervals (CIs: 0.94–5.30, p < 0.03–0.07] for various specific SNP barcodes with two to four SNPs. In conclusion, the proposed OR-GA method successfully generates SNP barcodes, which allow oral cancer risk to be evaluated and in the process the OR-GA method identifies possible SNP–SNP interactions.

  15. Effective detection of human leukocyte antigen risk alleles in celiac disease using tag single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Alienke J Monsuur

    Full Text Available BACKGROUND: The HLA genes, located in the MHC region on chromosome 6p21.3, play an important role in many autoimmune disorders, such as celiac disease (CD, type 1 diabetes (T1D, rheumatoid arthritis, multiple sclerosis, psoriasis and others. Known HLA variants that confer risk to CD, for example, include DQA1*05/DQB1*02 (DQ2.5 and DQA1*03/DQB1*0302 (DQ8. To diagnose the majority of CD patients and to study disease susceptibility and progression, typing these strongly associated HLA risk factors is of utmost importance. However, current genotyping methods for HLA risk factors involve many reactions, and are complicated and expensive. We sought a simple experimental approach using tagging SNPs that predict the CD-associated HLA risk factors. METHODOLOGY: Our tagging approach exploits linkage disequilibrium between single nucleotide polymorphism (SNPs and the CD-associated HLA risk factors DQ2.5 and DQ8 that indicate direct risk, and DQA1*0201/DQB1*0202 (DQ2.2 and DQA1*0505/DQB1*0301 (DQ7 that attribute to the risk of DQ2.5 to CD. To evaluate the predictive power of this approach, we performed an empirical comparison of the predicted DQ types, based on these six tag SNPs, with those executed with current validated laboratory typing methods of the HLA-DQA1 and -DQB1 genes in three large cohorts. The results were validated in three European celiac populations. CONCLUSION: Using this method, only six SNPs were needed to predict the risk types carried by >95% of CD patients. We determined that for this tagging approach the sensitivity was >0.991, specificity >0.996 and the predictive value >0.948. Our results show that this tag SNP method is very accurate and provides an excellent basis for population screening for CD. This method is broadly applicable in European populations.

  16. Association ofinterleukin-10gene single nucleotide polymorphisms with rheumatoid arthritis in a Chinese population.

    Science.gov (United States)

    Zhang, Tian-Ping; Lv, Tian-Tian; Xu, Shu-Zhen; Pan, Hai-Feng; Ye, Dong-Qing

    2018-02-27

    Increasing numbers of studies show that interleukin (IL)-10 plays a key role in the pathogenesis of autoimmune diseases including rheumatoid arthritis (RA) and acts as an immunomodulatory cytokine. The purpose of the present study was to analyse the relationship between gene single nucleotide polymorphisms (SNPs) in the IL-10 gene and RA susceptibility. We genotyped three SNPs (rs1800890, rs3024495, rs3024505) of the IL-10 gene in a Chinese population of 354 RA patients and 367 controls. Genotyping was conducted using TaqMan SNP genotyping assays. Plasma IL-10 levels were measured by ELISA. The A allele of the rs1800890 variant was significantly related to decreased risk for RA compared with the T allele (A vs T: OR 0.580, 95% CI 0.345 to 0.975, P=0.038). No significant association between the genotype distribution of these SNPs and RA susceptibility was detected. The genotype effect of the dominant model was also evaluated, but no statistical difference was found. Further analysis in RA patients demonstrated that none of these SNPs were associated with rheumatoid factor (RF) or anti-citrullinated protein antibody (anti-CCP). In addition, no significant differences in plasma IL-10 levels were observed among RA patients with different genotypes. The IL-10 rs1800890 variant might contribute to RA susceptibility in the Chinese population. Replication studies in different ethnic groups are required to further examine the critical role of IL-10 gene variation in the pathogenesis of RA. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  17. Single-nucleotide polymorphisms of microRNA processing machinery genes and risk of colorectal cancer

    Directory of Open Access Journals (Sweden)

    Zhao Y

    2015-02-01

    Full Text Available Yufei Zhao, Yanming Du, Shengnan Zhao, Zhanjun GuoDepartment of Gastroenterology and Hepatology, The Fourth Hospital of Hebei Medical University, Shijiazhuang, People’s Republic of ChinaObjective: MicroRNA (miRNA-related single-nucleotide polymorphisms (miR-SNPs in miRNA processing machinery genes can affect cancer risk, treatment efficacy, and patient prognosis. We genotyped 6 miR-SNPs of miRNA processing machinery genes including XPO5 (rs11077, RAN (rs14035, Dicer (rs3742330, TNRC6B (rs9623117, GEMIN3 (rs197412, and GEMIN4 (rs2740348 in a case-control study to evaluate their impact on colorectal cancer (CRC risk.Materials and methods: miR-SNPs were genotyped using the polymerase chain reaction–ligase detection reaction. The Χ2 test was used to analyze dichotomous values, such as the presence or absence of any individual SNP in CRC patients and healthy controls.Results: Two of these SNPs were identified for their association with cancer risk in the Dicer and GEMIN3 genes. The AA allele of rs3742330 located in the Dicer gene exhibited a significantly increased risk of CRC (odds ratio, 2.11; 95% confidence interval: 1.33–3.34; P=0.001; the TT allele of rs197412 located in GEMIN3 also exhibited a significantly increased risk of CRC (odds ratio, 1.68; 95% confidence interval: 1.07–2.65; P=0.024.Conclusion: Our results suggest that the specific genetic variants in miRNA machinery genes may affect CRC susceptibility.Keywords: miR-SNP, CRC, GEMIN3, Dicer

  18. FCGR2A single nucleotide polymorphism confers susceptibility to childhood-onset idiopathic nephrotic syndrome.

    Science.gov (United States)

    Rossi, Giovanni M; Bonatti, Francesco; Adorni, Alessia; Alberici, Federico; Bodria, Monica; Bonanni, Alice; Ghiggeri, Gian M; Martorana, Davide; Vaglio, Augusto

    2018-01-01

    Childhood-onset idiopathic nephrotic syndrome affects 1.15-3.4 children/100,000 children/year in Western Countries. Immune-mediated mechanisms, particularly T cell-mediated, are thought to play a key pathogenic role. The genetic basis of the disease is still poorly understood. We tested the association between single nucleotide polymorphisms (SNPs) of four genes encoding Fc gamma receptors (FCGR2A, FCGR2B, FCGR3A, FCGR3B) and idiopathic nephrotic syndrome in a case-control study of paediatric patients. Children with idiopathic nephrotic syndrome (aged 1-16 years) were included. FCGR2A rs1801274 and FCGR3A rs396991 SNPs were genotyped using real-time PCR with the TaqMan method, while FCGR2B rs1050501 and FCGR3B NA1/NA2 were genotyped using Sanger sequencing. Fisher's exact test was used to explore genetic association. We enrolled 103 idiopathic nephrotic syndrome patients and 181 healthy controls. A significant association was found between idiopathic nephrotic syndrome and FCGR2A rs1801274 SNP (both with the T allele and the TT genotype, p value=0.0009, OR 1.81, 95% CI 1.27-2.59 and p value=0.0007, OR 2.39, 95% CI 1.44-3.99, respectively). No associations were found for the remaining SNPs. Fc gamma receptors might modulate response to rituximab; since 60 of the enrolled patients were treated with rituximab, we also tested the association between the studied SNPs and rituximab efficacy in this patient subgroup, but found only a weak association with FCGR2A CC genotype (p value=0.03). The FCGR2A rs1801274 SNP in the gene encoding the activating receptor CD32A confers susceptibility to idiopathic nephrotic syndrome. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  19. MSProGene: integrative proteogenomics beyond six-frames and single nucleotide polymorphisms.

    Science.gov (United States)

    Zickmann, Franziska; Renard, Bernhard Y

    2015-06-15

    Ongoing advances in high-throughput technologies have facilitated accurate proteomic measurements and provide a wealth of information on genomic and transcript level. In proteogenomics, this multi-omics data is combined to analyze unannotated organisms and to allow more accurate sample-specific predictions. Existing analysis methods still mainly depend on six-frame translations or reference protein databases that are extended by transcriptomic information or known single nucleotide polymorphisms (SNPs). However, six-frames introduce an artificial sixfold increase of the target database and SNP integration requires a suitable database summarizing results from previous experiments. We overcome these limitations by introducing MSProGene, a new method for integrative proteogenomic analysis based on customized RNA-Seq driven transcript databases. MSProGene is independent from existing reference databases or annotated SNPs and avoids large six-frame translated databases by constructing sample-specific transcripts. In addition, it creates a network combining RNA-Seq and peptide information that is optimized by a maximum-flow algorithm. It thereby also allows resolving the ambiguity of shared peptides for protein inference. We applied MSProGene on three datasets and show that it facilitates a database-independent reliable yet accurate prediction on gene and protein level and additionally identifies novel genes. MSProGene is written in Java and Python. It is open source and available at http://sourceforge.net/projects/msprogene/. © The Author 2015. Published by Oxford University Press.

  20. Rapid high resolution single nucleotide polymorphism-comparative genome hybridization mapping in Caenorhabditis elegans.

    Science.gov (United States)

    Flibotte, Stephane; Edgley, Mark L; Maydan, Jason; Taylor, Jon; Zapf, Rick; Waterston, Robert; Moerman, Donald G

    2009-01-01

    We have developed a significantly improved and simplified method for high-resolution mapping of phenotypic traits in Caenorhabditis elegans using a combination of single nucleotide polymorphisms (SNPs) and oligo array comparative genome hybridization (array CGH). We designed a custom oligonucleotide array using a subset of confirmed SNPs between the canonical wild-type Bristol strain N2 and the Hawaiian isolate CB4856, populated with densely overlapping 50-mer probes corresponding to both N2 and CB4856 SNP sequences. Using this method a mutation can be mapped to a resolution of approximately 200 kb in a single genetic cross. Six mutations representing each of the C. elegans chromosomes were detected unambiguously and at high resolution using genomic DNA from populations derived from as few as 100 homozygous mutant segregants of mutant N2/CB4856 heterozygotes. Our method completely dispenses with the PCR, restriction digest, and gel analysis of standard SNP mapping and should be easy to extend to any organism with interbreeding strains. This method will be particularly powerful when applied to difficult or hard-to-map low-penetrance phenotypes. It should also be possible to map polygenic traits using this method.

  1. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

    Science.gov (United States)

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

    2015-11-14

    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

  2. QualitySNP: a pipeline for detecting single nucleotide polymorphisms and insertions/deletions in EST data from diploid and polyploid species

    NARCIS (Netherlands)

    Tang, J.; Vosman, B.; Voorrips, R.E.; Linden, van der C.G.; Leunissen, J.A.M.

    2006-01-01

    Background - Single nucleotide polymorphisms (SNPs) are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs)) and are

  3. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    Science.gov (United States)

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  4. SINGLE NUCLEOTIDE POLYMORPHISMS OF LIPOPROTEIN LIPASE GENE AND ITS ASSOCIATION WITH MARBLING QUALITY IN LOCAL SHEEPS

    Directory of Open Access Journals (Sweden)

    H. Hidayati

    2015-09-01

    Full Text Available Lipoprotein lipase (LPL is a key enzyme that plays in metabolism and transport lipoprotein andtherefore has an influence on blood triglyceride levels. LPL controls triacylglycerol partitioning betweenadipose tissue and muscle that increases fat storage or provides energy in the form of fatty acids formuscle growth. The research was aimed to explore Single Nucleotide Polymorphisms of LPL gene andto associate SNP with marbling quality. A total of 66 genomic DNAs consisted of sumatera thin-tail edsheep (50 heads and garut sheep (16 heads were used in this study. Polymerase Chain Reaction wasused to amplify genomic DNA and direct sequencing method was to identify polymorphism sequences.The sequences were analyzed with Bio Edit and MEGA 5.2. The BLAST sequence was obtained fromgene bank X.68308.1. The association between the genotype and marbling quality was analyze by oneway ANOVA and further between mean differences were tested using least sgnificant difference. Theresults showed that 3 novel SNPs i.e. insertion g.26>C; insertion g.27> G and c.192T>C on garut sheepand a SNP insertion g.26>C/G on sumatera thin-tail ed sheep. The diversity of LPL gene at c.192T>Cwas associated with heneicosanoic acid, whereas TT genotype (0.04% was higher than CC (0.03% andCT (0.02%.

  5. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  6. COMPARISON OF SINGLE NUCLEOTIDE POLYMORPHISMS AND MICROSATELLITES IN NON-INVASIVE GENETIC MONITORING OF A WOLF POPULATION

    DEFF Research Database (Denmark)

    Fabbri, Elena; Caniglia, R.; Mucci, Nadia

    2012-01-01

    Single nucleotide polymorphisms (SNPs) which represent the most widespread source of sequence variation in genomes, are becoming a routine application in several fields such as forensics, ecology and conservation genetics. Their use, requiring short amplifications, may allow a more efficient...... genotyping of degraded DNA. We provide the first application of SNP genotyping in an Italian non-invasive genetic monitoring project of the wolf. We compared three different techniques for genotyping SNPs: pyrosequencing, SNaPshot* and TaqMan* Probe Assay in Real-Time PCR. We successively genotyped nine SNPs....... We evaluated the cost, laboratory effort and reliability of these different markers and discuss the possible future use of VeraCode, SNPlex and Fluidigm EP1 system in wild population monitoring....

  7. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    Science.gov (United States)

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  8. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.

    2017-01-01

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  9. Association of single nucleotide polymorphisms with carcass traits in Nellore cattle.

    Science.gov (United States)

    Ferraz, J B S; Pinto, L F B; Meirelles, F V; Eler, J P; de Rezende, F M; Oliveira, E C M; Almeida, H B; Woodward, B; Nkrumah, D

    2009-11-17

    The association between two single nucleotide polymorphisms (SNPs), T945M and UCP1SNP1, with hot carcass weight (HCW, kg, N = 618), longissimus dorsi muscle area (REA, cm(2), N = 633), and backfat thickness (BF, mm, N = 625), measured in Nellore cattle in Brazil, was evaluated. Likelihood ratio tests were used to evaluate reduced (fixed effects of general mean, contemporary group, yearling weight, age at slaughter, and random effect of infinitesimal genetic value) and full model (reduced model effects plus quantitative trait locus effects). Additive and dominance effects were tested for each SNP. Genotypic and gene frequencies were also obtained for the SNPs and a descriptive phenotype analysis was made. Mean values for HCW, REA and BF were equal to 288.13 +/- 0.55 kg, 73.14 +/- 0.27 cm(2), and 4.28 +/- 0.07 mm, respectively; the coefficients of variation were 4.74, 9.24, and 42.43%, respectively. Gene frequencies for T945M and UCP1SNP1 were f(C) = 0.89, f(T) = 0.11, f(C) = 0.81, and f(G) = 0.19. The SNP T945M had a genotypic frequency of only three animals for TT genotype. Additive effects were observed for T945M on REA and BF, while UCP1SNP1 affected HCW and BF. Based on the significant additive effects of the SNPs and the gene frequencies that we found, we can expect genetic gains with marker assisted selection.

  10. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  11. Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update

    Directory of Open Access Journals (Sweden)

    Ishfaq A. Sheikh

    2016-10-01

    Full Text Available Abstract Background Preterm birth (PTB, birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 % of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs that are reported to be associated with PTB. Results A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007–2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. Conclusions A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

  12. Single nucleotide polymorphisms in CRTC1 and BARX1 are associated with esophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Anna M. J. van Nistelrooij

    2015-01-01

    Full Text Available Objective: Recently, single nucleotide polymorphisms (SNPs associated with esophageal adenocarcinoma (EAC and Barrett′s esophagus (BE were identified; rs10419226 (CRTC10, rs11789015 (BARX1, rs2687201 (FOXP10, rs2178146 (FOXF1, rs3111601 (FOXF10, and rs9936833 (FOXF1. These findings indicate that genetic susceptibility could play a role in the initiation of EAC in BE patients. The aim of this study was to validate the association between these previously identified SNPs and the risk of EAC in an independent and large case-control study. Design: Six SNPs found to be associated with EAC and BE were genotyped by a multiplex SNaPshot analysis in 1071 EAC patients diagnosed and treated in the Netherlands. Allele frequencies were compared to a control group derived from the Rotterdam Study, a population-based prospective cohort study (n = 6206. Logistic regression analysis and meta-analysis were performed to calculate odds ratios (OR. Results: Rs10419226 (CRTC1 showed a significantly increased EAC risk for the minor allele (OR = 1.17, P = 0.001, and rs11789015 (BARX1 showed a significantly decreased risk for the minor allele (OR = 0.85, P = 0.004 in the logistic regression analysis. The meta-analysis of the original GWAS and the current study revealed an improved level of significance for rs10419226 (CRTC1 (OR = 1.18, P = 6.66 × 10–10 and rs11789015 (BARX1 (OR = 0.83, P = 1.13 × 10–8 . Conclusions: This independent and large Dutch case-control study confirms the association of rs10419226 (CRTC1 and rs11789015 (BARX1 with the risk of EAC. These findings suggest a contribution of the patient genetic make-up to the development of EAC and might contribute to gain more insight in the etiology of this cancer.

  13. Association of the Single Nucleotide Polymorphisms in , , and with Blood Related Traits in Pigs

    Directory of Open Access Journals (Sweden)

    Jae-Bong Lee

    2016-12-01

    Full Text Available The aim of this study was to detect positional candidate genes located within the support interval (SI regions based on the results of red blood cell, mean corpuscular volume (MCV, and mean corpuscular hemoglobin quantitative trait locus (QTL in Sus scrofa chromosome 13, and to verify the correlation between specific single-nucleotide polymorphisms (SNPs located in the exonic region of the positional candidate gene and the three genetic traits. The flanking markers of the three QTL SI regions are SW38 and S0215. Within the QTL SI regions, 44 genes were located, and runt-related transcription factor 1, dual-specificity tyrosine-(Y-phosphorylation regulated kinase 1A (DYRK1A, and potassium inwardly-rectifying channel, subfamily J, member 15 KCNJ15–which are reported to be related to the hematological traits and clinical features of Down syndrome–were selected as positional candidate genes. The ten SNPs located in the exonic region of the three genes were detected by next generation sequencing. A total of 1,232 pigs of an F2 resource population between Landrace and Korean native pigs were genotyped. To investigate the effects of the three genes on each genotype, a mixed-effect model which is the considering family structure model was used to evaluate the associations between the SNPs and three genetic traits in the F2 intercross population. Among them, the MCV level was highly significant (nominal p = 9.8×10−9 in association with the DYRK1A-SNP1 (c.2989 G

  14. Multiple single nucleotide polymorphism analysis using penalized regression in nonlinear mixed-effect pharmacokinetic models.

    Science.gov (United States)

    Bertrand, Julie; Balding, David J

    2013-03-01

    Studies on the influence of single nucleotide polymorphisms (SNPs) on drug pharmacokinetics (PK) have usually been limited to the analysis of observed drug concentration or area under the concentration versus time curve. Nonlinear mixed effects models enable analysis of the entire curve, even for sparse data, but until recently, there has been no systematic method to examine the effects of multiple SNPs on the model parameters. The aim of this study was to assess different penalized regression methods for including SNPs in PK analyses. A total of 200 data sets were simulated under both the null and an alternative hypothesis. In each data set for each of the 300 participants, a PK profile at six sampling times was simulated and 1227 genotypes were generated through haplotypes. After modelling the PK profiles using an expectation maximization algorithm, genetic association with individual parameters was investigated using the following approaches: (i) a classical stepwise approach, (ii) ridge regression modified to include a test, (iii) Lasso and (iv) a generalization of Lasso, the HyperLasso. Penalized regression approaches are often much faster than the stepwise approach. There are significantly fewer true positives for ridge regression than for the stepwise procedure and HyperLasso. The higher number of true positives in the stepwise procedure was accompanied by a higher count of false positives (not significant). We find that all approaches except ridge regression show similar power, but penalized regression can be much less computationally demanding. We conclude that penalized regression should be preferred over stepwise procedures for PK analyses with a large panel of genetic covariates.

  15. Identification of single-nucleotide polymorphism markers associated with cortisol response to crowding in rainbow trout.

    Science.gov (United States)

    Liu, Sixin; Vallejo, Roger L; Gao, Guangtu; Palti, Yniv; Weber, Gregory M; Hernandez, Alvaro; Rexroad, Caird E

    2015-06-01

    Understanding stress responses is essential for improving animal welfare and increasing agriculture production efficiency. Previously, we reported microsatellite markers associated with quantitative trait loci (QTL) affecting plasma cortisol response to crowding in rainbow trout. In this study, our main objectives were to identify single-nucleotide polymorphism (SNP) markers associated with cortisol response to crowding in rainbow trout using both GWAS (genome-wide association studies) and QTL mapping methods and to employ rapidly expanding genomic resources for rainbow trout toward the identification of candidate genes affecting this trait. A three-generation F2 mapping family (2008052) was genotyped using RAD-seq (restriction-site-associated DNA sequencing) to identify 4874 informative SNPs. GWAS identified 26 SNPs associated with cortisol response to crowding whereas QTL mapping revealed two significant QTL on chromosomes Omy8 and Omy12, respectively. Positional candidate genes were identified using marker sequences to search the draft genome assembly of rainbow trout. One of the genes in the QTL interval on Omy12 is a putative serine/threonine protein kinase gene that was differentially expressed in the liver in response to handling and confinement stress in our previous study. A homologue of this gene was differentially expressed in zebrafish embryos exposed to diclofenac, a nonsteroidal anti-inflammatory drug (NSAID) and an environmental toxicant. NSAIDs have been shown to affect the cortisol response in rainbow trout; therefore, this gene is a good candidate based on its physical position and expression. However, the reference genome resources currently available for rainbow trout require continued improvement as demonstrated by the unmapped SNPs and the putative assembly errors detected in this study.

  16. Correlation between single nucleotide polymorphism in 11q24.1 chromosome and high myopia hereditary susceptibility

    OpenAIRE

    Xin-Hua Wang; Xiao-Yu Zhang; Han-Si Bi; Chang Zhao; Ruo-Xi Li

    2013-01-01

    AIM: To study the correlation between genetic susceptibility to high myopia and single nucleotide polymorphisms(SNPs)in 11q24. 1 chromosome among Chinese college students. METHOD: A total of 254 blood samples were obtained from Chinese college students who were often engaged in near work. The students were divided into high myopia group(42 cases), low to moderate myopia group(61 cases)and non-myopic group(151 cases). Genotyping technology was utilized to analyze the frequency of mutation of t...

  17. Prepubertal growth and single nucleotide polymorphism analysis of the growth hormone gene of low birth weight Holstein calves

    OpenAIRE

    Ro, Younghye; Choi, Woojae; Kim, Hoyung; Jang, Hojin; Lee, Hoseon; Lee, Yoonseok; Kim, Danil

    2018-01-01

    Holstein calves weighing less than 20 kg at birth have been noted in Korea. Due to insufficient information, we raised small calves with age-matched normal birth weight Holstein calves and determined body weights before puberty. In addition, 3 single nucleotide polymorphisms (SNPs) of the growth hormone (GH) gene were analyzed. Up to 10 months of age, low birth weight calves were smaller than normal weight calves. In exon 5 of the GH gene, SNP genotype variation was detected in some small cal...

  18. Association of a single nucleotide polymorphism in titin gene with marbling in Japanese Black beef cattle

    Directory of Open Access Journals (Sweden)

    Fujita Tatsuo

    2009-05-01

    Full Text Available Abstract Background Marbling defined by the amount and distribution of intramuscular fat is an economically important trait of beef cattle in Japan. We have recently reported that single nucleotide polymorphisms (SNPs in the endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1 gene were associated with marbling in Japanese Black beef cattle. As well as EDG1, the titin (TTN gene, involved in myofibrillogenesis, has been previously shown to possess expression difference in musculus longissimus muscle between low-marbled and high-marbled steer groups, and to be located within genomic region of a quantitative trait locus for marbling. Thus TTN was considered as a positional functional candidate for the gene responsible for marbling. In this study, we explored SNP in TTN and analyzed association of the SNP with marbling. Findings A SNP in the promoter region of TTN, referred to as g.231054C>T, was the only difference detected between high- and low-marbled steer groups. The SNP was associated with marbling in 3 experiments using 101 sires (P = 0.004, 848 paternal half-sib progeny steers from 5 sires heterozygous for the g.231054C>T (P = 0.046, and 820 paternal half-sib progeny steers from 3 sires homozygous for C allele at the g.231054C>T (P = 0.051, in Japanese Black beef cattle. The effect of genotypes of the SNP on subcutaneous fat thickness was not statistically significant (P > 0.05. Conclusion These findings suggest that in addition to the EDG1 SNPs, the TTN SNP polymorphism is associated with marbling and may be useful for effective marker-assisted selection to increase the levels of marbling in Japanese Black beef cattle. Further replicate studies will be needed to confirm the allelic association observed here, and to expand the results to evaluate all possible genotypic combinations of alleles.

  19. Discovery and characterization of single nucleotide polymorphisms in Chinook salmon, Oncorhynchus tshawytscha.

    Science.gov (United States)

    Clemento, A J; Abadía-Cardoso, A; Starks, H A; Garza, J C

    2011-03-01

    Molecular population genetics of non-model organisms has been dominated by the use of microsatellite loci over the last two decades. The availability of extensive genomic resources for many species is contributing to a transition to the use of single nucleotide polymorphisms (SNPs) for the study of many natural populations. Here we describe the discovery of a large number of SNPs in Chinook salmon, one of the world's most important fishery species, through large-scale Sanger sequencing of expressed sequence tag (EST) regions. More than 3 Mb of sequence was collected in a survey of variation in almost 132 kb of unique genic regions, from 225 separate ESTs, in a diverse ascertainment panel of 24 salmon. This survey yielded 117 TaqMan (5' nuclease) assays, almost all from separate ESTs, which were validated in population samples from five major stocks of salmon from the three largest basins on the Pacific coast of the contiguous United States: the Sacramento, Klamath and Columbia Rivers. The proportion of these loci that was variable in each of these stocks ranged from 86.3% to 90.6% and the mean minor allele frequency ranged from 0.194 to 0.236. There was substantial differentiation between populations with these markers, with a mean F(ST) estimate of 0.107, and values for individual loci ranging from 0 to 0.592. This substantial polymorphism and population-specific differentiation indicates that these markers will be broadly useful, including for both pedigree reconstruction and genetic stock identification applications. © 2011 Blackwell Publishing Ltd.

  20. Single Nucleotide Polymorphisms in Growth Hormone Gene and Their Association with Growth Traits in Siniperca chuatsi (Basilewsky

    Directory of Open Access Journals (Sweden)

    Changxu Tian

    2014-04-01

    Full Text Available Growth hormone (GH has been considered as a candidate gene for growth traits in fish. In this study, polymorphisms of the GH gene were evaluated for associations with growth traits in 282 Siniperca chuatsi individuals. Using directly sequencing, four single nucleotide polymorphisms (SNPs were identified in GH gene, with two mutations in intron 4 (g.4940A>C, g.4948A>T, one mutation in exon 5 (g.5045T>C and one in intron 5 (g.5234T>G. Notably, three of them were significantly associated with growth performance, particularly for g.4940A>C which was highly correlated with all the four growth traits. In conclusion, our results demonstrated that these SNPs in GH gene could influence growth performance of S.chuatsi and could be used for marker-assisted selection (MAS in this species.

  1. Previously Unidentified Single Nucleotide Polymorphisms in HIV/AIDS Cases Associate with Clinical Parameters and Disease Progression

    Directory of Open Access Journals (Sweden)

    Vladimir V. Anokhin

    2016-01-01

    Full Text Available The genetic background of an individual plays an important role in the progression of HIV infection to AIDS. Identifying previously unknown or uncharacterized single nucleotide polymorphisms (SNPs that associate with disease progression may reveal important therapeutic targets and provide a greater understanding of disease pathogenesis. In the present study, we employed ultra-high multiplex PCR on an Ion Torrent next-generation sequencing platform to sequence 23 innate immune genes from 94 individuals with HIV/AIDS. This data was used to identify potential associations of SNPs with clinical parameters and disease progression. SNPs that associated with an increased viral load were identified in the genes for the interleukin 15 receptor (IL15RA, toll-like receptor 7 (TLR7, tripartite motif-containing protein 5 (TRIM5, and two killer-cell immunoglobulin-like receptors (KIR2DL1 and KIR2DL3. Additionally, SNPs that associated with progression from HIV infection to AIDS were identified in two 2′-5′-oligoadenylate synthetase genes (OAS2 and OAS3. In contrast, other SNPs identified in OAS2 and OAS3 genes, as well as in the TRIM5 and KIR2DS4 genes, were associated with a slower progression of disease. Taken together, our data demonstrates the utility of ultra-high multiplex PCR in identifying polymorphisms of potential clinical significance and further,identifies SNPs that may play a role in HIV pathogenesis.

  2. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available RNA-seq is a useful next-generation sequencing (NGS technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits.The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM SNP genotyping assay. The

  3. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    Science.gov (United States)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay

  4. Association between single nucleotide polymorphism of apoVLDL-II ...

    African Journals Online (AJOL)

    ONOS

    2010-07-05

    Jul 5, 2010 ... Musa et al., 2007). Therefore, the present study was developed to detect apoVLDL-II gene polymorphism in. Iranian commercial broiler lines and evaluate ... DNA extraction. Whole blood samples were collected from 400 chickens at 6 weeks of age. They were obtained from four different commercial broiler.

  5. Single nucleotide polymorphism genotyping and its application on ...

    African Journals Online (AJOL)

    The nucleotide diversity across a genome is the source of most phenotypic variation. Such DNA polymorphism is the basis for the development of molecular markers, an indispensable tool in genetic mapping studies. In general, the high resolution fine mapping of genes is often limited by lack of sufficient number of ...

  6. Identification of a single nucleotide polymorphism of the pituitary ...

    African Journals Online (AJOL)

    Pit-1 is a pituitary-specific transcriptional factor that has been shown to play a critical role both in cell differentiation during organogenesis of the anterior pituitary and as a transcriptional activator for pituitary gene transcription. This study was designed to investigate the associations of Pit-1 gene polymorphism on chicken ...

  7. Analysis of single nucleotide polymorphisms of PRNP gene in ...

    Indian Academy of Sciences (India)

    12, 389–394. Del Bo R., Comi G. P., Giorda R., Crimi M., Locatelli F., Martinelli-. Boneschi F. et al. 2003 The 129 codon polymorphism of the prion protein gene influences earlier cognitive performance in. Down syndrome subjects. J. Neurol. 250, 688–692. Indian Genome Variation Consortium 2005 The Indian Genome.

  8. Identification of single nucleotide polymorphism of growth hormone ...

    African Journals Online (AJOL)

    Yurnalis

    bGH sequences from a public database (National Center for Biotechnology Information, acces number. M57764), revealed 15 polymorphisms (five SNP, eight deletion, and two insertion). Eight deletions were detected in position 1740, 1743, 1745, 1747, 1749, 1750, 1753, and 1754 with frequency allele of 0.50,. 0.22, 0.125 ...

  9. Identification of single nucleotide polymorphism of growth hormone ...

    African Journals Online (AJOL)

    Yurnalis

    The pupose of this study was to identify genetic polymorphisms of bovine growth hormone gene exon. 4, and intron 4 in local cattle breeds in West Sumatera Province of Indonesia. DNA was isolated from 60 blood samples and polymerase chain reaction (PCR) product of GH5 fragment (366 bp) were directly sequenced.

  10. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    as genotyping by melting curve analysis is possible by the use of hybridisation probes. These hybridisation probes are sequence-specific oligonucleotide probes, labelled by fluorescence dyes. For the detection of a SNP two hy- bridisation probes are required, one that binds to the. DNA strand in a way that the polymorphic ...

  11. Exploiting the Repetitive Fraction of the Wheat Genome for High-Throughput Single-Nucleotide Polymorphism Discovery and Genotyping

    Directory of Open Access Journals (Sweden)

    Nelly Cubizolles

    2016-03-01

    Full Text Available Transposable elements (TEs account for more than 80% of the wheat genome. Although they represent a major obstacle for genomic studies, TEs are also a source of polymorphism and consequently of molecular markers such as insertion site-based polymorphism (ISBP markers. Insertion site-based polymorphisms have been found to be a great source of genome-specific single-nucleotide polymorphism (SNPs in the hexaploid wheat ( L. genome. Here, we report on the development of a high-throughput SNP discovery approach based on sequence capture of ISBP markers. By applying this approach to the reference sequence of chromosome 3B from hexaploid wheat, we designed 39,077 SNPs that are evenly distributed along the chromosome. We demonstrate that these SNPs can be efficiently scored with the KASPar (Kompetitive allele-specific polymerase chain reaction genotyping technology. Finally, through genetic diversity and genome-wide association studies, we also demonstrate that ISBP-derived SNPs can be used in marker-assisted breeding programs.

  12. Computational Analysis of Damaging Single-Nucleotide Polymorphisms and Their Structural and Functional Impact on the Insulin Receptor

    Directory of Open Access Journals (Sweden)

    Zabed Mahmud

    2016-01-01

    Full Text Available Single-nucleotide polymorphisms (SNPs associated with complex disorders can create, destroy, or modify protein coding sites. Single amino acid substitutions in the insulin receptor (INSR are the most common forms of genetic variations that account for various diseases like Donohue syndrome or Leprechaunism, Rabson-Mendenhall syndrome, and type A insulin resistance. We analyzed the deleterious nonsynonymous SNPs (nsSNPs in INSR gene based on different computational methods. Analysis of INSR was initiated with PROVEAN followed by PolyPhen and I-Mutant servers to investigate the effects of 57 nsSNPs retrieved from database of SNP (dbSNP. A total of 18 mutations that were found to exert damaging effects on the INSR protein structure and function were chosen for further analysis. Among these mutations, our computational analysis suggested that 13 nsSNPs decreased protein stability and might have resulted in loss of function. Therefore, the probability of their involvement in disease predisposition increases. In the lack of adequate prior reports on the possible deleterious effects of nsSNPs, we have systematically analyzed and characterized the functional variants in coding region that can alter the expression and function of INSR gene. In silico characterization of nsSNPs affecting INSR gene function can aid in better understanding of genetic differences in disease susceptibility.

  13. Association of BAK1 single nucleotide polymorphism with a risk for dengue hemorrhagic fever.

    Science.gov (United States)

    Dang, Tran Ngoc; Naka, Izumi; Sa-Ngasang, Areerat; Anantapreecha, Surapee; Wichukchinda, Nuanjun; Sawanpanyalert, Pathom; Patarapotikul, Jintana; Tsuchiya, Naoyuki; Ohashi, Jun

    2016-07-11

    Dengue hemorrhagic fever (DHF) is a severe life-threatening form of dengue infection. Low platelet count is one of the characteristic clinical manifestations in patients with severe dengue. However, little is known about genetic factors in the host that cause low platelet count in patients with dengue. A previous genome-wide association study of hematological and biochemical traits identified single nucleotide polymorphisms (SNPs) associated with low platelet count in healthy subjects. To examine the possible association of these SNPs with DHF, 918 Thai patients with dengue [509 patients with DHF and 409 with dengue fever (DF)] were genotyped for five SNPs: rs5745568 in BAK1, rs6141 in THPO, rs6065 in GP1BA, rs739496 in SH2B3, and rs385893 in RCL1. In addition, rs4804803 in CD209, that has been reported to be associated with dengue infection, was also genotyped to examine if rs4804803 affects the association detected in this study. The allele frequencies of each SNP were compared between the DHF and DF groups. Among the five SNPs, the G allele of rs5745568 in BAK1 was significantly associated with a risk for DHF [P = 0.006 and crude odd ratio (95 % confidence interval) = 1.32 (1.09-1.60)]. The association of this allele with DHF was also significant in a logistic regression analysis adjusted for age, sex, hospital (i.e., geographic region), immune status (i.e., primary or secondary infection), and virus serotype [P = 0.016 and adjusted odd ratio (95 % confidence interval) = 1.29 (1.05-1.58)]. The result was not influenced by rs4804803 [P = 0.0167 and adjusted OR (95 % CI) = 1.29 (1.05-1.58)]. No other SNPs including rs4804803 showed significant association. The low-level constitutive production of platelets caused by the G allele of rs5745568 seems to increase the risk of bleeding in dengue infection. Our results suggest that BCL-2 homologous antagonist/killer (BAK) protein, encoded by BAK1, plays a crucial role in the pathogenesis of DHF.

  14. Varietal identification of tea (Camellia sinensis) using nanofluidic array of single nucleotide polymorphism (SNP) markers.

    Science.gov (United States)

    Fang, Wan-Ping; Meinhardt, Lyndel W; Tan, Hua-Wei; Zhou, Lin; Mischke, Sue; Zhang, Dapeng

    2014-01-01

    Apart from water, tea is the world's most widely consumed beverage. Tea is produced in more than 50 countries with an annual production of approximately 4.7 million tons. The market segment for specialty tea has been expanding rapidly owing to increased demand, resulting in higher revenues and profits for tea growers and the industry. Accurate varietal identification is critically important to ensure traceability and authentication of premium tea products, which in turn contribute to on-farm conservation of tea genetic diversity. Using a set of single nucleotide polymorphism (SNP) markers developed from the expressed sequence tag (EST) database of Camilla senensis, we genotyped deoxyribonucleic acid (DNA) samples extracted from a diverse group of tea varieties, including both fresh and processed commercial loose-leaf teas. The validation led to the designation of 60 SNPs that unambiguously identified all 40 tested tea varieties with high statistical rigor (pauthenticity and genetic relationships among the analyzed cultivars were further characterized by ordination and Bayesian clustering analysis. These SNP markers, in combination with a high-throughput genotyping protocol, effectively established and verified specific DNA fingerprints for all tested tea varieties. This method provides a powerful tool for variety authentication and quality control for the tea industry. It is also highly useful for the management of tea genetic resources and breeding, where accurate and efficient genotype identification is essential.

  15. Single Nucleotide Polymorphism Heritability of a General Psychopathology Factor in Children.

    Science.gov (United States)

    Neumann, Alexander; Pappa, Irene; Lahey, Benjamin B; Verhulst, Frank C; Medina-Gomez, Carolina; Jaddoe, Vincent W; Bakermans-Kranenburg, Marian J; Moffitt, Terrie E; van IJzendoorn, Marinus H; Tiemeier, Henning

    2016-12-01

    Co-occurrence of mental disorders is commonly observed, but the etiology underlying this observation is poorly understood. Studies in adolescents and adults have identified a general psychopathology factor associated with a high risk for different psychiatric disorders. We defined a multi-informant general psychopathology factor in school-aged children and estimated its single nucleotide polymorphism (SNP) heritability. The goal was to test the hypothesis that child behavioral and emotional problems are under the influence of highly pleiotropic common autosomal genetic variants that nonspecifically increase the risk for different dimensions of psychopathology. Children from the Generation R cohort were repeatedly assessed between ages 6 to 8 years. Child behavior problems were reported by parents, teachers, and children. Confirmatory factor analysis estimated a general psychopathology factor across informants using various psychiatric problem scales. Validation of the general psychopathology factor was based on IQ and temperamental measures. Genome-wide complex trait analysis (GCTA) was used to estimate the SNP heritability (N = 2,115). The general psychopathology factor was associated with lower IQ, higher negative affectivity, and lower effortful control, but not with surgency. Importantly, the general psychopathology factor showed a significant SNP heritability of 38% (SE = 0.16, p = .008). Common autosomal SNPs are pleiotropically associated with internalizing, externalizing, and other child behavior problems, and underlie a general psychopathology factor in childhood. Copyright © 2016 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

  16. Prediction of maize phenotype based on whole-genome single nucleotide polymorphisms using deep belief networks

    Science.gov (United States)

    Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.

    2017-05-01

    Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.

  17. Investigation of single nucleotide polymorphism loci susceptible to degradation by ultraviolet light.

    Science.gov (United States)

    Machida, Mitsuyo; Taki, Takashi; Shimada, Ryo; Kibayashi, Kazuhiko

    2016-10-01

    DNA in biological fluids is often degraded by environmental factors. Given that single nucleotide polymorphism (SNP) analyses require shorter amplicons than short tandem repeat (STR) analyses do, their use in human identification using degraded samples has recently attracted attention. Although various SNP loci are used to analyze degraded samples, it is unclear which ones are more appropriate. To characterize and identify SNP loci that are susceptible or resistant to degradation, we artificially degraded DNA, obtained from buccal swabs from 11 volunteers, by exposure to ultraviolet (UV) light for different durations (254 nm for 5, 15, 30, 60, or 120 min) and analyzed the resulting SNP loci. DNA degradation was assessed using gel electrophoresis, STR, and SNP profiling. DNA fragmentation occurred within 5 min of UV irradiation, and successful STR and SNP profiling decreased with increasing duration. However, 73% of SNP loci were still detected correctly in DNA samples irradiated for 120 min, a dose that rendered STR loci undetectable. The unsuccessful SNP typing and the base call failure of nucleotides neighboring the SNPs were traced to rs1031825, and we found that this SNP was susceptible to UV light. When comparing the detection efficiencies of STR and SNP loci, SNP typing was more successful than STR typing, making it effective when using degraded DNA. However, it is important to use rs1031825 with caution when interpreting SNP analyses of degraded DNA. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  18. Non-Mendelian Single-Nucleotide Polymorphism Inheritance and Atypical Meiotic Configurations are Prevalent in Hop.

    Science.gov (United States)

    Zhang, Dong; Easterling, Katherine A; Pitra, Nicholi J; Coles, Mark C; Buckler, Edward S; Bass, Hank W; Matthews, Paul D

    2017-11-01

    Hop ( L.) breeding programs seek to exploit genetic resources for bitter flavor, aroma, and disease resistance. However, these efforts have been thwarted by segregation distortion including female-biased sex ratios. To better understand the transmission genetics of hop, we genotyped 4512 worldwide accessions of hop, including cultivars, landraces, and over 100 wild accessions using a genotyping-by-sequencing (GBS) approach. From the resulting ∼1.2 million single-nucleotide polymorphisms (SNPs), prequalified GBS markers were validated by inferences in population structures and phylogeny. Analysis of pseudo-testcross (Pt) mapping data from F families revealed mixed patterns of Mendelian and non-Mendelian segregation. Three-dimensional (3D) cytogenetic analysis of late meiotic prophase nuclei from two wild and two cultivated hop revealed conspicuous and prevalent occurrences of multiple, atypical, nondisomic chromosome complexes including autosomes. We used genome-wide association studies (GWAS) and fixation index (F) analysis to demonstrate selection mapping of genetic loci for key traits including sex, bitter acids, and drought tolerance. Among the possible mechanisms underlying the observed segregation distortion from the genomic data analysis, the cytogenetic analysis points to meiotic chromosome behavior as one of the contributing factors. The findings shed light on long-standing questions on the unusual transmission genetics and phenotypic variation in hop, with major implications for breeding, cultivation, and the natural history of . Copyright © 2017 Crop Science Society of America.

  19. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos

    2017-12-01

    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  20. Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis

    Directory of Open Access Journals (Sweden)

    Rabinowicz Pablo D

    2010-01-01

    Full Text Available Abstract Background Castor bean (Ricinus communis is an agricultural crop and garden ornamental that is widely cultivated and has been introduced worldwide. Understanding population structure and the distribution of castor bean cultivars has been challenging because of limited genetic variability. We analyzed the population genetics of R. communis in a worldwide collection of plants from germplasm and from naturalized populations in Florida, U.S. To assess genetic diversity we conducted survey sequencing of the genomes of seven diverse cultivars and compared the data to a reference genome assembly of a widespread cultivar (Hale. We determined the population genetic structure of 676 samples using single nucleotide polymorphisms (SNPs at 48 loci. Results Bayesian clustering indicated five main groups worldwide and a repeated pattern of mixed genotypes in most countries. High levels of population differentiation occurred between most populations but this structure was not geographically based. Most molecular variance occurred within populations (74% followed by 22% among populations, and 4% among continents. Samples from naturalized populations in Florida indicated significant population structuring consistent with local demes. There was significant population differentiation for 56 of 78 comparisons in Florida (pairwise population ϕPT values, p Conclusion Low levels of genetic diversity and mixing of genotypes have led to minimal geographic structuring of castor bean populations worldwide. Relatively few lineages occur and these are widely distributed. Our approach of determining population genetic structure using SNPs from genome-wide comparisons constitutes a framework for high-throughput analyses of genetic diversity in plants, particularly in species with limited genetic diversity.

  1. EFIN: predicting the functional impact of nonsynonymous single nucleotide polymorphisms in human genome.

    Science.gov (United States)

    Zeng, Shuai; Yang, Jing; Chung, Brian Hon-Yin; Lau, Yu Lung; Yang, Wanling

    2014-06-10

    Predicting the functional impact of amino acid substitutions (AAS) caused by nonsynonymous single nucleotide polymorphisms (nsSNPs) is becoming increasingly important as more and more novel variants are being discovered. Bioinformatics analysis is essential to predict potentially causal or contributing AAS to human diseases for further analysis, as for each genome, thousands of rare or private AAS exist and only a very small number of which are related to an underlying disease. Existing algorithms in this field still have high false prediction rate and novel development is needed to take full advantage of vast amount of genomic data. Here we report a novel algorithm that features two innovative changes: 1. making better use of sequence conservation information by grouping the homologous protein sequences into six blocks according to evolutionary distances to human and evaluating sequence conservation in each block independently, and 2. including as many such homologous sequences as possible in analyses. Random forests are used to evaluate sequence conservation in each block and to predict potential impact of an AAS on protein function. Testing of this algorithm on a comprehensive dataset showed significant improvement on prediction accuracy upon currently widely-used programs. The algorithm and a web-based application tool implementing it, EFIN (Evaluation of Functional Impact of Nonsynonymous SNPs) were made freely available (http://paed.hku.hk/efin/) to the public. Grouping homologous sequences into different blocks according to the evolutionary distance of the species to human and evaluating sequence conservation in each group independently significantly improved prediction accuracy. This approach may help us better understand the roles of genetic variants in human disease and health.

  2. Discovery and characterization of single-nucleotide polymorphisms in steelhead/rainbow trout, Oncorhynchus mykiss.

    Science.gov (United States)

    Abadía-Cardoso, Alicia; Clemento, Anthony J; Garza, John Carlos

    2011-03-01

    Single-nucleotide polymorphisms (SNPs) have several advantages over other genetic markers, including lower mutation and genotyping error rates, ease of inter-laboratory standardization, and the prospect of high-throughput, low-cost genotyping. Nevertheless, their development and use has only recently moved beyond model organisms to groups such as salmonid fishes. Oncorhynchus mykiss is a salmonid native to the North Pacific rim that has now been introduced throughout the world for fisheries and aquaculture. The anadromous form of the species is known as steelhead. Native steelhead populations on the west coast of the United States have declined and many now have protected status. The nonanadromous, or resident, form of the species is termed rainbow, redband or golden trout. Additional life history and morphological variation, and interactions between the forms, make the species challenging to study, monitor and evaluate. Here, we describe the discovery, characterization and assay development for 139 SNP loci in steelhead/rainbow trout. We used EST sequences from existing genomic databases to design primers for 480 genes. Sanger-sequencing products from these genes provided 130 KB of consensus sequence in which variation was surveyed for 22 individuals from steelhead, rainbow and redband trout groups. The resulting TaqMan assays were surveyed in five steelhead populations and three rainbow trout stocks, where they had a mean minor allele frequency of 0.15-0.26 and observed heterozygosity of 0.18-0.35. Mean F(ST) was 0.204. The development of SNPs for O. mykiss will help to provide highly informative genetic tools for individual and stock identification, pedigree reconstruction, phylogeography and ecological investigation. © 2011 Blackwell Publishing Ltd.

  3. Deciphering Single Nucleotide Polymorphisms and Evolutionary Trends in Isolates of the Cydia pomonella granulovirus.

    Science.gov (United States)

    Wennmann, Jörg T; Radtke, Pit; Eberle, Karolin E; Gueli Alletti, Gianpiero; Jehle, Johannes A

    2017-08-18

    Six complete genome sequences of Cydia pomonella granulovirus (CpGV) isolates from Mexico (CpGV-M and CpGV-M1), England (CpGV-E2), Iran (CpGV-I07 and CpGV-I12), and Canada (CpGV-S) were aligned and analyzed for genetic diversity and evolutionary processes. The selected CpGV isolates represented recently identified phylogenetic lineages of CpGV, namely, the genome groups A to E. The genomes ranged from 120,816 bp to 124,269 bp. Several common differences between CpGV-M, -E2, -I07, -I12 and -S to CpGV-M1, the first sequenced and published CpGV isolate, were highlighted. Phylogenetic analysis based on the aligned genome sequences grouped CpGV-M and CpGV-I12 as the most derived lineages, followed by CpGV-E2, CpGV-S and CpGV-I07, which represent the most basal lineages. All of the genomes shared a high degree of co-linearity, with a common setup of 137 (CpGV-I07) to 142 (CpGV-M and -I12) open reading frames with no translocations. An overall trend of increasing genome size and a decrease in GC content was observed, from the most basal lineage (CpGV-I07) to the most derived (CpGV-I12). A total number of 788 positions of single nucleotide polymorphisms (SNPs) were determined and used to create a genome-wide SNP map of CpGV. Of the total amount of SNPs, 534 positions were specific for exactly one of either isolate CpGV-M, -E2, -I07, -I12 or -S, which allowed the SNP-based detection and identification of all known CpGV isolates.

  4. A high throughput single nucleotide polymorphism multiplex assay for parentage assignment in New Zealand sheep.

    Directory of Open Access Journals (Sweden)

    Shannon M Clarke

    Full Text Available Accurate pedigree information is critical to animal breeding systems to ensure the highest rate of genetic gain and management of inbreeding. The abundance of available genomic data, together with development of high throughput genotyping platforms, means that single nucleotide polymorphisms (SNPs are now the DNA marker of choice for genomic selection studies. Furthermore the superior qualities of SNPs compared to microsatellite markers allows for standardization between laboratories; a property that is crucial for developing an international set of markers for traceability studies. The objective of this study was to develop a high throughput SNP assay for use in the New Zealand sheep industry that gives accurate pedigree assignment and will allow a reduction in breeder input over lambing. This required two phases of development--firstly, a method of extracting quality DNA from ear-punch tissue performed in a high throughput cost efficient manner and secondly a SNP assay that has the ability to assign paternity to progeny resulting from mob mating. A likelihood based approach to infer paternity was used where sires with the highest LOD score (log of the ratio of the likelihood given parentage to likelihood given non-parentage are assigned. An 84 "parentage SNP panel" was developed that assigned, on average, 99% of progeny to a sire in a problem where there were 3,000 progeny from 120 mob mated sires that included numerous half sib sires. In only 6% of those cases was there another sire with at least a 0.02 probability of paternity. Furthermore dam information (either recorded, or by genotyping possible dams was absent, highlighting the SNP test's suitability for paternity testing. Utilization of this parentage SNP assay will allow implementation of progeny testing into large commercial farms where the improved accuracy of sire assignment and genetic evaluations will increase genetic gain in the sheep industry.

  5. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  6. Genetic diversity and relatedness of sweet cherry (prunus avium L.) cultivars based on single nucleotide polymorphic markers.

    Science.gov (United States)

    Fernandez I Marti, Angel; Athanson, Blessing; Koepke, Tyson; Font I Forcada, Carolina; Dhingra, Amit; Oraguzie, Nnadozie

    2012-01-01

    Most previous studies on genetic fingerprinting and cultivar relatedness in sweet cherry were based on isoenzyme, RAPD, and simple sequence repeat (SSR) markers. This study was carried out to assess the utility of single nucleotide polymorphism (SNP) markers generated from 3' untranslated regions (UTR) for genetic fingerprinting in sweet cherry. A total of 114 sweet cherry germplasm representing advanced selections, commercial cultivars, and old cultivars imported from different parts of the world were screened with seven SSR markers developed from other Prunus species and with 40 SNPs obtained from 3' UTR sequences of Rainier and Bing sweet cherry cultivars. Both types of marker study had 99 accessions in common. The SSR data was used to validate the SNP results. Results showed that the average number of alleles per locus, mean observed heterozygosity, expected heterozygosity, and polymorphic information content values were higher in SSRs than in SNPs although both set of markers were similar in their grouping of the sweet cherry accessions as shown in the dendrogram. SNPs were able to distinguish sport mutants from their wild type germplasm. For example, "Stella" was separated from "Compact Stella." This demonstrates the greater power of SNPs for discriminating mutants from their original parents than SSRs. In addition, SNP markers confirmed parentage and also determined relationships of the accessions in a manner consistent with their pedigree relationships. We would recommend the use of 3' UTR SNPs for genetic fingerprinting, parentage verification, gene mapping, and study of genetic diversity in sweet cherry.

  7. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    Science.gov (United States)

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  8. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  9. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  10. Verification of genetic identity of introduced cacao germplasm in Ghana using single nucleotide polymorphism (SNP) markers

    Science.gov (United States)

    Accurate identification of individual genotypes is important for cacao (Theobroma cacao L.) breeding, germplasm conservation and seed propagation. The development of single nucleotide polymorphism (SNP) markers in cacao offers an effective way to use a high-throughput genotyping system for cacao gen...

  11. Single-nucleotide polymorphisms in the B7H3 gene are not ...

    Indian Academy of Sciences (India)

    toimmune encephalomyelitis (Suh et al. 2003; Prasad et al. 2004). A recent study has stated that the 4Ig-B7-H3 molecule. Keywords. myasthenia gravis (MG); B7 homologue 3 (B7H3); single-nucleotide polymorphism (SNP); acetylcholine receptor (AChR) antibodies; pyrosequencing. Journal of Genetics, Vol. 85, No.

  12. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    MAHESWARI

    Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of ... Keywords. anovulation; hyperandrogenism; infertility; polycystic ovary syndrome; single-nucleotide polymorphism; real-time polymerase ...... tion with insulin secretion in obese children.

  13. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  14. Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit

    Directory of Open Access Journals (Sweden)

    E.M. Abdel-Kafy

    2016-09-01

    Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.

  15. Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.

    Science.gov (United States)

    Li, Hao; Wetten, Sally; Li, Li; St Jean, Pamela L; Upmanyu, Ruchi; Surh, Linda; Hosford, David; Barnes, Michael R; Briley, James David; Borrie, Michael; Coletta, Natalie; Delisle, Richard; Dhalla, Daniella; Ehm, Margaret G; Feldman, Howard H; Fornazzari, Luis; Gauthier, Serge; Goodgame, Neil; Guzman, Danilo; Hammond, Sandra; Hollingworth, Paul; Hsiung, Ging-Yuek; Johnson, Joan; Kelly, Devon D; Keren, Ron; Kertesz, Andrew; King, Karen S; Lovestone, Simon; Loy-English, Inge; Matthews, Paul M; Owen, Michael J; Plumpton, Mary; Pryse-Phillips, William; Prinjha, Rab K; Richardson, Jill C; Saunders, Ann; Slater, Andrew J; St George-Hyslop, Peter H; Stinnett, Sandra W; Swartz, Jina E; Taylor, Rachel L; Wherrett, John; Williams, Julie; Yarnall, David P; Gibson, Rachel A; Irizarry, Michael C; Middleton, Lefkos T; Roses, Allen D

    2008-01-01

    To identify single-nucleotide polymorphisms (SNPs) associated with risk and age at onset of Alzheimer disease (AD) in a genomewide association study of 469 438 SNPs. Case-control study with replication. Memory referral clinics in Canada and the United Kingdom. The hypothesis-generating data set consisted of 753 individuals with AD by National Institute of Neurological and Communicative Diseases and Stroke/Alzheimer's Disease and Related Disorders Association criteria recruited from 9 memory referral clinics in Canada and 736 ethnically matched control subjects; control subjects were recruited from nonbiological relatives, friends, or spouses of the patients and did not exhibit cognitive impairment by history or cognitive testing. The follow-up data set consisted of 418 AD cases and 249 nondemented control cases from the United Kingdom Medical Research Council Genetic Resource for Late-Onset AD recruited from clinics at Cardiff University, Cardiff, Wales, and King's College London, London, England. Odds ratios and 95% confidence intervals for association of SNPs with AD by logistic regression adjusted for age, sex, education, study site, and French Canadian ancestry (for the Canadian data set). Hazard ratios and 95% confidence intervals from Cox proportional hazards regression for age at onset with similar covariate adjustments. Unadjusted, SNP RS4420638 within APOC1 was strongly associated with AD due entirely to linkage disequilibrium with APOE. In the multivariable adjusted analyses, 3 SNPs within the top 120 by P value in the logistic analysis and 1 in the Cox analysis of the Canadian data set provided additional evidence for association at P< .05 within the United Kingdom Medical Research Council data set: RS7019241 (GOLPH2), RS10868366 (GOLPH2), RS9886784 (chromosome 9), and RS10519262 (intergenic between ATP8B4 and SLC27A2). Our genomewide association analysis again identified the APOE linkage disequilibrium region as the strongest genetic risk factor for AD

  16. Geography and genography: prediction of continental origin using randomly selected single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramoni Marco F

    2007-03-01

    Full Text Available Abstract Background Recent studies have shown that when individuals are grouped on the basis of genetic similarity, group membership corresponds closely to continental origin. There has been considerable debate about the implications of these findings in the context of larger debates about race and the extent of genetic variation between groups. Some have argued that clustering according to continental origin demonstrates the existence of significant genetic differences between groups and that these differences may have important implications for differences in health and disease. Others argue that clustering according to continental origin requires the use of large amounts of genetic data or specifically chosen markers and is indicative only of very subtle genetic differences that are unlikely to have biomedical significance. Results We used small numbers of randomly selected single nucleotide polymorphisms (SNPs from the International HapMap Project to train naïve Bayes classifiers for prediction of ancestral continent of origin. Predictive accuracy was tested on two independent data sets. Genetically similar groups should be difficult to distinguish, especially if only a small number of genetic markers are used. The genetic differences between continentally defined groups are sufficiently large that one can accurately predict ancestral continent of origin using only a minute, randomly selected fraction of the genetic variation present in the human genome. Genotype data from only 50 random SNPs was sufficient to predict ancestral continent of origin in our primary test data set with an average accuracy of 95%. Genetic variations informative about ancestry were common and widely distributed throughout the genome. Conclusion Accurate characterization of ancestry is possible using small numbers of randomly selected SNPs. The results presented here show how investigators conducting genetic association studies can use small numbers of arbitrarily

  17. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  18. Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

    Science.gov (United States)

    Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

    2016-07-01

    A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

  19. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    Science.gov (United States)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  20. Genomic variation and population structure detected by single nucleotide polymorphism arrays in Corriedale, Merino and Creole sheep

    Directory of Open Access Journals (Sweden)

    Andrés N Grasso

    2014-06-01

    Full Text Available The aim of this study was to investigate the genetic diversity within and among three breeds of sheep: Corriedale, Merino and Creole. Sheep from the three breeds (Merino n = 110, Corriedale n = 108 and Creole n = 10 were genotyped using the Illumina Ovine SNP50 beadchip®. Genetic diversity was evaluated by comparing the minor allele frequency (MAF among breeds. Population structure and genetic differentiation were assessed using STRUCTURE software, principal component analysis (PCA and fixation index (F ST. Fixed markers (MAF = 0 that were different among breeds were identified as specific breed markers. Using a subset of 18,181 single nucleotide polymorphisms (SNPs, PCA and STUCTURE analysis were able to explain population stratification within breeds. Merino and Corriedale divergent lines showed high levels of polymorphism (89.4% and 86% of polymorphic SNPs, respectively and moderate genetic differentiation (F ST = 0.08 between them. In contrast, Creole had only 69% polymorphic SNPs and showed greater genetic differentiation from the other two breeds (F ST = 0.17 for both breeds. Hence, a subset of molecular markers present in the OvineSNP50 is informative enough for breed assignment and population structure analysis of commercial and Creole breeds.

  1. High resolution discrimination of clinical Mycobacterium tuberculosis complex strains based on single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Susanne Homolka

    Full Text Available Recently, the diversity of the Mycobacterium tuberculosis complex (MTBC population structure has been described in detail. Based on geographical separation and specific host pathogen co-evolution shaping MTBC virulence traits, at least 20 major lineages/genotypes have evolved finally leading to a clear influence of strain genetic background on transmissibility, clinical presentation/outcome, and resistance development. Therefore, high resolution genotyping for characterization of strains in larger studies is mandatory for understanding mechanisms of host-pathogen-interaction and to improve tuberculosis (TB control. Single nucleotide polymorphisms (SNPs represent the most reliable markers for lineage classification of clinical isolates due to the low levels of homoplasy, however their use is hampered either by low discriminatory power or by the need to analyze a large number of genes to achieve higher resolution. Therefore, we carried out de novo sequencing of 26 genes (approx. 20000 bp per strain in a reference collection of MTBC strains including all major genotypes to define a highly discriminatory gene set. Overall, 161 polymorphisms were detected of which 59 are genotype-specific, while 13 define deeper branches such as the Euro-American lineage. Unbiased investigation of the most variable set of 11 genes in a population based strain collection (one year, city of Hamburg, Germany confirmed the validity of SNP analysis as all strains were classified with high accuracy. Taken together, we defined a diagnostic algorithm which allows the identification of 17 MTBC phylogenetic lineages with high confidence for the first time by sequencing analysis of just five genes. In conclusion, the diagnostic algorithm developed in our study is likely to open the door for a low cost high resolution sequence/SNP based differentiation of the MTBC with a very high specificity. High throughput assays can be established which will be needed for large association

  2. Gene-based single nucleotide polymorphism markers for genetic and association mapping in common bean.

    Science.gov (United States)

    Galeano, Carlos H; Cortés, Andrés J; Fernández, Andrea C; Soler, Álvaro; Franco-Herrera, Natalia; Makunde, Godwill; Vanderleyden, Jos; Blair, Matthew W

    2012-06-26

    In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. In short, this study illustrates the power of intron-based markers for linkage and association mapping in

  3. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs within potential candidate genes (CGs or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF, Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis

  4. Analysis of horse myostatin gene and identification of single nucleotide polymorphisms in breeds of different morphological types.

    Science.gov (United States)

    Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto

    2010-01-01

    Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.

  5. Empirical Comparison of Simple Sequence Repeats and Single Nucleotide Polymorphisms in Assessment of Maize Diversity and Relatedness

    Science.gov (United States)

    Hamblin, Martha T.; Warburton, Marilyn L.; Buckler, Edward S.

    2007-01-01

    While Simple Sequence Repeats (SSRs) are extremely useful genetic markers, recent advances in technology have produced a shift toward use of single nucleotide polymorphisms (SNPs). The different mutational properties of these two classes of markers result in differences in heterozygosities and allele frequencies that may have implications for their use in assessing relatedness and evaluation of genetic diversity. We compared analyses based on 89 SSRs (primarily dinucleotide repeats) to analyses based on 847 SNPs in individuals from the same 259 inbred maize lines, which had been chosen to represent the diversity available among current and historic lines used in breeding. The SSRs performed better at clustering germplasm into populations than did a set of 847 SNPs or 554 SNP haplotypes, and SSRs provided more resolution in measuring genetic distance based on allele-sharing. Except for closely related pairs of individuals, measures of distance based on SSRs were only weakly correlated with measures of distance based on SNPs. Our results suggest that 1) large numbers of SNP loci will be required to replace highly polymorphic SSRs in studies of diversity and relatedness and 2) relatedness among highly-diverged maize lines is difficult to measure accurately regardless of the marker system. PMID:18159250

  6. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2010-01-01

    Full Text Available Myostatin (MSTN is a negative modulator of muscle mass. We characterized the horse (Equus caballus MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type than in light breeds (dolichomorphic type such as Italian Trotter breed. The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.

  7. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    Directory of Open Access Journals (Sweden)

    Kim Tae-Ho

    2007-11-01

    Full Text Available Abstract Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63% had been previously identified and 331 (37% were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an

  8. Forensic usefulness of a 25 X-chromosome single-nucleotide polymorphism marker set

    DEFF Research Database (Denmark)

    Tomas, Carmen; Sanchez, Juan J; Castro, Jose Aurelio

    2010-01-01

    -nucleotide polymorphisms (X-SNPs) is still limited. STUDY DESIGN AND METHODS: The forensic usefulness of a set of 25 SNPs located across the X-chromosome was analyzed in 13 populations. The applicability of the 25 X-SNPs in kinship testing was illustrated in two immigration cases where the conclusions based....... The usefulness of X-chromosome markers was particularly illustrative in Case 1, where the typing of 25 X-SNPs would have been sufficient to exclude paternity. CONCLUSION: The high level of polymorphism, low degree of linkage disequilibrium, and very low probability of mutation of the 25 X-SNPs makes this set...

  9. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea

    Directory of Open Access Journals (Sweden)

    J. S. Choi

    2016-09-01

    Full Text Available This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R] and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003. The meats of PRKAG3 (A 0.024/G 0.976 AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699 AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627 AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792 AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs.

  10. A comparative analysis of chaotic particle swarm optimizations for detecting single nucleotide polymorphism barcodes.

    Science.gov (United States)

    Chuang, Li-Yeh; Moi, Sin-Hua; Lin, Yu-Da; Yang, Cheng-Hong

    2016-10-01

    Evolutionary algorithms could overcome the computational limitations for the statistical evaluation of large datasets for high-order single nucleotide polymorphism (SNP) barcodes. Previous studies have proposed several chaotic particle swarm optimization (CPSO) methods to detect SNP barcodes for disease analysis (e.g., for breast cancer and chronic diseases). This work evaluated additional chaotic maps combined with the particle swarm optimization (PSO) method to detect SNP barcodes using a high-dimensional dataset. Nine chaotic maps were used to improve PSO method results and compared the searching ability amongst all CPSO methods. The XOR and ZZ disease models were used to compare all chaotic maps combined with PSO method. Efficacy evaluations of CPSO methods were based on statistical values from the chi-square test (χ 2 ). The results showed that chaotic maps could improve the searching ability of PSO method when population are trapped in the local optimum. The minor allele frequency (MAF) indicated that, amongst all CPSO methods, the numbers of SNPs, sample size, and the highest χ 2 value in all datasets were found in the Sinai chaotic map combined with PSO method. We used the simple linear regression results of the gbest values in all generations to compare the all methods. Sinai chaotic map combined with PSO method provided the highest β values (β≥0.32 in XOR disease model and β≥0.04 in ZZ disease model) and the significant p-value (p-value<0.001 in both the XOR and ZZ disease models). The Sinai chaotic map was found to effectively enhance the fitness values (χ 2 ) of PSO method, indicating that the Sinai chaotic map combined with PSO method is more effective at detecting potential SNP barcodes in both the XOR and ZZ disease models. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi

    2010-01-01

    It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca......It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl...... among patients with type 2 diabetes and proteinuria. A meta-analysis revealed that rs2268388 was significantly associated with proteinuria in Japanese patients with type 2 diabetes (p = 5.35 x 10(-8), odds ratio = 1.61, 95% Cl: 1.35-1.91). Rs2268388 was also associated with type 2 diabetes...

  12. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu......Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers...... for the European eel using the RAD sequencing approach that was simultaneously identified and scored in a genome-wide scan of 30 individuals. Whereas genomic resources are increasingly becoming available for this species, including the recent release of a draft genome, no genome-wide set of SNP markers...

  13. Single nucleotide polymorphisms of cathepsin S and the risks of asthma attack induced by acaroid mites.

    Science.gov (United States)

    Li, Chaopin; Chen, Qi; Jiang, Yuxin; Liu, Zhiming

    2015-01-01

    To investigate association between the three single nucleotide polymorphisms (SNPs, rs146456111, rs143154304 and rs147260142) in cathepsin S (Cat S) and the risks of allergic asthma attack induced by the acaroid mites in the Chinese population. A case-control study was performed in 412 cases and 454 volunteers/controls to evaluate the effects of three SNPs in Cat S on the risks of asthma attack. The genotypes were determined using polymerase chain reaction (PCR) and cleaved amplification polymorphism sequence-tagged sites (PCR-RFLP). The frequencies of genotypes and alleles in these SNPs in the asthmatic group were also analyzed between the two groups. The locus of rs146456111 in Cat S gene, the allele frequency of A and C in asthmatic group were significantly different from the control group (χ(2) = 184.425, P = 0.000), and the difference was significant regarding the distribution of the genotypes (AA, AC, and CC) between asthmatic subjects and normal controls (χ(2) = 177.915, P = 0.000). Logistic regression analysis revealed that the AC, CC, and AC + CC genotypes were significantly increased with the risk of asthma (AC vs. AA, OR = 4.013, 95% CI = 2.989-4.751, P = 0.000; CC vs. AA, OR = 3.167, 95% CI = 2.483-3.785, P = 0.000; AC + CC vs. AA, OR = 3.418, 95% CI = 2.381-4.214, P = 0.000, respectively), compared with AA genotype. Moreover, by comparison with allele A, allele C (OR = 2.187, 95% CI = 1.743-2.281, P asthma; For the locus of rs143154304, compared with the allele frequency G with A in control group, there was no difference (χ(2) = 1.434, P = 0.231) in that of asthmatic group, as well as the distributions of the genotypes (AA, AG, and GG) between asthmatic subjects and normal controls (χ(2) = 1.997, P = 0.369); Logistic regression analysis showed that the AG, GG, and AG + GG genotypes were no risk to asthma (AG vs. AA, OR = 0.991, 95% CI = 0.625-1.507, P = 0.968; GG vs. AA, OR = 0.812, 95% CI = 0.525-1.258, P = 0.352; AG + GG vs. AA, OR = 0.914, 95

  14. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  15. LDheatmap: An R Function for Graphical Display of Pairwise Linkage Disequilibria Between Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    Ji-Hyung Shin

    2006-09-01

    Full Text Available We describe the R function LDheatmap( which produces a graphical display, as a heat map, of pairwise linkage disequilibrium measurements between single nucleotide polymorphisms within a genomic region. LDheatmap( uses the grid graphics system, an alternative to the traditional R graphics system. The features of the LDheatmap( function and the use of tools from the grid package to modify heat maps are illustrated by examples.

  16. Comparing single-nucleotide polymorphism marker-based and microsatellite marker-based linkage analyses.

    OpenAIRE

    Ulgen, Ayse; Li, Wentian

    2005-01-01

    Abstract We compared linkage analysis results for an alcoholism trait, ALDX1 (DSM-III-R and Feigner criteria) using a nonparametric linkage analysis method, which takes into account allele sharing among several affected persons, for both microsatellite and single-nucleotide polymorphism (SNP) markers (Affymetrix and Illumina) in the Collaborative Study on the Genetics of Alcoholism (COGA) dataset provided to participants at the Genetic Analysis Workshop 14 (GAW14). The two sets of linkage res...

  17. Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

    Science.gov (United States)

    Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

    2016-01-01

    Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

  18. The MGMT promoter single-nucleotide polymorphism rs1625649 had prognostic impact on patients with MGMT methylated glioblastoma.

    Directory of Open Access Journals (Sweden)

    Chih-Yi Hsu

    Full Text Available Promoter methylation is the most significant mechanism to regulate O6-methylguanine-DNA-methyltransferase (MGMT expression. Single-nucleotide polymorphisms (SNPs in the MGMT promoter region may also play a role. The aim of this study was to evaluate the clinical significance of SNPs in the MGMT promoter region of glioblastoma. Genomic DNAs from 118 glioblastomas were collected for polymerase chain reaction (PCR amplification. Sanger sequencing was used to sequence the MGMT promoter region to detect SNPs. The results were correlated with MGMT status and patient survival. Rs1625649 was the only polymorphic SNP located at the MGMT promoter region in 37.5% of glioblastomas. Homozygous rs1625649 (AA genotype was correlated with a higher MGMT methylation level and a lower protein expression, but the result was not statistically significant. In patients with MGMT methylated glioblastoma, cases with homozygous rs1625649 (AA genotype were significantly associated with a lack of MGMT protein expression and a better progression-free survival (PFS than the cases with wild type rs1625649 (CC genotype or heterozygous rs1625649 (CA genotype. The survival impact was significant in multivariate analyses. In conclusion, the MGMT promoter homozygous rs1625649 (AA genotype was found to correlate with a better PFS in patients with MGMT methylated glioblastoma.

  19. Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation

    Science.gov (United States)

    Thomas, Laurent F.; Sætrom, Pål

    2012-01-01

    Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

  20. Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population.

    Science.gov (United States)

    Allabi, Aurel C; Horsmans, Yves; Issaoui, Bouchra; Gala, Jean-Luc

    2005-04-01

    The ABCB1 (MDR1) multidrug transporter plays a key role in determining drug bioavailability. Differences in drug response exist among different ethnic groups. However, until now, no haplotype data are available in a Black African population. Exons 2, 7, 10, 11, 12, 14, 17, 21, 26, and the surrounding intronic regions were sequenced using genomic DNA from 111 Beninese subjects to examine 19 intragenic single nucleotide polymorphisms (SNPs). Linkage disequilibrium analysis and haplotypes were generated using the expectation-maximization algorithm. We identified 12 SNPs, 3 of which were novel: IVS9-57delA, IVS9-8T>A, 1662G>C (exon 14). The most common SNP was IVS14+38A>G. At the MRD1 locus, 53 haplotypes were inferred from the SNP data sets. The 4 SNPs, IVS6+139C>T, IVS9-44A>G, 1236C>T, and 3435C>T, showed strong linkage disequilibrium with each other, confirming the block concept. Moreover, our findings suggest that ABCB1 exonic SNPs are less frequently observed in our population than in African-Americans. Our data are compatible with a close evolutionary relationship in Black Africans from Benin.

  1. Single-nucleotide polymorphisms in the promoter region of the PARKIN gene and Parkinson's disease.

    Science.gov (United States)

    Mata, Ignacio F; Alvarez, Victoria; García-Moreira, Vanessa; Guisasola, Luis M; Ribacoba, René; Salvador, Carlos; Blázquez, Marta; Sarmiento, Rogelio González; Lahoz, Carlos H; Menes, Bernardino B; García, Eliecer Coto

    2002-08-30

    Mutations in the PARKIN gene have been identified in families with recessively inherited Parkinson disease (PD). Common DNA-polymorphisms at the PARKIN gene could contribute to the risk for PD in the general population. Here we searched for DNA-polymorphisms in the PARKIN promoter. We found two single nucleotide polymorphisms (-324 A/G and -797 A/G). In order to analyse the association of PD with these and two previously described polymorphisms (1281 G/A, Asp394Asn, and 601 G/A, Ser167Asn) we genotyped 105 patients and 150 healthy controls. Allele and genotype frequencies for the four polymorphisms did not differ between patients and controls, or between patients with an early-onset (40 years; n = 85). According to our data, the genetic variation at the PARKIN gene (including promoter polymorphisms) did not contribute to the risk of developing PD in the general population. Copyright 2002 Elsevier Science Ireland Ltd.

  2. Association of body mass index-related single nucleotide polymorphisms with psychiatric disease and memory performance in a Japanese population.

    Science.gov (United States)

    Ninomiya-Baba, Midori; Matsuo, Junko; Sasayama, Daimei; Hori, Hiroaki; Teraishi, Toshiya; Ota, Miho; Hattori, Kotaro; Noda, Takamasa; Ishida, Ikki; Shibata, Shigenobu; Kunugi, Hiroshi

    2017-10-01

    Obesity is a risk factor for psychiatric diseases. Recently, a number of single nucleotide polymorphisms (SNPs) have been shown to be related to body mass index (BMI). In this study, we investigated the association of BMI-related SNPs with psychiatric diseases and one of their endophenotypes, memory performance, in a Japanese population. The subjects were 1624 patients with one of three psychiatric diseases (799 patients with major depressive disorder, 594 with schizophrenia, and 231 with bipolar disorder) and 1189 healthy controls. Memory performance was assessed using the Wechsler Memory Scale - Revised (WMS-R). Genomic DNA was prepared from venous blood and used to genotype 23 BMI-related SNPs using the TaqMan 5'-exonuclease allelic discrimination assay. We then analysed the relationships between the SNPs and psychiatric disease and various subscales of the WMS-R. Three SNPs (rs11142387, rs12597579, and rs6548238) showed significant differences in the genotype or allele frequency between patients with any psychiatric diseases and controls. Furthermore, six SNPs (rs11142387, rs12597579, rs2815752, rs2074356, rs4776970, and rs2287019) showed significant differences in at least one subscale of the WMS-R depending on the genotypes of the healthy controls. Interestingly, rs11142387 near the Kruppel-like factor 9 (KLF9) was significantly associated with psychiatric disease and poor memory function. We identified three and six BMI-related SNPs associated with psychiatric disease and memory performance, respectively. In particular, carrying the A allele of rs11142387 near KLF9 was found to be associated with psychiatric disease and poor memory performance, which warrants further investigations.

  3. Association between single nucleotide polymorphisms of the interleukin-4 gene and atopic dermatitis.

    Science.gov (United States)

    Gharagozlou, Mohammad; Behniafard, Nasrin; Amirzargar, Ali Akbar; Hosseinverdi, Sima; Sotoudeh, Soheila; Farhadi, Elham; Khaledi, Mojdeh; Aryan, Zahra; Moghaddam, Zahra Gholizadeh; Mahmoudi, Maryam; Aghamohammadi, Asghar; Rezaei, Nima

    2015-01-01

    Atopic dermatitis (AD) is an inflammatory skin disease in which both genetic and environmental factors seem to be involved. Several studies investigated the association of certain genetic factors with AD in different ethnic groups, but conflicting data were obtained. This study was performed to check the possible association between single nucleotide polymorphisms (SNPs) of interleukin 4 (IL-4) and the IL-4 receptor α chain (IL-4Rα) and AD in a group of Iranian patients. The allele and genotype frequencies of genes encoding for IL-4 and IL-4Rα were investigated in 89 patients with AD in comparison with 139 healthy controls, using methods based on polymerase chain reaction sequence-specific primers. The most frequent alleles of IL-4 in patients were T at -1098 (P<0.001, odds ratio (OR)=2.35), C at -590 (P<0.001, OR=4.84) and C at -33 (P=0.002, OR=2.08). The most frequent genotypes of IL-4 in patients were TT, CC, and CC at positions -1098 (P<0.001, OR=3.59), -590 (P<0.001, OR=31.25) and -33 (P<0.001, OR=3.46), respectively. We found a significant lower frequency of GT at -1098 GT, TC at -590, and TC at -33 in patients. There were no statistically significant differences in the frequency of alleles and genotypes of IL-4Rα gene at position +1902. A strong positive association was seen between TCC haplotype and AD (68% in patients vs. 23.4% in controls, P<0.001, OR=8.91). We detected a significantly lower frequency of TTC, GCC, and TTT haplotypes (P<0.001, OR=0.02, P<0.001, OR=0.40, P<0.001, OR=0.39, respectively) in patients compared to controls. A significant association between the polymorphisms of the IL-4 gene promoter at positions -1098, -590, and -33 and AD was detected in the Iranian population.

  4. Non-invasive prenatal detection of trisomy 13 using a single nucleotide polymorphism- and informatics-based approach.

    Directory of Open Access Journals (Sweden)

    Megan P Hall

    Full Text Available PURPOSE: To determine how a single nucleotide polymorphism (SNP- and informatics-based non-invasive prenatal aneuploidy test performs in detecting trisomy 13. METHODS: Seventeen trisomy 13 and 51 age-matched euploid samples, randomly selected from a larger cohort, were analyzed. Cell-free DNA was isolated from maternal plasma, amplified in a single multiplex polymerase chain reaction assay that interrogated 19,488 SNPs covering chromosomes 13, 18, 21, X, and Y, and sequenced. Analysis and copy number identification involved a Bayesian-based maximum likelihood statistical method that generated chromosome- and sample-specific calculated accuracies. RESULTS: Of the samples that passed a stringent DNA quality threshold (94.1%, the algorithm correctly identified 15/15 trisomy 13 and 49/49 euploid samples, for 320/320 correct copy number calls. CONCLUSIONS: This informatics- and SNP-based method accurately detects trisomy 13-affected fetuses non-invasively and with high calculated accuracy.

  5. Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...

    African Journals Online (AJOL)

    In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these SNPs with mastitis in cattle. Through DNA sequencing and PCR-RFLP ...

  6. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  7. DEFLATE Compression Algorithm Corrects for Overestimation of Phylogenetic Diversity by Grantham Approach to Single-Nucleotide Polymorphism Classification

    Directory of Open Access Journals (Sweden)

    Arran Schlosberg

    2014-05-01

    Full Text Available Improvements in speed and cost of genome sequencing are resulting in increasing numbers of novel non-synonymous single nucleotide polymorphisms (nsSNPs in genes known to be associated with disease. The large number of nsSNPs makes laboratory-based classification infeasible and familial co-segregation with disease is not always possible. In-silico methods for classification or triage are thus utilised. A popular tool based on multiple-species sequence alignments (MSAs and work by Grantham, Align-GVGD, has been shown to underestimate deleterious effects, particularly as sequence numbers increase. We utilised the DEFLATE compression algorithm to account for expected variation across a number of species. With the adjusted Grantham measure we derived a means of quantitatively clustering known neutral and deleterious nsSNPs from the same gene; this was then used to assign novel variants to the most appropriate cluster as a means of binary classification. Scaling of clusters allows for inter-gene comparison of variants through a single pathogenicity score. The approach improves upon the classification accuracy of Align-GVGD while correcting for sensitivity to large MSAs. Open-source code and a web server are made available at https://github.com/aschlosberg/CompressGV.

  8. A panel of 130 autosomal single-nucleotide polymorphisms for ancestry assignment in five Asian populations and in Caucasians.

    Science.gov (United States)

    Hwa, Hsiao-Lin; Lin, Chih-Peng; Huang, Tsun-Ying; Kuo, Po-Hsiu; Hsieh, Wei-Hsin; Lin, Chun-Yen; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

    2017-06-01

    Ancestry informative single-nucleotide polymorphism (AISNP) panels for differentiating between East and Southeast Asian populations are scarce. This study aimed to identify AISNPs for ancestry assignment of five East and Southeast Asian populations, and Caucasians. We analyzed 145 autosomal SNPs of the 627 DNA samples from individuals of six populations (234 Taiwanese Han, 91 Filipinos, 79 Indonesians, 60 Thais, 71 Vietnamese, and 92 Caucasians) using arrays. The multiple logistic regression model and a multi-tier approach were used for ancestry classification. We observed that 130 AISNPs were effective for classifying the ethnic origins with fair accuracy. Among the 130 AISNPs, 122 were useful for stratification between these five Asian populations and 64 were effective for differentiating between Caucasians and these Asian populations. For differentiation between Caucasians and Asians, an accuracy rate of 100% was achieved in these 627 subjects with 50 optimal AISNPs among the 64 effective SNPs. For classification of the five Asian populations, the accuracy rates of ancestry inference using 20 to 57 SNPs for each of the two Asian populations ranged from 74.1% to 100%. Another 14 degraded DNA samples with incomplete profiling were analyzed, and the ancestry of 12 (85.7%) of those subjects was accurately assigned. We developed a 130-AISNP panel for ethnic origin differentiation between the five East and Southeast Asian populations and Caucasians. This AISNP set may be helpful for individual ancestral assignment of these populations in forensic casework.

  9. Comparison of single nucleotide polymorphisms and microsatellites in non-invasive genetic monitoring of a wolf population

    Directory of Open Access Journals (Sweden)

    Fabbri Elena

    2012-01-01

    Full Text Available Single nucleotide polymorphisms (SNPs which represent the most widespread source of sequence variation in genomes, are becoming a routine application in several fields such as forensics, ecology and conservation genetics. Their use, requiring short amplifications, may allow a more efficient genotyping of degraded DNA. We provide the first application of SNP genotyping in an Italian non-invasive genetic monitoring project of the wolf. We compared three different techniques for genotyping SNPs: pyrosequencing, SNaPshot® and TaqMan® Probe Assay in Real-Time PCR. We successively genotyped nine SNPs using the TaqMan Probe Assay in 51 Italian wolves, 57 domestic dogs, 15 wolf x dog hybrids and 313 wolf scats collected in the northern Apennines. The obtained results were used to estimate genetic variability and PCR error rates in SNP genotyping protocols compared to standard microsatellite analysis. We evaluated the cost, laboratory effort and reliability of these different markers and discuss the possible future use of VeraCode, SNPlex and Fluidigm EP1 system in wild population monitoring.

  10. CYP3A5*3 and *6 single nucleotide polymorphisms in three distinct Asian populations.

    Science.gov (United States)

    Balram, C; Zhou, Qingyu; Cheung, Yin Bun; Lee, Edmund J D

    2003-06-01

    To determine the frequencies of two functional single nucleotide polymorphisms, CYP3A5*3 and CYP3A5*6, in the CYP3A5 gene in three distinct Asian ethnic groups, namely, the Chinese, Malays and Indians. Single nucleotide polymorphism analyses of CYP3A5*1, *3 and *6 were performed in 296 healthy subjects (108 Chinese, 98 Malays and 90 Indians) using the polymerase chain reaction-restriction fragment length polymorphism method. The *1 allele frequency was 25% in Chinese compared with 40% in Malays and Indians ( P=0.001). The *3 allele frequency was also higher in the Chinese population, being 76% versus 60% in the Malays and Indians ( P=0.001). The Malays and Indians also had allele frequencies significantly different from Caucasian, Japanese and African-American populations (each Pliterature. The *6 allele was not detected in any the three Asian ethnic groups analysed. These results seem to suggest that genetic polymorphisms in CYP3A5 in Asians, in particular Malays and Indians but also Chinese although to a lesser extent, may be an important genetic contributor to interindividual as well as interethnic differences in clearance of CYP3A substrates.

  11. Candidate genes and single nucleotide polymorphisms associated with variation in residual feed intake in beef cattle.

    Science.gov (United States)

    Karisa, B K; Thomson, J; Wang, Z; Stothard, P; Moore, S S; Plastow, G S

    2013-08-01

    The candidate gene approach was used to identify genes associated with residual feed intake (RFI) in beef steers. The approach uses prior knowledge of gene functions to predict their biological role in the variation observed in a trait. It is suited to identify genes associated with complex traits where each gene has a relatively small effect. First, positional candidate genes were identified within the genomic positions of previously reported QTL associated with component traits related to RFI such as dry matter intake (DMI), growth, feed conversion ratio (FCR), average daily gain (ADG), and energy balance. Secondly, the positional candidate genes were prioritized into functional candidate genes according to their biological functions and their relationship with the biological processes associated with RFI including carbohydrate, fat and protein metabolism, thermoregulation, immunity and muscle activity. Single nucleotide polymorphisms (SNPs) located within the functional candidate genes were identified using mRNA sequences and prioritized into functional classes such as non-synonymous (nsSNP), synonymous (sSNP) or intronic SNP. A total of 117 nsSNP were considered as functional SNP and genotyped in steers at the University of Alberta ranch in Kinsella. Multiple marker association analysis in ASReml was performed using RFI data obtained from 531 beef steers. Twenty-five SNP were significantly associated with RFI (P < 0.05) accounting for 19.7% of the phenotypic variation. Using SIFT program to predict the effect of the SNP on the function of the corresponding protein, 3 of the 25 SNP were predicted to cause a significant effect on protein function (P < 0.05). One of the 3 SNP was located in the GHR gene and was also associated with a significant effect on the tertiary structure of the GHR protein (P < 0.05) as modeled using SWISSModel software. Least square means for each genotype were estimated and an over-dominance effect was observed for the SNP located in the

  12. The effect of single nucleotide polymorphisms from genome wide association studies in multiple sclerosis on gene expression.

    Directory of Open Access Journals (Sweden)

    Adam E Handel

    2010-04-01

    Full Text Available Multiple sclerosis (MS is a complex neurological disorder. Its aetiology involves both environmental and genetic factors. Recent genome-wide association studies have identified a number of single nucleotide polymorphisms (SNPs associated with susceptibility to (MS. We investigated whether these genetic variations were associated with alteration in gene expression.We used a database of mRNA expression and genetic variation derived from immortalised peripheral lymphocytes to investigate polymorphisms associated with MS for correlation with gene expression. Several SNPs were found to be associated with changes in expression: in particular two with HLA-DQA1, HLA-DQA2, HLA-DQB1, HLA-DRB1, HLA-DRB4 and HLA-DRB5, one with ZFP57, one with CD58, two with IL7 and FAM164A, and one with FAM119B, TSFM and KUB3. We found minimal cross-over with a recent whole genome expression study in MS patients.We have shown that many susceptibility loci in MS are associated with changes in gene expression using an unbiased expression database. Several of these findings suggest novel gene candidates underlying the effects of MS-associated genetic variation.

  13. Single nucleotide polymorphism analysis of ubiquitin extension protein genes (ubq) of gossypium arboreum and gossypium herbaceum in comparison with arabidopsis thaliana

    International Nuclear Information System (INIS)

    Shaheen, T.; Zafar, Y.; Rahman, M.

    2014-01-01

    Single nucleotide polymorphism analysis is an expedient way to study polymorphisms at genomic level. In the present study we have explored Ubiquitin extension protein gene of G. arboreum (A2) and G. herbaceum (A1) of cotton which is a multiple copy gene. We have found SNPs at 16 positions in 200 bp region within A genome of cotton indicating frequency of SNPs 1/13 bp. Both sequences from cotton have shown maximum similarity with UBQ5 and UBQ6 of Arabidopsis thaliana. Sequence obtained from G. arboreum has shown SNPs at 28 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana while sequence obtained from G. herbaceum has shown SNPs at 31 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana. In conclusion although during pace of evolution ubiquitin extension protein genes of both A genome species have got some mutations from nature but still most of their sequence is similar. Single nucleotide polymorphism study can prove a vital tool to identify gene type in case of Multicopy genes. (author)

  14. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Directory of Open Access Journals (Sweden)

    Diego Hepp

    Full Text Available The melanocortin 1 receptor (MC1R is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H; C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  15. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Science.gov (United States)

    Hepp, Diego; Gonçalves, Gislene Lopes; de Freitas, Thales Renato Ochotorena

    2015-01-01

    The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  16. Prediction of the Damage-Associated Non-Synonymous Single Nucleotide Polymorphisms in the Human MC1R Gene

    Science.gov (United States)

    2015-01-01

    The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes. PMID:25794181

  17. Plasminogen Activator Inhibitor Type-1 Tag Single-Nucleotide Polymorphisms in Patients with Diabetes Mellitus Type 2 and Diabetic Retinopathy.

    Science.gov (United States)

    Siokas, Vasileios; Dardiotis, Efthimios; Sokolakis, Thomas; Kotoula, Maria; Tachmitzi, Sophia V; Chatzoulis, Dimitrios Z; Almpanidou, Pavlina; Stefanidis, Ioannis; Hadjigeorgiou, Georgios M; Tsironi, Evangelia E

    2017-07-01

    There is accumulating evidence for genetic susceptibility to the development of diabetic retinopathy (DR). The role of plasminogen activator inhibitor-1 (PAI-1) in DR risk remains controversial. The present study was designed to investigate possible influence of PAI-1 gene region polymorphisms on the risk of DR and on the risk of developing DR early vs late in the course of type 2 diabetes mellitus (T2DM). A total of 138 patients with DR, 107 patients with T2DM without DR, and 315 healthy controls were recruited. To cover the majority of the genetic variability across the extended region of PAI-1 gene, five tag single-nucleotide polymorphisms (SNPs) from the HapMap using a pairwise approach and an r 2 ≥ 0.8 and a minor allele frequency (MAF) of >0.05 were identified. Using logistic regression analyses, tag SNPs and haplotypes were tested for associations with DR risk and risk of DR development early or late in the course of T2DM. The generalized odds ratio (OR G ) was calculated to estimate the mutational load effect on DR development among all participants. Corrections for multiple comparisons were carried out (p-value < 0.01). A significant effect of rs2070682 on the risk of early DR onset was found in the codominant model of inheritance [odds ratio, OR (95% confidence interval, CI): 5.04 (1.47-17.28), p = 0.018]. However, this association marginally did not survive multiple testing corrections. No other significant association between PAI-1 tag-SNPs and haplotypes was revealed. Furthermore, no significant mutational load effect of PAI-1 tag SNPs on the risk of DR development in T2DM course was found. In conclusion, the present study does not provide any strong evidence that PAI-1 gene variants are implicated in the risk of DR or the development of DR during T2DM course.

  18. Lack of association between common single nucleotide polymorphisms in the TERT-CLPTM1L locus and breast cancer in women of African ancestry.

    Science.gov (United States)

    Zheng, Yonglan; Ogundiran, Temidayo O; Adebamowo, Clement; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Simon, Michael S; John, Esther M; Hennis, Anselm; Nemesure, Barbara; Wu, Suh-Yuh; Leske, Maria Cristina; Ambs, Stefan; Niu, Qun; Zhang, Jing; Cox, Nancy J; Olopade, Olufunmilayo I; Huo, Dezheng

    2012-02-01

    As one of the most common cancers worldwide, breast cancer places an extraordinary burden on the populations of African ancestry. Common SNPs in the TERT-CLPTM1L locus have been reported to be associated with several types of cancer, including breast cancer. We sought to investigate whether the previously reported common single nucleotide polymorphisms (SNPs) in the TERT-CLPTM1L locus could also contribute to the breast cancer risk in women of African ancestry. We genotyped eleven SNPs in 2,892 women of African descent but were unable to detect any significant association between TERT-CLPTM1L SNPs and their predispositions for breast cancer risk. Given the differences in linkage disequilibrium patterns across populations, our findings suggest that larger independent studies from diverse populations are expected to evaluate the importance of the TERT-CLPTM1L locus in breast cancer.

  19. Single nucleotide polymorphisms associated with P2X7R function regulate the onset of gouty arthritis.

    Science.gov (United States)

    Tao, Jin-Hui; Cheng, Miao; Tang, Jiang-Ping; Dai, Xiao-Juan; Zhang, Yong; Li, Xiang-Pei; Liu, Qin; Wang, Ya-Ling

    2017-01-01

    Gout is an inflammatory disease that is caused by the increased production of Interleukin-1β (IL-1β) stimulated by monosodium urate (MSU) crystals. However, some hyperuricemia patients, even gouty patients with tophi in the joints, never experience gout attack, which indicates that pathogenic pathways other than MSU participate in the secretion of IL-1β in the pathogenesis of acute gouty arthritis. The ATP-P2X7R-IL-1β axis may be one of these pathways. This study examines the role of Adenosine triphosphate (ATP) in the pathogenesis of gout and the association of ATP receptor (P2X7R) function with single nucleotide polymorphisms and gout arthritis. Non-synonymous single nucleotide polymorphisms (SNP) loci of P2X7R in Chinese people were screened to compare the frequencies of different alleles and genotype distribution of selective SNPs in 117 gouty patients and 95 hyperuricemia patients. Peripheral white blood cells were purified from the peripheral blood of 43 randomly selected gout patients and 36 hyperuricemia patients from the total group. Cells were cultured with MSU or MSU + ATP, and supernatants were collected for the detection of IL-1β concentrations using enzyme-linked immunosorbent assay (ELISA). 1. Eight SNP loci, including rs1653624, rs10160951, rs1718119, rs7958316, rs16950860, rs208294, rs17525809 and rs2230912, were screened and detected, and rs1653624, rs7958316 and rs17525809 were associated with gout arthritis. 2. IL-1β concentrations in supernatants after MSU + ATP stimulation were significantly higher in gouty patients than in the hyperuricemia group [(131.08 ± 176.11) pg/ml vs. (50.84 ± 86.10) pg/ml]; Patients (including gout and hyperuricemia) carrying the susceptibility genotype AA or AT of rs1653624 exhibited significantly higher concentrations of IL-1β than patients carrying the non-susceptibility genotype TT [(104.20 ± 164.25) pg/ml vs. (21.90 ± 12.14) pg/ml]; However, no differences were found with MSU stimulation alone. ATP

  20. Single nucleotide polymorphisms associated with P2X7R function regulate the onset of gouty arthritis.

    Directory of Open Access Journals (Sweden)

    Jin-Hui Tao

    Full Text Available Gout is an inflammatory disease that is caused by the increased production of Interleukin-1β (IL-1β stimulated by monosodium urate (MSU crystals. However, some hyperuricemia patients, even gouty patients with tophi in the joints, never experience gout attack, which indicates that pathogenic pathways other than MSU participate in the secretion of IL-1β in the pathogenesis of acute gouty arthritis. The ATP-P2X7R-IL-1β axis may be one of these pathways.This study examines the role of Adenosine triphosphate (ATP in the pathogenesis of gout and the association of ATP receptor (P2X7R function with single nucleotide polymorphisms and gout arthritis.Non-synonymous single nucleotide polymorphisms (SNP loci of P2X7R in Chinese people were screened to compare the frequencies of different alleles and genotype distribution of selective SNPs in 117 gouty patients and 95 hyperuricemia patients. Peripheral white blood cells were purified from the peripheral blood of 43 randomly selected gout patients and 36 hyperuricemia patients from the total group. Cells were cultured with MSU or MSU + ATP, and supernatants were collected for the detection of IL-1β concentrations using enzyme-linked immunosorbent assay (ELISA.1. Eight SNP loci, including rs1653624, rs10160951, rs1718119, rs7958316, rs16950860, rs208294, rs17525809 and rs2230912, were screened and detected, and rs1653624, rs7958316 and rs17525809 were associated with gout arthritis. 2. IL-1β concentrations in supernatants after MSU + ATP stimulation were significantly higher in gouty patients than in the hyperuricemia group [(131.08 ± 176.11 pg/ml vs. (50.84 ± 86.10 pg/ml]; Patients (including gout and hyperuricemia carrying the susceptibility genotype AA or AT of rs1653624 exhibited significantly higher concentrations of IL-1β than patients carrying the non-susceptibility genotype TT [(104.20 ± 164.25 pg/ml vs. (21.90 ± 12.14 pg/ml]; However, no differences were found with MSU stimulation alone

  1. Interleukin-4 cytokine single nucleotide polymorphisms in kawasaki disease: a case-control study and a review of knowledge.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rezaei, Arezou; Rahmani, Farzaneh; Sadr, Zeinab; Raeeskarami, Seyed Reza; Moradinejad, Mohammad Hassan; Rezaei, Nima

    2018-01-01

    Kawasaki disease (KD) is a systemic vasculitis of medium-sized arteries. High levels of interleukin 4 (IL-4) and the dominance of Th2 cytokines seem to be a key feature in the acute phase of KD. In this study, the role of IL-4 and IL-4R gene polymorphisms were investigated in Iranian children with KD. Fifty-five patients with KD and 140 healthy subjects as a control group were enrolled in this study. Single nucleotide polymorphisms (SNPs) of IL-4 gene at positions -1098 (rs2243248), -590 (rs2243250) and -33 (rs2070874), as well as IL-4RA gene at position +1902 (rs180275) were assessed in patients and the control group. The C allele and CC genotype of IL-4 gene at position -590 and at position -33 had positive associations and the CT genotype at -590 was negatively associated with KD (odds ratio (95% CI) = 0.04 [0.01-0.09]). The haplotype TCC was more frequent among the patients, while the haplotypes TTT and TTC had a negative association with KD. IL-4 polymorphisms might be associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  2. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    2016-06-01

    Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.

  3. Single Nucleotide Polymorphism Detection Using Au-Decorated Single-Walled Carbon Nanotube Field Effect Transistors

    Directory of Open Access Journals (Sweden)

    Keum-Ju Lee

    2011-01-01

    Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.

  4. VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    HyoYoung Kim

    2014-12-01

    Full Text Available Copy number variation (CNV or single nucleotide phlyorphism (SNP is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i the enrichment of genome contents in CNV; ii the physical distribution of CNV or SNP on chromosomes; iii the distribution of log2 ratio of CNVs with criteria of interested; iv the number of CNV or SNP per binning unit; v the distribution of homozygosity of SNP genotype; and vi cytomap of genes within CNV or SNP region.

  5. Comparative analysis of disease-linked single nucleotide polymorphic markers from Brassica rapa for their applicability to Brassica oleracea.

    Science.gov (United States)

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

    2015-01-01

    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH--developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP--based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS--derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species.

  6. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

    Directory of Open Access Journals (Sweden)

    Jaewoo Song

    Full Text Available VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC study for the association of single nucleotide polymorphisms (SNPs in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  7. Single nucleotide polymorphisms in the PRDX3 and RPS19 and risk of HPV persistence and cervical precancer/cancer.

    Directory of Open Access Journals (Sweden)

    Mahboobeh Safaeian

    Full Text Available Host genetic factors might affect the risk of progression from infection with carcinogenic human papillomavirus (HPV, the etiologic agent for cervical cancer, to persistent HPV infection, and hence to cervical precancer and cancer.We assessed 18,310 tag single nucleotide polymorphisms (SNPs from 1113 genes in 416 cervical intraepithelial neoplasia 3 (CIN3/cancer cases, 356 women with persistent carcinogenic HPV infection (median persistence of 25 months and 425 randomly selected women (non-cases and non-HPV persistent from the 10,049 women from the Guanacaste, Costa Rica HPV natural history cohort. For gene and SNP associations, we computed age-adjusted odds ratio and p-trend. Three comparisons were made: 1 association with CIN3/cancer (compared CIN3/cancer cases to random controls, 2 association with persistence (compared HPV persistence to random controls, and 3 progression (compared CIN3/cancers with HPV-persistent group. Regions statistically significantly associated with CIN3/cancer included genes for peroxiredoxin 3 PRDX3, and ribosomal protein S19 RPS19. The single most significant SNPs from each gene associated with CIN3/cancer were PRDX3 rs7082598 (P(trend<0.0001, and RPS19 rs2305809 (P(trend=0.0007, respectively. Both SNPs were also associated with progression.These data suggest involvement of two genes, RSP19 and PRDX3, or other SNPs in linkage disequilibrium, with cervical cancer risk. Further investigation showed that they may be involved in both the persistence and progression transition stages. Our results require replication but, if true, suggest a role for ribosomal dysfunction, mitochondrial processes, and/or oxidative stress, or other unknown function of these genes in cervical carcinogenesis.

  8. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

    Science.gov (United States)

    Song, Jaewoo; Xue, Cheng; Preisser, John S; Cramer, Drake W; Houck, Katie L; Liu, Guo; Folsom, Aaron R; Couper, David; Yu, Fuli; Dong, Jing-Fei

    2016-01-01

    VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC) study for the association of single nucleotide polymorphisms (SNPs) in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G) project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  9. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    Science.gov (United States)

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

    2015-01-01

    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  10. Molecular evolutionary analysis of ABCB5: the ancestral gene is a full transporter with potentially deleterious single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Karobi Moitra

    2011-01-01

    Full Text Available ABCB5 is a member of the ABC protein superfamily, which includes the transporters ABCB1, ABCC1 and ABCG2 responsible for causing drug resistance in cancer patients and also several other transporters that have been linked to human disease. The ABCB5 full transporter (ABCB5.ts is expressed in human testis and its functional significance is presently unknown. Another variant of this transporter, ABCB5 beta possess a "half-transporter-like" structure and is expressed in melanoma stem cells, normal melanocytes, and other types of pigment cells. ABCB5 beta has important clinical implications, as it may be involved with multidrug resistance in melanoma stem cells, allowing these stem cells to survive chemotherapeutic regimes.We constructed and examined in detail topological structures of the human ABCB5 protein and determined in-silico the cSNPs (coding single nucleotide polymorphisms that may affect its function. Evolutionary analysis of ABCB5 indicated that ABCB5, ABCB1, ABCB4, and ABCB11 share a common ancestor, which began duplicating early in the evolutionary history of chordates. This suggests that ABCB5 has evolved as a full transporter throughout its evolutionary history.From our in-silco analysis of cSNPs we found that a large number of non-synonymous cSNPs map to important functional regions of the protein suggesting that these SNPs if present in human populations may play a role in diseases associated with ABCB5. From phylogenetic analyses, we have shown that ABCB5 evolved as a full transporter throughout its evolutionary history with an absence of any major shifts in selection between the various lineages suggesting that the function of ABCB5 has been maintained during mammalian evolution. This finding would suggest that ABCB5 beta may have evolved to play a specific role in human pigment cells and/or melanoma cells where it is predominantly expressed.

  11. Comparative analysis of disease-linked single nucleotide polymorphic markers from Brassica rapa for their applicability to Brassica oleracea.

    Directory of Open Access Journals (Sweden)

    Young-Il Cho

    Full Text Available Numerous studies using single nucleotide polymorphisms (SNPs have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes, biological process (96 genes, and cellular component (96 genes. A total of 693 SNP markers, including 145 SNP markers [BRH--developed from the B. rapa genome for high-resolution melt (HRM analysis], 425 SNP markers (BRP--based on the B. rapa genome that could be applied to B. oleracea, and 123 new SNP markers (BRS--derived from BRP and designed for HRM analysis, were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome, selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%, 415 of 425 BRP (97.6%, and 118 of 123 BRS (95.9% showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species.

  12. Using 2k + 2 bubble searches to find single nucleotide polymorphisms in k-mer graphs.

    Science.gov (United States)

    Younsi, Reda; MacLean, Dan

    2015-03-01

    Single nucleotide polymorphism (SNP) discovery is an important preliminary for understanding genetic variation. With current sequencing methods, we can sample genomes comprehensively. SNPs are found by aligning sequence reads against longer assembled references. De Bruijn graphs are efficient data structures that can deal with the vast amount of data from modern technologies. Recent work has shown that the topology of these graphs captures enough information to allow the detection and characterization of genetic variants, offering an alternative to alignment-based methods. Such methods rely on depth-first walks of the graph to identify closing bifurcations. These methods are conservative or generate many false-positive results, particularly when traversing highly inter-connected (complex) regions of the graph or in regions of very high coverage. We devised an algorithm that calls SNPs in converted De Bruijn graphs by enumerating 2k + 2 cycles. We evaluated the accuracy of predicted SNPs by comparison with SNP lists from alignment-based methods. We tested accuracy of the SNP calling using sequence data from 16 ecotypes of Arabidopsis thaliana and found that accuracy was high. We found that SNP calling was even across the genome and genomic feature types. Using sequence-based attributes of the graph to train a decision tree allowed us to increase accuracy of SNP calls further. Together these results indicate that our algorithm is capable of finding SNPs accurately in complex sub-graphs and potentially comprehensively from whole genome graphs. The source code for a C++ implementation of our algorithm is available under the GNU Public Licence v3 at: https://github.com/danmaclean/2kplus2. The datasets used in this study are available at the European Nucleotide Archive, reference ERP00565, http://www.ebi.ac.uk/ena/data/view/ERP000565. © The Author 2014. Published by Oxford University Press.

  13. Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.

    Science.gov (United States)

    Tashjian, Robert Z; Granger, Erin K; Farnham, James M; Cannon-Albright, Lisa A; Teerlink, Craig C

    2016-02-01

    The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Limited data exist identifying specific genes associated with rotator cuff tearing. The purpose of this study was to identify specific genes or genetic variants associated with rotator cuff tearing by a genome-wide association study with an independent set of rotator cuff tear cases. A set of 311 full-thickness rotator cuff tear cases genotyped on the Illumina 5M single-nucleotide polymorphism (SNP) platform were used in a genome-wide association study with 2641 genetically matched white population controls available from the Illumina iControls database. Tests of association were performed with GEMMA software at 257,558 SNPs that compose the intersection of Illumina SNP platforms and that passed general quality control metrics. SNPs were considered significant if P development of rotator cuff tearing. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  14. Correlation between single nucleotide polymorphism in 11q24.1 chromosome and high myopia hereditary susceptibility

    Directory of Open Access Journals (Sweden)

    Xin-Hua Wang

    2013-12-01

    Full Text Available AIM: To study the correlation between genetic susceptibility to high myopia and single nucleotide polymorphisms(SNPsin 11q24. 1 chromosome among Chinese college students. METHOD: A total of 254 blood samples were obtained from Chinese college students who were often engaged in near work. The students were divided into high myopia group(42 cases, low to moderate myopia group(61 casesand non-myopic group(151 cases. Genotyping technology was utilized to analyze the frequency of mutation of the SNPs alleles of four mononucleotides in the 11q24.1 chromosome, including rs577948, rs11218544, rs10892819 and rs11218553. And the Chi-square test was performed to test the difference of such mutation with myopia. RESULTS:The frequency of the SNP alleles mutation of the mononucleotide rs577948 site in the high myopia group was significantly different from that in the low-to-moderate myopia group and the non-myopic group(P=2.28×10-7. CONCLUSION: There is no significant correlation between genetic susceptibility and the four variations of SNPs between mild myopic population and normal population and there is no significant difference between the two populations, either. However, A - G mutation of Rs577948 site in 11q24.1 chromosome in university students with high myopia group is closely associated with high myopia hereditary susceptibility.

  15. A single nucleotide polymorphism in the dimethylarginine dimethylaminohydrolase gene is associated with lower risk of pulmonary hypertension in bronchopulmonary dysplasia

    Science.gov (United States)

    Trittmann, JK; Gastier-Foster, JM; Zmuda, EJ; Frick, J; Rogers, LK; Vieland, VJ; Chicoine, LG; Nelin, LD

    2016-01-01

    Aim Pulmonary hypertension (PH) develops in 25–40% of bronchopulmonary dysplasia (BPD) patients, substantially increasing mortality. We have previously found that asymmetric dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide (NO) production, is elevated in patients with BPD-associated PH. ADMA is metabolized by NG,NG- dimethylarginine dimethylaminohydrolase (DDAH). Presently, we test the hypothesis that there are single nucleotide polymorphisms (SNPs) in DDAH1 and/or DDAH2 associated with the development of PH in BPD patients. Methods BPD patients were enrolled (n=98) at Nationwide Children’s Hospital. Clinical characteristics and 36 SNPs in DDAH1 and DDAH2 were compared between BPD-associated PH patients (cases) and BPD-alone patients (controls). Results In BPD patients, 25 (26%) had echocardiographic evidence of PH (cases). In this cohort, DDAH1 wildtype rs480414 was 92% sensitive and 53% specific for PH in BPD, and the DDAH1 SNP rs480414 decreased the risk of PH in an additive model of inheritance (OR=0.39; 95% CI [0.18–0.88], p=0.01). Conclusion The rs480414 SNP in DDAH1 may be protective against the development of PH in patients with BPD. Furthermore, the DDAH1 rs480414 may be a useful biomarker in developing predictive models for PH in patients with BPD. PMID:26663142

  16. Cloning, sequencing and identification of single nucleotide polymorphisms of partial sequence on the porcine CACNA1S gene.

    Science.gov (United States)

    Fang, XiaoMin; Xu, NingYing; Ren, ShouWen

    2008-04-01

    CACNA1S gene encodes the alpha1 subunit of the calcium channel. The mutation of CACNA1S gene can cause hypokalemic periodic paralysis (HypoKPP) and maliglant hyperthermia synarome (MHS) in human beings. Current research on CACNA1S was mainly in human being and model animal, but rarely in livestock and poultry. In this study, Yorkshire pigs (23), Pietrain pigs (30), Jinhua pigs (115) and the second generation (126) of crossbred of Jinhua and Pietrain were used. Primers were designed according to the sequence of human CACNA1S gene and PCR was carried out using pig genome DNA. PCR products were sequenced and compared with that of human, and then single nucleotide polymorphisms (SNPs) were investigated by PCR-SSCP, while PCR-RFLP tests were performed to validate the mutations. Results indicated: (1) the 5211 bp DNA fragments of porcine CACNA1S gene were acquired (GenBank accession number: DQ767693 ) and the identity of the exon region was 82.6% between human and pig; (2) fifty-seven mutations were found within the cloned sequences, among which 24 were in exon region; (3) the results of PCR-RFLP were in accordance with that of PCR-SSCP. According to the EST of porcine CACNA1S gene published in GenBank (Bx914582, Bx666997), 8 of the 11 SNPs identified in the present study were consistent with the base difference between two EST fragments.

  17. Novel single nucleotide polymorphism associations with colorectal cancer on chromosome 8q24 in African and European Americans.

    Science.gov (United States)

    Kupfer, Sonia S; Torres, Jada Benn; Hooker, Stanley; Anderson, Jeffrey R; Skol, Andrew D; Ellis, Nathan A; Kittles, Rick A

    2009-08-01

    Regions on chromosome 8q24 harbor susceptibility alleles for multiple cancers including colorectal (region 3) and prostate cancer (regions 1-4). The objectives of the present study were (i) to test whether single-nucleotide polymorphisms (SNPs) in region 4 are associated with colorectal cancer (CRC) in European or African Americans; (ii) to test whether 8q24 SNPs previously shown to be associated with colorectal and prostate cancer also show association in our multiethnic series and (iii) to test for association between 100 ancestry informative markers (AIMs) and CRC in both the African American and European American cohorts. In total, we genotyped nine markers on 8q24 and 100 unlinked AIMs in 569 CRC cases and 439 controls (490 European Americans and 518 African Americans) obtained retrospectively from a hospital-based sample. We found rs7008482 in 8q24 region 4 to be significantly associated with CRC in European Americans (P = 0.03). Also in region 4, we found that a second SNP, rs16900305, trended toward association with CRC in African Americans. The rs6983267 in region 3, previously implicated in CRC risk, trended toward association with disease in European Americans but not in African Americans. Finally, none of the 100 AIMs tested for association reached statistical significance after correction for multiple hypothesis testing. In summary, these results are evidence that 8q24 region 4 contains novel CRC-associated alleles in European and African Americans.

  18. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    Directory of Open Access Journals (Sweden)

    Mônica Barcellos Arruda

    Full Text Available Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs, and 8 to protease inhibitors (PIs containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001, while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009. Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

  19. Genetic homogeneity of the invasive lionfish across the Northwestern Atlantic and the Gulf of Mexico based on Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Pérez-Portela, R; Bumford, A; Coffman, B; Wedelich, S; Davenport, M; Fogg, A; Swenarton, M K; Coleman, F; Johnston, M A; Crawford, D L; Oleksiak, M F

    2018-03-22

    Despite the devastating impact of the lionfish (Pterois volitans) invasion on NW Atlantic ecosystems, little genetic information about the invasion process is available. We applied Genotyping by Sequencing techniques to identify 1,220 single nucleotide polymorphic sites (SNPs) from 162 lionfish samples collected between 2013 and 2015 from two areas chronologically identified as the first and last invaded areas in US waters: the east coast of Florida and the Gulf of Mexico. We used population genomic analyses, including phylogenetic reconstruction, Bayesian clustering, genetic distances, Discriminant Analyses of Principal Components, and coalescence simulations for detection of outlier SNPs, to understand genetic trends relevant to the lionfish's long-term persistence. We found no significant differences in genetic structure or diversity between the two areas (F ST p-values > 0.01, and t-test p-values > 0.05). In fact, our genomic analyses showed genetic homogeneity, with enough gene flow between the east coast of Florida and Gulf of Mexico to erase previous signals of genetic divergence detected between these areas, secondary spreading, and bottlenecks in the Gulf of Mexico. These findings suggest rapid genetic changes over space and time during the invasion, resulting in one panmictic population with no signs of divergence between areas due to local adaptation.

  20. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    Science.gov (United States)

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  1. Single nucleotide polymorphisms in the TP53 region and susceptibility to invasive epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Schildkraut, Joellen M; Goode, Ellen L; Clyde, Merlise A

    2009-01-01

    The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2......,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNP.......07-1.57) and rs12951053 (median per allele OR, 1.19; 95% PI, 1.01-1.38). Analyses of other histologic subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated...

  2. Interaction of single nucleotide polymorphisms in ADRB2, ADRB3, TNF, IL6, IGF1R, LIPC, LEPR, and GHRL with physical activity on the risk of type 2 diabetes mellitus and changes in characteristics of the metabolic syndrome

    DEFF Research Database (Denmark)

    Oskari Kilpeläinen, Tuomas; Lakka, Timo A; Laaksonen, David E

    2008-01-01

    Single nucleotide polymorphisms (SNPs) in the ADRB2, ADRB3, TNF, IL6, IGF1R, LIPC, LEPR, and GHRL genes were associated with the conversion from impaired glucose tolerance (IGT) to type 2 diabetes mellitus (T2D) in the Finnish Diabetes Prevention Study (DPS). In this study, we determined whether...

  3. Correlation between single nucleotide polymorphisms of NADPH oxidase p22phox gene and ischemic stroke in Shanghai Han population

    Directory of Open Access Journals (Sweden)

    Wei XU

    2015-09-01

    Full Text Available Objective This paper aims to investigate the distribution of genotypes and alleles of nicotinamide adenine dinucleotide phosphate (NADPH oxidase p22phox -930A/G, 242C/T and -675A/T, so as to evaluate the association between three single-nucleotide polymorphisms (SNPs and risk of atherosclerotic ischemic stroke in permanent resident population of Han nationality living in Shanghai area. Methods The genotypes and allele frequencies of NADPH oxidase p22phox subunit -930A/G, 242C/T and -675A/T were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis in 205 patients with ischemic stroke and 136 healthy controls. Results In patients with ischemic stroke, the results of PCR-RFLP in variant genetic loci were different. For -930A/G, one band appeared at 268 bp of genotype AA; 2 bands appeared at 197 and 71 bp of genotype GG; 3 bands appeared at 268, 197 and 71 bp of genotype AG. For 242C/T, one band appeared at 348 bp of genotype CC; 2 bands appeared at 188 and 160 bp of genotype TT; 3 bands appeared at 348, 188 and 160 bp of genotype CT. For -675A/T, 2 bands appeared at 158 and 54 bp of genotype TT; 3 bands appeared at 212, 158 and 54 bp of genotype AT. The genotypes and allele frequency of all three SNPs of NADPH oxidase p22phox gene had no significant difference between ischemic stroke patients and healthy controls (P > 0.05. Conclusions The genetic polymorphism of NADPH oxidase p22phox gene -930A/G, 242C/T and -675A/T might have no association with ischemic stroke. DOI: 10.3969/j.issn.1672-6731.2015.09.011

  4. Compilation of a panel of informative single nucleotide polymorphisms for bovine identification in the Northern Irish cattle population

    Directory of Open Access Journals (Sweden)

    Hartshorne David

    2010-01-01

    Full Text Available Abstract Background Animal identification is pivotal in governmental agricultural policy, enabling the management of subsidy payments, movement of livestock, test scheduling and control of disease. Advances in bovine genomics have made it possible to utilise inherent genetic variability to uniquely identify individual animals by DNA profiling, much as has been achieved with humans over the past 20 years. A DNA profiling test based on bi-allelic single nucleotide polymorphism (SNP markers would offer considerable advantages over current short tandem repeat (STR based industry standard tests, in that it would be easier to analyse and interpret. In this study, a panel of 51 genome-wide SNPs were genotyped across panels of semen DNA from 6 common breeds for the purposes of ascertaining allelic frequency. For SNPs on the same chromosome, the extent of linkage disequilbrium was determined from genotype data by Expectation Maximization (EM algorithm. Minimum probabilities of unique identification were determined for each breed panel. The usefulness of this SNP panel was ascertained by comparison to the current bovine STR Stockmarks II assay. A statistically representative random sampling of bovine animals from across Northern Ireland was assembled for the purposes of determining the population allele frequency for these STR loci and subsequently, the minimal probability of unique identification they conferred in sampled bovine animals from Northern Ireland. Results 6 SNPs exhibiting a minor allele frequency of less than 0.2 in more than 3 of the breed panels were excluded. 2 Further SNPs were found to reside in coding areas of the cattle genome and were excluded from the final panel. The remaining 43 SNPs exhibited genotype frequencies which were in Hardy Weinberg Equilibrium. SNPs on the same chromosome were observed to have no significant linkage disequilibrium/allelic association. Minimal probabilities of uniquely identifying individual animals from

  5. Polymorphisms of Tumor Necrosis Factor Alpha in Moroccan Patients with Gastric Pathology: New Single-Nucleotide Polymorphisms in TNF-α−193 (G/A

    Directory of Open Access Journals (Sweden)

    A. Essadik

    2015-01-01

    Full Text Available Polymorphisms in tumor necrosis factor alpha (TNF-α gene are emerging as key determinants of gastric diseases. The TNF-α−308 (G/A and TNF-α−238 (G/A single-nucleotide polymorphisms SNPs are the most extensively studied. However, all these studies are conducted in Caucasian and Asian populations. Thus, for the first time in Africa, we sought to investigate whether polymorphisms in TNF-α gene were associated with the development of gastric pathology in Morocco. Two SNPs located in the promoter region (positions −308 and −238 in TNF-α gene were genotyped in 244 individuals (170 patients and 74 healthy controls. Odds ratios (ORs and 95% confidence intervals (CI were estimated using logistic regression analysis. The TNF-α−238 (G/A genotype was significantly associated with a high risk of gastritis and gastric cancer (GC (P=0.001 and P=0.002, resp.. Furthermore, a new polymorphism located in the promoter region at position −193 in TNF-α gene was identified. The distribution of this SNP was markedly different in patients suffering from ulcers. The association between TNF-α−193 (G/A genotype and high risk of ulcer was significant (P=0.03. These results suggest that the TNF-α−193 (G/A allele has a protective function against gastric cancer by developing ulcer.

  6. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Science.gov (United States)

    Ni, Jing; You, Feng; Xu, Jianhe; Xu, Dongdong; Wen, Aiyun; Wu, Zhihao; Xu, Yongli; Zhang, Peijun

    2012-03-01

    The growth hormone gene ( GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits. In this study, we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker, Larimichthys crocea, from Zhejiang and Fujian stocks. The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1, named AA and AB genotypes, in Zhejiang stock. AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height ( P≤0.05). Two different genotypes, CC and CD, were identified in intron 2 in Fujian stock, with CD showing an SNP at position 692 (T→C). The CD genotype had a significantly positive correlation with both weight and total length ( P≤0.01). These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  7. Novel single nucleotide polymorphisms in candidate genes for growth in tilapia ( Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Breidy Lizeth Cuevas-Rodríguez

    2016-06-01

    Full Text Available ABSTRACT The objective of the present work was to identify and validate single nucleotide variations located in candidate genes to growth traits in tilapia (Oreochromis niloticus. Two transitions were identified in the promoter region of the growth hormone gene (GH; eight nucleotide changes were identified in introns and promoter region of the IGF-I gene; and a transition (T/C was identified in the Myogenin gene (MyoG. The highest genotypic frequency (0.8 for GHpA1 and MyoG was found in the GG and TT homozygous individuals, while the highest frequency (0.9 for GHpB1 was observed in the CT heterozygous fish. There was no genotypic frequency in the CC homozygous tilapia for the GHpB1 and MyoG markers. Based on their allelic frequencies, validation as novel single nucleotide polymorphisms (SNP of those variations located at O. niloticus GH and MyoG genes was possible. These new markers will allow their association with growth traits in tilapia to be exploited in order to determine their potential use as assisted-selection markers.

  8. A multiplex assay with 52 single nucleotide polymorphisms for human identification

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, Chris; Børsting, Claus

    2006-01-01

    A total of 52 SNPs reported to be polymorphic in European, Asian and African populations were selected. Of these, 42 were from the distal regions of each autosome (except chromosome 19). Nearly all selected SNPs were located at least 100 kb distant from known genes and commonly used STRs. We...... from 500 pg DNA. The 52 loci were efficiently amplified from degraded samples where previously only partial STR profiles had been obtained. A total of 700 individuals from Denmark, Greenland, Somalia, Turkey, China, Germany, Taiwan, Thailand and Japan were typed, and the allele frequencies estimated....... All 52 SNPs were polymorphic in the three major population groups. The mean match probability was at least 5.0 x 10(-19) in the populations studied. Typical paternity indices ranged from 336 000 in Asians to 549 000 in Europeans. Details of the 52 SNP loci and population data generated in this work...

  9. Single nucleotide polymorphism rs1800872 in the promoter region of the IL10 gene is associated with predisposition to chronic hepatitis C in Russian population.

    Science.gov (United States)

    Barkhash, Andrey V; Kochneva, Galina V; Chub, Elena V; Romaschenko, Aida G

    2018-03-01

    Previously, we studied an association of two IL28B gene single nucleotide polymorphisms (SNPs) and three IL10 gene SNPs with predisposition to tick-borne encephalitis in a Russian population. In this study, a possible involvement of these SNPs in the development of predisposition to chronic hepatitis C (caused by structurally similar, related virus from the Flaviviridae family) was investigated in the same population. Only the IL10 promoter rs1800872 SNP was associated with predisposition to chronic hepatitis C. This SNP seems to be a common genetic marker of predisposition to two diseases caused by hepatitis C and tick-borne encephalitis viruses in Russian population. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. WNT3A gene polymorphisms are associated with bone mineral density variation in postmenopausal mestizo women of an urban Mexican population: findings of a pathway-based high-density single nucleotide screening

    OpenAIRE

    Velázquez-Cruz, Rafael; García-Ortiz, Humberto; Castillejos-López, Manuel; Quiterio, Manuel; Valdés-Flores, Margarita; Orozco, Lorena; Villarreal-Molina, Teresa; Salmerón, Jorge

    2014-01-01

    Osteoporosis (OP) is a common skeletal disorder characterized by low bone mineral density (BMD) and is a common health problem in Mexico. To date, few genes affecting BMD variation in the Mexican population have been identified. The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) located in genes of the Wnt pathway with BMD variation at various skeletal sites in a cohort of postmenopausal Mexican women. A total of 121 SNPs in or near 15 Wnt signa...

  11. Sexual dimorphism and identification of single nucleotide polymorphism of growth hormone gene in muscovy duck

    Directory of Open Access Journals (Sweden)

    I. Ismoyowati

    2017-08-01

    Full Text Available This research was aimed to investigate the different growth and to identify growth hormone gene polymorphism in Muscovy ducks. Two hundred Muscovy day-old ducks consisting of white-plumed male and female duck, black and white-plumed male and female ducks. Body weight was recorded weekly and the obtained data were subject to T test. Primer design used the Custal X Program based on a database from the GeneBank Cairina moschata GH gene, partial cds (AB158762. Primer base sequence of GH gene was forward/Sequence: 5’-CTGGGGTTGTTTAGCTTGGA-3’ and reverse/Sequence: 5’-TAAACCTTCCCTGGCACAAC-3’. The DNA sequences were aligned by using the BioEdit version 7.7 for identification of the single nucleotide polymorphism. The result showed that male Muscovy duck produced higher an average body weight gain and more relative growth than those of females. The highest body weight gain was at three weeks old, and then it started to decrease at four weeks old. The sequencing PCR product obtained nucleotide polymorphism. AA genotype was observed at 136 t of black female Muscovy duck, CC in black and white male Muscovy duck, and white female Muscovy duck. Conclusively, a body weight gain of 3-week-old male Muscovy ducks was higher than that of females and GH gene polymorphism was observed in Muscovy ducks.

  12. Single nucleotide polymorphisms of DNA mismatch repair genes MSH2 and MLH1 confer susceptibility to esophageal cancer.

    Science.gov (United States)

    Sun, Ming-Zhong; Ju, Hui-Xiang; Zhou, Zhong-Wei; Jin, Hao; Zhu, Rong

    2014-01-01

    Defects in DNA mismatch repair genes like MSH2 and MLH1 confer increased risk of cancers. Here, single nucleotide polymorphisms (SNPs) in MSH2 and MLH1 were investigated for their potential contribution to the risk of esophageal cancer. This study recruited 614 participants from Affiliated Yancheng Hospital, School of Medicine, Southeast University, of which 289 were patients with esophageal cancer, and the remainder was healthy individuals who served as a control group. Two SNPs, MSH2 c.2063T>G and MLH1 IVS14-19A>G, were genotyped using PCR-RFLP. Statistical analysis was performed using chi-square test and logistic regression analysis. Carriers of the MSH2 c.2063G allele were at significantly higher risk for esophageal cancer compared to individuals with the TT genotype [OR = 3.36, 95% confidence interval (CI): 1.18-11.03]. The MLH1 IVS14-19A>G allele also conferred significantly increased (1.70-fold) for esophageal cancer compared to the AA genotype (OR = 1.70, 95% CI: 1.13-5.06). Further, the variant alleles interacted such that individuals with the susceptible genotypes at both MSH2 and MLH1 had a significantly exacerbated risk for esophageal cancer (OR = 12.38, 95% CI: 3.09-63.11). In brief, SNPs in the DNA mismatch repair genes MSH2 and MLH1 increase the risk of esophageal cancer. Molecular investigations are needed to uncover the mechanism behind their interaction effect.

  13. Predictive single nucleotide polymorphism markers for acute oral mucositis in patients with nasopharyngeal carcinoma treated with radiotherapy

    Science.gov (United States)

    Le, Ziyu; Niu, Xiaoshuang; Chen, Ying; Ou, Xiaomin; Zhao, Guoqi; Liu, Qi; Tu, Wenzhi; Hu, Chaosu; Kong, Lin; Liu, Yong

    2017-01-01

    The aim of this study was to investigate the association between the susceptibility of severe oral mucositis (OM) in Chinese nasopharyngeal carcinoma (NPC) patients treated with radiotherapy and single nucleotide polymorphisms (SNPs) across the whole genome. SNPs were screened in a total of 24 patients with NPC and an additional 6 were subjected to mRNA expression analysis. Patients were subdivided into CTC 0-2 (CTC toxicity grade 0, 1, and 2) and CTC 3+ (CTC toxicity grade 3 and above) groups according to their CTC (common toxicity criteria) scores. The GTEx dataset was used to performed eQTL analyses and in-vitro functional assays were performed for eQTL-associated genes. Our data identified 7 functional SNPs associated with the development of OM. We observed that rs11081899-A, located in the 5′-UTR of the ZNF24 gene, was significantly correlated with a higher risk of severe mucositis (OR = 14.631, 95% CI = 2.61-105.46, p = 1.2 × 10−4), and positively associated with ZNF24 mRNA expression (p = 4.1 × 10−6) from GTEx dataset. In addition, high ZNF24 mRNA expression was associated with severe OM in patients with NPC (p = 0.02). Further functional assays revealed that ZNF24 knockdown reduced p65 expression and suppressed TNF-α-induced NF-κB activation and pro-inflammatory cytokines release. These findings suggested that rs11081899-A may be a genetic susceptibility factor for radiation-induced OM in patients with NPC, although its value in clinical application needs to be further verified in a large cohort. Also, we suggested that downregulation of ZNF24 may attenuate the development of mucositis by suppressing NF-κB activation. PMID:28968968

  14. Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

    Science.gov (United States)

    Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

    2012-01-01

    Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

  15. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents

    Directory of Open Access Journals (Sweden)

    Nur Lisa Zaharan

    2018-04-01

    Full Text Available BackgroundSeveral non-synonymous single-nucleotide polymorphisms (nsSNPs have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA in relation to adiposity parameters among adolescents in Malaysia.MethodsWe examined whether (a PA and (b selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study (n = 1,151. Body mass indices, waist–hip ratio, and percentage body fat (% BF were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C. Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3 rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS. Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model.ResultsPAQ-C scores were associated with % BF (β = −0.44 [95% confidence interval −0.72, −0.16], p = 0.002. The CC genotype of ADRB3 rs4994 (β = −0.16 [−0.28, −0.05], corrected p = 0.01 and AA genotype of MC3R rs3827103 (β = −0.06 [−0.12, −0.00], p = 0.02 were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = −0.05 [−0.10, −0.01], p = 0.02 and combined GRS (β = −0.03 [−0.04, −0.01], p = 0.01 for % BF.ConclusionHigher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention

  16. Impact of IL28B-related single nucleotide polymorphisms on liver histopathology in chronic hepatitis C genotype 2 and 3

    DEFF Research Database (Denmark)

    Rembeck, Karolina; Alsiö, Asa; Christensen, Peer Brehm

    2012-01-01

    Recently, several genome-wide association studies have revealed that single nucleotide polymorphisms (SNPs) in proximity to IL28B predict spontaneous clearance of HCV infection as well as outcome following peginterferon and ribavirin therapy among HCV genotype 1 infected patients. The present study...... aimed to evaluate the impact of IL28B SNP variability on liver histology in the context of a phase III treatment trial (NORDynamIC) for treatment-naïve patients with chronic HCV genotype 2 or 3 infection, where pretreatment liver biopsies were mandatory....

  17. Single-nucleotide polymorphisms may cause erroneous results in primer-introduced restriction enzyme analyses: a case of molecular misdiagnosis of homozygous vs heterozygous familial hypercholesterolemia.

    Science.gov (United States)

    Vuorio, A F; Paulin, L; Saltevo, J; Kontula, K

    1999-12-01

    PCR amplification followed by a primer introduced restriction analysis PCR (PIRA-PCR) is a widely used method to detect point mutations. Usually the artificial RFLP is created by siting one nucleotide mismatch near the 3; end of the primer. This does not alter the hybrization of the primer to the target DNA sequence. Unfortunately, unexpected single nucleotide polymorphisms (SNPs) may lead to additional mismatches and result in no amplification of the allele having unexpected SNP. We describe a warning example in which heterozygous familial hypercholesterolemia patient had an unexpected SNP and this led to his misdiagnosis. Copyright 1999 Academic Press.

  18. FADS single-nucleotide polymorphisms are associated with behavioral outcomes in children, and the effect varies between sexes and is dependent on PPAR genotype

    DEFF Research Database (Denmark)

    Jensen, Heidi Ar; Harsløf, Laurine Bente Schram; Nielsen, Maria Søgaard

    2014-01-01

    to investigate whether behavioral outcomes in childhood were associated with FADS tag-single-nucleotide polymorphisms (SNPs) previously found to have opposing effects on infant erythrocyte DHA. DESIGN: At 36 mo, we assessed psychomotor development with the third edition of the Ages & Stages Questionnaire (n......BACKGROUND: Docosahexaenoic acid (DHA), supplied by the diet or endogenous biosynthesis from α-linolenic acid, accretes during the perinatal brain growth spurt. Results regarding a potential programming effect on cognitive function and behavior in humans are inconclusive. OBJECTIVE: Here we aimed...

  19. [Comparative study of prenatal diagnosis with single nucleotide polymorphism array and karyotype analysis].

    Science.gov (United States)

    Chang, Ling; Zhao, Nan; Wei, Yuan; Zhong, Su; Liu, Ping; Qiao, Jie

    2014-10-18

    To compare the roles of single nucleotide polymorphism array (SNP array) and karyotype analysis in high-risk pregnant women prenatal diagnosis. From July 2012 to December 2013, a total of 141 pregnant women with high-risk in prenatal diagnosis were selected as the object of study in Department of Obstetrics and Gynecology, Peking University Third Hospital, 78 cases of umbilical cord puncture and 63 of amnion cavity puncture , both taking SNP array detection and karyotype analysis. The abnormality karyotype rate was 6.4%, the abnormal rate of SNP array result was 11.3%, and the abnormal rate of the combined two methods for detecting was 12.1%. There were significant differences between the SNP array and karyotype analysis (P=0.039). There were obvious differences between the two techniques. It is an effective way to determine genetic disease by integrating SNP array and karyotype analysis in prenatal diagnosis.

  20. High speed single nucleotide polymorphism typing of a hereditary haemochromatosis mutation with capillary array electrophoresis microplates.

    Science.gov (United States)

    Medintz, I; Wong, W W; Sensabaugh, G; Mathies, R A

    2000-07-01

    A single nucleotide polymorphism (SNP) typing assay is developed and evaluated on a microfabricated capillary array electrophoresis system. Using fluorescently labeled allele-specific primers, the S65C (193A-->T) substitution associated with hereditary haemochromatosis in the HFE gene is genotyped. The covalently labeled polymerase chain reaction (PCR) products are separated on a microfabricated radial capillary array electrophoresis microplate using nondenaturing gel media in under two minutes. Detection is accomplished with a laser-excited rotary confocal scanner. The Rox-labeled A-allele specific amplicon (211 bp) is differentiated from the R110-labeled T-allele specific amplicon (201 bp) by both size and color. This study demonstrates the feasibility of using allele-specific PCR with covalently labeled primers for high speed fluorescent SNP typing on microfabricated radial capillary array electrophoresis microplates.

  1. Effect of common single-nucleotide polymorphisms in acetylsalicylic acid metabolic pathway genes on platelet reactivity in patients with diabetes

    Science.gov (United States)

    Postula, Marek; Janicki, Piotr K.; Rosiak, Marek; Kaplon-Cieslicka, Agnieszka; Kondracka, Agnieszka; Trzepla, Ewa; Filipiak, Krzysztof J.; Kosior, Dariusz A.; Czlonkowski, Andrzej; Opolski, Grzegorz

    2013-01-01

    Background Platelet reactivity in patients on acetylsalicylic acid (ASA) therapy can be influenced by physiological or pathological conditions affecting ASA pharmacokinetics or pharmacodynamics. The mechanism of such variability in the therapeutic response to ASA, particularly in diabetic patients, is poorly understood. The rate of elimination of ASA and its metabolite, salicylic acid (SA), is likely a major factor determining drug efficacy. The objective of this study was to investigate the effect of genetic polymorphisms in the selected candidate genes within the ASA metabolic pathway on the platelet reactivity and concentration of ASA and thromboxane A2 (TxA2) metabolites in a population of patients with type 2 diabetes mellitus (T2DM). Material/Methods The study cohort consisted of 287 Caucasians with T2DM who had been taking ASA tablets at the dose of 75 mg per day for at least 3 months. Platelet reactivity analyses were performed using VerifyNow Aspirin and PFA-100 assays. The measured ASA metabolite included salicylic acid (ASA), and TxA2 metabolites included serum TxB2 and urinary 11-dh-TxB2. Genotyping for the selected 18 single-nucleotide polymorphisms (SNPs) within 5 genes of the ASA metabolic pathway was performed using a Sequenom iPLEX platform. Results No statistically significant association was observed between the investigated SNPs genotypes, platelet reactivity, and measured metabolites in the investigated cohort of patients. Conclusions The results of our study failed to confirm that the selected variants in the genes within the ASA metabolic pathway might contribute to platelet reactivity in a diabetic population treated with ASA. PMID:23715170

  2. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  3. QualitySNP: a pipeline for detecting single nucleotide polymorphisms and insertions/deletions in EST data from diploid and polyploid species

    Directory of Open Access Journals (Sweden)

    Voorrips Roeland E

    2006-10-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs and are considered to be faster and more cost-effective than experimental procedures. A major challenge in computational SNP discovery is distinguishing allelic variation from sequence variation between paralogous sequences, in addition to recognizing sequencing errors. For the majority of the public EST sequences, trace or quality files are lacking which makes detection of reliable SNPs even more difficult because it has to rely on sequence comparisons only. Results We have developed a new algorithm to detect reliable SNPs and insertions/deletions (indels in EST data, both with and without quality files. Implemented in a pipeline called QualitySNP, it uses three filters for the identification of reliable SNPs. Filter 1 screens for all potential SNPs and identifies variation between or within genotypes. Filter 2 is the core filter that uses a haplotype-based strategy to detect reliable SNPs. Clusters with potential paralogs as well as false SNPs caused by sequencing errors are identified. Filter 3 screens SNPs by calculating a confidence score, based upon sequence redundancy and quality. Non-synonymous SNPs are subsequently identified by detecting open reading frames of consensus sequences (contigs with SNPs. The pipeline includes a data storage and retrieval system for haplotypes, SNPs and alignments. QualitySNP's versatility is demonstrated by the identification of SNPs in EST datasets from potato, chicken and humans. Conclusion QualitySNP is an efficient tool for SNP detection, storage and retrieval in diploid as well as polyploid species. It is available for running on Linux or UNIX systems. The program, test data, and user manual are available at

  4. QualitySNP: a pipeline for detecting single nucleotide polymorphisms and insertions/deletions in EST data from diploid and polyploid species

    Science.gov (United States)

    Tang, Jifeng; Vosman, Ben; Voorrips, Roeland E; van der Linden, C Gerard; Leunissen, Jack AM

    2006-01-01

    Background Single nucleotide polymorphisms (SNPs) are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs)) and are considered to be faster and more cost-effective than experimental procedures. A major challenge in computational SNP discovery is distinguishing allelic variation from sequence variation between paralogous sequences, in addition to recognizing sequencing errors. For the majority of the public EST sequences, trace or quality files are lacking which makes detection of reliable SNPs even more difficult because it has to rely on sequence comparisons only. Results We have developed a new algorithm to detect reliable SNPs and insertions/deletions (indels) in EST data, both with and without quality files. Implemented in a pipeline called QualitySNP, it uses three filters for the identification of reliable SNPs. Filter 1 screens for all potential SNPs and identifies variation between or within genotypes. Filter 2 is the core filter that uses a haplotype-based strategy to detect reliable SNPs. Clusters with potential paralogs as well as false SNPs caused by sequencing errors are identified. Filter 3 screens SNPs by calculating a confidence score, based upon sequence redundancy and quality. Non-synonymous SNPs are subsequently identified by detecting open reading frames of consensus sequences (contigs) with SNPs. The pipeline includes a data storage and retrieval system for haplotypes, SNPs and alignments. QualitySNP's versatility is demonstrated by the identification of SNPs in EST datasets from potato, chicken and humans. Conclusion QualitySNP is an efficient tool for SNP detection, storage and retrieval in diploid as well as polyploid species. It is available for running on Linux or UNIX systems. The program, test data, and user manual are available at and as Additional files

  5. Association analysis of single nucleotide polymorphisms at five loci: comparison between atopic dermatitis and asthma in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Hua-Yang Tang

    Full Text Available Atopic diseases, such as atopic dermatitis (AD and asthma, are closely related to clinical phenotypes with hypersensitivity, and often share some similar genetic and pathogenic bases. Our recent GWAS identified three susceptibility gene/loci FLG (rs11204971 and rs3126085, 5q22.1 (rs10067777, rs7701890, rs13360927 and rs13361382 and 20q13.33 (rs6010620 to AD. The effect of these AD associated polymorphisms in asthma is so far unknown. To investigate whether AD relevant genetic variants is identical to asthma and reveal the differences in genetic factors between AD and asthma in Chinese Han population, seven AD associated single nucleotide polymorphisms (SNPs as well as 3 other SNPs (rs7936562 and rs7124842 at 11q13.5 and rs4982958 at 14q11.2 from our previous AD GWAS were genotyped in 463 asthma patients and 985 controls using Sequenom MassArray system. We found rs4982958 at 14q11.2 was significantly associated with asthma (P = 3.04×10(-4, OR = 0.73. We also detected one significant risk haplotype GGGA from the 4 SNPs (rs10067777, rs7701890, rs13360927 and rs13361382 at 5q22.1 in AD cases (P(correction = 3.60×10(-10, OR = 1.26, and the haplotype was suggestive of risk in asthma cases in this study (P = 0.014, P(correction = 0.084, OR = 1.38. These SNPs (rs11204971, rs3126085, rs7936562, rs712484 and rs6010620 at AD susceptibility genes/loci FLG, 11q13.5 and 20q13.33 were not associated with asthma in this study. Our results further comfirmed that 14q11.2 was an important candidate locus for asthma and demonstrated that 5q22.1 might be shared by AD and asthma in Chinese Han population.

  6. Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... Mastitis is a major cause of economic loss in dairy cattle. In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these.

  7. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    Expressed Sequence Tags (ESTs) and Single Nucleotide Polymorphisms (SNPs) are providing in depth knowledge in plant biology, breeding and biotechnology. The emergence of many novel molecular marker techniques are changing and accelerating the process of producing mutations in plant molecular biology ...

  8. An Investigation of Modifying Effects of Metallothionein Single-Nucleotide Polymorphisms on the Association between Mercury Exposure and Biomarker Levels

    Science.gov (United States)

    Wang, Yi; Goodrich, Jaclyn M.; Gillespie, Brenda; Werner, Robert; Basu, Niladri

    2012-01-01

    Background: Recent studies have suggested that several genes that mediate mercury metabolism are polymorphic in humans. Objective: We hypothesized that single-nucleotide polymorphisms (SNPs) in metallothionein (MT) genes may underlie interindividual differences in mercury biomarker levels. We studied the potential modifying effects of MT SNPs on mercury exposure–biomarker relationships. Methods: We measured total mercury in urine and hair samples of 515 dental professionals. We also surveyed occupational and personal exposures to dental amalgam and dietary fish consumption, from which daily methylmercury (MeHg) intake was estimated. Log-transformed urine and hair levels were modeled in multivariable linear regression separately against respective exposure surrogates, and the effect modification of 13 MT SNPs on exposure was investigated. Results: The mean mercury levels in urine (1.06 μg/L) and hair (0.51 μg/g) were not significantly different from the U.S. general population (0.95 μg/L and 0.47 μg/g, respectively). The mean estimated daily MeHg intake was 0.084 μg/kg/day (range, 0–0.98 μg/kg/day), with 25% of study population intakes exceeding the current U.S. Environmental Protection Agency reference dose of 0.1 μg/kg/day. Multivariate regression analysis showed that subjects with the MT1M (rs2270837) AA genotype (n = 10) or the MT2A (rs10636) CC genotype (n = 42) had lower urinary mercury levels than did those with the MT1M or MT2A GG genotype (n = 329 and 251, respectively) after controlling for exposure and potential confounders. After controlling for MeHg intake, subjects with MT1A (rs8052394) GA and GG genotypes (n = 24) or the MT1M (rs9936741) TT genotype (n = 459) had lower hair mercury levels than did subjects with MT1A AA (n = 113) or MT1M TC and CC genotypes (n = 15), respectively. Conclusion: Our findings suggest that some MT genetic polymorphisms may influence mercury biomarker concentrations at levels of exposure relevant to the general

  9. Single nucleotide polymorphism typing of Mycobacterium ulcerans reveals focal transmission of buruli ulcer in a highly endemic region of Ghana.

    Directory of Open Access Journals (Sweden)

    Katharina Röltgen

    Full Text Available Buruli ulcer (BU is an emerging necrotizing disease of the skin and subcutaneous tissue caused by Mycobacterium ulcerans. While proximity to stagnant or slow flowing water bodies is a risk factor for acquiring BU, the epidemiology and mode of M. ulcerans transmission is poorly understood. Here we have used high-throughput DNA sequencing and comparisons of the genomes of seven M. ulcerans isolates that appeared monomorphic by existing typing methods. We identified a limited number of single nucleotide polymorphisms (SNPs and developed a real-time PCR SNP typing method based on these differences. We then investigated clinical isolates of M. ulcerans on which we had detailed information concerning patient location and time of diagnosis. Within the Densu river basin of Ghana we observed dominance of one clonal complex and local clustering of some of the variants belonging to this complex. These results reveal focal transmission and demonstrate, that micro-epidemiological analyses by SNP typing has great potential to help us understand how M. ulcerans is transmitted.

  10. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Science.gov (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

    2015-11-01

    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  11. Effects of bovine cytochrome P450 single-nucleotide polymorphism, forage type and body condition on production traits in cattle.

    Science.gov (United States)

    Sales, M A; Larson, M J; Reiter, S T; Brown, A H; Brown, M A; Looper, M L; Coffey, K P; Rosenkrans, C F

    2012-08-01

    Relating single-nucleotide polymorphisms (SNP) to cows with acceptable productivity could benefit cattle breeders in areas where tall fescue is the predominant forage. This study aimed to (i) identify SNPs in bovine cytochrome P450 3A28 (CYP3A28) and (ii) determine the associations between SNP genotype, forage and cow body condition (BC). Genotype (CC, CG or GG) and forage [Kentucky-31 wild-type endophyte-infected tall fescue (KY+) vs. bermudagrass] effects on milk volume and quality were determined in Herd 1 cows (123 cows); in Herd 2 (99 cows), genotype and BC (low vs. moderate) effects on ovarian follicle size, calving date and calving per cent were determined; and in Herd 3 (114 cows), effects of genotype and fescue cultivar [KY+ vs. non-toxic endophyte-infected tall fescue (HiMag4)] were related to calving per cent, calving date and weaning weights of both cow and her calf. A cytosine (C) to guanine (G) transversion at base 994 (C994G) in CYP3A28 was identified. There was a genotype × forage type interaction (p productivity in cows. © 2011 Blackwell Verlag GmbH.

  12. Association analysis of two single-nucleotide polymorphisms of the RELN gene with autism in the South African population

    KAUST Repository

    Sharma, Jyoti Rajan

    2013-02-01

    Background: Autism (MIM209850) is a neurodevelopmental disorder characterized by a triad of impairments, namely impairment in social interaction, impaired communication skills, and restrictive and repetitive behavior. A number of family and twin studies have demonstrated that genetic factors play a pivotal role in the etiology of autistic disorder. Various reports of reduced levels of reelin protein in the brain and plasma in autistic patients highlighted the role of the reelin gene (RELN) in autism. There is no such published study on the South African (SA) population. Aims: The aim of the present study was to find the genetic association of intronic rs736707 and exonic rs362691 (single-nucleotide polymorphisms [SNPs] of the RELN gene) with autism in a SA population. Methods: Genomic DNA was isolated from cheek cell swabs from autistic (136) as well as control (208) subjects. The TaqMan ® Real-Time polymerase chain reaction and genotyping assay was utilized to determine the genotypes. Results: A significant association of SNP rs736707, but not for SNP rs362691, with autism in the SA population is observed. Conclusion: There might be a possible role of RELN in autism, especially for SA populations. The present study represents the first report on genetic association studies on the RELN gene in the SA population. © 2013, Mary Ann Liebert, Inc.

  13. Impact of Viral Activators and Epigenetic Regulators on HIV-1 LTRs Containing Naturally Occurring Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    Sonia Shah

    2015-01-01

    Full Text Available Following human immunodeficiency virus type 1 (HIV-1 integration into host cell DNA, the viral promoter can become transcriptionally silent in the absence of appropriate signals and factors. HIV-1 gene expression is dependent on regulatory elements contained within the long terminal repeat (LTR that drive the synthesis of viral RNAs and proteins through interaction with multiple host and viral factors. Previous studies identified single nucleotide polymorphisms (SNPs within CCAAT/enhancer binding protein (C/EBP site I and Sp site III (3T, C-to-T change at position 3, and 5T, C-to-T change at position 5 of the binding site, respectively, when compared to the consensus B sequence that are low affinity binding sites and correlate with more advanced stages of HIV-1 disease. Stably transfected cell lines containing the wild type, 3T, 5T, and 3T5T LTRs were developed utilizing bone marrow progenitor, T, and monocytic cell lines to explore the LTR phenotypes associated with these genotypic changes from an integrated chromatin-based microenvironment. Results suggest that in nonexpressing cell clones LTR-driven gene expression occurs in a SNP-specific manner in response to LTR activation or treatment with trichostatin A treatment, indicating a possible cell type and SNP-specific mechanism behind the epigenetic control of LTR activation.

  14. Direct genotyping of single nucleotide polymorphisms in methyl metabolism genes using probe-free high-resolution melting analysis.

    Science.gov (United States)

    Kristensen, Lasse S; Dobrovic, Alexander

    2008-05-01

    High-resolution melting (HRM) shows great promise for high-throughput, rapid genotyping of individual polymorphic loci. We have developed HRM assays for genotyping single nucleotide polymorphisms (SNP) in several key genes that are involved in methyl metabolism and may directly or indirectly affect the methylation status of the DNA. The SNPs are in the 5,10-methylenetetrahydrofolate reductase (MTHFR; C677T and A1298C), methionine synthetase (MTR; 5-methyltetrahydrofolate-homocysteine methyltransferase; A2756G), and DNA methyltransferase 3b (DNMT3b; C46359T and C31721T) loci. The choice of short amplicons led to greater melting temperature (Tm) differences between the two homozygous genotypes, which allowed accurate genotyping without the use of probes or spiking with control DNA. In the case of MTHFR, there is a second rarer SNP (rs4846051) close to the A1298C SNP that may result in inaccurate genotyping. We masked this second SNP by placing the primer over it and choosing a base at the polymorphic position that was equally mismatched to both alleles. The HRM assays were done on HRM capable real-time PCR machines rather than stand-alone HRM machines. Monitoring the amplification allows ready identification of samples that may give rise to aberrant melting curves because of PCR abnormalities. We show that samples amplifying markedly late can give rise to shifted melting curves without alteration of shapes and potentially lead to misclassification of genotypes. In conclusion, rapid and high-throughput SNP analysis can be done with probe-free HRM if sufficient attention is paid to amplicon design and quality control to omit aberrantly amplifying samples.

  15. Effects of four single nucleotide polymorphisms of EZH2 on cancer risk: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Ling Z

    2018-02-01

    Full Text Available Zhixin Ling,1,2,* Zonghao You,1,2,* Ling Hu,3 Lei Zhang,1,2 Yiduo Wang,1,2 Minhao Zhang,1,2 Guangyuan Zhang,1,2 Shuqiu Chen,1,2 Bin Xu,1,2 Ming Chen1,2 1Department of Urology, Affiliated Zhongda Hospital of Southeast University, Nanjing, China; 2Surgical Research Center, Institute of Urology, Medical School of Southeast University, Nanjing, China; 3Department of Nephrology, People’s Hospital of Wuxi City, Wuxi, China *These authors contributed equally to this work Background: Although the relationship between several single nucleotide polymorphisms (SNPs of the oncogene EZH2 and cancer risk has been assessed by some case–control studies, results of subsequent studies are controversial. Sample sizes from single-center studies are also limited, thereby providing unreliable findings. Hence, we conducted a comprehensive search and meta-analysis to evaluate the associations between EZH2 SNPs and cancer risk.Materials and methods: A comprehensive literature search for studies focusing on EZH2 SNPs and cancer risk was conducted on PubMed, Web of Science, Embase, and China National Knowledge Infrastructure online databases. Genotype data were extracted and examined through a meta-analysis, and pooled odds ratios (ORs with 95% CIs were used to assess the corresponding associations. Sensitivity analysis, publication bias assessment, and heterogeneity test were performed using STATA 12.0.Results: Twelve eligible studies were included in this meta-analysis. The association of 4 SNPs, namely, rs887569, rs2302427, rs3757441, and rs41277434, in the EZH2 locus with cancer risk was evaluated. Five studies (1,794 cases and 1,878 controls indicated that rs887569 was related to a decreased cancer risk (CTTT/CC: OR =0.849, 95% CI: [0.740 to 0.973], P=0.019; TT/CCCT: OR =0.793, 95% CI: [0.654 to 0.962], P=0.019. Seven studies (2,408 cases and 2,910 controls showed that rs2302427 was linked to a decreased cancer risk (GG/CC: OR =0.562, 95% CI: [0.400 to 0.792], P

  16. Development, Characterization, and Linkage Mapping of Single Nucleotide Polymorphisms in the Grain Amaranths (Amaranthus sp.

    Directory of Open Access Journals (Sweden)

    PJ. Maughan

    2011-03-01

    Full Text Available The grain amaranths ( sp. are important pseudo-cereals native to the New World. During the last decade they have garnered increased international attention for their nutritional quality, tolerance to abiotic stress, and importance as a symbol of indigenous cultures. We describe the development of the first single nucleotide polymorphism (SNP assays for amaranth. In addition, we report the characterization of the first complete genetic linkage map in the genus. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 41 accessions of the cultivated amaranth species and their putative ancestor species ( L. showed that the minor allele frequency (MAF of these markers ranged from 0.05 to 0.5 with an average MAF of 0.27 per SNP locus. One hundred and forty-one of the SNP loci were considered highly polymorphic (MAF ≥ 0.3. Linkage mapping placed all 411 markers into 16 linkage groups, presumably corresponding to each of the 16 amaranth haploid chromosomes. The map spans 1288 cM with an average marker density of 3.1 cM per marker. The work reported here represents the initial first steps toward the genetic dissection of agronomically important characteristics in amaranth.

  17. A STAT6 Intronic Single-Nucleotide Polymorphism is Associated with Clinical Malaria in Ghanaian Children

    Directory of Open Access Journals (Sweden)

    Daniel Amoako-Sakyi

    2016-01-01

    Full Text Available Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974, total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP. Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001, severe malarial anemia (OR = 0.18, P < 0.001, and cerebral malaria (OR = 0.39, P = 0.022. Levels of total IgE significantly differed among malaria phenotypes (P = 0.044 and rs3024974 genotypes (P = 0.037. Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis.

  18. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.

    Science.gov (United States)

    Rotherham, D; Harbison, S A

    2011-04-15

    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  19. [Association between CMTM5 gene rs723840 single nucleotide polymorphism and high on asprin platelet reactivity].

    Science.gov (United States)

    Liu, Teng-fei; Zhang, Jing-wei; Chen, Xia-huan; Feng, Xue-ru; Bai, Zhong-sheng; Liu, Mei-lin

    2015-12-18

    To elucidate the correlation between the single nucleotide polymorphism of CKLF-like MARVEL transmembrane member 5 (CMTM5) gene rs723840 and the occurrence of high on aspirin platelet reactivity (HAPR). The present study is a case-control study. A total of 210 hospitalized patients in Peking University First Hospital were enrolled. Aspirin response was assessed by 0.5 g/L arachidonic acid (AA)-induced platelet aggregation ratio (PR), and ≥ 3/4 quartile of PR of the population was defined as HAPR. Accordingly all the enrolled 210 coronary artery diseases (CAD) patients were divided into HAPR group and No-HAPR group. The genotypes were determined by polymerase chain reaction (PCR) and sequencing analysis for rs723840 of CMTM5 gene. The genotype frequencies in rs723840 C>T of CMTM5 gene conformed well to the Hardy-Weinberg equilibrium in both HAPR group and No-HAPR group. Between the two groups, the genotypes frequencies in HAPR and No-HAPR groups were 48.4%, 51.6%, 0.0% and 73.7%, 22.9%, 0.034%, respectively (P=0.004). The C, T allele frequencies were significantly different in the two groups (P=0.031,OR=0.501, 95% CI: 0.264-0.947). Our study finds a significant correlation between CMTM5 gene rs723840 polymorphism and high on aspirin platelet reactivity.

  20. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

    Science.gov (United States)

    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

    2014-02-15

    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. The Role of Vitamin D Level and Related Single Nucleotide Polymorphisms in Crohn’s Disease

    Directory of Open Access Journals (Sweden)

    Wen J. Lam

    2013-09-01

    Full Text Available New Zealand has one of the highest rates of Crohn’s Disease (CD in the world, and there is much speculation as to why this might be. A high risk of CD has been associated with deficient or insufficient levels of Vitamin D (Vit D, lifestyle as well as various genetic polymorphisms. In this study we sought to analyse the relevance of serum Vit D levels, lifestyle and genotype to CD status. Serum samples were analysed for 25-OH-Vitamin D levels. DNA was isolated from blood and cheek-swabs, and Sequenom and ImmunoChip techniques were used for genotyping. Serum Vit D levels were significantly lower in CD patients (mean = 49.5 mg/L than those found in controls (mean = 58.9 mg/L, p = 4.74 × 10−6. A total of seven single nucleotide polymorphisms were examined for effects on serum Vit D levels, with adjustment for confounding variables. Two variants: rs731236[A] (VDR and rs732594[A] (SCUBE3 showed a significant association with serum Vit D levels in CD patients. Four variants: rs7975232[A] (VDR, rs732594[A] (SCUBE3, and rs2980[T] and rs2981[A] (PHF-11 showed a significant association with serum Vit D levels in the control group. This study demonstrates a significant interaction between Vit D levels and CD susceptibility, as well as a significant association between Vit D levels and genotype.

  2. Genetic Diversity Revealed by Single Nucleotide Polymorphism Markers in a Worldwide Germplasm Collection of Durum Wheat

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Luo

    2013-03-01

    Full Text Available Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

  3. TGFB1 Single Nucleotide Polymorphisms Are Associated With Adverse Quality of Life in Prostate Cancer Patients Treated With Radiotherapy

    International Nuclear Information System (INIS)

    Peters, Christopher A.; Stock, Richard G.; Cesaretti, Jamie A.; Atencio, David P.; Peters, Sheila B.A.; Burri, Ryan J.; Stone, Nelson N.; Ostrer, Harry; Rosenstein, Barry S.

    2008-01-01

    Purpose: To investigate whether the presence of single nucleotide polymorphisms (SNPs) located within TGFB1 might be predictive for the development of adverse quality-of-life outcomes in prostate cancer patients treated with radiotherapy. Methods and Materials: A total of 141 prostate cancer patients treated with radiotherapy were screened for SNPs in TGFB1 using DNA sequencing. Three quality-of-life outcomes were investigated: (1) prospective decline in erectile function, (2) urinary quality of life, and (3) rectal bleeding. Median follow-up was 51.3 months (range, 12-138 months; SD, 24.4 months). Results: Those patients who possessed either the T/T genotype at position -509, the C/C genotype at position 869 (pro/pro, codon 10) or the G/C genotype at position 915 (arg/pro, codon 25) were significantly associated with the development of a decline in erectile function compared with those who did not have these genotypes: 56% (9 of 16) vs. 24% (11 of 45) (p = 0.02). In addition, patients with the -509 T/T genotype had a significantly increased risk of developing late rectal bleeding compared with those who had either the C/T or C/C genotype at this position: 55% (6 of 11) vs. 26% (34 of 130) (p = 0.05). Conclusions: Possession of certain TGFB1 genotypes is associated with the development of both erectile dysfunction and late rectal bleeding in patients treated with radiotherapy for prostate cancer. Therefore, identification of patients harboring these genotypes may represent a means to predict which men are most likely to suffer from poor quality-of-life outcomes after radiotherapy for prostate cancer

  4. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  5. Genetic control of conventional labeling through the bovine meat production chain by single nucleotide polymorphisms using real-time PCR.

    Science.gov (United States)

    Capoferri, Rossana; Bongioni, Graziella; Galli, Andrea; Aleandri, Riccardo

    2006-08-01

    Since January 2002, the European Union has adopted precise guidelines aimed at protecting the safety of meat and controlling the production chain. To this purpose, the conventional traceability of livestock and meat represents the main tool, but verification of traceability requires genetic support. At present, single nucleotide polymorphisms (SNPs) represent the most innovative molecular markers in genotyping studies. The aim of this study was to verify correct labeling in a bovine meat production chain by a real-time PCR protocol based on SNP analysis. Reference hair samples from 5,000 animals were randomly collected from 22 farms. Twelve hundred meat samples were collected at different steps of the bovine meat production chain. In particular, 1,000 meat samples were collected at the slaughterhouse and 200 samples from the same animals directly at the butcher's shop. The protocol was optimized and validated by testing a set of 16 SNP markers on 95 DNA samples from bovine sires of different breeds. Thereafter, the genotyping of 2,200 samples was conducted with a set of 12 selected SNPs to verify traceability of the meat production chain at three different stages: farm, slaughterhouse, and butcher's shop. Irregularities in conventional traceability were evidenced directly in 1.87% of the samples at the slaughterhouse. This percentage increased to 3.25% when sampling was conducted at the butcher's shop. This study demonstrates that despite the precautions adopted over the meat production chain, some critical points still exist that cause the loss of a correct association between registration numbers and samples.

  6. Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

    Science.gov (United States)

    Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

    2017-07-01

    The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  7. Functional single nucleotide polymorphisms within the cyclin-dependent kinase inhibitor 2A/2B region affect pancreatic cancer risk

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Pastore, M.; Gentiluomo, M.; Talar-Wojnarowska, R.; Kupcinskas, J.; Malecka-Panas, E.; Neoptolemos, J. P.; Niesen, W.; Vodička, Pavel; Delle Fave, G.; Bueno-de-Mesquita, H. B.; Gazouli, M.; Pacetti, P.; Di Leo, M.; Ito, H.; Klüter, H.; Souček, P.; Corbo, V.; Yamao, K.; Hosono, S.; Kaaks, R.; Vashist, Y.; Gioffreda, D.; Strobel, O.; Shimizu, Y.; Dijk, F.; Andriulli, A.; Ivanauskas, A.; Bugert, P.; Tavano, F.; Vodičková, L.; Zambon, C.F.; Lovecek, M.; Landi, S.; Key, T. J.; Boggi, U.; Pezzilli, R.; Jamroziak, K.; Mohelníková-Duchoňová, B.; Mambrini, A.; Bambi, F.; Busch, O.; Pazienza, V.; Valente, R.; Theodoropoulos, G.E.; Hackert, T.; Capurso, G.; Cavestro, G.M.; Pasquali, C.; Basso, D.; Sperti, C.; Matsuo, K.; Büchler, M.; Khaw, K. T.; Izbicki, J.; Costello, E.; Katzke, V.; Michalski, Ch.; Stepien, A.; Rizzato, C.; Canzian, F.

    2016-01-01

    Roč. 7, č. 35 (2016), s. 57011-57020 ISSN 1949-2553 R&D Projects: GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : pancreatic cancer * CDKN2A * single nucleotide polymorphisms Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.168, year: 2016

  8. Risk of estrogen receptor-positive and -negative breast cancer and single-nucleotide polymorphism 2q35-rs13387042

    DEFF Research Database (Denmark)

    Milne, Roger L; Benítez, Javier; Nevanlinna, Heli

    2009-01-01

    BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...

  9. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    Science.gov (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  10. Single nucleotide polymorphisms of Toll-like receptor 4 decrease the risk of development of hepatocellular carcinoma.

    Directory of Open Access Journals (Sweden)

    Shi Minmin

    Full Text Available BACKGROUND: Toll-like receptor 4 (TLR4 is a key innate immunity receptor that initiates an inflammatory response. Growing evidence suggests that mutation of TLR4 gene may play a role in the development of cancers. This study aimed to investigate the temporal relationship of single nucleotide polymorphisms of TLR4 and the risk of hepatocellular carcinoma, a single center-based case-control study was conducted. METHODS: A systematic genetic analysis of sequence variants of TLR4 by evaluating ten single-nucleotide polymorphisms was performed from 216 hepatocellular carcinoma cases and 228 controls. RESULTS: Six single nucleotide polymorphisms of the TLR4 in the 5'-untranslated region and intron were associated with risk of hepatocellular carcinoma. Individuals carrying the heterozygous genotypes for the rs10759930, rs2737190, rs10116253, rs1927914, rs12377632 and rs1927911 had significantly decreased risk of hepatocellular carcinoma (adjusted odds ratio [OR], from 0.527 to 0.578, P<0.01 comparing with those carrying wild-type homozygous genotypes. In haplotype analysis, one haplotype (GCCCTTAG of TLR4 was associated significantly with decrease of the occurrence of hepatocellular carcinoma (OR, 0.556, 95% confidence interval [CI], 0.407-0.758, P = 0.000. CONCLUSIONS: Collectively, these results suggested that the risk of hepatocellular carcinoma was associated with TLR4 sequence variation. TLR4 single nucleotide polymorphisms may play an important protective role in the development of hepatocellular carcinoma.

  11. Lack of Association of OPRM1 and ABCB1 Single-Nucleotide Polymorphisms to Oxycodone Response in Postoperative Pain

    DEFF Research Database (Denmark)

    Zwisler, Stine T; Enggaard, Thomas P; Mikkelsen, Soeren

    2012-01-01

    Purpose: The aim of the study was to search for an association between the single-nucleotide polymorphisms A118G in OPRM1 and C3435T and G2677T/A in ABCB1 and the analgesic effect of intravenous oxycodone in postoperative pain. Methods: There were 268 patients with postoperative pain after, prima...

  12. Association of single nucleotide polymorphisms in TCF2 with type 2 diabetes susceptibility in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Xuelong Zhang

    Full Text Available Hepatocyte nuclear factor 1β (HNF1β, a transcription factor encoded by the transcription factor 2 gene (TCF2, plays a critical role in pancreatic cell formation and glucose homeostasis. It has been suggested that single nucleotide polymorphisms (SNPs of TCF2 are associated with susceptibility to type 2 diabetes (T2D. However, published results are inconsistent and inclusive. To further investigate the role of these common variants, we examined the association of TCF2 polymorphisms with the risk of T2D in a Han population in northeastern China. We genotyped five SNPs in 624 T2D patients and 630 healthy controls by using a SNaPshot method, and evaluated the T2D risk conferred by individual SNPs and haplotypes. In the single-locus analysis, we found that rs752010, rs4430796 and rs7501939 showed allelic differences between T2D patients and healthy controls, with an OR of 1.26 (95% CI 1.08-1.51, P = 0.003, an OR of 1.23 (95% CI 1.06-1.55, P = 0.001 and an OR of 1.28 (95% CI 1.10-1.61, P = 0.001, respectively. Genotype association analysis of each locus also revealed that the homozygous carriers of the at-risk allele had a significant increased T2D risk compared to homozygous carriers of the other allele (OR 1.78, 95% CI 1.20-2.64 for rs752010; OR 1.82, 95% CI 1.24-2.67 for rs4430796; OR 1.95, 95% CI 1.31-2.90 for rs7501939, even after Bonferroni correction for multiple comparisons. Besides, the haplotype-based analysis demonstrated that AGT in block rs752010-rs4430796-rs7501939 was associated with about 30% increase in T2D risk (OR 1.31, 95% CI 1.09-1.57, P = 0.01. Our findings suggested that TCF2 variants may be involved in T2D risk in a Han population of northeastern China. Larger studies with ethnically diverse populations are warranted to confirm the results reported in this investigation.

  13. Mitochondrial bioenergetics and drug-induced toxicity in a panel of mouse embryonic fibroblasts with mitochondrial DNA single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Claudia V.; Oliveira, Paulo J. [CNC—Center for Neuroscience and Cell Biology, University of Coimbra (Portugal); Will, Yvonne [Compound Safety Prediction, Pfizer Global Research and Development, Groton, CT (United States); Nadanaciva, Sashi, E-mail: sashi.nadanaciva@pfizer.com [Compound Safety Prediction, Pfizer Global Research and Development, Groton, CT (United States)

    2012-10-15

    Mitochondrial DNA (mtDNA) variations including single nucleotide polymorphisms (SNPs) have been proposed to be involved in idiosyncratic drug reactions. However, current in vitro and in vivo models lack the genetic diversity seen in the human population. Our hypothesis is that different cell strains with distinct mtDNA SNPs may have different mitochondrial bioenergetic profiles and may therefore vary in their response to drug-induced toxicity. Therefore, we used an in vitro system composed of four strains of mouse embryonic fibroblasts (MEFs) with mtDNA polymorphisms. We sequenced mtDNA from embryonic fibroblasts isolated from four mouse strains, C57BL/6J, MOLF/EiJ, CZECHII/EiJ and PERA/EiJ, with the latter two being sequenced for the first time. The bioenergetic profile of the four strains of MEFs was investigated at both passages 3 and 10. Our results showed that there were clear differences among the four strains of MEFs at both passages, with CZECHII/EiJ having a lower mitochondrial robustness when compared to C57BL/6J, followed by MOLF/EiJ and PERA/EiJ. Seven drugs known to impair mitochondrial function were tested for their effect on the ATP content of the four strains of MEFs in both glucose- and galactose-containing media. Our results showed that there were strain-dependent differences in the response to some of the drugs. We propose that this model is a useful starting point to study compounds that may cause mitochondrial off-target toxicity in early stages of drug development, thus decreasing the number of experimental animals used. -- Highlights: ► mtDNA SNPs may be linked to individual predisposition to drug-induced toxicity. ► CZECHII/EiJ and PERA/EiJ mtDNA was sequenced for the first time in this study. ► Strain-dependent mitochondrial capacity differences were measured. ► Strain-dependent differences in response to mitochondrial toxicants were observed.

  14. [Single nucleotide polymorphisms of HIV coreceptor CCR5 gene in Chinese Yi ethnic group and its association with HIV infection].

    Science.gov (United States)

    Ma, Li-ying; Hong, Kun-xue; Lu, Xiao-zhi; Qin, Guang-ming; Chen, Jian-ping; Chen, Kang-lin; Ruan, Yu-hua; Xing, Hui; Zhu, Jia-hong; Shao, Yi-ming

    2005-11-30

    To investigate the single nucleotide polymorphism (SNP) of HIV-1 coreceptor CCR5 gene in Chinese Yi ethnic group and the association between these SNPs and HIV/AIDS. Peripheral blood samples of 102 HIV negative persons of Chinese Yi nationality, 87 males amd 15 females, aged 23 (12-37), and 68 HIV carriers, 61 males and 7 females, aged 27 (17-51). The regulatory and structural regions of the HIV coreceptor CCR5 gene were amplified from the genomic DNA by nested PCR, each of the two regions was divided into three gene fragments which were overlapped. High throughput DHPLC was used for screening of unknown mutations in each gene fragment. The PCR products showing different peak traces from wild types in DHPLC were sequenced by forward and reverse primers respectively. The sequences were analyzed with the help of Sequence Navigator software to search for SNP loci. Statistical analysis by SPSS and PPAP softwares were made to study the association between these SNPs and HIV infection. Five SNPs (A77G, G316A, T532C, C921T, and G668A) and a AGA deletion of the 686-688 nucleotides were discovered in the coding region of this gene in Chinese Yi ethnic group. C921T mutation was a nonsense mutation, and the other SNPs (A77G, G316A, T532C, and G668A) are sense mutation, with the amino acid changes of K26R, G106R, C178R, and R223Q. Only the frequency of R223Q allelic gene was high (0.08) but those of the others were low (less than 0.01). There was no significant difference in the allele frequency between the HIV negative and HIV positive groups (all P > 0.05). Five SNP loci (T58934G, G59029A, T59353C, G59402A, and C59653T) were found in the regulatory region of CCR5 gene with high allelic frequencies of 0.1912-0.2941. Between the HIV negative and HIV positive groups, there were no differences in the SNP loc (all P > 0.05). Statistical analysis of the association between the linkage of mutation loci with HIV infection suggested a significant difference in the haplotype frequency

  15. Correlation of chitinase 3-like 1 single nucleotide polymorphisms and haplotypes with uterine cervical cancer in Taiwanese women.

    Directory of Open Access Journals (Sweden)

    Yue-Shan Lin

    Full Text Available This study aimed to investigate the relationships of chitinase 3-like 1 (CHI3L1 single nucleotide polymorphisms (SNPs and haplotypes with the development of uterine cervical cancer in Taiwanese women. The SNPs frequencies and haplotypes were also correlated with the clinicopathologic variables of cervical cancer, cancer recurrence, and patient survival.Ninety-nine patients with invasive cancer and 61 with pre-cancerous lesions of the uterine cervix were compared to 310 healthy control subjects. Three SNPs rs6691378 (-1371, G/A, rs10399805 (-247, G/A and rs4950928 (-131, C/G in the promoter region, and one SNP rs880633 (+2950, T/C in exon 5 were analyzed by real time polymerase chain reaction and genotyping. The results showed that the mutant homozygous genotype AA of CHI3L1 SNP rs6691378 and AA of rs10399805, and haplotypes AACC and AACT increased the risk of developing pre-cancerous lesions and invasive cancer. The patients with these risk haplotypes had higher than stage I tumors, larger tumors, and vaginal invasion. In logistic regression model, they also tended to have poor survival event [p = 0.078; odds ratio (OR: 2.99, 95% confidence interval (CI: 0.89-10.08] and a higher probability of recurrence event (p = 0.081; OR: 3.07, 95% CI: 0.87-10.81. There was a significant association between the CHI3L1 risk haplotypes and probability of recurrence (p = 0.002; hazard ratio: 6.21, 95% CI: 1.90-20.41, and a marginal association between the risk haplotypes and overall survival (p = 0.051; hazard ratio: 3.76, 95% CI: 0.99-14.29 in the patients with SCC, using Cox proportional hazard model.The CHI3L1 SNPs rs6691378 and rs10399805 and CHI3L1 haplotypes all correlated with the development of cervical pre-cancerous lesions and invasive cancer. The cervical cancer patients with the CHI3L1 haplotypes AACC or AACT had poor clinicopathologic characteristics and poor recurrence and survival events. These risk haplotypes were associated with higher

  16. Influence of single nucleotide polymorphisms on thrombin generation in factor V Leiden heterozygotes.

    Science.gov (United States)

    Segers, O; Simioni, P; Tormene, D; Castoldi, E

    2014-03-03

    Carriership of the factor V (FV) Leiden mutation increases the risk of venous thromboembolism (VTE) ~4-fold, but the individual risk of each FV Leiden carrier depends on several co-inherited risk and protective factors. Under the hypothesis that thrombin generation might serve as an intermediate phenotype to identify genetic modulators of VTE risk, we enrolled 188 FV Leiden heterozygotes (11 with VTE) and determined the following parameters: thrombin generation in the absence and presence of activated protein C (APC); plasma levels of prothrombin, factor X, antithrombin, protein S and tissue factor pathway inhibitor; and the genotypes of 24 SNPs located in the genes encoding these coagulation factors and inhibitors. Multiple regression analysis was subsequently applied to identify the (genetic) determinants of thrombin generation. The endogenous thrombin potential (ETP) showed a striking inter-individual variability among different FV Leiden carriers and, especially when measured in the presence of APC, correlated with VTE risk. Several SNPs in the F2 (rs1799963, rs3136516), F10 (rs693335), SERPINC1 (rs2227589), PROS1 (Heerlen polymorphism) and TFPI (rs5940) genes significantly affected the ETP-APC and/or the ETP+APC in FV Leiden carriers. Most of these SNPs have shown an association with VTE risk in conventional epidemiological studies, suggesting that the genetic dissection of thrombin generation leads to the detection of clinically relevant SNPs. In conclusion, we have identified several SNPs that modulate thrombin generation in FV Leiden heterozygotes. These SNPs may help explain the large variability in VTE risk observed among different FV Leiden carriers.

  17. Correlation of matrix metalloproteinase-2 single nucleotide polymorphisms with the risk of small vessel disease (SVD).

    Science.gov (United States)

    Zhang, Min; Zhu, Wusheng; Yun, Wenwei; Wang, Qizhang; Cheng, Maogang; Zhang, Zhizhong; Liu, Xinfeng; Zhou, Xianju; Xu, Gelin

    2015-09-15

    Maladjustment of matrix metalloproteinases (MMPs) results in cerebral vasculature and blood-brain barrier dysfunction, which is associated with small vessel disease (SVD). This study was to aim at evaluating correlations between matrix metalloproteinase-2 and 9 single nucleotide polymorphisms and the risk of SVD. A total of 178 patients with SVD were enrolled into this study via Nanjing Stroke Registry Program (NSRP) from January 2010 to November 2011. SVD patients were further subtyped as isolated lacunar infarction (ILI, absent or with mild leukoaraiosis) and ischemic leukoaraiosis (ILA, with moderate or severe leukoaraiosis) according to the Fazekas scale. 100 age- and gender-matched individuals from outpatient medical examination were recruited as the control group. The genotypes of MMP-2-1306 T/C and MMP-9-1562 C/T were determined by the TaqMan method. Of 178 SVD patients, 86 and 92 patients were classified as ILI and ILA, respectively. Comparison analysis between SVD patients and controls revealed a significant correlation between SVD and hypertension, as well as a prevalence of hypertension in ILA. Further genotype analysis showed that the frequency of MMP-2-1306 CC genotype was higher in ILA patients than in controls (P=0.009, χ(2) test; P=0.027, the multiple test with Bonferroni correction). Finally, logistic regression analysis with adjustment of age, sex and vascular risk factors showed that the MMP-2-1306 T/C polymorphism was an independent predictor for ILA (OR: 2.605; 95% confidence interval [CI], 1.067-6.364; P=0.036). Our findings suggest that the MMP-2-1306 T/C polymorphism is a direct risk factor for ILA. Copyright © 2015. Published by Elsevier B.V.

  18. Single nucleotide polymorphism of the growth hormone (GH encoding gene in inbred and outbred domestic rabbits

    Directory of Open Access Journals (Sweden)

    Deyana Gencheva Hristova

    2018-03-01

    Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.

  19. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2009-01-01

    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  20. Genome-wide Single Nucleotide Polymorphism Analyses Reveal Genetic Diversity and Structure of Wild and Domestic Cattle in Bangladesh

    Directory of Open Access Journals (Sweden)

    Md. Rasel Uzzaman

    2014-10-01

    Full Text Available In spite of variation in coat color, size, and production traits among indigenous Bangladeshi cattle populations, genetic differences among most of the populations have not been investigated or exploited. In this study, we used a high-density bovine single nucleotide polymorphism (SNP 80K Bead Chip derived from Bos indicus breeds to assess genetic diversity and population structure of 2 Bangladeshi zebu cattle populations (red Chittagong, n = 28 and non-descript deshi, n = 28 and a semi-domesticated population (gayal, n = 17. Overall, 95% and 58% of the total SNPs (69,804 showed polymorphisms in the zebu and gayal populations, respectively. Similarly, the average minor allele frequency value was as high 0.29 in zebu and as low as 0.09 in gayal. The mean expected heterozygosity varied from 0.42±0.14 in zebu to 0.148±0.14 in gayal with significant heterozygosity deficiency of 0.06 (FIS in the latter. Coancestry estimations revealed that the two zebu populations are weakly differentiated, with over 99% of the total genetic variation retained within populations and less than 1% accounted for between populations. Conversely, strong genetic differentiation (FST = 0.33 was observed between zebu and gayal populations. Results of population structure and principal component analyses suggest that gayal is distinct from Bos indicus and that the two zebu populations were weakly structured. This study provides basic information about the genetic diversity and structure of Bangladeshi cattle and the semi-domesticated gayal population that can be used for future appraisal of breed utilization and management strategies.

  1. Single Nucleotide Polymorphism TGFβ1 R25P Correlates with Acute Toxicity during Neoadjuvant Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Smith, J. Joshua [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Wasserman, Isaac [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Icahn School of Medicine at Mount Sinai, New York, New York (United States); Milgrom, Sarah A. [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Chow, Oliver S.; Chen, Chin-Tung [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Patil, Sujata [Department of Epidemiology and Biostatistics, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Goodman, Karyn A. [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Garcia-Aguilar, Julio, E-mail: garciaaj@mskcc.org [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States)

    2017-04-01

    Purpose: To validate the finding of an association between single nucleotide polymorphisms (SNPs) and toxicity during chemoradiotherapy (CRT) in rectal cancer patients, in an independent population. Methods and Materials: The cohort consisted of 165 patients who received CRT for rectal cancer from 2006 to 2012. Prospectively recorded toxicity information, graded according to the Common Terminology Criteria for Adverse Events version 3.0, was retrieved from the medical record. Additionally, a subset of 52 patients recorded their gastrointestinal symptoms weekly during CRT, using the 7-item Bowel Problems Scale. Deoxyribonucleic acid was extracted from normal tissue in the proctectomy specimens and screened for 3 SNPs: XRCC1 R399Q, XPD K751Q, and TGFβ1 R25P. Univariable and multivariable logistic regression models were constructed. Results: The median radiation dose was 50.4 Gy, and all patients received concurrent chemotherapy. Toxicities measured by the Common Terminology Criteria for Adverse Events were closely associated with patient-reported outcomes for the patients who completed the 7-item Bowel Problems Scale. Grade ≥3 toxicity occurred during CRT in 14 patients (8%). All 14 patients had either XRCC1 R399Q or TGFβ1 R25P polymorphisms. The TGFβ1 R25P polymorphism was significantly associated with grade ≥3 toxicity (odds ratio [OR] 3.47, P=.04) and, in patients who completed the Bowel Problems Scale, with grade ≥4 toxicity (OR 5.61, P=.02). The latter finding persisted in a multivariable logistic regression model controlling for ethnicity, age, and sex (adjusted OR 1.83, P=.02). Conclusions: We have validated the correlation between the TGFβ1 R25P SNP and acute toxicity during CRT in an independent cohort using both clinician- and patient-reported toxicity. The information from our study could be used as a basis to formulate a prospective trial testing the utility of this SNP as a biomarker of acute toxicity during neoadjuvant treatment in locally

  2. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    Science.gov (United States)

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. AICDA single nucleotide polymorphism in common variable immunodeficiency and selective IgA deficiency.

    Science.gov (United States)

    Farhadi, E; Nemati, S; Amirzargar, A A; Hirbod-Mobarakeh, A; Nabavi, M; Soltani, S; Mahdaviani, S A; Shahinpour, S; Arshi, S; Nikbin, B; Aghamohammadi, A; Rezaei, N

    2014-01-01

    Primary antibody deficiencies (PADs) are a heterogeneous group of disorders, characterised by increased susceptibility to recurrent bacterial infections. Common variable immunodeficiency (CVID) is the most important PAD from the clinical point of view and selective IgA deficiency (IgAD) is the most common PAD. However, the underlying gene defect in both is still unknown. As a recent study in Europe showed an association between a single nucleotide polymorphism (SNP) of AICDA gene with PADs, this study was performed to evaluate such an association in Iranian patients. Fifty-eight patients with PAD, including 39 CVID and 19 IgAD, as well as 34 healthy volunteers, were enrolled in this study. Genotyping was done in all groups for an intronic SNP in AICDA (rs2580874), using real-time PCR genotyping assay. The less frequent genotype of AICDA in IgAD patients was AA, seen in 10.5% of the patients, which was much lower than the 30.8% in CVID patients and 38.2% in the controls. However, these differences were not significant. Indeed the GG genotype in the patients with PADs was seen in 20.7%, compared to 8.8% in the controls without any significant difference. There was no significant association between the previously reported genetic variant of AICDA gene and the development of CVID or IgAD, but further multi-center studies are also needed. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

  4. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2.

    Science.gov (United States)

    Sjöstedt, Noora; van den Heuvel, Jeroen J M W; Koenderink, Jan B; Kidron, Heidi

    2017-08-01

    To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. The transport activity of the variants was tested in inside-out membrane vesicles from Sf9 insect and human derived HEK293 cells overexpressing ABCG2. Lucifer Yellow and estrone sulfate were used as probe substrates of activity. The expression levels and cellular localization of the variants was compared to the wild-type ABCG2 by western blotting and immunofluorescence microscopy. All studied variants of ABCG2 displayed markedly decreased transport in both Sf9-ABCG2 and HEK293-ABCG2 vesicles. Impaired transport could be explained for some variants by altered expression levels and cellular localization. Moreover, the destructive effect on transport activity of variants G406R, P480L, M515R and T542A is, to our knowledge, reported for the first time. These results indicate that the transmembrane region of ABCG2 is sensitive to amino acid substitution and that patients harboring these ABCG2 variant forms could suffer from unexpected pharmacokinetic events of ABCG2 substrate drugs or have an increased risk for diseases such as gout where ABCG2 is implicated.

  5. [Unexpected discovery of a fetus with DMD gene deletion using single nucleotide polymorphism array].

    Science.gov (United States)

    Lin, Shaobin; Zhou, Yu; Zhou, Bingyi; Gu, Heng

    2017-08-10

    To investigate the value of single nucleotide polymorphism array (SNP array) for the identification of de novo mutations in the DMD gene among fetuses. G-banded karyotyping and SNP array were performed on a fetus with intrauterine growth restriction but without family history of Duchenne/Becker muscular dystrophy (DMD/BMD). Multiplex ligation-dependent probe amplification (MLPA) was subsequently applied on amniocytes and maternal peripheral blood sample to detect DMD gene deletion/duplication mutations. Karyotyping of amniocytes showed a normal 46, XY karyotype. SNP array on amniocytes detected a 116 kb deletion (chrX: 32 455 741-32 571 504) at Xp21.1 with breakpoints at introns 16 and 30 respectively, encompassing exons 17-29 of the DMD gene. In addition, MLPA analysis of the DMD gene on amniocytes confirmed the deletion of exons 17 to 29 identified by SNP array. However, no deletion/duplication mutation was detected by MLPA in the mother. The de novo deletion of exons 17 to 29 of the DMD gene detected in the fetus may result in BMD or DMD. SNP array can improve the efficiency for detecting genomic disorders in fetuses with unidentified pathogenic genes, negative family history and nonspecific phenotypes.

  6. Single-nucleotide polymorphism array genotyping is equivalent to metaphase cytogenetics for diagnosis of Turner syndrome.

    Science.gov (United States)

    Prakash, Siddharth; Guo, Dongchuan; Maslen, Cheryl L; Silberbach, Michael; Milewicz, Dianna; Bondy, Carolyn A

    2014-01-01

    Turner syndrome is a developmental disorder caused by partial or complete monosomy for the X chromosome in 1 in 2,500 females. We hypothesized that single-nucleotide polymorphism (SNP) array genotyping could provide superior resolution in comparison to metaphase karyotype analysis to facilitate genotype-phenotype correlations. We genotyped 187 Turner syndrome patients with 733,000 SNP marker arrays. All cases met diagnostic criteria for Turner syndrome based on karyotypes (60%) or characteristic physical features. The SNP array results confirmed the diagnosis of Turner syndrome in 100% of cases. We identified a single X chromosome (45,X) in 113 cases. In 58 additional cases (31%), other mosaic cell lines were present, including isochromosomes (16%), rings (5%), and Xp deletions (8%). The remaining cases were mosaic for monosomy X and normal male or female cell lines. Array-based models of X chromosome structure were compatible with karyotypes in 104 of 116 comparable cases (90%). We found that the SNP array data did not detect X-autosome translocations (three cases) but did identify two derivative Y chromosomes and 13 large copy-number variants that were not detected by karyotyping. Our study is the first systematic comparison between the two methods and supports the utility of SNP array genotyping to address clinical and research questions in Turner syndrome.

  7. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  8. Multiple single nucleotide polymorphisms in the first intron of the IL2RA gene affect transcription factor binding and enhancer activity.

    Science.gov (United States)

    Schwartz, Anton M; Demin, Denis E; Vorontsov, Ilya E; Kasyanov, Artem S; Putlyaeva, Lidia V; Tatosyan, Karina A; Kulakovskiy, Ivan V; Kuprash, Dmitry V

    2017-02-20

    IL2RA gene encodes the alpha subunit of a high-affinity receptor for interleukin-2 which is expressed by several distinct populations of lymphocytes involved in autoimmune processes. A large number of polymorphic alleles of the IL2RA locus are associated with the development of various autoimmune diseases. With bioinformatics analysis we the dissected the first intron of the IL2RA gene and selected several single nucleotide polymorphisms (SNPs) that may influence the regulation of the IL2RA gene in cell types relevant to autoimmune pathology. We described five enhancers containing the selected SNPs that stimulated activity of the IL2RA promoter in a cell-type specific manner, and tested the effect of specific SNP alleles on activity of the respective enhancers (E1 to E5, labeled according to the distance to the promoter). The E4 enhancer with minor T variant of rs61839660 SNP demonstrated reduced activity due to disrupted binding of MEF2A/C transcription factors (TFs). Neither rs706778 nor rs706779 SNPs, both associated with a number of autoimmune diseases, had any effect on the activity of the enhancer E2. However, rare variants of several SNPs (rs139767239, rs115133228, rs12722502, rs12722635) genetically linked to either rs706778 and/or rs706779 significantly influenced the activity of E1, E3 and E5 enhancers, presumably by disrupting EBF1, GABPA and ELF1 binding sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Single nucleotide polymorphisms unravel hierarchical divergence and signatures of selection among Alaskan sockeye salmon (Oncorhynchus nerka populations

    Directory of Open Access Journals (Sweden)

    Habicht Christopher

    2011-02-01

    Full Text Available Abstract Background Disentangling the roles of geography and ecology driving population divergence and distinguishing adaptive from neutral evolution at the molecular level have been common goals among evolutionary and conservation biologists. Using single nucleotide polymorphism (SNP multilocus genotypes for 31 sockeye salmon (Oncorhynchus nerka populations from the Kvichak River, Alaska, we assessed the relative roles of geography (discrete boundaries or continuous distance and ecology (spawning habitat and timing driving genetic divergence in this species at varying spatial scales within the drainage. We also evaluated two outlier detection methods to characterize candidate SNPs responding to environmental selection, emphasizing which mechanism(s may maintain the genetic variation of outlier loci. Results For the entire drainage, Mantel tests suggested a greater role of geographic distance on population divergence than differences in spawn timing when each variable was correlated with pairwise genetic distances. Clustering and hierarchical analyses of molecular variance indicated that the largest genetic differentiation occurred between populations from distinct lakes or subdrainages. Within one population-rich lake, however, Mantel tests suggested a greater role of spawn timing than geographic distance on population divergence when each variable was correlated with pairwise genetic distances. Variable spawn timing among populations was linked to specific spawning habitats as revealed by principal coordinate analyses. We additionally identified two outlier SNPs located in the major histocompatibility complex (MHC class II that appeared robust to violations of demographic assumptions from an initial pool of eight candidates for selection. Conclusions First, our results suggest that geography and ecology have influenced genetic divergence between Alaskan sockeye salmon populations in a hierarchical manner depending on the spatial scale. Second

  10. Single nucleotide polymorphism discovery in cutthroat trout subspecies using genome reduction, barcoding, and 454 pyro-sequencing

    Directory of Open Access Journals (Sweden)

    Houston Derek D

    2012-12-01

    Full Text Available Abstract Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and

  11. Preliminary Study on the Single Nucleotide Polymorphism (SNP of XRCC1 Gene Identificationto Improve the Outcomes of Radiotherapy for Cervical Cancer

    Directory of Open Access Journals (Sweden)

    Devita Tetriana

    2015-09-01

    Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks

  12. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2008-01-01

    Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop

  13. SNPPhenA: a corpus for extracting ranked associations of single-nucleotide polymorphisms and phenotypes from literature.

    Science.gov (United States)

    Bokharaeian, Behrouz; Diaz, Alberto; Taghizadeh, Nasrin; Chitsaz, Hamidreza; Chavoshinejad, Ramyar

    2017-04-07

    Single Nucleotide Polymorphisms (SNPs) are among the most important types of genetic variations influencing common diseases and phenotypes. Recently, some corpora and methods have been developed with the purpose of extracting mutations and diseases from texts. However, there is no available corpus, for extracting associations from texts, that is annotated with linguistic-based negation, modality markers, neutral candidates, and confidence level of associations. In this research, different steps were presented so as to produce the SNPPhenA corpus. They include automatic Named Entity Recognition (NER) followed by the manual annotation of SNP and phenotype names, annotation of the SNP-phenotype associations and their level of confidence, as well as modality markers. Moreover, the produced corpus was annotated with negation scopes and cues as well as neutral candidates that play crucial role as far as negation and the modality phenomenon in relation to extraction tasks. The agreement between annotators was measured by Cohen's Kappa coefficient where the resulting scores indicated the reliability of the corpus. The Kappa score was 0.79 for annotating the associations and 0.80 for the confidence degree of associations. Further presented were the basic statistics of the annotated features of the corpus in addition to the results of our first experiments related to the extraction of ranked SNP-Phenotype associations. The prepared guideline documents render the corpus more convenient and facile to use. The corpus, guidelines and inter-annotator agreement analysis are available on the website of the corpus: http://nil.fdi.ucm.es/?q=node/639 . Specifying the confidence degree of SNP-phenotype associations from articles helps identify the strength of associations that could in turn assist genomics scientists in determining phenotypic plasticity and the importance of environmental factors. What is more, our first experiments with the corpus show that linguistic-based confidence

  14. A replication study for association of 53 single nucleotide polymorphisms in ScoliScore test with adolescent idiopathic scoliosis in French-Canadian population.

    Science.gov (United States)

    Tang, Qi Lin; Julien, Cedric; Eveleigh, Robert; Bourque, Guillaume; Franco, Anita; Labelle, Hubert; Grimard, Guy; Parent, Stefan; Ouellet, Jean; Mac-Thiong, Jean-Marc; Gorman, Kristen F; Moreau, Alain

    2015-04-15

    A replication association study that used genomic data generated from French-Canadian case and control cohorts. To determine whether the 53 single nucleotide polymorphisms (SNPs) that were previously associated with spinal deformity progression in an American Caucasian cohort are similarly associated in French-Canadian population. It is widely accepted that genetic factors contribute to adolescent idiopathic scoliosis. The identification of genetic variants associated with the predisposition or progression of curvature could facilitate diagnostic/prognostic tool development. Although 53 SNPs have been associated with spinal curve progression in Caucasian cohorts in the United States, these associations were not replicated in a large Japanese population study, arguing that such a discrepancy could be explained by ethnicity, thus raising the importance of a replication study in an independent Caucasian population of European descent. Genomic data were collected from the French-Canadian population, using the Illumina HumanOmni 2.5M BeadChip. Fifty-two SNPs, tested in ScoliScore or in high linkage disequilibrium with SNPs in the test, were selected to assess their association with scoliosis generally, and with spinal curve progression. One SNP in ScoliScore, rs16909285, could not be evaluated in our Genome-Wide association study. None of the SNPs used in ScoliScore were associated with adolescent idiopathic scoliosis curve progression or curve occurrence in French-Canadian population. We evaluated 52 SNPs in severe patients by comparing risk allele frequencies with those in nonsevere patients and with those in control individuals. There was no significant difference between the severe group and the nonsevere group or between the severe group and the control group. Although the 52 SNPs studied here were previously associated with curve progression in an American population of European descent, we found no association in French-Canadian patients with adolescent

  15. The predictive value of single nucleotide polymorphisms in the VEGF system to the efficacy of first-line treatment with bevacizumab plus chemotherapy in patients with metastatic colorectal cancer : Results from the Nordic ACT trial

    DEFF Research Database (Denmark)

    Hansen, Torben Frøstrup; Christensen, René Depont; Andersen, Rikke Fredslund

    2012-01-01

    PURPOSE: Bevacizumab and chemotherapy is a common choice for first-line treatment of metastatic colorectal cancer (mCRC). So far, no predictive markers have been identified. The aim was to investigate the possible predictive value of single nucleotide polymorphisms (SNPs) in the vascular endothel......PURPOSE: Bevacizumab and chemotherapy is a common choice for first-line treatment of metastatic colorectal cancer (mCRC). So far, no predictive markers have been identified. The aim was to investigate the possible predictive value of single nucleotide polymorphisms (SNPs) in the vascular...... endothelial growth factor (VEGF) system in this setting. METHODS: Pre-treatment blood samples and response evaluations were available from 218 of the 249 included patients. All patients received bevacizumab and chemotherapy comprising fluorouracil and leucovorin or capecitabine combined with either...... marker for bevacizumab plus chemotherapy in patients with mCRC. Patients with the A allele appeared to have increased response rates. The results call for validation....

  16. Both COMT Val158Met single nucleotide polymorphism and sex-dependent differences influence response inhibition

    Directory of Open Access Journals (Sweden)

    Valentina eMione

    2015-05-01

    Full Text Available Reactive and proactive control of actions are cognitive abilities that allow to deal with a continuously changing environment by adjusting already programmed actions. They also set forthcoming acts by evaluating the outcome of the previous ones. Earlier studies highlighted sex related differences in the strategies and in the pattern of brain activation during cognitive tasks involving reactive and proactive control. To further identify sex-dependent characteristics in the cognitive control of actions, in this study we have assessed whether/how differences in reactive and proactive control were modulated by the COMT Val158Met single nucleotide polymorphism, a genetic factor known to influence the functionality of the dopaminergic system, in particular at the level of prefrontal cortex. Two groups of male and female participants were further sorted according to their genotype (Val/Met, Val/Val and Met/Met and tested in a stop signal task, a consolidated tool to measure reactive and proactive control in experimental and clinical settings. In each group of participants we estimated both a measure of the capacity to react to unexpected events and the ability of monitoring their performance. The between groups comparison of these measures indicated a poorer ability of male individuals carrying the Val/Val genotype in error-monitoring, suggesting that differences between sexes could be influenced by the efficiency of COMT and that other sex-specific factors have to be considered. The comprehension of inter-groups behavioral and physiological correlates of cognitive control will provide more accurate diagnostic tools for predicting the incidence and the development of pathologies like ADHD or deviant behaviors as drug or alcohol abuse.

  17. Real time hybridization studies by resonant waveguide gratings using nanopattern imaging for Single Nucleotide Polymorphism detection

    KAUST Repository

    Bougot-Robin, Kristelle

    2013-12-20

    2D imaging of biochips is particularly interesting for multiplex biosensing. Resonant properties allow label-free detection using the change of refractive index at the chip surface. We demonstrate a new principle of Scanning Of Resonance on Chip by Imaging (SORCI) based on spatial profiles of nanopatterns of resonant waveguide gratings (RWGs) and its embodiment in a fluidic chip for real-time biological studies. This scheme allows multiplexing of the resonance itself by providing nanopattern sensing areas in a bioarray format. Through several chip designs we discuss resonance spatial profiles, dispersion and electric field distribution for optimal light-matter interaction with biological species of different sizes. Fluidic integration is carried out with a black anodized aluminum chamber, advantageous in term of mechanical stability, multiple uses of the chip, temperature control and low optical background. Real-time hybridization experiments are illustrated by SNP (Single Nucleotide Polymorphism) detection in gyrase A of E. coli K12, observed in evolution studies of resistance to the antibiotic ciprofloxacin. We choose a 100 base pairs (bp) DNA target (∼30 kDa) including the codon of interest and demonstrate the high specificity of our technique for probes and targets with close affinity constants. This work validates the safe applicability of our unique combination of RWGs and simple instrumentation for real-time biosensing with sensitivity in buffer solution of ∼10 pg/mm2. Paralleling the success of RWGs sensing for cells sensing, our work opens new avenues for a large number of biological studies. © 2013 Springer Science+Business Media.

  18. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

    Science.gov (United States)

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

    2015-07-01

    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

  19. Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Sujana Ghanta

    Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal

  20. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    Science.gov (United States)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  1. Correcting estimators of theta and Tajima's D for ascertainment biases caused by the single-nucleotide polymorphism discovery process

    DEFF Research Database (Denmark)

    Ramírez-Soriano, Anna; Nielsen, Rasmus

    2009-01-01

    Most single-nucleotide polymorphism (SNP) data suffer from an ascertainment bias caused by the process of SNP discovery followed by SNP genotyping. The final genotyped data are biased toward an excess of common alleles compared to directly sequenced data, making standard genetic methods of analysis...... the variances and covariances of these estimators and provide a corrected version of Tajima's D statistic. We reanalyze a human genomewide SNP data set and find substantial differences in the results with or without ascertainment bias correction....

  2. Molecular analysis of desmoid tumors with a high-density single-nucleotide polymorphism array identifies new molecular candidate lesions

    OpenAIRE

    Erben, Philipp; Nowak, Daniel; Sauer, Christian; Ströbel, Philipp; Hofmann, Wolf-Karsten; Hofheinz, Ralf-Dieter; Hohenberger, Peter; Kasper, Bernd

    2012-01-01

    Background: Desmoid tumors are neoplastic proliferations of connective tissues. The mutation status of the gene coding for catenin (cadherin-associated protein) beta 1 (CTNNB1) and trisomy 8 on the chromosomal level have been described to have prognostic relevance. Patients and Methods: In order to elucidate new molecular mechanisms underlying these tumors, we carried out a molecular analysis with a genome-wide human high-density single-nucleotide polymorphism (SNP) array, in 9 patients. Resu...

  3. Integrative analysis of single nucleotide polymorphisms and gene expression efficiently distinguishes samples from closely related ethnic populations

    Directory of Open Access Journals (Sweden)

    Yang Hsin-Chou

    2012-07-01

    Full Text Available Abstract Background Ancestry informative markers (AIMs are a type of genetic marker that is informative for tracing the ancestral ethnicity of individuals. Application of AIMs has gained substantial attention in population genetics, forensic sciences, and medical genetics. Single nucleotide polymorphisms (SNPs, the materials of AIMs, are useful for classifying individuals from distinct continental origins but cannot discriminate individuals with subtle genetic differences from closely related ancestral lineages. Proof-of-principle studies have shown that gene expression (GE also is a heritable human variation that exhibits differential intensity distributions among ethnic groups. GE supplies ethnic information supplemental to SNPs; this motivated us to integrate SNP and GE markers to construct AIM panels with a reduced number of required markers and provide high accuracy in ancestry inference. Few studies in the literature have considered GE in this aspect, and none have integrated SNP and GE markers to aid classification of samples from closely related ethnic populations. Results We integrated a forward variable selection procedure into flexible discriminant analysis to identify key SNP and/or GE markers with the highest cross-validation prediction accuracy. By analyzing genome-wide SNP and/or GE markers in 210 independent samples from four ethnic groups in the HapMap II Project, we found that average testing accuracies for a majority of classification analyses were quite high, except for SNP-only analyses that were performed to discern study samples containing individuals from two close Asian populations. The average testing accuracies ranged from 0.53 to 0.79 for SNP-only analyses and increased to around 0.90 when GE markers were integrated together with SNP markers for the classification of samples from closely related Asian populations. Compared to GE-only analyses, integrative analyses of SNP and GE markers showed comparable testing

  4. QTLs Associated with Agronomic Traits in the Cutler × AC Barrie Spring Wheat Mapping Population Using Single Nucleotide Polymorphic Markers

    Science.gov (United States)

    Perez-Lara, Enid; Semagn, Kassa; Chen, Hua; Iqbal, Muhammad; N’Diaye, Amidou; Kamran, Atif; Navabi, Alireza; Pozniak, Curtis; Spaner, Dean

    2016-01-01

    We recently reported three earliness per se quantitative trait loci (QTL) associated with flowering and maturity in a recombinant inbred lines (RILs) population derived from a cross between the spring wheat (Triticum aestivum L.) cultivars ‘Cutler’ and ‘AC Barrie’ using 488 microsatellite and diversity arrays technology (DArT) markers. Here, we present QTLs associated with flowering time, maturity, plant height, and grain yield using high density single nucleotide polymorphic (SNP) markers in the same population. A mapping population of 158 RILs and the two parents were evaluated at five environments for flowering, maturity, plant height and grain yield under field conditions, at two greenhouse environments for flowering, and genotyped with a subset of 1809 SNPs out of the 90K SNP array and 2 functional markers (Ppd-D1 and Rht-D1). Using composite interval mapping on the combined phenotype data across all environments, we identified a total of 19 QTLs associated with flowering time in greenhouse (5), and field (6) conditions, maturity (5), grain yield (2) and plant height (1). We mapped these QTLs on 8 chromosomes and they individually explained between 6.3 and 37.8% of the phenotypic variation. Four of the 19 QTLs were associated with multiple traits, including a QTL on 2D associated with flowering, maturity and grain yield; two QTLs on 4A and 7A associated with flowering and maturity, and another QTL on 4D associated with maturity and plant height. However, only the QTLs on both 2D and 4D had major effects, and they mapped adjacent to well-known photoperiod response Ppd-D1 and height reducing Rht-D1 genes, respectively. The QTL on 2D reduced flowering and maturity time up to 5 days with a yield penalty of 436 kg ha-1, while the QTL on 4D reduced plant height by 13 cm, but increased maturity by 2 days. The high density SNPs allowed us to map eight moderate effect, two major effect, and nine minor effect QTLs that were not identified in our previous study

  5. Association of Single-Nucleotide Polymorphisms in Immune-Related Genes with Development of Dengue Hemorrhagic Fever in a Mexican Population.

    Science.gov (United States)

    Vargas-Castillo, Angélica Berenice; Ruiz-Tovar, Karina; Vivanco-Cid, Héctor; Quiroz-Cruz, Sarai; Escobar-Gutiérrez, Alejandro; Cerna-Cortes, Jorge Francisco; Vaughan, Gilberto; Fonseca-Coronado, Salvador

    2017-11-13

    Single-nucleotide polymorphisms (SNPs) occurring in immune-related genes have been associated with risk or protection for development of dengue, depending on ethnicity. Here, we genotyped seven SNPs located in immune response-related genes to identify their association with severe forms of dengue in patients from an endemic region in Mexico. One hundred and thirty-eight patients with dengue fever (DF), thirty-one dengue hemorrhagic fever (DHF) patients, as well as 304 healthy donors were genotyped by using a TaqMan-based approach. SNP analysis, including rs1800629 (TNF), rs4804803 (CD209), rs2780831 (JAK1), rs1801274 (FCGR2A), rs231775 (CTLA4), rs12979860, and rs8099917 (IFNL3), was performed. The rs1800629 A-allele in the TNF gene was associated with an increased risk of DHF (OR = 3.4, CI = 1.235-9.284 p = 0.0212) whereas SNPs rs4804803, rs2780831, rs1801274, rs231775, rs12979860, and rs8099917 showed no association in this cohort. These results show that allelic variations in TNF can play an important role in the development of DHF. However, the lack of association between all remaining SNPs and DHF suggests that the genetic background might directly modify the role of these immune-related molecules, leading to the milder illness often observed in a Mexican population.

  6. Rapid Genome-wide Single Nucleotide Polymorphism Discovery in Soybean and Rice via Deep Resequencing of Reduced Representation Libraries with the Illumina Genome Analyzer

    Directory of Open Access Journals (Sweden)

    Stéphane Deschamps

    2010-07-01

    Full Text Available Massively parallel sequencing platforms have allowed for the rapid discovery of single nucleotide polymorphisms (SNPs among related genotypes within a species. We describe the creation of reduced representation libraries (RRLs using an initial digestion of nuclear genomic DNA with a methylation-sensitive restriction endonuclease followed by a secondary digestion with the 4bp-restriction endonuclease This strategy allows for the enrichment of hypomethylated genomic DNA, which has been shown to be rich in genic sequences, and the digestion with serves to increase the number of common loci resequenced between individuals. Deep resequencing of these RRLs performed with the Illumina Genome Analyzer led to the identification of 2618 SNPs in rice and 1682 SNPs in soybean for two representative genotypes in each of the species. A subset of these SNPs was validated via Sanger sequencing, exhibiting validation rates of 96.4 and 97.0%, in rice ( and soybean (, respectively. Comparative analysis of the read distribution relative to annotated genes in the reference genome assemblies indicated that the RRL strategy was primarily sampling within genic regions for both species. The massively parallel sequencing of methylation-sensitive RRLs for genome-wide SNP discovery can be applied across a wide range of plant species having sufficient reference genomic sequence.

  7. Multi-generational imputation of single nucleotide polymorphism marker genotypes and accuracy of genomic selection.

    Science.gov (United States)

    Toghiani, S; Aggrey, S E; Rekaya, R

    2016-07-01

    Availability of high-density single nucleotide polymorphism (SNP) genotyping platforms provided unprecedented opportunities to enhance breeding programmes in livestock, poultry and plant species, and to better understand the genetic basis of complex traits. Using this genomic information, genomic breeding values (GEBVs), which are more accurate than conventional breeding values. The superiority of genomic selection is possible only when high-density SNP panels are used to track genes and QTLs affecting the trait. Unfortunately, even with the continuous decrease in genotyping costs, only a small fraction of the population has been genotyped with these high-density panels. It is often the case that a larger portion of the population is genotyped with low-density and low-cost SNP panels and then imputed to a higher density. Accuracy of SNP genotype imputation tends to be high when minimum requirements are met. Nevertheless, a certain rate of genotype imputation errors is unavoidable. Thus, it is reasonable to assume that the accuracy of GEBVs will be affected by imputation errors; especially, their cumulative effects over time. To evaluate the impact of multi-generational selection on the accuracy of SNP genotypes imputation and the reliability of resulting GEBVs, a simulation was carried out under varying updating of the reference population, distance between the reference and testing sets, and the approach used for the estimation of GEBVs. Using fixed reference populations, imputation accuracy decayed by about 0.5% per generation. In fact, after 25 generations, the accuracy was only 7% lower than the first generation. When the reference population was updated by either 1% or 5% of the top animals in the previous generations, decay of imputation accuracy was substantially reduced. These results indicate that low-density panels are useful, especially when the generational interval between reference and testing population is small. As the generational interval

  8. Genomic expression and single-nucleotide polymorphism profiling discriminates chromophobe renal cell carcinoma and oncocytoma

    International Nuclear Information System (INIS)

    Tan, Min-Han; Furge, Kyle A; Kort, Eric; Giraud, Sophie; Ferlicot, Sophie; Vielh, Philippe; Amsellem-Ouazana, Delphine; Debré, Bernard; Flam, Thierry; Thiounn, Nicolas; Zerbib, Marc; Wong, Chin Fong; Benoît, Gérard; Droupy, Stéphane; Molinié, Vincent; Vieillefond, Annick; Tan, Puay Hoon; Richard, Stéphane; Teh, Bin Tean; Tan, Hwei Ling; Yang, Ximing J; Ditlev, Jonathon; Matsuda, Daisuke; Khoo, Sok Kean; Sugimura, Jun; Fujioka, Tomoaki

    2010-01-01

    Chromophobe renal cell carcinoma (chRCC) and renal oncocytoma are two distinct but closely related entities with strong morphologic and genetic similarities. While chRCC is a malignant tumor, oncocytoma is usually regarded as a benign entity. The overlapping characteristics are best explained by a common cellular origin, and the biologic differences between chRCC and oncocytoma are therefore of considerable interest in terms of carcinogenesis, diagnosis and clinical management. Previous studies have been relatively limited in terms of examining the differences between oncocytoma and chromophobe RCC. Gene expression profiling using the Affymetrix HGU133Plus2 platform was applied on chRCC (n = 15) and oncocytoma specimens (n = 15). Supervised analysis was applied to identify a discriminatory gene signature, as well as differentially expressed genes. High throughput single-nucleotide polymorphism (SNP) genotyping was performed on independent samples (n = 14) using Affymetrix GeneChip Mapping 100 K arrays to assess correlation between expression and gene copy number. Immunohistochemical validation was performed in an independent set of tumors. A novel 14 probe-set signature was developed to classify the tumors internally with 93% accuracy, and this was successfully validated on an external data-set with 94% accuracy. Pathway analysis highlighted clinically relevant dysregulated pathways of c-erbB2 and mammalian target of rapamycin (mTOR) signaling in chRCC, but no significant differences in p-AKT or extracellular HER2 expression was identified on immunohistochemistry. Loss of chromosome 1p, reflected in both cytogenetic and expression analysis, is common to both entities, implying this may be an early event in histogenesis. Multiple regional areas of cytogenetic alterations and corresponding expression biases differentiating the two entities were identified. Parafibromin, aquaporin 6, and synaptogyrin 3 were novel immunohistochemical markers effectively discriminating

  9. Genome-wide linkage analysis of 972 bipolar pedigrees using single-nucleotide polymorphisms.

    Science.gov (United States)

    Badner, J A; Koller, D; Foroud, T; Edenberg, H; Nurnberger, J I; Zandi, P P; Willour, V L; McMahon, F J; Potash, J B; Hamshere, M; Grozeva, D; Green, E; Kirov, G; Jones, I; Jones, L; Craddock, N; Morris, D; Segurado, R; Gill, M; Sadovnick, D; Remick, R; Keck, P; Kelsoe, J; Ayub, M; MacLean, A; Blackwood, D; Liu, C-Y; Gershon, E S; McMahon, W; Lyon, G J; Robinson, R; Ross, J; Byerley, W

    2012-07-01

    Because of the high costs associated with ascertainment of families, most linkage studies of Bipolar I disorder (BPI) have used relatively small samples. Moreover, the genetic information content reported in most studies has been less than 0.6. Although microsatellite markers spaced every 10 cM typically extract most of the genetic information content for larger multiplex families, they can be less informative for smaller pedigrees especially for affected sib pair kindreds. For these reasons we collaborated to pool family resources and carried out higher density genotyping. Approximately 1100 pedigrees of European ancestry were initially selected for study and were genotyped by the Center for Inherited Disease Research using the Illumina Linkage Panel 12 set of 6090 single-nucleotide polymorphisms. Of the ~1100 families, 972 were informative for further analyses, and mean information content was 0.86 after pruning for linkage disequilibrium. The 972 kindreds include 2284 cases of BPI disorder, 498 individuals with bipolar II disorder (BPII) and 702 subjects with recurrent major depression. Three affection status models (ASMs) were considered: ASM1 (BPI and schizoaffective disorder, BP cases (SABP) only), ASM2 (ASM1 cases plus BPII) and ASM3 (ASM2 cases plus recurrent major depression). Both parametric and non-parametric linkage methods were carried out. The strongest findings occurred at 6q21 (non-parametric pairs LOD 3.4 for rs1046943 at 119 cM) and 9q21 (non-parametric pairs logarithm of odds (LOD) 3.4 for rs722642 at 78 cM) using only BPI and schizoaffective (SA), BP cases. Both results met genome-wide significant criteria, although neither was significant after correction for multiple analyses. We also inspected parametric scores for the larger multiplex families to identify possible rare susceptibility loci. In this analysis, we observed 59 parametric LODs of 2 or greater, many of which are likely to be close to maximum possible scores. Although some linkage

  10. Single Nucleotide Polymorphisms in Key One-Carbon Metabolism Genes and Their Association with Blood Folate and Homocysteine Levels in a Chinese Population in Yunnan.

    Science.gov (United States)

    Ni, Juan; Liu, Yaoxian; Zhou, Tao; Wu, Xiayu; Wang, Xu

    2018-02-16

    One-carbon metabolism (OCM) is essential for DNA synthesis and methylation. Single nucleotide polymorphisms (SNPs) within OCM genes may affect folic acid (FA) metabolism, disrupt homocysteine (Hcy) homeostasis, and increase the risk of disease. This study investigated the relationship between SNPs in key OCM genes and their association with blood FA and Hcy levels in a healthy population in Yunnan, China. Six SNPs within five key OCM genes (MTHFR C677T, MTHFR A1298C, MS A2756G, MTRR A66G, CBS T833C, and SHMT C1420T) were genotyped in 300 healthy volunteers (148 males and 152 females) using polymerase chain reaction/restriction fragment length polymorphism. Blood folate [serum FA (SFA) and red blood cell folate (RBC FA)] and Hcy levels were determined by chemiluminescence immunoassays and enzymatic assays. Subjects with the MTHFR 677TT genotype had significantly higher Hcy levels and RBC FA concentrations compared with those harboring the MTHFR 677CC/CT genotypes (p < 0.01). Both Hcy and blood FA concentrations were also increased in subjects with MS 2756AA, as well as those within CBS 833TT, when compared with those with MS 2756AG/GG (p < 0.05) and CBS 833TC/CC (p < 0.05) genotypes, respectively. Subjects harboring the combined genotype of MTHFR 677TT and MS 2756AA had a higher Hcy concentration than those carrying other MTHFR and MS combinations (p = 0.002). Similarly, subjects harboring the combination of CBS 833TT with MTHFR 677TT had higher Hcy concentrations than those harboring other CBS and MTHFR combinations (p = 0.011). The genotypes involving the MTHFR C677T, MS A2756G, and CBS T833C polymorphisms, including combinations of these genotypes, were the most important factors associated with blood FA and Hcy levels of the investigated SNPs in the OCM genes.

  11. Single Nucleotide Polymorphisms of Gene and Association with Non-specific Digestive Disorder in Rabbit

    Directory of Open Access Journals (Sweden)

    Yun-Fu Liu

    2013-08-01

    Full Text Available The NLRP12 (NLR family, pyrin domain containing 12 serves as a suppressor factor in the inflammatory response and protects the host against inflammation-induced damage. In the present study, we aimed to study the polymorphisms of NLRP12 gene and its association with susceptibility to non-specific digestive disorder (NSDD in rabbits. We re-sequenced the entire coding region of the rabbit NLRP12 gene and detected a total of 19 SNPs containing 14 synonymous and five non-synonymous variations. Among them, the coding SNP (c.1682A>G, which would carry a potential functional implication, was subsequently subjected to genotyping for case-control association study (272 cases and 267 controls. The results revealed that allele A was significantly protective against NSDD with an odds ratio value of 0.884 (95% confidence interval, 0.788 to 0.993; p = 0.038. We also experimentally induced NSDD in growing rabbits by feeding a fibre-deficient diet and subsequently investigated NLRP12 mRNA expression. The mRNA expression of NLRP12 in healthy status was significantly higher than that in severe NSDD (p = 0.0016. The highest expression was observed in individuals carrying the protective genotype AA (p = 0.0108. These results suggested that NLRP12 was significantly associated with the NSDD in rabbits. However, the precise molecular mechanism of NLRP12 involving in the development of rabbit NSDD requires further research.

  12. Association between maternal single nucleotide polymorphisms in genes regulating glucose metabolism and risk for neural tube defects in offspring.

    Science.gov (United States)

    Fu, Yunting; Wang, Lin-lin; Yi, Deqing; Jin, Lei; Liu, Jufen; Zhang, Yali; Ren, Aiguo

    2015-06-01

    Maternal pregestational hyperglycemia, diabetes, and obesity are well-established risk factors for neural tube defects (NTDs). As a common underlying mechanism, the imbalance of glucose homeostasis is directly related to the development of NTDs. Polymorphisms in genes regulating glucose metabolism in women may impact their chance of having an NTD-affected pregnancy. We conducted a two-stage case-control study to investigate the association between maternal genetic variants in genes regulating glucose metabolism and risk for NTDs. The cases were 547 women who gave birth to a child with an NTD (anencephaly, spina bifida, or encephalocele); the controls were 543 women who gave birth to a full-term healthy infant. In the first stage, 12 single nucleotide polymorphisms were genotyped in 160 cases and 162 controls. In the second stage, five single nucleotide polymorphisms found in the first stage and potentially associated with NTD risk were genotyped for validation, in an additional 387 cases and 381 controls. Combined analysis of data from the two stages showed an association between maternal AA genotype of GCKR rs780094 and increased risk for total NTDs [odds ratio, 1.73; 95% confidence interval, 1.16-2.59) and spina bifida subtype [odds ratio, 1.83; 95% confidence interval, 1.16-2.88). No association was found between the other four single nucleotide polymorphisms (LEPR rs1137100, HK1 rs748235, HHEX rs5015480, KCNQ1 rs2237892) and NTD risk. The AA genotype in maternal GCKR rs780094 is associated with an increased risk for NTDs and spina bifida in the Chinese population. © 2014 Wiley Periodicals, Inc.

  13. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  14. Insights into the Molecular Mechanisms Underlying Mammalian P2X7 Receptor Functions and Contributions in Diseases, Revealed by Structural Modeling and Single Nucleotide Polymorphisms

    Science.gov (United States)

    Jiang, Lin-Hua; Baldwin, Jocelyn M.; Roger, Sebastien; Baldwin, Stephen A.

    2013-01-01

    The mammalian P2X7 receptors (P2X7Rs), a member of the ionotropic P2X receptor family with distinctive functional properties, play an important part in mediating extracellular ATP signaling in health and disease. A clear delineation of the molecular mechanisms underlying the key receptor properties, such as ATP-binding, ion permeation, and large pore formation of the mammalian P2X7Rs, is still lacking, but such knowledge is crucial for a better understanding of their physiological functions and contributions in diseases and for development of therapeutics. The recent breakthroughs in determining the atomic structures of the zebrafish P2X4.1R in the closed and ATP-bound open states have provided the long-awaited structural information. The human P2RX7 gene is abundant with non-synonymous single nucleotide polymorphisms (NS-SNPs), which generate a repertoire of human P2X7Rs with point mutations. Characterizations of the NS-SNPs identified in patients of various disease conditions and the resulting mutations have informed previously unknown molecular mechanisms determining the mammalian P2X7R functions and diseases. In this review, we will discuss the new insights into such mechanisms provided by structural modeling and recent functional and genetic linkage studies of NS-SNPs. PMID:23675347

  15. Insights into the molecular mechanisms underlying mammalian P2X7 receptor functions and contributions in diseases, revealed by structural modeling and single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Lin-Hua eJiang

    2013-05-01

    Full Text Available The mammalian P2X7 receptors (P2X7Rs, a member of the ionotropic P2X receptor family with distinctive functional properties, play an important part in mediating extracellular ATP signaling in health and disease. A clear delineation of the molecular mechanisms underlying the key receptor properties, such as ATP-binding, ion permeation, and large pore formation of the mammalian P2X7Rs, is still lacking, but such knowledge is crucial for a better understanding of their physiological functions and contributions in diseases and for development of therapeutics. The recent breakthroughs in determining the atomic structures of the zebrafish P2X4.1R in the closed and ATP-bound open states have provided the long-awaited structural information. The human P2RX7 gene is abundant with non-synonymous single nucleotide polymorphisms (NS-SNPs, which generate a repertoire of human P2X7Rs with point mutations. Characterizations of the NS-SNPs identified in patients of various disease conditions and the resulting mutations have informed previously unknown molecular mechanisms determining the mammalian P2X7R functions and diseases. In this review, we will discuss the new insights into such mechanisms provided by structural modeling and recent functional and genetic linkage studies of NS-SNPs.

  16. Reduced Single Nucleotide Polymorphism Panels for Assigning Atlantic Albacore and Bay of Biscay Anchovy Individuals to Their Geographic Origin: Toward Sustainable Fishery Management.

    Science.gov (United States)

    Montes, Iratxe; Laconcha, Urtzi; Iriondo, Mikel; Manzano, Carmen; Arrizabalaga, Haritz; Estonba, Andone

    2017-05-31

    There is an increasing trend upon adding a detailed description of the origin of seafood products driven by a general interest in the implementation of sustainable fishery management plans for the conservation of marine ecosystems. North Atlantic albacore ("Bonito del Norte con Eusko Label") and Bay of Biscay anchovy ("Anchoa del Cantábrico") are two commercially important fish populations with high economical value and vulnerable to commercial fraud. This fact, together with the overexploited situation of these two populations, makes it necessary to develop a tool to identify individual origin and to detect commercial fraud. In the present study, we have developed and validated a traceability tool consisting of reduced panels of gene-associated single nucleotide polymorphisms (SNPs) suitable for assigning individuals of two species to their origin with unprecedented accuracy levels. Only 48 SNPs are necessary to assign 81.1% albacore and 93.4% anchovy individuals with 100% accuracy to their geographic origin. The total accuracy of the results demonstrates how gene-associated SNPs can revolutionize food traceability. Gene-associated SNP panels are not of mere commercial interest, but they also can result in a positive impact on sustainability of marine ecosystems through conservation of fish populations through establishing a more effective and sustainable fishery management framework and contributing to the prevention of falsified labeling.

  17. Association of rs1285933 single nucleotide polymorphism in CLEC5A gene with dengue severity and its functional effects.

    Science.gov (United States)

    Xavier-Carvalho, Caroline; Cezar, Renata Duarte da Silva; Freire, Naishe Matos; Vasconcelos, Carla Maria Mola de; Solorzano, Victor Edgar Fiestas; de Toledo-Pinto, Thiago Gomes; Fialho, Luciana Gomes; do Carmo, Rodrigo Feliciano; Vasconcelos, Luydson Richardson Silva; Cordeiro, Marli Tenório; Baptista, Paulo; de Azeredo, Elzinandes Leal; da Cunha, Rivaldo Venâncio; de Souza, Luiz José; Pacheco, Antonio Guilherme; Kubelka, Claire Fernandes; Moura, Patrícia Muniz Mendes Freire de; Moraes, Milton Ozorio

    2017-10-01

    Outbreaks of the Zika, dengue, and chikungunya viruses, especially in the Americas, pose a global threat due to their rapid spread and difficulty controlling the vector. Extreme phenotypes are often observed, from asymptomatic to severe clinical manifestations, which are well-studied in dengue. Host variations are also important contributors to disease outcomes, and many case-control studies have associated single nucleotide polymorphisms (SNPs) with severe dengue. Here, we found that the TC genotype and T-carriers for SNP rs1285933 in the C-type lectin superfamily member 5 (CLEC5A) gene was associated with severe dengue in a Northern Brazilian population (OR=2.75 and p-value=0.01, OR=2.11 and p-value=0.04, respectively). We also tested the functional effect of the CLEC5A protein and found that it is upregulated on the surface of human monocytes after in vitro dengue infection. CLEC5A was correlated with viral load inside the monocytes (Spearman r=0.55, p=0.008) and TNF production in culture supernatants (Spearman r=0.72, p=0.03). Analysis of mRNA in blood samples from DENV4-infected patients exhibiting mild symptoms showed that CLEC5A mRNA expression is correlated with TNF (r=0.67, p=0.0001) and other immune mediators. Monocytes from rs1285933 TT/TC individuals showed lower CLEC5A expression compared to CC genotypes. However, in these cells, CLEC5A was not correlated with TNF production. In summary, we confirmed that CLEC5A is genetically associated with dengue severity outcome, playing a central role during the immune response triggered by a dengue viral infection, and rs1285933 is a relevant SNP that is able to regulate signaling pathways after interactions between the dengue virus and CLEC5A receptors. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  18. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat.

    Directory of Open Access Journals (Sweden)

    Long-Xi Yu

    Full Text Available Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn. is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS for identifying loci associated with the Ug99 stem rust resistance (SR in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT. Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat.

  19. Single nucleotide polymorphisms other than factor V Leiden are associated with coagulopathy and osteonecrosis of the femoral head in Chinese patients.

    Science.gov (United States)

    Peng, Kou-Ti; Huang, Kuo-Chin; Huang, Tsan-Wen; Lee, Yun-Shien; Hsu, Wei-Hsiu; Hsu, Robert W W; Ueng, Steve W N; Lee, Mel S

    2014-01-01

    Single nucleotide polymorphisms (SNPs) of factor V Leiden have been associated with osteonecrosis of the femoral head (ONFH) in Caucasians but remains controversial in Asians. We used an SNP microarray to screen 55 loci of factor V gene in patients with ONFH of Chinese. Significantly different candidate SNPs at 14 loci were analyzed in 146 patients and 116 healthy controls using MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry and gene sequencing. The factor V Leiden (rs6025) was not found in all participants. Six SNP loci (rs9332595, rs6020, rs9332647, rs3766110, rs10919186, and rs12040141) were confirmed with significant differences in patients but not in controls. The rs6020 G-to-A polymorphism was found in 88.9% of the patients. In addition, a high percentage (87.6%) of the patients had an abnormal coagulation profile that included hyperfibrinogen, elevated fibrinogen degradation products, elevated D-dimer, abnormal protein S, abnormal protein C, or a decrease in anti-thrombin III. Patients with the rs6020 G-to-A polymorphism (mutation) had a higher risk (odds ratio: 4.62; 95% confidence interval: 1.44-14.8) of having coagulation abnormalities than did those without the mutation (wild-type) (χ(2) p  =  0.006). Our findings suggested that the rs6020 polymorphism might be the genetic trait that accounts for the higher prevalence of ONFH in the Chinese population than in Westerners. Exposure to risk factors such as alcohol and steroids in patients with the rs6020 polymorphism causes coagulation abnormalities and, subsequently, thromboembolisms in the femoral head.

  20. Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

    Science.gov (United States)

    Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

    2013-01-01

    Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

  1. Identification of single nucleotide polymorphisms in the bovine Toll-like receptor 1 gene and association with health traits in cattle

    Directory of Open Access Journals (Sweden)

    Russell Christopher D

    2012-03-01

    Full Text Available Abstract Bovine mastitis remains the most common and costly disease of dairy cattle worldwide. A complementary control measure to herd hygiene and vaccine development would be to selectively breed cattle with greater resistance to mammary infection. Toll-like receptor 1 (TLR1 has an integral role for the initiation and regulation of the immune response to microbial pathogens, and has been linked to numerous inflammatory diseases. The objective of this study was to investigate whether single nucleotide polymorphisms (SNPs within the bovine TLR1 gene (boTLR1 are associated with clinical mastitis (CM. Selected boTLR1 SNPs were analysed within a Holstein Friesian herd. Significant associations were found for the tagging SNP -79 T > G and the 3'UTR SNP +2463 C > T. We observed favourable linkage of reduced CM with increased milk fat and protein, indicating selection for these markers would not be detrimental to milk quality. Furthermore, we present evidence that some of these boTLR1 SNPs underpin functional variation in bovine TLR1. Animals with the GG genotype (from the tag SNP -79 T > G had significantly lower boTLR1 expression in milk somatic cells when compared with TT or TG animals. In addition, stimulation of leucocytes from GG animals with the TLR1-ligand Pam3csk4 resulted in significantly lower levels of CXCL8 mRNA and protein. SNPs in boTLR1 were significantly associated with CM. In addition we have identified a bovine population with impaired boTLR1 expression and function. This may have additional implications for animal health and warrants further investigation to determine the suitability of identified SNPs as markers for disease susceptibility.

  2. Frequency of single nucleotide polymorphisms of some immune response genes in a population sample from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Léa Campos de Oliveira

    2011-09-01

    Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.

  3. Melon Transcriptome Characterization: Simple Sequence Repeats and Single Nucleotide Polymorphisms Discovery for High Throughput Genotyping across the Species

    Directory of Open Access Journals (Sweden)

    José Miguel Blanca

    2011-07-01

    Full Text Available Melon ( L. ranks among the highest-valued fruit crops worldwide. Some genomic tools are available for this crop, including a Sanger transcriptome. We report the generation of 689,054 high-quality expressed sequence tags (ESTs from two 454 sequencing runs, using normalized and nonnormalized complementary DNA (cDNA libraries prepared from four genotypes belonging to the two subspecies and the main commercial types. 454 ESTs were combined with the Sanger available ESTs and de novo assembled into 53,252 unigenes. Over 63% of the unigenes were functionally annotated with Gene Ontology (GO terms and 21% had known orthologs of (L. Heynh. Annotation distribution followed similar tendencies than that reported for , suggesting that the dataset represents a fairly complete melon transcriptome. Furthermore, we identified a set of 3298 unigenes with microsatellite motifs and 14,417 sequences with single nucleotide variants of which 11,655 single nucleotide polymorphism met criteria for use with high-throughput genotyping platforms, and 453 could be detected as cleaved amplified polymorphic sequence (CAPS. A set of markers were validated, 90% of them being polymorphic in a number of variable accessions. This transcriptome provides an invaluable new tool for biological research, more so when it includes transcripts not described previously. It is being used for genome annotation and has provided a large collection of markers that will allow speeding up the process of breeding new melon varieties.

  4. The TNFSF15 gene single nucleotide polymorphism rs7848647 is associated with surgical diverticulitis.

    Science.gov (United States)

    Connelly, Tara M; Berg, Arthur S; Hegarty, John P; Deiling, Sue; Brinton, David; Poritz, Lisa S; Koltun, Walter A

    2014-06-01

    To determine if single nuclear polymorphisms (SNPs) in the TFNSF15 gene play a role in patients requiring surgery for diverticulitis. A role for a genetic predisposition in diverticulitis is suggested by its association with hereditary connective tissue disorders, youthful onset in some patients, and the observation of families with multiple affected individuals. The TNFSF15 gene has been associated with other inflammatory diseases affecting the colon such as medically refractory ulcerative colitis (UC), aggressive Crohn's disease (CD), and pouchitis after restorative proctocolectomy. In the discovery phase of this study, 21 sporadic surgical diverticulitis (SD) patients (9 female, mean age = 52 ± 5) and 5 individuals from a single family with surgically managed diverticulitis [familial diverticulitis (FD), 4 female, mean age = 51.1 ± 7] were studied. SD patients were age and sex matched with 3 separate groups of healthy, CD and UC control patients. All patients were genotyped for 5 known TNFSF15-associated SNPs. The SNP discovered to be associated with diverticulitis (rs7848647) was then confirmed in a separate test group composed of 34 additional patients (20 female, mean age 57.7 ± 2) who also underwent surgical treatment for diverticulitis. These patients were age matched to a new control cohort of patients having no history of diverticulitis (26 female). Patients were genotyped using a TaqMan assay. In the discovery phase, logistical regression on matched subjects was performed to determine an association of TNFSF SNP with diverticulitis versus the control groups. In the test phase, significance for the rs7848647 SNP was assessed by the Fischer's exact test. In the discovery phase, the TNFSF15 SNP rs7848647 was significantly associated with SD (p = 0.0003) versus all control groups studied. The risk allele for this SNP (G substituted for A) was found in all SD patients. The homozygous GG allele was found in 62% (13/21) of SD patients versus only 5% (1

  5. Single nucleotide polymorphisms in CAPN and leptin genes associated with meat color and tenderness in Nellore cattle.

    Science.gov (United States)

    Pinto, L F B; Ferraz, J B S; Pedrosa, V B; Eler, J P; Meirelles, F V; Bonin, M N; Rezende, F M; Carvalho, M E; Cucco, D C; Silva, R C G

    2011-09-15

    We analyzed single nucleotide polymorphisms in calpain, leptin, leptin receptor, and growth hormone receptor genes and their association with color, drip and cooking losses of longissimus muscle at 7, 14 and 21 days postmortem in 638 purebred Nellore bulls slaughtered between 22 and 26 months of age. Meat samples were vacuum-packed and aged at 4°C. The single nucleotide polymorphisms T945M, GHR2, E2FB, and CAPN4751 were evaluated. All genotypic classes were observed; however, the T/T genotype of T945M and E2FB was found at a low frequency. A significant association of E2FB with drip loss (a measure of water-holding capacity) was detected at seven days of meat aging. CAPN4751 had an additive effect on red and yellow color intensities. The T allele of CAPN4751 was found to be positively associated with improved meat color, but not with meat tenderness, differing from a previous report indicating that it is associated with meat tenderness. We conclude that the potential for use of CAPN4751 as a marker for these meat quality traits requires further research.

  6. Single-nucleotide polymorphisms and DNA methylation markers associated with central obesity and regulation of body weight.

    Science.gov (United States)

    Goni, Leticia; Milagro, Fermín I; Cuervo, Marta; Martínez, J Alfredo

    2014-11-01

    Visceral fat is strongly associated with the development of specific obesity-related metabolic alterations. Genetic and epigenetic mechanisms seem to be involved in the development of obesity and visceral adiposity. The aims of this review are to identify the single-nucleotide polymorphisms related to central obesity and to summarize the main findings on DNA methylation and obesity. A search of the MEDLINE database was conducted to identify genome-wide association studies, meta-analyses of genome-wide association studies, and gene-diet interaction studies related to central obesity, and, in addition, studies that analyzed DNA methylation in relation to body weight regulation. A total of 8 genome-wide association studies and 9 meta-analyses of genome-wide association studies reported numerous single-nucleotide polymorphisms to be associated with central obesity. Ten studies analyzed gene-diet interactions and central obesity, while 2 epigenome-wide association studies analyzed DNA methylation patterns and obesity. Nine studies investigated the relationship between DNA methylation and weight loss, excess body weight, or adiposity outcomes. Given the development of new sequencing and omics technologies, significantly more knowledge on genomics and epigenomics of obesity and body fat distribution will emerge in the near future. © 2014 International Life Sciences Institute.

  7. Single nucleotide polymorphism microarray-based concurrent screening of 24-chromosome aneuploidy and unbalanced translocations in preimplantation human embryos.

    Science.gov (United States)

    Treff, Nathan R; Northrop, Lesley E; Kasabwala, Khushabu; Su, Jing; Levy, Brynn; Scott, Richard T

    2011-04-01

    To develop, validate, and apply a single nucleotide polymorphism (SNP) microarray-based method for simultaneous preimplantation genetic diagnosis (PGD) of unbalanced inheritance of rearranged chromosomes and 24-chromosome aneuploidy screening. Prospective clinical research study. Academic reproductive medicine center. Eighteen couples carrying a balanced reciprocal or Robertsonian chromosomal rearrangement. PGD on blastocyst trophectoderm biopsy specimens. Aneuploidy, implantation, pregnancy, and delivery rates after SNP microarray-based aneuploidy and translocation screening. Single nucleotide polymorphism microarray was capable of detecting translocation-associated imbalances as small as 9.0 megabases. In the 12 transfers performed, sustained implantation occurred for 9 (45%) of 20 balanced-normal and euploid embryos replaced. The clinical pregnancy rate in patients receiving a transfer was 75% with six singleton deliveries and three ongoing singleton pregnancies thus far. Significantly fewer embryos were eligible for transfer with the incorporation of simultaneous 24-chromosome aneuploidy screening. Arrested embryos were also significantly more likely to possess unbalanced chromosomes when compared with developmentally competent blastocysts. This SNP microarray-based method provides the first opportunity to improve outcomes through comprehensive identification of euploid embryos from translocation carrier couples. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  8. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672

  9. A single nucleotide polymorphism in the zona pellucida 3 gene is associated with the first parity litter size in Hu sheep.

    Science.gov (United States)

    Chong, Yuqing; Huang, Huarong; Liu, Guiqiong; Jiang, Xunping; Rong, Weiheng

    2018-03-31

    Zona pellucida 3 (ZP3) is a primary sperm receptor and acrosome reaction inducer. As a candidate gene, the ZP3 gene has been widely studied since it has great influence on reproductive traits in farm animals. However, little is known about the association between polymorphisms of the coding region of the ZP3 gene and the first parity litter size in Hu sheep. Therefore, the objective of this study was to identify single nucleotide polymorphisms (SNPs) of the ZP3 gene associated with the first parity litter size in Hu sheep. A total of 462 female Hu sheep were sampled to detect SNPs in the coding region of the ZP3 gene. Six SNPs were identified and the reliability of all estimated allele frequencies reached 0.9545 except for one locus (g.2293C > T). SNP (rs401271989) was identified as that involved in amino acid change (Ile → Leu). This amino acid was located at the beginning of a β-strand and outside of the ZP3 protein membrane, and it was most likely to be a ligand-binding site (the possibility was 0.917). At this locus, individuals with AC genotype had a larger litter size than those with CC genotype in the first parity (2.050 vs 1.727, p size in Hu sheep, and it may affect the function of ZP3 protein by impacting the secondary and tertiary protein structures. The present study demonstrates that SNP (rs401271989) could be used in marker-assisted selection of the first parity litter size in Hu sheep. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Interaction between Methylation and CpG Single-Nucleotide Polymorphisms in the HTR2A Gene: Association Analysis with Suicide Attempt in Schizophrenia.

    Science.gov (United States)

    Bani-Fatemi, Ali; Howe, Aaron S; Matmari, Michelle; Koga, Arthur; Zai, Clement; Strauss, John; De Luca, Vincenzo

    2016-01-01

    Dysfunctional mechanisms in the serotonergic system have been implicated in suicidal behavior among patients with schizophrenia. However, previous association analyses of major serotonin genes have provided inconsistent findings regarding their role in suicidal behavior. The goal of the current study was to identify single-nucleotide polymorphisms (SNP) within HTR2A that directly affect CpG methylation sites in schizophrenic patients with suicidal behavior. Furthermore, direct methylation analysis was performed using genomic DNA from peripheral leukocytes employing bisulfite pyrosequencing to assess the contributions of six CpG sites in HTR2A exon I in 67 schizophrenia patients assessed for lifetime suicide attempt. Potential methylation in 25 CpG SNPs across the entire HTR2A gene was analyzed considering their direct contribution to methylation. When we compared direct methylation between attempters and nonattempters, we found that only the polymorphic T102C (rs6313) was significantly different between the two groups (p = 0.02). Furthermore, in the potential methylation analysis, we found a nominal association with suicide attempt for six of the 25 SNPs analyzed, i.e. rs2770293 (p = 0.045), rs6313 (p = 0.033), rs17068986 (p = 0.029), rs4942578 (p = 0.024), rs1728872 (p = 0.014), and rs9534511 (p = 0.003). The results of this investigation provide preliminary evidence that the combined analysis of CpG SNPs and methylation may be useful for investigating the genetic and epigenetic factors involved in suicidal behavior. © 2016 S. Karger AG, Basel.

  11. Identification of Splice Variants, Targeted MicroRNAs and Functional Single Nucleotide Polymorphisms of the BOLA-DQA2 Gene in Dairy Cattle

    Science.gov (United States)

    Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai

    2012-01-01

    Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (pmastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (pmastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936

  12. An Integrated Pipeline of Open Source Software Adapted for Multi-CPU Architectures: Use in the Large-Scale Identification of Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    B. Jayashree

    2007-01-01

    Full Text Available The large amounts of EST sequence data available from a single species of an organism as well as for several species within a genus provide an easy source of identification of intra- and interspecies single nucleotide polymorphisms (SNPs. In the case of model organisms, the data available are numerous, given the degree of redundancy in the deposited EST data. There are several available bioinformatics tools that can be used to mine this data; however, using them requires a certain level of expertise: the tools have to be used sequentially with accompanying format conversion and steps like clustering and assembly of sequences become time-intensive jobs even for moderately sized datasets. We report here a pipeline of open source software extended to run on multiple CPU architectures that can be used to mine large EST datasets for SNPs and identify restriction sites for assaying the SNPs so that cost-effective CAPS assays can be developed for SNP genotyping in genetics and breeding applications. At the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT, the pipeline has been implemented to run on a Paracel high-performance system consisting of four dual AMD Opteron processors running Linux with MPICH. The pipeline can be accessed through user-friendly web interfaces at http://hpc.icrisat.cgiar.org/PBSWeb and is available on request for academic use. We have validated the developed pipeline by mining chickpea ESTs for interspecies SNPs, development of CAPS assays for SNP genotyping, and confirmation of restriction digestion pattern at the sequence level.

  13. Structural insight of dopamine β-hydroxylase, a drug target for complex traits, and functional significance of exonic single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Abhijeet Kapoor

    Full Text Available Human dopamine β-hydroxylase (DBH is an important therapeutic target for complex traits. Several single nucleotide polymorphisms (SNPs have also been identified in DBH with potential adverse physiological effect. However, difficulty in obtaining diffractable crystals and lack of a suitable template for modeling the protein has ensured that neither crystallographic three-dimensional structure nor computational model for the enzyme is available to aid rational drug design, prediction of functional significance of SNPs or analytical protein engineering.Adequate biochemical information regarding human DBH, structural coordinates for peptidylglycine alpha-hydroxylating monooxygenase and computational data from a partial model of rat DBH were used along with logical manual intervention in a novel way to build an in silico model of human DBH. The model provides structural insight into the active site, metal coordination, subunit interface, substrate recognition and inhibitor binding. It reveals that DOMON domain potentially promotes tetramerization, while substrate dopamine and a potential therapeutic inhibitor nepicastat are stabilized in the active site through multiple hydrogen bonding. Functional significance of several exonic SNPs could be described from a structural analysis of the model. The model confirms that SNP resulting in Ala318Ser or Leu317Pro mutation may not influence enzyme activity, while Gly482Arg might actually do so being in the proximity of the active site. Arg549Cys may cause abnormal oligomerization through non-native disulfide bond formation. Other SNPs like Glu181, Glu250, Lys239 and Asp290 could potentially inhibit tetramerization thus affecting function.The first three-dimensional model of full-length human DBH protein was obtained in a novel manner with a set of experimental data as guideline for consistency of in silico prediction. Preliminary physicochemical tests validated the model. The model confirms, rationalizes and

  14. The Prediction of the Expected Current Selection Coefficient of Single Nucleotide Polymorphism Associated with Holstein Milk Yield, Fat and Protein Contents

    Directory of Open Access Journals (Sweden)

    Young-Sup Lee

    2016-01-01

    Full Text Available Milk-related traits (milk yield, fat and protein have been crucial to selection of Holstein. It is essential to find the current selection trends of Holstein. Despite this, uncovering the current trends of selection have been ignored in previous studies. We suggest a new formula to detect the current selection trends based on single nucleotide polymorphisms (SNP. This suggestion is based on the best linear unbiased prediction (BLUP and the Fisher’s fundamental theorem of natural selection both of which are trait-dependent. Fisher’s theorem links the additive genetic variance to the selection coefficient. For Holstein milk production traits, we estimated the additive genetic variance using SNP effect from BLUP and selection coefficients based on genetic variance to search highly selective SNPs. Through these processes, we identified significantly selective SNPs. The number of genes containing highly selective SNPs with p-value <0.01 (nearly top 1% SNPs in all traits and p-value <0.001 (nearly top 0.1% in any traits was 14. They are phosphodiesterase 4B (PDE4B, serine/threonine kinase 40 (STK40, collagen, type XI, alpha 1 (COL11A1, ephrin-A1 (EFNA1, netrin 4 (NTN4, neuron specific gene family member 1 (NSG1, estrogen receptor 1 (ESR1, neurexin 3 (NRXN3, spectrin, beta, non-erythrocytic 1 (SPTBN1, ADP-ribosylation factor interacting protein 1 (ARFIP1, mutL homolog 1 (MLH1, transmembrane channel-like 7 (TMC7, carboxypeptidase X, member 2 (CPXM2 and ADAM metallopeptidase domain 12 (ADAM12. These genes may be important for future artificial selection trends. Also, we found that the SNP effect predicted from BLUP was the key factor to determine the expected current selection coefficient of SNP. Under Hardy-Weinberg equilibrium of SNP markers in current generation, the selection coefficient is equivalent to 2*SNP effect.

  15. Accuracy of Assignment of Atlantic Salmon (Salmo salar L. to Rivers and Regions in Scotland and Northeast England Based on Single Nucleotide Polymorphism (SNP Markers.

    Directory of Open Access Journals (Sweden)

    John Gilbey

    Full Text Available Understanding the habitat use patterns of migratory fish, such as Atlantic salmon (Salmo salar L., and the natural and anthropogenic impacts on them, is aided by the ability to identify individuals to their stock of origin. Presented here are the results of an analysis of informative single nucleotide polymorphic (SNP markers for detecting genetic structuring in Atlantic salmon in Scotland and NE England and their ability to allow accurate genetic stock identification. 3,787 fish from 147 sites covering 27 rivers were screened at 5,568 SNP markers. In order to identify a cost-effective subset of SNPs, they were ranked according to their ability to differentiate between fish from different rivers. A panel of 288 SNPs was used to examine both individual assignments and mixed stock fisheries and eighteen assignment units were defined. The results improved greatly on previously available methods and, for the first time, fish caught in the marine environment can be confidently assigned to geographically coherent units within Scotland and NE England, including individual rivers. As such, this SNP panel has the potential to aid understanding of the various influences acting upon Atlantic salmon on their marine migrations, be they natural environmental variations and/or anthropogenic impacts, such as mixed stock fisheries and interactions with marine power generation installations.

  16. Accuracy of Assignment of Atlantic Salmon (Salmo salar L.) to Rivers and Regions in Scotland and Northeast England Based on Single Nucleotide Polymorphism (SNP) Markers.

    Science.gov (United States)

    Gilbey, John; Cauwelier, Eef; Coulson, Mark W; Stradmeyer, Lee; Sampayo, James N; Armstrong, Anja; Verspoor, Eric; Corrigan, Laura; Shelley, Jonathan; Middlemas, Stuart

    2016-01-01

    Understanding the habitat use patterns of migratory fish, such as Atlantic salmon (Salmo salar L.), and the natural and anthropogenic impacts on them, is aided by the ability to identify individuals to their stock of origin. Presented here are the results of an analysis of informative single nucleotide polymorphic (SNP) markers for detecting genetic structuring in Atlantic salmon in Scotland and NE England and their ability to allow accurate genetic stock identification. 3,787 fish from 147 sites covering 27 rivers were screened at 5,568 SNP markers. In order to identify a cost-effective subset of SNPs, they were ranked according to their ability to differentiate between fish from different rivers. A panel of 288 SNPs was used to examine both individual assignments and mixed stock fisheries and eighteen assignment units were defined. The results improved greatly on previously available methods and, for the first time, fish caught in the marine environment can be confidently assigned to geographically coherent units within Scotland and NE England, including individual rivers. As such, this SNP panel has the potential to aid understanding of the various influences acting upon Atlantic salmon on their marine migrations, be they natural environmental variations and/or anthropogenic impacts, such as mixed stock fisheries and interactions with marine power generation installations.

  17. Univariate and multiple linear regression analyses for 23 single nucleotide polymorphisms in 14 genes predisposing to chronic glomerular diseases and IgA nephropathy in Han Chinese.

    Science.gov (United States)

    Wang, Hui; Sui, Weiguo; Xue, Wen; Wu, Junyong; Chen, Jiejing; Dai, Yong

    2014-09-01

    Immunoglobulin A nephropathy (IgAN) is a complex trait regulated by the interaction among multiple physiologic regulatory systems and probably involving numerous genes, which leads to inconsistent findings in genetic studies. One possibility of failure to replicate some single-locus results is that the underlying genetics of IgAN nephropathy is based on multiple genes with minor effects. To learn the association between 23 single nucleotide polymorphisms (SNPs) in 14 genes predisposing to chronic glomerular diseases and IgAN in Han males, the 23 SNPs genotypes of 21 Han males were detected and analyzed with a BaiO gene chip, and their associations were analyzed with univariate analysis and multiple linear regression analysis. Analysis showed that CTLA4 rs231726 and CR2 rs1048971 revealed a significant association with IgAN. These findings support the multi-gene nature of the etiology of IgAN and propose a potential gene-gene interactive model for future studies.

  18. Genetic diversity in domesticated soybean (Glycine max) and its wild progenitor (Glycine soja) for simple sequence repeat and single-nucleotide polymorphism loci.

    Science.gov (United States)

    Li, Ying-Hui; Li, Wei; Zhang, Chen; Yang, Liang; Chang, Ru-Zhen; Gaut, Brandon S; Qiu, Li-Juan

    2010-10-01

    • The study of genetic diversity between a crop and its wild relatives may yield fundamental insights into evolutionary history and the process of domestication. • In this study, we genotyped a sample of 303 accessions of domesticated soybean (Glycine max) and its wild progenitor Glycine soja with 99 microsatellite markers and 554 single-nucleotide polymorphism (SNP) markers. • The simple sequence repeat (SSR) loci averaged 21.5 alleles per locus and overall Nei's gene diversity of 0.77. The SNPs had substantially lower genetic diversity (0.35) than SSRs. A SSR analyses indicated that G. soja exhibited higher diversity than G. max, but SNPs provided a slightly different snapshot of diversity between the two taxa. For both marker types, the primary division of genetic diversity was between the wild and domesticated accessions. Within taxa, G. max consisted of four geographic regions in China. G. soja formed six subgroups. Genealogical analyses indicated that cultivated soybean tended to form a monophyletic clade with respect to G. soja. • G. soja and G. max represent distinct germplasm pools. Limited evidence of admixture was discovered between these two species. Overall, our analyses are consistent with the origin of G. max from regions along the Yellow River of China.

  19. Association study between single nucleotide polymorphisms in porcine genes and pork quality traits for fresh consumption and processing into Italian dry-cured ham.

    Science.gov (United States)

    Davoli, Roberta; Schivazappa, Cristina; Zambonelli, Paolo; Braglia, Silvia; Rossi, Andrea; Virgili, Roberta

    2017-04-01

    Single nucleotide polymorphisms (SNPs) of six genes (TTN, PRKAG3, CAST, CTSB, CTSF, and MYPN), known for associations with carcass and meat quality traits, post mortem proteolysis, were screened in a commercial crossed population of 368 heavy pigs (Large White x Landrace)×Duroc, reared according to the rules of Italian Protected Designation of Origin (PDO) dry-cured ham. Carcass, longissimus thoracis et lumborum muscle (LTL), and green ham traits were obtained after slaughtering, main weight losses of dry-cured hams were collected during processing. The results showed the impact of CAST variants on carcass weight, of CTSF on LTL tenderness, ham weight and fatness, of PRKAG3 and TTN on ultimate pH, hamweight. This study, while confirming significant associations between SNPs of genes and qualitative traits of carcass, longissimus and ham, supports CTSF as candidate gene suitable for fresh consumption purpose (tenderness of longissimus at 24h post mortem), and for dry-cured ham processing (higher thickness of ham subcutaneous fat). Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A single nucleotide polymorphism in the human serotonin transporter introduces a new site for N-linked glycosylation

    DEFF Research Database (Denmark)

    Rasmussen, Trine Nygaard; Plenge, Per; Bay, Tina

    2009-01-01

    The human serotonin transporter (hSERT) is responsible for reuptake of serotonin (5-HT) from the synaptic cleft and is target for antidepressant medicine. Differential hSERT activity caused by genetic polymorphisms is believed to affect the risk of developing depression and, moreover, to affect...... the response to antidepressant therapy. The hSERT contains in the second extracellular loop (EL2) two sites for N-linked glycosylation that are critical for functional transporter expression. Here we examine a non-synonymous single nucleotide polymorphism (SNP) in EL2 that gives rise to a potential third...... as compared to hSERT in both cell systems. The increase in expression was accompanied by corresponding significant increases in the number of [(3)H]citalopram binding sites and in the V(max) for [(3)H]5-HT uptake. Characterization of mutants carrying all possible combinations of glycosylation sites...

  1. Genetic diversity of Argentina tomato varieties revealed by morphological traits, simple sequence repeat, and single nucleotide polymorphism markers

    International Nuclear Information System (INIS)

    Xiaorong, H.U.; Yang, W.

    2012-01-01

    Twenty-six morphological traits as well as 47 single nucleotide polymorphism and simple sequence repeat markers were used to investigate genetic variation in 67 tomato (Solanum lycopersicum L.) varieties collected from Argentina between 1932 and 1974. Approximately 65.0% of the morphological traits and 55.3% of the molecular markers showed polymorphisms in the 67 varieties. Average taxonomic distance between any two varieties ranged from 0.6643 to 1.1776, while Nei's genetic distance varied from 0 to 0.2022. Cluster analysis indicated that 67 varieties could be grouped into three clusters at both morphological and molecular levels. The varieties collected before 1960 had larger genetic variation than those collected after 1960. (author)

  2. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    Science.gov (United States)

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  3. Single Nucleotide Polymorphisms in IL17A and IL6 Are Associated with Decreased Risk for Pulmonary Tuberculosis in Southern Brazilian Population.

    Directory of Open Access Journals (Sweden)

    Mariana Milano

    Full Text Available In Mycobacterium tuberculosis (MTB infection, the complex interaction of host immune system and the mycobacteria is associated with levels of cytokines production that play a major role in determining the outcome of the disease. Several single-nucleotide polymorphisms (SNPs in cytokine genes have been associated with tuberculosis (TB outcome. The aim of this study was to evaluate the association between previously reported SNPs IL2-330 T>G (rs2069762; IL4-590 C>T (rs2243250; IL6-174 G>C (rs1800795; IL10-592 A>C (rs1800872; IL10-1082 G>A (rs1800896; IL17A -692 C>T (rs8193036; IL17A -197 G>A (rs2275913; TNF -238 G>A (rs361525; TNF -308 G>A (rs1800629 and IFNG +874 T>A (rs2430561 and pulmonary TB (PTB susceptibility. We conducted a case-control study in individuals from Southern Brazil who were recruited between February 2012 and October 2013 in a high incidence TB city. We performed a multiplex genotyping assay in 191 patients with PTB and 175 healthy subjects. Our results suggest a decreased risk for PTB development associated with the IL17A -197A allele (OR = 0.29; p = 0.04, AA genotype (OR = 0.12; p = 0.04 and A carrier (AG/AA (OR = 0.29; p = 0.004 and IL6 -174C carrier (CC/CG (OR = 0.46; p = 0.04. We could not properly analyze IL17A -692 C>T (rs8193036 and IFNG +874T>A due to genotypic inconsistencies and found no evidence of association for the IL2, IL4, IL10 and TNF polymorphisms and PTB. In conclusion, our results show a protective effect of IL17 and IL6 polymorphisms on PTB outcome in Southern Brazilian population.

  4. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A

    2009-01-01

    , CDK4, RB1, CDKN2D, and CCNE1) and one gene region (CDKN2A-CDKN2B). Because of the semi-overlapping nature of the 123 assayed tagging SNPs, we performed multiple imputation based on fastPHASE using data from White non-Hispanic study participants and participants in the international HapMap Consortium...... and National Institute of Environmental Health Sciences SNPs Program. Logistic regression assuming a log-additive model was done on combined and imputed data. We observed strengthened signals in imputation-based analyses at several SNPs, particularly CDKN2A-CDKN2B rs3731239; CCND1 rs602652, rs3212879, rs649392...

  5. Response to treatment in Brazilian patients with chronic hepatitis C is associated with a single-nucleotide polymorphism near the interleukin-28B gene

    Directory of Open Access Journals (Sweden)

    Tarciana Grandi

    2013-02-01

    Full Text Available A single-nucleotide polymorphism (SNP upstream of interleukin (IL28B was recently identified as an important predictor of the outcome of chronic hepatitis C patients treated with pegylated interferon plus ribavirin (PEG-IFN/RBV. The aim of this study was to investigate the association between the IL28B gene polymorphism (rs12979860 and virological response in chronic hepatitis C patients. Brazilian patients (n = 263 who were infected with hepatitis C virus (HCV genotype 1 and were receiving PEG-IFN/RBV were genotyped. Early virological response (EVR (12 weeks, end-of-treatment response (EOTR (48 weeks, sustained virological response (SVR (72 weeks and relapse were evaluated using conventional and quantitative polymerase chain reaction (PCR assays. The frequency of the C allele in the population was 39%. Overall, 43% of patients experienced SVR. The IL28B CC genotype was significantly associated with higher treatment response rates and a lower relapse rate compared to the other genotypes [84% vs. 58% EVR, 92% vs. 63% EOTR, 76% vs. 38% SVR and 17% vs. 40% relapse rate in CC vs. other genotypes (CT and TT, respectively]. Thus, the IL28B genotype appears to be a strong predictor of SVR following PEG-IFN/RBV therapy in treatment-naïve Brazilian patients infected with HCV genotype 1. This study, together with similar research examining other SNPs, should help to define adequate protocols for the treatment of patients infected with HCV genotype 1, especially those with a poor prognosis.

  6. Association between single nucleotide polymorphisms of sterol regulatory element binding protein-2 gene and risk of knee osteoarthritis in a Chinese Han population.

    Science.gov (United States)

    Qiu, Xiao-Ming; Jin, Cheng-Tao; Wang, Wei

    2014-04-01

    To investigate associations between single nucleotide polymorphisms (SNPs) rs2228314 and rs2267443 in the sterol regulatory element binding protein-2 gene (SREBP-2) and knee osteoarthritis (OA) susceptibility in a Chinese Han population. SREBP-2 rs2228314 and rs2267443 polymorphisms were genotyped in patients with knee OA and age- and sex-matched OA-free controls from a Chinese Han population. A total of 402 patients with knee OA and 410 controls were enrolled in the study. GC and CC genotypes of rs2228314, and variant C, were associated with a significantly increased risk of knee OA. On stratification analysis, the association between the risk of OA and rs2228314 GC heterozygotes compared with GG homozygotes was stronger in females and those aged >65 years. In contrast, the GA and AA genotypes of rs2267443 were not significantly associated with the risk of knee OA, even after further stratification analysis according to age or sex. SREBP-2 rs2228314 G to C change and variant C genotype may contribute to knee OA risk in a Chinese Han population.

  7. ESR1 single nucleotide polymorphism rs1062577 (c.*3804T>A) alters the susceptibility of breast cancer risk in Iranian population.

    Science.gov (United States)

    Dehghan, Zahra; Sadeghi, Samira; Tabatabaeian, Hossein; Ghaedi, Kamran; Azadeh, Mansoureh; Fazilati, Mohammad; Bagheri, Fatemeh

    2017-05-05

    Albeit single nucleotide polymorphisms related to ESR1 gene have been studied, only a number of them have been reported to be associated with breast cancer risk. rs1062577 is one of the most recent microRNA-related ESR1 SNPs; however, no study has been conducted to investigate the significance this polymorphism in Iranian population. In this study, we aimed to investigate the frequency and also the association between rs1062577 and breast cancer. rs1062577 position was genotyped by Tetra-primer ARMS-PCR in totally 182 blood specimens obtained from breast cancer patients (n=86), and healthy blood donors (n=96). The distribution of different genotypes was statistically analyzed in terms of the potential association between rs1062577 different alleles, breast cancer risk and clinicopathological criteria of breast cancer patients. The statistical analyses confidently indicated that rs1062577 A allele is associated with the increased breast cancer risk in both univariate and multivariate regression models (Odds Ratio=8.403 and 32.602 respectively). rs1062577 T allele was statistically associated with stage I of breast cancer patients (p-value=0.025). In silico studies implied that rs1062577 A allele can alter the binding capacity of ESR1 mRNA and miRNAs via either breakage or formation of hydrogen bonds. rs1062577 A allele is significantly and dramatically associated with the elevated risk and greater stages of breast cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    /enzyme function or stability is useful for altering its properties for a wide variety of engineering studies. Since measuring the effects of amino acid mutations experimentally is a laborious process, a variety of computational methods have been discussed here that aid to extract direct genotype to phenotype...

  9. ERCC1 and XRCC1 but not XPA single nucleotide polymorphisms correlate with response to chemotherapy in endometrial carcinoma

    Directory of Open Access Journals (Sweden)

    Chen L

    2016-11-01

    Full Text Available Liang Chen,1 Mei-Mei Liu,1 Hui Liu,1 Dan Lu,2 Xiao-Dan Zhao,3 Xue-Jing Yang4 1Department of Gynecology and Obstetrics, 2Department of Oncology, 3Department of Clinical Laboratory, The 2nd Affiliated Hospital, Harbin Medical University, 4Nursing Department, Harbin Chest Hospital, Harbin, People’s Republic of China Abstract: Our study aimed to investigate the correlation between single nucleotide polymorphisms of ERCC1/XRCC1/XPA genes and postoperative chemotherapy efficacy and prognosis of endometrial carcinoma. Our study included 108 patients with endometrial carcinoma and 100 healthy participants. ERCC1 rs11615/XRCC1 rs25487/XPA rs1800975 gene polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism. Then the chemotherapy efficacy and toxic effects of the patients were assessed. The genotype and allele frequency of ERCC1 rs11615/XRCC1 rs25487 in the case group were significantly different from that in the control group (all P<0.05. The patients with AA + GA in ERCC1 rs11615 had an increased risk of endometrial carcinoma than those with GG, and the risk of endometrial carcinoma for patients with AA + GA was also higher in comparison with patients with GG genotype in XRCC1 rs25487 (all P<0.05. GG on both ERCC1 rs11615/XRCC1 rs25487 had a higher effective rate of chemotherapy than GA + AA (all P<0.05. ERCC1 rs11615/XRCC1 rs25487 gene polymorphisms were linked with toxic effects in liver, kidney, and nervous system. ERCC1 rs11615/XRCC1 rs25487, muscular invasion, and tumor stage were independent risk factors for the prognosis of endometrial carcinoma (all P<0.05. However, no significant associations were observed between XPA rs1800975 polymorphism and chemotherapy efficacy and prognosis of endometrial carcinoma (all P>0.05. These results indicated that ERCC1 and XRCC1 but not XPA polymorphisms correlate with response to chemotherapy in endometrial carcinoma. Keywords: ERCC1, XRCC1, XPA, single nucleotide

  10. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

    Science.gov (United States)

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

    2015-07-01

    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal

  11. Microsatellite and single nucleotide polymorphisms in the β-globin locus control region-hypersensitive Site 2: SPECIFICITY of Tunisian βs chromosomes.

    Science.gov (United States)

    Ben Mustapha, Maha; Moumni, Imen; Zorai, Amine; Douzi, Kaïs; Ghanem, Abderraouf; Abbes, Salem

    2012-01-01

    The diversity of sickle cell disease severity is attributed to several cis acting factors, among them the single nucleotide polymorphisms (SNPs) and (AT) rich region in the β-locus control region (β-LCR). This contains five DNase I hypersensitive sites (HS) located 6 to 22 kb upstream to the ϵ gene. The most important of these is the HS2 (5' β-LCR-HS2), characterized by the presence of three different SNPs and a microsatellite region known to be in association with β(S) chromosomes in various populations. The aim of this study was to present the molecular investigation of the 5' β-LCR-HS2 site in normal and sickle cell disease individuals in order to determine if there is any correlation or specificity between these molecular markers, the β(S) Tunisian chromosomes and phenotypical expression of sickle cell disease. One hundred and twenty-four chromosomes from Tunisian individuals (49 β(S) carriers and 13 normal individuals) were screened by polymerase chain reaction (PCR) and sequencing for the polymorphic short tandem microsatellite repeats (AT)(X)N(12)(AT)(Y) and the three SNPs (rs7119428, rs9736333 and rs60240093) of the 5' β-LCR-HS2. Twelve configurations of the microsatellite motif were found with an ancestral configuration elaborated by ClustalW software. Normal and mutated alleles were observed at the homozygous and heterozygous states for the three SNPs. Correlation between microsatellites and SNPs suggests that mutant SNP alleles were mainly associated, in the homozygous sickle cell disease phenotype, with the (AT)(8)N(12)GT(AT)(7) configuration, whereas, normal SNP alleles were associated with the (AT)(X)N(12)(AT)(11) configurations in normal β(A) chromosomes. The correlation of these various configurations with Hb F expression was also investigated. The principal component analysis (PCA) showed the correlation between the homozygous sickle cell disease phenotype, mutated SNP alleles and the Benin microsatellite configuration (AT)(8)N(12)GT

  12. Genetic study of two single nucleotide polymorphisms within corresponding microRNAs and susceptibility to tuberculosis in a Chinese Tibetan and Han population.

    Science.gov (United States)

    Li, Dongdong; Li, Dingdong; Wang, Tingting; Song, Xingbo; Qucuo, MeiLang; Yang, Bin; Zhang, Junlong; Wang, Jun; Ying, Binwu; Tao, Chuanmin; Wang, Lanlan

    2011-07-01

    MicroRNAs (miRNA) are thought to play important roles in the pathogenesis of diseases. Single nucleotide polymorphisms (SNPs) within miRNAs can change their characteristics via altering their target selection and/or expression, resulting in functional and/or phenotypic changes. We decided to investigate the genetic association with pulmonary tuberculosis with 2 nucleotide variations within corresponding microRNAs regulating the Toll-like receptor (TLR)-mediating signal pathway. MiRNAs potentially regulating the TLR-mediating signal pathway were predicted via bioinformatics. Finally, 2 SNPs, rs2910164 G>C and rs3746444 T>C within miR-146a and miR-499, were selected as candidates in accordance with some criteria. SNPs were genotyped by polymerase chain reaction-restriction fragment length polymorphism and validated by sequencing to demonstrate their association with susceptibility to pulmonary tuberculosis (PTB) in 337 PTB cases and 738 healthy controls, including 318 Tibetan and 757 Han individuals. Bioinformatics databases were searched to support the association between miRNAs and PTB. There was no association between rs3746444 and PTB risk (p = 0.118) in the Han population, but subjects carrying the C allele exhibited decreased PTB risk (odds ratio [OR] = 0.403 [95% confidence interval (95% CI) 0.278-0.583]). However, there was an association between rs3746444 and PTB in the Tibetan population, and individuals carrying the C allele exhibited increased PTB risk (OR = 1.870 [95% CI 1.218-2.871]). A polymorphism (rs2910164 G>C) indicated an association with PTB risk in both Tibetan (p = 0.031) and Han (p = 0.000) populations. However, the role of the G allele of rs2910164, like the C allele in rs3746444, differed in the Tibetan (OR = 1.509, p tuberculosis with SNPs within the corresponding miRNAs potentially regulates the TLR signal pathway. It is interesting that both the G allele (rs2910164) and the C allele (rs3746444) play different roles in 2 populations

  13. A study of single nucleotide polymorphism in the ystB gene of Yersinia enterocolitica strains isolated from various wild animal species.

    Science.gov (United States)

    Bancerz-Kisiel, Agata; Szczerba-Turek, Anna; Platt-Samoraj, Aleksandra; Michalczyk, Maria; Szweda, Wojciech

    2017-03-01

    Y. enterocolitica is the causative agent of yersiniosis. The objective of the article was a study of single nucleotide polymorphism in the ystB gene of Y. enterocolitica strains isolated from various wild animal species. High-resolution melting (HRM) analysis was applied to identify single nucleotide polymorphism (SNP) of ystB gene fragments of 88 Y. enterocolitica biotype 1A strains isolated from wild boar, roe deer, red deer and wild ducks. HRM analysis revealed 14 different melting profiles - 4 of them were defined as regular genotypes (G1, G2, G3, G4), whereas 10 as variations. 24 of the examined Y. enterocolitica strains were classified as G1, 18 strains as a G2, 21 strains as a G3, and 15 strains as a G4. Nucleotide sequences classified as G1 revealed 100% similarity with the Y. enterocolitica D88145.1 sequence (NCBI). Analysis of G2 revealed one point mutation - transition T111A. One mutation was also found in G3, but SNP was placed in a different gene region - transition G193A. Two SNPs - transitions G92C and T111A - were identified in G4. Direct sequencing of 10 variations revealed 5 new variants of the ystB nucleotide sequence: V1 - transition G129A (3 strains); V2 - transitions T111A and G193A (2 strains); V3 - transitions C118T and G193A (1 strain); V4 - transitions C141A and G193A (2 strains); and V5 characterized by 19 SNPs: G83A, T93A, A109G, G114T, C116T, A123G, T134C, T142G, T144C, A150C, G162A, T165G, T170G, T174A, T177G, G178A, A179G, A184G and G193A (2 strains). The predominant genotype in isolates from wild ducks was G1; in red deer G2; in wild boar G3; in roe deer G1 and G4. The proposed HRM method could be used to analyze Y. enterocolitica biotype 1A strains isolated from different sources, including humans.

  14. [Clinical implementation of non-invasive prenatal study for detecting aneuploidies by fetal DNA based on single nucleotide polymorphisms: two years in Mexico].

    Science.gov (United States)

    Sánchez-Usabiaga, Rafael A; Aguinaga-Ríos, Mónica; Batista-Espinoza, Anaid; Hurtado-Amador, Ricardo; Romero-Tovar, Sergio

    2015-04-01

    Recent data have shown that non invasive prenatal test (NIPT) for the detection of fetal aneuploidies (chromosomes 13, 18, 21, X, Y, and triploidy) by cell free fetal DNA in maternal blood (cfDNA) is a clinical reality, with detection rates > 99% and false positive rates of 0.1%. Results that exceed the first trimester screening. To describe our experience of 2 years integrating NIPT by cfADN in its variant of single nucleotide polymorphism (SNPs) as a screening method for the detection of common aneuploidies, since nine weeks of gestation. Observational prospective study from March 2013 to February 2015. Women with a singleton pregnancy were offered conventional prenatal screening fetal aneuploidy and or new alternative NIPT-SNPs. 270 women were included,the mean maternal age was 35.3 years with a mean gestational age of 11.85 weeks. The result was obtained in 98.5%, with an average report time of 7.5 working days. Blood collection was repeated in fifteen patients, obtaining the result in eleven. The NIPT tested positive for ten cases, 8 for trisomy 21, one for trisomy 18 and one trisomy 13. We describe our first two years of integrating NIPT-SNPs to obstetric private practice, that is an alternative screening with the potential to be incorporated into theexisting algorithms in prenatal care, from the ninth week of gestation. We expect this information will motivate a debate on the issue of prenatal screening and get to improve obstetric care and genetic counseling in Mexico.

  15. Association of the Single Nucleotide Polymorphisms in microRNAs 130b, 200b, and 495 with Ischemic Stroke Susceptibility and Post-Stroke Mortality.

    Directory of Open Access Journals (Sweden)

    Jinkwon Kim

    Full Text Available The microRNA (miRNA is a small non-coding RNA molecule that modulates gene expression at the posttranscriptional level. Platelets have a crucial role in both hemostasis and thrombosis, a condition that can occlude a cerebral artery and cause ischemic stroke. miR-130b, miR-200b, and miR-495 are potential genetic modulators involving platelet production and activation. We hypothesized that single nucleotide polymorphisms (SNPs in these miRNAs might potentially contribute to the susceptibility to ischemic stroke and post-stroke mortality. This study included 523 ischemic stroke patients and 400 control subjects. We investigated the association of three miRNA SNPs (miR-130bT>C, miR-200bT>C, and miR-495A>C with ischemic stroke prevalence and post-stroke mortality. In the multivariate logistic regression, there was no statistically significant difference in the distribution of miR-130bT>C, miR-200bT>C, or miR-495A>C between the ischemic stroke and control groups. In the subgroup analysis based on ischemic stroke subtype, the miR-200b CC genotype was less frequently found in the large-artery atherosclerosis stroke subtype compared with controls (TT+CT vs CC; adjusted odds ratio for CC, 0.506; 95% confidence interval, 0.265-0.965. During a mean follow-up period of 4.80 ± 2.11 years after stroke onset, there were 106 all-cause deaths among the 523 stroke patients. Multivariate Cox regression analysis did not find a significant association between post-stroke mortality and three miRNA SNPs. Our findings suggest that the functional SNP of miR-200b might be responsible for the susceptibility to large-artery atherosclerotic stroke.

  16. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    Science.gov (United States)

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  17. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  18. Single Nucleotide Polymorphism in the Coding Region of Bovine Chemerin Gene and Their Associations with Carcass Traits in Japanese Black Cattle

    Directory of Open Access Journals (Sweden)

    Eri Yamauchi

    2015-08-01

    Full Text Available Chemerin, highly expressed in adipose and liver tissues, regulates glucose and lipid metabolism and immunity in these tissues in ruminants and mice. Our previous reports showed that chemerin is involved in adipogenesis and lipid metabolism in adipose tissue as an adipokine. The aim of the present study was to identify single nucleotide polymorphisms (SNPs in the coding region of the chemerin gene and to analyze their effects on carcass traits and intramuscular fatty acid compositions in Japanese Black cattle. The SNPs in the bovine chemerin gene were detected in 232 Japanese Black steers (n = 161 and heifers (n = 71 using DNA sequencing. The results revealed five novel silent mutations: NM_001046020: c.12A>G (4aa, c.165GT (92aa, c.321 A>G (107aa, and c.396C>T (132aa. There was no association between 4 of the SNPs (c.12A>G [4aa], c.165GG [107aa], and c.396C>T and carcass traits or intramuscular fatty acid compositions. Regarding the remaining SNP, c.276C>T, we found that cattle with genotype CC had a higher beef marbling score than that of cattle with genotype CT, whereas cattle with genotype CT had a higher body condition score (pT SNP is small. It is suggested that the c.276C>T SNP of the chemerin gene has potential in cattle breeding using modern methods, such as marker assisted selection. So, further functional and physiological research elucidating the impact of the chemerin gene on bovine lipid metabolism including fatty acid synthesis will help in understanding these results.

  19. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  20. Association of single nucleotide polymorphisms of IL23R and IL17 with ulcerative colitis risk in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Pengli Yu

    Full Text Available BACKGROUND: Previous studies implicated that IL23R and IL17 genes play an important role in autoimmune inflammation. Genome-wide association studies have also identified multiple single nucleotide polymorphisms (SNPs in the IL23R gene region associated with inflammatory bowel diseases. This study examined the association of IL23R and IL17A gene SNPs with ulcerative colitis susceptibility in a population in China. METHODOLOGY: A total of 270 ulcerative colitis and 268 healthy controls were recruited for the analyses of 23 SNPs in the IL23R and IL17A regions. Genomic DNA was extracted and analysis of these 23 SNPs using ligase detection reaction allelic (LDR technology. Genotype and allele associations were calculated using SPSS 13.0 software package. PRINCIPAL FINDINGS: Compared to the healthy controls, the variant alleles IL23R rs7530511, and rs11805303 showed a statistically significant difference for ulcerative colitis susceptibility (0.7% vs 3.3%, P = 0.002; 60.4% vs 53.2%, P = 0.0017, respectively. The linkage disequilibrium (LD patterns of these SNPs were measured and three LD blocks from the SNPs of IL23R and one block from those of IL17A were identified. A novel association with ulcerative colitis susceptibility occurred in haplotypes of IL23R (Block1 H3 P = 0.02; Block2 H2 P = 0.019; Block3 H4 P = 0.029 and IL17A (H4 P = 0.034. Pair-wise analyses showed an interaction between the risk haplotypes in IL23R and IL17A (P = 0.014. CONCLUSIONS: Our study demonstrated that rs7530511, and rs11805303 of IL23R were significantly associated with ulcerative colitis susceptibility in the Chinese population. The most noticeable finding was the linkage of IL23R and IL17A gene region to ulcerative colitis risk due to the gene-gene interaction.

  1. Maternal single nucleotide polymorphisms in the fatty acid desaturase 1 and 2 coding regions modify the impact of prenatal supplementation with DHA on birth weight.

    Science.gov (United States)

    Gonzalez-Casanova, Ines; Rzehak, Peter; Stein, Aryeh D; Garcia Feregrino, Raquel; Rivera Dommarco, Juan A; Barraza-Villarreal, Albino; Demmelmair, Hans; Romieu, Isabelle; Villalpando, Salvador; Martorell, Reynaldo; Koletzko, Berthold; Ramakrishnan, Usha

    2016-04-01

    Specific single nucleotide polymorphisms (SNPs) in the fatty acid desaturase (FADS) gene affect the activity and efficiency of enzymes that are responsible for the conversion of polyunsaturated fatty acids (PUFAs) into their long-chain active form. A high prevalence of SNPs that are associated with slow PUFA conversion has been described in Hispanic populations. We assessed the heterogeneity of the effect of prenatal supplementation with docosahexaenoic acid (DHA) on birth weight across selected FADS SNPs in a sample of Mexican women and their offspring. We obtained information on the maternal genotype from stored blood samples of 654 women who received supplementation with 400 mg DHA/d or a placebo from weeks 18 to 22 of gestation through delivery as part of a randomized controlled trial conducted in Cuernavaca, Mexico. We selected 4 tag SNPs (rs174455, rs174556, rs174602, and rs498793) in the FADS region for analysis. We used an ANOVA to test for the heterogeneity of the effect on birth weight across each of the 4 SNPs. The mean ± SD birth weight was 3210 ± 470 g, and the weight-for-age z score (WAZ) was -0.24 ± 1.00. There were no intention-to-treat differences in birth weights. We showed significant heterogeneity by SNP rs174602 (P= 0.02); offspring of carriers of alleles TT and TC in the intervention group were heavier than those in the placebo group (WAZ: -0.13 ± 0.14 and -0.20 ± 0.08 compared with -0.55 ± 0.15 and -0.39 ± 0.09, respectively); there were no significant differences in offspring of rs174602 CC homozygotes (WAZ: -0.26 ± 0.09 in the intervention group compared with -0.04 ± 0.09 in the placebo group). We showed no significant heterogeneity across the other 3 FADS SNPs. Differential responses to prenatal DHA supplementation on the basis of the genetic makeup of target populations could explain the mixed evidence of the impact of DHA supplementation on birth weight. This trial was registered at clinicaltrials.gov as NCT00646360. © 2016

  2. Inflammatory single nucleotide polymorphisms and the risk of atrial fibrillation: a case control study

    DEFF Research Database (Denmark)

    Henningsen, Kristoffer M; Olesen, Morten S; Ravn, Lasse S

    2011-01-01

    Systemic inflammation is associated with atrial fibrillation (AF) and inflammatory processes are involved in the pathophysiology of AF. We hypothesized that genetic polymorphisms, which determine the rate of inflammatory cytokines, are associated with increased risk of AF.......Systemic inflammation is associated with atrial fibrillation (AF) and inflammatory processes are involved in the pathophysiology of AF. We hypothesized that genetic polymorphisms, which determine the rate of inflammatory cytokines, are associated with increased risk of AF....

  3. The Clinical Utility of a Single-Nucleotide Polymorphism Microarray in Patients With Epilepsy at a Tertiary Medical Center.

    Science.gov (United States)

    Hrabik, Sarah A; Standridge, Shannon M; Greiner, Hansel M; Neilson, Derek E; Pilipenko, Valentina V; Zimmerman, Sarah L; Connor, Jessica A; Spaeth, Christine G

    2015-11-01

    Microarray testing has revolutionized clinical cytogenetics, as it provides a significantly higher resolution and greater clinical yield than karyotype analysis. This study assessed the clinical utility of single-nucleotide polymorphism microarray in patients with epilepsy. Study subjects were patients between the ages of birth to 23 years who were diagnosed with epilepsy and had a microarray performed at Cincinnati Children's Hospital Medical Center. Statistical analysis explored the association of microarray results and brain magnetic resonance imaging (MRI), seizure type, and structural malformations. Approximately 17.7% (26/147) of participants had an abnormal microarray as defined by laboratory guidelines. There were no differences in frequency of abnormal brain MRI or seizure type between the abnormal and normal microarray groups. There was a higher prevalence of musculoskeletal malformations (P microarrays. Clinicians should consider microarray analysis in individuals who have epilepsy, especially in combination with musculoskeletal malformation or cardiovascular malformation. © The Author(s) 2015.

  4. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Mohamed N. Saad

    2016-01-01

    Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.

  5. Association of Single Nucleotide Polymorphisms of PADI4 and HLA-DRB1 Alleles with Susceptibility to Rheumatoid Arthritis-Related Lung Diseases.

    Science.gov (United States)

    Song, Seung Taek; Kim, Song Soo; Kim, Ji Young; Lee, So Young; Kim, Kwangwoo; Kwon, In Sun; Kim, Ji Na; Park, Won Hong; Yoo, In Seol; Yoo, Su-Jin; Kim, Jin Hyun; Kang, Seong Wook; Shim, Seung-Cheol

    2016-10-01

    Lung diseases (LD) are common extra-articular manifestations in rheumatoid arthritis (RA). However, little is known about factors associated with susceptibility to rheumatoid arthritis-related lung diseases (RA-LD). The aim of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) of PADI4 and HLA-DRB1 alleles were associated with RA-LD. Blood samples and clinical data were collected from 116 consecutive RA patients who satisfied the 1987 American College of Rheumatology classification criteria. RA-LD was diagnosed using high-resolution computed tomography of the chest. All patients were genotyped for SNPs of PADI4 and HLA-DRB1 alleles and analyzed for full amino acid sequence of the HLA protein corresponding to a 4-digit HLA typing. Data were analyzed by independent t test (or Mann-Whitney test) for continuous variables, Chi-square test (or Fisher's exact test) and trend test for categorical variables, and logistic regression analysis. Ninety-four (81.0 %) RA patients had LD, of which eight (6.9 %) had interstitial lung disease (ILD) and 92 (79.3 %) had airway abnormalities in which 64 (55.2 %) showed bronchiectasis and 47 (40.5 %) revealed bronchial wall thickening. The recessive genotype of padi4_92 was susceptible to airway abnormalities (OR = 2.22, 95 % CI = 1.05-4.49, p = 0.034). Tryptophan at position 9 of HLA-DRB1 sequence was associated with the susceptibility to RA-ILD (OR = 22.89, 95 % CI = 1.20-432.56, p = 0.037). PADI4 polymorphisms and HLA-DRB1 alleles could attribute differently to the development of airway abnormalities and ILD, respectively, in RA.

  6. RET single nucleotide polymorphism in Indonesians with sporadic Hirschsprung’s disease

    Directory of Open Access Journals (Sweden)

    Saryono

    2010-08-01

    Full Text Available The tyrosine kinase receptor RET, which is the protein product of the RET gene, is involved in the development of the mammalian nervous system that causes Hirschsprung’s disease (HSCR. RETs are cell surface molecules that are expressed in cells derived from the neural crest. The purpose of this study was to investigate the polymorphism of the RET gene in HSCR in the Yogyakarta population. Genomic DNA was extracted from surgically removed bowel tissues of 54 unrelated HSCR patients. Exon 2 of the RET gene was amplified by polymerase chain reaction (PCR and analyzed by restriction fragment length polymorphism (RFLP. Molecular results were compared with clinical performance of Hirschsprung patients. RET polymorphism was detected in exon 2 in all of the 54 Indonesian HSCR patients. The allelic distribution of the c135GàA polymorphism in the RET exon 2 indicated that the A allele was more frequent in patients than in control individuals (chi-square test, p= 0.001. Thus the RET variant allele A is over-represented in patients affected with the HSCR phenotype. Polymorphism of exon 2 of the RET gene was found in sporadic Hirschsprung’s disease in the Yogyakarta population, which suggests that the RET gene plays important roles in the pathogenesis of HSCR.

  7. RET single nucleotide polymorphism in Indonesians with sporadic Hirschsprung’s disease

    Directory of Open Access Journals (Sweden)

    Saryono Saryono

    2016-02-01

    Full Text Available The tyrosine kinase receptor RET, which is the protein product of the RET gene, is involved in the development of the mammalian nervous system that causes Hirschsprung’s disease (HSCR. RETs are cell surface molecules that are expressed in cells derived from the neural crest. The purpose of this study was to investigate the polymorphism of the RET gene in HSCR in the Yogyakarta population. Genomic DNA was extracted from surgically removed bowel tissues of 54 unrelated HSCR patients. Exon 2 of the RET gene was amplified by polymerase chain reaction (PCR and analyzed by restriction fragment length polymorphism (RFLP. Molecular results were compared with clinical performance of Hirschsprung patients. RET polymorphism was detected in exon 2 in all of the 54 Indonesian HSCR patients. The allelic distribution of the c135GàA polymorphism in the RET exon 2 indicated that the A allele was more frequent in patients than in control individuals (chi-square test, p= 0.001. Thus the RET variant allele A is over-represented in patients affected with the HSCR phenotype. Polymorphism of exon 2 of the RET gene was found in sporadic Hirschsprung’s disease in the Yogyakarta population, which suggests that the RET gene plays important roles in the pathogenesis of HSCR.

  8. Association of single nucleotide polymorphisms in Wnt signaling pathway genes with breast cancer in Saudi patients.

    Directory of Open Access Journals (Sweden)

    Mohammad Saud Alanazi

    Full Text Available Breast cancer is a complex heterogeneous disease involving genetic and epigenetic alterations in genes encoding proteins that are components of various signaling pathways. Candidate gene approach have identified association of genetic variants in the Wnt signaling pathway genes and increased susceptibility to several diseases including breast cancer. Due to the rarity of somatic mutations in key genes of Wnt pathway, we investigated the association of genetic variants in these genes with predisposition to breast cancers. We performed a case-control study to identify risk variants by examining 15 SNPs located in 8 genes associated with Wnt signaling. Genotypic analysis of individual locus showed statistically significant association of five SNPs located in β-catenin, AXIN2, DKK3, SFRP3 and TCF7L2 with breast cancers. Increased risk was observed only with the SNP in β-catenin while the other four SNPs conferred protection against breast cancers. Majority of these associations persisted after stratification of the cases based on estrogen receptor status and age of on-set of breast cancer. The rs7775 SNP in exon 6 of SFRP3 gene that codes for either arginine or glycine exhibited very strong association with breast cancer, even after Bonferroni's correction. Apart from these five variants, rs3923086 in AXIN2 and rs3763511 in DKK4 that did not show any association in the overall population were significantly associated with early on-set and estrogen receptor negative breast cancers, respectively. This is the first study to utilize pathway based approach to identify association of risk variants in the Wnt signaling pathway genes with breast cancers. Confirmation of our findings in larger populations of different ethnicities would provide evidence for the role of Wnt pathway as well as screening markers for early detection of breast carcinomas.

  9. Study on the introgression of beef breeds in Canchim cattle using single nucleotide polymorphism markers.

    Directory of Open Access Journals (Sweden)

    Marcos Eli Buzanskas

    Full Text Available The aim of this study was to evaluate the level of introgression of breeds in the Canchim (CA: 62.5% Charolais-37.5% Zebu and MA genetic group (MA: 65.6% Charolais-34.4% Zebu cattle using genomic information on Charolais (CH, Nelore (NE, and Indubrasil (IB breeds. The number of animals used was 395 (CA and MA, 763 (NE, 338 (CH, and 37 (IB. The Bovine50SNP BeadChip from Illumina panel was used to estimate the levels of introgression of breeds considering the Maximum likelihood, Bayesian, and Single Regression method. After genotype quality control, 32,308 SNPs were considered in the analysis. Furthermore, three thresholds to prune out SNPs in linkage disequilibrium higher than 0.10, 0.05, and 0.01 were considered, resulting in 15,286, 7,652, and 1,582 SNPs, respectively. For k = 2, the proportion of taurine and indicine varied from the expected proportion based on pedigree for all methods studied. For k = 3, the Regression method was able to differentiate the animals in three main clusters assigned to each purebred breed, showing more reasonable according to its biological viewpoint. Analyzing the data considering k = 2 seems to be more appropriate for Canchim-MA animals due to its biological interpretation. The usage of 32,308 SNPs in the analyses resulted in similar findings between the estimated and expected breed proportions. Using the Regression approach, a contribution of Indubrasil was observed in Canchim-MA when k = 3 was considered. Genetic parameter estimation could account for this breed composition information as a source of variation in order to improve the accuracy of genetic models. Our findings may help assemble appropriate reference populations for genomic prediction for Canchim-MA in order to improve prediction accuracy. Using the information on the level of introgression in each individual could also be useful in breeding or crossing design to improve individual heterosis in crossbred cattle.

  10. Identifying the similarities and differences between single nucleotide polymorphism array (SNPa analysis and karyotyping in acute myeloid leukemia and myelodysplastic syndromes

    Directory of Open Access Journals (Sweden)

    Thiago Rodrigo de Noronha

    2015-02-01

    Full Text Available Objective: To standardize the single nucleotide polymorphism array (SNPa method in acute myeloid leukemia/myelodysplastic syndromes, and to identify the similarities and differ- ences between the results of this method and karyotyping. Methods: Twenty-two patients diagnosed with acute myeloid leukemia and three with myelodysplastic syndromes were studied. The G-banding karyotyping and single nucleotide polymorphism array analysis (CytoScan(r HD were performed using cells from bone marrow, DNA extracted from mononuclear cells from bone marrow and buccal cells (BC. Results: The mean age of the patients studied was 54 years old, and the median age was 55 years (range: 28-93. Twelve (48% were male and 13 (52% female. Ten patients showed abnormal karyotypes (40.0%, 11 normal (44.0% and four had no mitosis (16.0%. Regarding the results of bone marrow single nucleotide polymorphism array analysis: 17 were abnor- mal (68.0% and eight were normal (32.0%. Comparing the two methods, karyotyping identified a total of 17 alterations (8 deletions/losses, 7 trissomies/gains, and 2 translocations and single nucleotide polymorphism array analysis identified a total of 42 alterations (17 losses, 16 gains and 9 copy-neutral loss of heterozygosity. Conclusion: It is possible to standardize single nucleotide polymorphism array analysis in acute myeloid leukemia/myelodysplastic syndromes and compare the results with the abnormalities detected by karyotyping. Single nucleotide polymorphism array analysis increased the detection rate of abnormalities compared to karyotyping and also identified a new set of abnormalities that deserve further investigation in future studies.

  11. [Association of the tagging single nucleotide polymorphisms in transforming growth factor beta-1 gene with hypertension in the Han nationality population in Xinjiang].

    Science.gov (United States)

    Yang, Jian-feng; Shi, Xiao-peng; Zhao, Dan; Deng, Feng-mei; Zhong, Hua; Wang, Gang; Wang, Zhen-huan; Chen, Xiong-ying; He, Fang

    2010-06-01

    Essential hypertension (EH) was a complex disease resulted from the interaction of cumulative effect of multiple genetic and environment factors. The relationship between the genetic polymorphisms in the transforming growth factor-beta1 (TGF-beta1), the blood levels and EH have been investigated, but the conclusions were different. Therefore, we investigate the relationship between the tagging single nucleotide polymorphisms (tSNPs) (rs1800469, rs2241716, rs11466345, rs2241715, rs4803455) in TGF-beta1 gene, blood levels and EH in the Han nationality population in Xinjiang, to clarity the pattern of linkage disequilibrium (LD) and the feature of the structure of haplotype. Based on the case-control study,we selected 732 (365 EH patients,367 controls) Han Chinese population from the Boertonggu countryside of Shawan region in the Xinjiang Uygur Autonomous Region of China by random cluster sampling. After questionnaire and physical examination, we collected blood samples, and the blood levels of TGF-beta1 were quantified using sandwich ELISA. The polymorphisms of TGF-beta1 gene in the study groups were detected with SNaPshot system. The case-control study in a large group was carried out separately for each of the tSNP and followed up by haplotypes analyses to determine the relation between tSNPs of TGF-beta1 gene and EH in the Han population. (1) The frequencies of alleles A, G of rs11466345 of TGF-beta1 gene in EH group and control group were as follows: 69.7%, 30.3%, 74.4%, 25.6%, respectively. It was demonstrated that the G allele of the rs11466345 polymorphism occurred at a significantly higher frequency in EH patients than in healthy controls (30.3% vs. 25.6%, P 0.05). (2)Except the site of rs11466345, the other tSNPs were in strong LD, and no statistical differences were observed in haplotypes distribution in the followup study between case-control groups (P > 0.05). (3) There were no difference of TGF-beta1 levels between the different genotypes and alleles in

  12. Single nucleotide polymorphisms in the HIF-1α gene and chemoradiotherapy of locally advanced rectal cancer

    DEFF Research Database (Denmark)

    Havelund, Birgitte Mayland; Spindler, Karen-Lise Garm; Ploen, John

    2012-01-01

    The aim of this study was to investigate the predictive impact of polymorphisms in the HIF-1α gene on the response to chemoradiotherapy (CRT) in rectal cancer. This study included two cohorts of patients with locally advanced rectal cancer receiving long-course CRT. The HIF-1α C1772T (rs11549465...... tumour response (P=0.03) in the validation cohort. In conclusion, these results suggest that HIF-1α polymorphisms have no value as predictors of response to neoadjuvant CRT in rectal cancer. The results of the HIF-1α c(*)191T>C in two cohorts differ and emphasise the importance of biomarker validation....

  13. Single nucleotide polymorphism rs6716901 in SLC25A12 gene is associated with Asperger syndrome.

    Science.gov (United States)

    Durdiaková, Jaroslava; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-03-31

    Autism Spectrum Conditions (ASC) are a group of developmental conditions which affect communication, social interactions and behaviour. Mitochondrial oxidative dysfunction has been suggested as a mechanism of autism based on the results of multiple genetic association and expression studies. SLC25A12 is a gene encoding a calcium-binding carrier protein that localizes to the mitochondria and is involved in the exchange of aspartate for glutamate in the inner membrane of the mitochondria regulating the cytosolic redox state. rs2056202 SNP in this gene has previously been associated with ASC. SNPs rs6716901 and rs3765166 analysed in this study have not been previously explored in association with AS. We genotyped three SNPs (rs2056202, rs3765166, and rs6716901) in SLC25A12 in n?=?117 individuals with Asperger syndrome (AS) and n?=?426 controls, all of Caucasian ancestry. rs6716901 showed significant association with AS (P?=?0.008) after correcting for multiple testing. We did not replicate the previously identified association between rs2056202 and AS in our sample. Similarly, rs3765166 (P?=?0.11) showed no significant association with AS. The present study, in combination with previous studies, provides evidence for SLC25A12 as involved in the etiology of AS. Further cellular and molecular studies are required to elucidate the role of this gene in ASC.

  14. Single nucleotide polymorphism (rs1035130C>T) in the interleukin ...

    African Journals Online (AJOL)

    The interleukin 18 receptor 1 (IL18R1) gene encodes a potent cytokine receptor that is critical for IL18 binding and subsequent signal transduction. This gene is a member of the IL1 receptor family that resides in a cluster of genes on human chromosome 2. Several polymorphisms have been shown to exist on this gene ...

  15. T-786C single-nucleotide polymorphism (SNP) of endothelial nitric ...

    African Journals Online (AJOL)

    The study was designed to investigate the frequency of T-786C polymorphism of the gene in patients suffering from coronary artery disease (CAD) in North West of Iran. One hundred and twenty (120) subjects including 60 patients with angiographically diagnosed CAD and 60 age and sex matched CAD-free subjects as ...

  16. Using PCR-RFLP Technology to Teach Single Nucleotide Polymorphism for Undergraduates

    Science.gov (United States)

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a…

  17. Study on Association between Single Nucleotide Polymorphisms in Murine Double Minute 2 and Susceptibility of Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Xia Wang

    2014-03-01

    Full Text Available Objective: To investigate the relationship between single nucleotide polymorphisms (SNP in murine double minute 2 (MDM2 and susceptibility and biological behavior of hepatocellularcarcinoma (HCC. Methods: MDM2 (rs2279744 site polymorphism in peripheral blood from 166 patients with HCC and 157 healthy controls were detected by SYBR GREEN PCR method and the relationship between MDM2 polymorphism and susceptibility and biological behavior of HCC was analyzed by comparing the differences of genotypes in two populations. Results: There was no statistical significance between two groups in terms of MDM2 allele distribution in research population (P = 0.753. The risk of HCC onset in individuals with GG+ TG genotype was 1.698 times of those with TT genotype in case group (95%CI = 1.027 -2.808. MDM2 SNP was associated with HBV infection and the degree of tumor differentiation (P< 0.05. The incidence of alleles in experimental group (T, 0.49; G, 0.51 was very different from that in control group (T, 0.59; G, 0.41 (P = 0.015. The incidence of GG genotype in patients with HCC (22.29% was significantly higher than those without HCC (13.38%. Compared with TT genotype, G allele or GG genotype had more correlation with HCC onset. Conclusion: Compared with TT genotype, MDM2 promoter SNP309 G allele or GG genotype is more associated with HCC onset in Chinese population.

  18. Significant association of methylenetetrahydrofolate reductase single nucleotide polymorphisms with prostate cancer susceptibility in taiwan.

    Science.gov (United States)

    Wu, Hsi-Chin; Chang, Chao-Hsiang; Tsai, Ru-Yin; Lin, Chih-Hsueh; Wang, Rou-Fen; Tsai, Chia-Wen; Chen, Kuen-Bao; Yao, Chun-Hsu; Chiu, Chang-Fang; Bau, Da-Tian; Lin, Cheng-Chieh

    2010-09-01

    Prostate cancer is the most common cause of cancer death in men and is a major health problem worldwide. Methylene tetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is also an important source of DNA methylation and DNA synthesis (nucleotide synthesis). To assess the association and interaction of genotypic polymorphisms in MTHFR and lifestyle factors with prostate cancer in Taiwan, we investigated two well-known polymorphic variants of MTHFR, C677T (rs1801133) and A1298C (rs1801131), analyzed the association of specific genotypes with prostate cancer susceptibility, and discussed their joint effects with individual habits on prostate cancer risk. In total, 218 patients with prostate cancer and 436 healthy controls recruited from the China Medical Hospital in central Taiwan were genotyped for these polymorphisms with prostate cancer susceptibility. We found the MTHFR C677T but not the A1298C genotype was differently distributed between the prostate cancer and control groups. The T allele of MTHFR C677T conferred a significantly (p=0.0011) decreased risk of prostate cancer. As for the A1298C polymorphism, there was no difference in distribution between the prostate cancer and control groups. Gene interactions with smoking were significant for MTHFR C677T polymorphism. The MTHFR C677T CT and TT genotypes in association with smoking conferred a decreased risk of 0.501 (95% confidence interval=0.344-0.731) for prostate cancer. Our results provide the first evidence that the C allele of MTHFR C677T may be associated with the development of prostate cancer and may be a novel useful marker for primary prevention and anticancer intervention.

  19. Genetic divergence among Psidium accessions based on single nucleotide polymorphisms developed for Eucalyptus.

    Science.gov (United States)

    Costa, S R; Santos, C A F

    2017-05-04

    The goal of this study was to analyze the genetic divergence among Psidium species accessions based on SNPs developed for Eucalyptus. Fifty-three Psidium accessions, including 47 P. guajava, were genotyped with EUCHIP60K. The dendrogram similarity ranged from 0.58 to 1.00, with a cophenetic value of 0.97. Five groups were identified at dendrogram cut point of 0.7: the first with 44 guava accessions, the second with 1 guava accession, the third with 3 P. guineense accessions, the forth with 2 guava accessions, and the fifth with 3 P. cattleianum accessions. The Bayesian analyses suggested seven subpopulations, with formation of two additional groups with guava accessions. Primers designed with Eucalyptus SNP sequences resulted in reliable Psidium amplicons on 6% polyacrylamide gels. In general, the SNP dendrogram agreed with biological genus structure, since different species were not grouped, indicating that transferability among Myrtaceae genus was possible and reliable.

  20. FADS single-nucleotide polymorphisms are associated with behavioral outcomes in children, and the effect varies between sexes and is dependent on PPAR genotype.

    Science.gov (United States)

    Jensen, Heidi A R; Harsløf, Laurine B S; Nielsen, Maria S; Christensen, Line B; Ritz, Christian; Michaelsen, Kim F; Vogel, Ulla; Lauritzen, Lotte

    2014-09-01

    Docosahexaenoic acid (DHA), supplied by the diet or endogenous biosynthesis from α-linolenic acid, accretes during the perinatal brain growth spurt. Results regarding a potential programming effect on cognitive function and behavior in humans are inconclusive. Here we aimed to investigate whether behavioral outcomes in childhood were associated with FADS tag-single-nucleotide polymorphisms (SNPs) previously found to have opposing effects on infant erythrocyte DHA. At 36 mo, we assessed psychomotor development with the third edition of the Ages & Stages Questionnaire (n = 256) and physical activity by accelerometry (n = 231) in children from the SKOT [Småbørns Kost Og Trivsel (Diet and Thriving in Young Children)] cohort. Blood samples were taken to determine erythrocyte DHA (n = 200), FADS tag-SNPs (n = 255), and PPARG-Pro12Ala (n = 255). All outcomes were analyzed in models, including all 3 SNPs, SNP-sex interactions, erythrocyte DHA at 36 mo, and covariates. As previously shown, the minor allele carriers of the FADS SNP rs1535 had increased erythrocyte DHA at 9 mo, whereas DHA decreased in minor allele carriers of rs174448 and rs174575 (effect size around 0.5 percentage points per allele). No overall effects were observed for any of the FADS SNPs on the outcomes reported here, but FADS SNP-sex interactions were found for a number of DHA-increasing FADS alleles on both communication and problem solving (P = 0.005 and 0.013). DHA-increasing FADS alleles resulted in reduced scores in girls and improved abilities in boys, with an effect size of ∼1 score-point/allele. No associations were found between current erythrocyte DHA and any of the behavioral outcomes. The P value for the triple interaction between DHA-increasing FADS alleles, PPARG, and sex for communication was 0.051, and subsequent analyses showed the FADS-sex interaction only in PPARG minor allele carriers (n = 70). Furthermore, FADS-PPARG interactions were seen for problem solving in boys and for

  1. Sex Steroid Hormone Single-Nucleotide Polymorphisms, Pesticide Use, and the Risk of Prostate Cancer: A Nested Case–Control Study within the Agricultural Health Study

    Science.gov (United States)

    Christensen, Carol H.; Barry, Kathryn Hughes; Andreotti, Gabriella; Alavanja, Michael C. R.; Cook, Michael B.; Kelly, Scott P.; Burdett, Laurie A.; Yeager, Meredith; Beane Freeman, Laura E.; Berndt, Sonja I.; Koutros, Stella

    2016-01-01

    Experimental and epidemiologic investigations suggest that certain pesticides may alter sex steroid hormone synthesis, metabolism or regulation, and the risk of hormone-related cancers. Here, we evaluated whether single-nucleotide polymorphisms (SNPs) involved in hormone homeostasis alter the effect of pesticide exposure on prostate cancer risk. We evaluated pesticide–SNP interactions between 39 pesticides and SNPs with respect to prostate cancer among 776 cases and 1,444 controls nested in the Agricultural Health Study cohort. In these interactions, we included candidate SNPs involved in hormone synthesis, metabolism or regulation (N = 1,100), as well as SNPs associated with circulating sex steroid concentrations, as identified by genome-wide association studies (N = 17). Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs). Multiplicative SNP–pesticide interactions were calculated using a likelihood ratio test. We translated p-values for interaction into q-values, which reflected the false discovery rate, to account for multiple comparisons. We observed a significant interaction, which was robust to multiple comparison testing, between the herbicide dicamba and rs8192166 in the testosterone metabolizing gene SRD5A1 (p-interaction = 4.0 × 10−5; q-value = 0.03), such that men with two copies of the wild-type genotype CC had a reduced risk of prostate cancer associated with low use of dicamba (OR = 0.62 95% CI: 0.41, 0.93) and high use of dicamba (OR = 0.44, 95% CI: 0.29, 0.68), compared to those who reported no use of dicamba; in contrast, there was no significant association between dicamba and prostate cancer among those carrying one or two copies of the variant T allele at rs8192166. In addition, interactions between two organophosphate insecticides and SNPs related to estradiol metabolism were observed to result in an increased risk of prostate cancer. While replication is

  2. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... the allele Arg showed a risk of 1.94 in developing PCOS. (P < 0.001), Bonferroni corrected value (P = 0.0001). But Gly972Arg polymorphism did not show a change in the phenotypes except for the left antral follicular count in control subjects (P = 0.036). Consistent with our results, a study from the Japanese ...

  3. Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

    Science.gov (United States)

    Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

    2017-07-01

    To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

  4. Single nucleotide polymorphism profiling across the methotrexate pathway in normal subjects and patients with rheumatoid arthritis.

    Science.gov (United States)

    Ranganathan, Prabha; Culverhouse, Robert; Marsh, Sharon; Ahluwalia, Ranjeet; Shannon, William D; Eisen, Seth; McLeod, Howard L

    2004-07-01

    Methotrexate (MTX) is a commonly used disease-modifying antirheumatic drug in rheumatoid arthritis (RA). Polymorphisms occur in several genes encoding key enzymes in the folic acid pathway, which is influenced by MTX, but have not been evaluated in patients with RA. The effect of race on allele frequency has also not been evaluated. In this study, the allele frequencies of polymorphisms in six key enzymes in the MTX-folate pathway in patients with RA and healthy controls, including several common racial groups were studied. European- and African-American patients with RA and European and African healthy controls were genotyped for 22 genetic loci in six genes in the MTX cellular pathway. Differences in genotype distributions between the different racial groups were evaluated using chi(2) tests. Allele frequencies were significantly different (p racial differences exist between the allele frequencies of several polymorphisms in enzymes in the MTX-folate pathway in patients with RA and healthy controls. Whether such differences contribute to a differential response to MTX in patients with RA deserves to be investigated.

  5. Resolving incomplete single nucleotide polymorphism tagging of HLA-DQ2.2 for coeliac disease genotyping using digital droplet PCR.

    Science.gov (United States)

    Hardy, M Y; Ontiveros, N; Varney, M D; Tye-Din, J A

    2018-04-01

    A hallmark of coeliac disease (CD) is the exceptionally strong genetic association with HLA-DQ2.5, DQ8, and DQ2.2. HLA typing provides information on CD risk important to both clinicians and researchers. A method that enables simple and fast detection of all CD risk genotypes is particularly desirable for the study of large populations. Single nucleotide polymorphism (SNP)-based HLA typing can detect the CD risk genotypes by detecting a combination of six SNPs but this approach can struggle to resolve HLA-DQ2.2, seen in 4% of European CD patients, because of the low resolution of one negatively predicting SNP. We sought to optimise SNP-based HLA typing by harnessing the additional resolution of digital droplet PCR to resolve HLA-DQ2.2. Here we test this two-step approach in an unselected sample of Mexican DNA and compare its accuracy to DNA typed using traditional exon detection. The addition of digital droplet PCR for samples requiring negative prediction of HLA-DQ2.2 enabled HLA-DQ2.2 to be accurately typed. This technique is a simple addition to a SNP-based typing strategy and enables comprehensive definition of all at-risk HLA genotypes in CD in a timely and cost-effective manner. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Single Nucleotide Polymorphisms in Taste Receptor Genes Are Associated with Snacking Patterns of Preschool-Aged Children in the Guelph Family Health Study: A Pilot Study.

    Science.gov (United States)

    Chamoun, Elie; Hutchinson, Joy M; Krystia, Owen; Mirotta, Julia A; Mutch, David M; Buchholz, Andrea C; Duncan, Alison M; Darlington, Gerarda; Haines, Jess; Ma, David W L

    2018-01-30

    Snacking is an integral component of eating habits in young children that is often overlooked in nutrition research. While snacking is a substantial source of calories in preschoolers' diets, there is limited knowledge about the factors that drive snacking patterns. The genetics of taste may help to better understand the snacking patterns of children. The rs1761667 single nucleotide polymorphism (SNP) in the CD36 gene has been linked to fat taste sensitivity, the rs35874116 SNP in the TAS1R2 gene has been related to sweet taste preference, and the rs713598 SNP in the TAS2R38 gene has been associated with aversion to bitter, green leafy vegetables. This study seeks to determine the cross-sectional associations between three taste receptor SNPs and snacking patterns among preschoolers in the Guelph Family Health Study. Preschoolers' snack quality, quantity, and frequency were assessed using three-day food records and saliva was collected for SNP genotyping ( n = 47). Children with the TT genotype in TAS1R2 consumed snacks with significantly more calories from sugar, and these snacks were consumed mostly in the evening. Total energy density of snacks was highest in the CC and CG genotypes compared to the GG genotype in TAS2R38 , and also greater in the AA genotype in CD36 compared to G allele carriers, however this difference was not individually attributable to energy from fat, carbohydrates, sugar, or protein. Genetic variation in taste receptors may influence snacking patterns of preschoolers.

  7. Qualitative Sybr Green real-time detection of single nucleotide polymorphisms responsible for target-site resistance in insect pests: the example of Myzus persicae and Musca domestica.

    Science.gov (United States)

    Puggioni, V; Chiesa, O; Panini, M; Mazzoni, E

    2017-02-01

    Chemical insecticides have been widely used to control insect pests, leading to the selection of resistant populations. To date, several single nucleotide polymorphisms (SNPs) have already been associated with insecticide resistance, causing reduced sensitivity to many classes of products. Monitoring and detection of target-site resistance is currently one of the most important factors for insect pest management strategies. Several methods are available for this purpose: automated and high-throughput techniques (i.e. TaqMan or pyrosequencing) are very costly; cheaper alternatives (i.e. RFLP or PASA-PCRs) are time-consuming and limited by the necessity of a final visualization step. This work presents a new approach (QSGG, Qualitative Sybr Green Genotyping) which combines the specificity of PASA-PCR with the rapidity of real-time PCR analysis. The specific real-time detection of Cq values of wild-type or mutant alleles (amplified used allele-specific primers) allows the calculation of ΔCqW-M values and the consequent identification of the genotypes of unknown samples, on the basis of ranges previously defined with reference clones. The methodology is applied here to characterize mutations described in Myzus persicae and Musca domestica and we demonstrate it represents a valid, rapid and cost-effective technique that can be adopted for monitoring target-site resistance in field populations of these and other insect species.

  8. The CD14 C-260T single nucleotide polymorphism (SNP) modulates monocyte/macrophage activation in treated HIV-infected individuals.

    Science.gov (United States)

    Rajasuriar, Reena; Kong, Yong Yean; Nadarajah, Reshika; Abdullah, Noor Kamila; Spelman, Tim; Yuhana, Muhamad Yazli; Ponampalavanar, Sasheela; Kamarulzaman, Adeeba; Lewin, Sharon R

    2015-01-27

    HIV-infected individuals have an increased risk of cardiovascular disease (CVD). T-allele carriers of the CD14 C-260T single-nucleotide polymorphism (SNP) have reported increased expression of the LPS-binding receptor, CD14 and inflammation in the general population. Our aim was to explore the relationship of this SNP with monocyte/macrophage activation and inflammation and its association with sub-clinical atherosclerosis in HIV-infected individuals. Patients with no pre-existing CVD risk factors on suppressive antiretroviral therapy were recruited from University Malaya Medical Centre, Malaysia (n = 84). The CD14 C-260T and TLR4 SNPs, Asp299Gly and Thr399Ile were genotyped and soluble(s) CD14 and sCD163 and high-sensitivity C-reactive protein, hsCRP were measured in plasma. Subclinical atherosclerosis was assessed by measuring carotid intima media thickness (cIMT). The association between CD14 C-260T SNP carriage and cIMT was assessed in a multivariable quantile regression model where a p-value of CVD risk profile.

  9. Single Nucleotide Polymorphisms in Taste Receptor Genes Are Associated with Snacking Patterns of Preschool-Aged Children in the Guelph Family Health Study: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Elie Chamoun

    2018-01-01

    Full Text Available Snacking is an integral component of eating habits in young children that is often overlooked in nutrition research. While snacking is a substantial source of calories in preschoolers’ diets, there is limited knowledge about the factors that drive snacking patterns. The genetics of taste may help to better understand the snacking patterns of children. The rs1761667 single nucleotide polymorphism (SNP in the CD36 gene has been linked to fat taste sensitivity, the rs35874116 SNP in the TAS1R2 gene has been related to sweet taste preference, and the rs713598 SNP in the TAS2R38 gene has been associated with aversion to bitter, green leafy vegetables. This study seeks to determine the cross-sectional associations between three taste receptor SNPs and snacking patterns among preschoolers in the Guelph Family Health Study. Preschoolers’ snack quality, quantity, and frequency were assessed using three-day food records and saliva was collected for SNP genotyping (n = 47. Children with the TT genotype in TAS1R2 consumed snacks with significantly more calories from sugar, and these snacks were consumed mostly in the evening. Total energy density of snacks was highest in the CC and CG genotypes compared to the GG genotype in TAS2R38, and also greater in the AA genotype in CD36 compared to G allele carriers, however this difference was not individually attributable to energy from fat, carbohydrates, sugar, or protein. Genetic variation in taste receptors may influence snacking patterns of preschoolers.

  10. Genome-wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium tuberculosis complex organisms: resolution of genetic relationships among closely related microbial strains.

    Science.gov (United States)

    Gutacker, Michaela M; Smoot, James C; Migliaccio, Cristi A Lux; Ricklefs, Stacy M; Hua, Su; Cousins, Debby V; Graviss, Edward A; Shashkina, Elena; Kreiswirth, Barry N; Musser, James M

    2002-12-01

    Several human pathogens (e.g., Bacillus anthracis, Yersinia pestis, Bordetella pertussis, Plasmodium falciparum, and Mycobacterium tuberculosis) have very restricted unselected allelic variation in structural genes, which hinders study of the genetic relationships among strains and strain-trait correlations. To address this problem in a representative pathogen, 432 M. tuberculosis complex strains from global sources were genotyped on the basis of 230 synonymous (silent) single nucleotide polymorphisms (sSNPs) identified by comparison of four genome sequences. Eight major clusters of related genotypes were identified in M. tuberculosis sensu stricto, including a single cluster representing organisms responsible for several large outbreaks in the United States and Asia. All M. tuberculosis sensu stricto isolates of previously unknown phylogenetic position could be rapidly and unambiguously assigned to one of the eight major clusters, thus providing a facile strategy for identifying organisms that are clonally related by descent. Common clones of M. tuberculosis sensu stricto and M. bovis are distinct, deeply branching genotypic complexes whose extant members did not emerge directly from one another in the recent past. sSNP genotyping rapidly delineates relationships among closely related strains of pathogenic microbes and allows construction of genetic frameworks for examining the distribution of biomedically relevant traits such as virulence, transmissibility, and host range.

  11. Associations of the single-nucleotide polymorphisms of the Mina gene with the development of asthma in Chinese Han children: a case-control study.

    Science.gov (United States)

    Chen, Yun; Yang, Xiqiang; Huang, Ying; Liu, Enmei; Wang, Lijia

    2011-01-01

    The single-nucleotide polymorphisms (SNPs) of the Mina gene in animals are associated with the development of Th2-mediated diseases. However, there is no information whether the association occurs in humans. This case-control study aimed at examining the potential association of the SNP of the Mina gene with the development of asthma in Chinese Han children. The DNA genotypes and serum immunoglobulin E and interleukin-4 levels of 202 asthmatic patients and 191 nonasthmatic subjects were determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry method and enzyme-linked immunosorbent assay, respectively. We found that the frequency of the T allele of rs4857304, but not rs832081, rs832078, rs9879532, and rs17374916, in the Mina gene in asthmatic patients was significantly higher than that of controls (p = 0.0199). Using a recessive model, we found that the percentage of patients with TT homozygous rs4857304 was significantly higher than that of controls (p = 0.0282, odds ratio=1.568, 95% confidence interval=1.048-2.346). Further, the mean levels of serum immunoglobulin E and interleukin-4 in the patients with TT genotype of rs4857304 were significantly higher than that of patients with the G allele (p = 0.000 and p = 0.03, respectively). Apparently, the T allele of rs4857304 of the Mina gene may be associated with increased risk for the development of asthma in Chinese Han children.

  12. Identification of single nucleotide polymorphisms of the human metabotropic glutamate receptor 1 gene and pharmacological characterization of a P993S variant.

    Science.gov (United States)

    Downey, Patrick M; Petrò, Roberta; Simon, Jason S; Devlin, David; Lozza, Gianluca; Veltri, Alessio; Beltramo, Massimiliano; Bertorelli, Rosalia; Reggiani, Angelo

    2009-04-01

    mGluR1 receptors are believed to play major roles in the pathophysiology of diseases such as anxiety and chronic pain and are being actively investigated as targets for drug development. Sequence polymorphisms can potentially influence the efficacy of drugs in patient populations and are therefore an important consideration in the drug development process. To identify DNA sequence variants of the mGluR1 receptor, comparative DNA sequencing was performed on DNA samples (n=186) from apparently healthy subjects representing two ethnic groups. In total, eight non-synonymous single nucleotide polymorphisms (SNPs) were identified and one SNP (c2977>T) was found to be particularly common, this SNP results in a proline to serine substitution at residue 993 (P993S). The WT (P993) and S993 variants were expressed in an inducible system which allowed us to titrate gene expression to equivalent levels and were pharmacologically characterized. We determined the potency and affinity of standard antagonist compounds as well as the potency and efficacy of the endogenous ligand glutamate and other agonist compounds at both receptor variants. Agonist evoked increases in intracellular Ca(2+) were measured by fluorometric imaging plate reader (FLIPR). The potency of mGluR1 antagonists was evaluated by their ability to inhibit quisqualate induced increases in intracellular Ca(2+), while their affinities were determined by radio-ligand binding studies. This study demonstrates that the Pro993Ser amino acid exchange is highly frequent in the human mGluR1 gene. This polymorphism however, does not appear to affect the potency of agonist compounds or the potencies or affinities of small molecule antagonist compounds.

  13. Association study in Alzheimer’s disease of single nucleotide polymorphisms implicated with coffee consumption

    Directory of Open Access Journals (Sweden)

    Victor Junji Yamamoto

    2015-06-01

    Full Text Available Background There is evidence from animal and in vitro models of the protective effects of caffeine in Alzheimer’s disease. The suggested mechanisms through which caffeine may protect neurons against Alzheimer’s disease pathology include the facilitation of beta-amyloid clearance, upregulation of cholinergic transmission, and increased neuronal plasticity and survival. Epidemiological studies support that Alzheimer’s disease patients consume smaller amounts of coffee beverages throughout their lives as compared to age-matched cognitively healthy individuals. Objective The aim of the present study was to determine whether the negative association between Alzheimer’s disease and coffee consumption may be influenced by a common genetic predisposition, given the fact that the pattern of coffee consumption is determined by both environmental and genetic factors. Method We conducted an in silico search addressing the association between genetic polymorphisms related to coffee consumption and the diagnosis of Alzheimer’s disease. We further investigated the interactions between genes located in regions bearing these polymorphisms. Results Our analysis revealed no evidence for a genetic association (nor interaction between related proteins involving coffee consumption and Alzheimer’s disease. Discussion The negative association between Alzheimer’s disease and coffee consumption suggested by epidemiological studies is most likely due to environmental factors that are not necessarily regulated by genetic background.

  14. Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

    Directory of Open Access Journals (Sweden)

    Linda S. Pescatello

    2013-01-01

    Full Text Available The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT. The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years, healthy men (42% and women (58% that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

  15. CARD15 single nucleotide polymorphisms 8, 12 and 13 are not increased in ethnic Danes with sarcoidosis

    DEFF Research Database (Denmark)

    Milman, Nils; Nielsen, Ole Haagen; Hviid, Thomas Vauvert F

    2007-01-01

    and SNP13, respectively, were performed by capillary electrophoresis single-strand confirmation polymorphism in 53 patients with histologically verified sarcoidosis and in 103 healthy controls. RESULTS: The frequencies of CARD15 mutations in sarcoidosis patients were: SNP8, 4/106 chromosomes (3.8%); SNP12...... with Crohn's disease. OBJECTIVES: To evaluate whether ethnic Danes with sarcoidosis have an increased frequency of CARD15 mutations compared to healthy control subjects. METHODS: Genotyping for CARD15 mutations R702W, G908R, and L1007fsinsC, also designated single nucleotide polymorphism (SNP) SNP8, SNP12......, 2/106 chromosomes (1.9%); SNP13, 2/106 chromosomes (1.9%); SNP8+SNP12+SNP13, 8/106 chromosomes (7.6%). All 8 patients were heterozygous. The frequencies in controls were: SNP8, 9/206 chromosomes (4.4%); SNP12, 2/206 chromosomes (1.0%); SNP13, 4/206 chromosomes (1.9%); SNP8+SNP12+SNP13, 15...