WorldWideScience

Sample records for single-nucleotide polymorphism snp

  1. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  2. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  3. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  4. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  5. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  6. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  7. Single Nucleotide Polymorphism Detection Using Au-Decorated Single-Walled Carbon Nanotube Field Effect Transistors

    Directory of Open Access Journals (Sweden)

    Keum-Ju Lee

    2011-01-01

    Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.

  8. Influence of the MDM2 single nucleotide polymorphism SNP309 on tumour development in BRCA1 mutation carriers

    Directory of Open Access Journals (Sweden)

    Johnson Peter W

    2006-03-01

    Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.

  9. Identification of novel single nucleotide polymorphisms (SNPs in deer (Odocoileus spp. using the BovineSNP50 BeadChip.

    Directory of Open Access Journals (Sweden)

    Gwilym D Haynes

    Full Text Available Single nucleotide polymorphisms (SNPs are growing in popularity as a genetic marker for investigating evolutionary processes. A panel of SNPs is often developed by comparing large quantities of DNA sequence data across multiple individuals to identify polymorphic sites. For non-model species, this is particularly difficult, as performing the necessary large-scale genomic sequencing often exceeds the resources available for the project. In this study, we trial the Bovine SNP50 BeadChip developed in cattle (Bos taurus for identifying polymorphic SNPs in cervids Odocoileus hemionus (mule deer and black-tailed deer and O. virginianus (white-tailed deer in the Pacific Northwest. We found that 38.7% of loci could be genotyped, of which 5% (n = 1068 were polymorphic. Of these 1068 polymorphic SNPs, a mixture of putatively neutral loci (n = 878 and loci under selection (n = 190 were identified with the F(ST-outlier method. A range of population genetic analyses were implemented using these SNPs and a panel of 10 microsatellite loci. The three types of deer could readily be distinguished with both the SNP and microsatellite datasets. This study demonstrates that commercially developed SNP chips are a viable means of SNP discovery for non-model organisms, even when used between very distantly related species (the Bovidae and Cervidae families diverged some 25.1-30.1 million years before present.

  10. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.

    Science.gov (United States)

    Rotherham, D; Harbison, S A

    2011-04-15

    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  12. Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP Array

    Directory of Open Access Journals (Sweden)

    Qian You

    2018-02-01

    Full Text Available Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane. Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species. Single nucleotide polymorphism (SNP array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches. However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species. Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding. In this review, we (1 discussed the pros and cons of SNP array in general for high throughput genotyping, (2 presented the challenges of and solutions to SNP calling in polyploid species, (3 summarized the SNP selection criteria and considerations of SNP array design for polyploid species, (4 illustrated SNP array applications in several different polyploid crop species, then (5 discussed challenges, available software, and their accuracy comparisons for genotype calling based on SNP array data in polyploids, and finally (6 provided a series of SNP array design and genotype calling recommendations. This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

  13. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  14. Preliminary Study on the Single Nucleotide Polymorphism (SNP of XRCC1 Gene Identificationto Improve the Outcomes of Radiotherapy for Cervical Cancer

    Directory of Open Access Journals (Sweden)

    Devita Tetriana

    2015-09-01

    Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks

  15. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  16. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  17. Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramensky Vasily E

    2007-01-01

    Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously

  18. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  19. [A population genetic study of 22 autosomal loci of single nucleotide polymorphisms].

    Science.gov (United States)

    Tang, Jian-pin; Jiang, Feng-hui; Shi, Mei-sen; Xu, Chuan-chao; Chen, Rui; Lai, Xiao-pin

    2012-12-01

    To evaluate polymorphisms and forensic efficiency of 22 non-binary single nucleotide polymorphism (SNP) loci. One hundred ethnic Han Chinese individuals were recruited from Dongguan, Guangdong. The 22 loci were genotyped with matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Nine loci were found with a single allele, 4 loci were found to be biallelic, whilst 9 loci were found to have 3 alleles. For 13 polymorphic loci, the combined discrimination power and power of exclusion were 0.999 98 and 0.9330, respectively. For the 9 non-biallelic loci, the combined discrimination power and power of exclusion were 0.9998 and 0.8956, respectively. For motherless cases, the combined power of exclusion was 0.6405 for 13 polymorphic SNPs and 0.6405 for 9 non-binary SNPs. Non-binary loci have a greater discrimination power and exclusion power per SNP.

  20. CARD15 single nucleotide polymorphisms 8, 12 and 13 are not increased in ethnic Danes with sarcoidosis

    DEFF Research Database (Denmark)

    Milman, Nils; Nielsen, Ole Haagen; Hviid, Thomas Vauvert F

    2007-01-01

    and SNP13, respectively, were performed by capillary electrophoresis single-strand confirmation polymorphism in 53 patients with histologically verified sarcoidosis and in 103 healthy controls. RESULTS: The frequencies of CARD15 mutations in sarcoidosis patients were: SNP8, 4/106 chromosomes (3.8%); SNP12...... with Crohn's disease. OBJECTIVES: To evaluate whether ethnic Danes with sarcoidosis have an increased frequency of CARD15 mutations compared to healthy control subjects. METHODS: Genotyping for CARD15 mutations R702W, G908R, and L1007fsinsC, also designated single nucleotide polymorphism (SNP) SNP8, SNP12......, 2/106 chromosomes (1.9%); SNP13, 2/106 chromosomes (1.9%); SNP8+SNP12+SNP13, 8/106 chromosomes (7.6%). All 8 patients were heterozygous. The frequencies in controls were: SNP8, 9/206 chromosomes (4.4%); SNP12, 2/206 chromosomes (1.0%); SNP13, 4/206 chromosomes (1.9%); SNP8+SNP12+SNP13, 15...

  1. Effect of secondary structure on single nucleotide polymorphism detection with a porous microarray matrix; implications for probe selection

    NARCIS (Netherlands)

    Anthony, R. M.; Schuitema, A. R. J.; Chan, A. B.; Boender, P. J.; Klatser, P. R.; Oskam, L.

    2003-01-01

    Oligonucleotide arrays capable of detecting single nucleotide polymorphisms (SNPs) from amplified nucleic acid have many applications. The expected SNP is usually placed approximately in the center of the probe to ensure the maximum shift in Tm between complementary and SNP sequences. Unfortunately,

  2. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  3. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  4. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Børsting, Claus; Morling, Niels

    2012-01-01

    and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...

  5. Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

    Directory of Open Access Journals (Sweden)

    Kourosh Bamdad

    2016-12-01

    Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

  6. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  7. High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification

    Directory of Open Access Journals (Sweden)

    Sun Zhenyu

    2001-08-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring.

  8. Correcting estimators of theta and Tajima's D for ascertainment biases caused by the single-nucleotide polymorphism discovery process

    DEFF Research Database (Denmark)

    Ramírez-Soriano, Anna; Nielsen, Rasmus

    2009-01-01

    Most single-nucleotide polymorphism (SNP) data suffer from an ascertainment bias caused by the process of SNP discovery followed by SNP genotyping. The final genotyped data are biased toward an excess of common alleles compared to directly sequenced data, making standard genetic methods of analysis...... the variances and covariances of these estimators and provide a corrected version of Tajima's D statistic. We reanalyze a human genomewide SNP data set and find substantial differences in the results with or without ascertainment bias correction....

  9. SNP Polymorphism Survey of the Parental Lines of ISRA Sorghum Breeding Program as Part of the Feed the Future

    Data.gov (United States)

    US Agency for International Development — Polymorphism of SNP Markers (single nucleotide polymorphisms) was assessed on 24 parental lines of the ISRA sorghum breeding program . About 1300 SNP have been used...

  10. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

    Science.gov (United States)

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

    2012-11-10

    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  12. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available RNA-seq is a useful next-generation sequencing (NGS technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits.The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM SNP genotyping assay. The

  13. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    Science.gov (United States)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

    2017-01-01

    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive

  14. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

    Science.gov (United States)

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

    2015-07-01

    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal

  15. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

    DEFF Research Database (Denmark)

    Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael

    2002-01-01

    Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

  16. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  17. Risk of estrogen receptor-positive and -negative breast cancer and single-nucleotide polymorphism 2q35-rs13387042

    DEFF Research Database (Denmark)

    Milne, Roger L; Benítez, Javier; Nevanlinna, Heli

    2009-01-01

    BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...

  18. Exploration of pathomechanisms triggered by a single-nucleotide polymorphism in titin's I-band: the cardiomyopathy-linked mutation T2580I

    NARCIS (Netherlands)

    Bogomolovas, J.; Fleming, J.R.; Anderson, B.R.; Williams, R.; Lange, S.; Simon, B.; Khan, M.M.; Rudolf, R.; Franke, B.; Bullard, B.; Rigden, D.J.; Granzier, H.; Labeit, S.; Mayans, O.

    2016-01-01

    Missense single-nucleotide polymorphisms (mSNPs) in titin are emerging as a main causative factor of heart failure. However, distinguishing between benign and disease-causing mSNPs is a substantial challenge. Here, we research the question of whether a single mSNP in a generic domain of titin can

  19. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  20. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A

    2009-01-01

    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  1. The single-nucleotide polymorphism 309 in the MDM2 gene contributes to the Li-Fraumeni syndrome and related phenotypes

    NARCIS (Netherlands)

    Ruijs, Mariëlle W. G.; Schmidt, Marjanka K.; Nevanlinna, Heli; Tommiska, Johanna; Aittomäki, Kristiina; Pruntel, Roelof; Verhoef, Senno; van 't Veer, L. J.

    2007-01-01

    Li-Fraumeni syndrome (LFS) is an autosomal-dominant cancer predisposition syndrome of which the majority is caused by TP53 germline mutations and is characterised by different tumour types occurring at relatively young age. Recently, it was shown that a single-nucleotide polymorphism (SNP) in the

  2. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  3. Single nucleotide polymorphisms (SNPs in coding regions of canine dopamine- and serotonin-related genes

    Directory of Open Access Journals (Sweden)

    Lingaas Frode

    2008-01-01

    Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.

  4. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos

    2017-12-01

    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  5. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    Science.gov (United States)

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. High-density single nucleotide polymorphism (SNP) array mapping in Brassica oleracea: identification of QTL associated with carotenoid variation in broccoli florets.

    Science.gov (United States)

    Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W

    2014-09-01

    A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.

  7. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  8. Whole-genome single-nucleotide polymorphism (SNP marker discovery and association analysis with the eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA content in Larimichthys crocea

    Directory of Open Access Journals (Sweden)

    Shijun Xiao

    2016-12-01

    Full Text Available Whole-genome single-nucleotide polymorphism (SNP markers are valuable genetic resources for the association and conservation studies. Genome-wide SNP development in many teleost species are still challenging because of the genome complexity and the cost of re-sequencing. Genotyping-By-Sequencing (GBS provided an efficient reduced representative method to squeeze cost for SNP detection; however, most of recent GBS applications were reported on plant organisms. In this work, we used an EcoRI-NlaIII based GBS protocol to teleost large yellow croaker, an important commercial fish in China and East-Asia, and reported the first whole-genome SNP development for the species. 69,845 high quality SNP markers that evenly distributed along genome were detected in at least 80% of 500 individuals. Nearly 95% randomly selected genotypes were successfully validated by Sequenom MassARRAY assay. The association studies with the muscle eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA content discovered 39 significant SNP markers, contributing as high up to ∼63% genetic variance that explained by all markers. Functional genes that involved in fat digestion and absorption pathway were identified, such as APOB, CRAT and OSBPL10. Notably, PPT2 Gene, previously identified in the association study of the plasma n-3 and n-6 polyunsaturated fatty acid level in human, was re-discovered in large yellow croaker. Our study verified that EcoRI-NlaIII based GBS could produce quality SNP markers in a cost-efficient manner in teleost genome. The developed SNP markers and the EPA and DHA associated SNP loci provided invaluable resources for the population structure, conservation genetics and genomic selection of large yellow croaker and other fish organisms.

  9. QualitySNP: a pipeline for detecting single nucleotide polymorphisms and insertions/deletions in EST data from diploid and polyploid species

    Directory of Open Access Journals (Sweden)

    Voorrips Roeland E

    2006-10-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs and are considered to be faster and more cost-effective than experimental procedures. A major challenge in computational SNP discovery is distinguishing allelic variation from sequence variation between paralogous sequences, in addition to recognizing sequencing errors. For the majority of the public EST sequences, trace or quality files are lacking which makes detection of reliable SNPs even more difficult because it has to rely on sequence comparisons only. Results We have developed a new algorithm to detect reliable SNPs and insertions/deletions (indels in EST data, both with and without quality files. Implemented in a pipeline called QualitySNP, it uses three filters for the identification of reliable SNPs. Filter 1 screens for all potential SNPs and identifies variation between or within genotypes. Filter 2 is the core filter that uses a haplotype-based strategy to detect reliable SNPs. Clusters with potential paralogs as well as false SNPs caused by sequencing errors are identified. Filter 3 screens SNPs by calculating a confidence score, based upon sequence redundancy and quality. Non-synonymous SNPs are subsequently identified by detecting open reading frames of consensus sequences (contigs with SNPs. The pipeline includes a data storage and retrieval system for haplotypes, SNPs and alignments. QualitySNP's versatility is demonstrated by the identification of SNPs in EST datasets from potato, chicken and humans. Conclusion QualitySNP is an efficient tool for SNP detection, storage and retrieval in diploid as well as polyploid species. It is available for running on Linux or UNIX systems. The program, test data, and user manual are available at

  10. FUNCTIONAL IMPLICATIONS OF THE CLOCK 3111T/C SINGLE-NUCLEOTIDE POLYMORPHISM

    Directory of Open Access Journals (Sweden)

    Angela Renee Ozburn

    2016-04-01

    Full Text Available Circadian rhythm disruptions are prominently associated with Bipolar Disorder (BD. Circadian rhythms are regulated by the molecular clock, a family of proteins that function together in a transcriptional-translational feedback loop. The CLOCK protein is a key transcription factor of this feedback loop, and previous studies have found that manipulations of the Clock gene are sufficient to produce manic-like behavior in mice (Roybal et al., 2007. The Clock 3111T/C single-nucleotide polymorphism (SNP; rs1801260 is a genetic variation of the human Clock gene that is significantly associated with increased frequency of manic episodes in BD patients (Benedetti et al., 2003. The 3111T/C SNP is located in the 3’ untranslated region of the Clock gene. In this study, we sought to examine the functional implications of the human Clock 3111T/C SNP by transfecting a mammalian cell line (mouse embryonic fibroblasts isolated from Clock -/- knockout mice with pcDNA plasmids containing the human Clock gene with either the T or C SNP at position 3111. We then measured circadian gene expression over a 24 hour time period. We found that the Clock3111C SNP resulted in higher mRNA levels than the Clock 3111T SNP. Further, we found that Per2, a transcriptional target of CLOCK, was also more highly expressed with Clock 3111C expression, indicating the 3’UTR SNP affects the expression, function and stability of Clock mRNA.

  11. Species trees from consensus single nucleotide polymorphism (SNP) data: Testing phylogenetic approaches with simulated and empirical data.

    Science.gov (United States)

    Schmidt-Lebuhn, Alexander N; Aitken, Nicola C; Chuah, Aaron

    2017-11-01

    Datasets of hundreds or thousands of SNPs (Single Nucleotide Polymorphisms) from multiple individuals per species are increasingly used to study population structure, species delimitation and shallow phylogenetics. The principal software tool to infer species or population trees from SNP data is currently the BEAST template SNAPP which uses a Bayesian coalescent analysis. However, it is computationally extremely demanding and tolerates only small amounts of missing data. We used simulated and empirical SNPs from plants (Australian Craspedia, Asteraceae, and Pelargonium, Geraniaceae) to compare species trees produced (1) by SNAPP, (2) using SVD quartets, and (3) using Bayesian and parsimony analysis with several different approaches to summarising data from multiple samples into one set of traits per species. Our aims were to explore the impact of tree topology and missing data on the results, and to test which data summarising and analyses approaches would best approximate the results obtained from SNAPP for empirical data. SVD quartets retrieved the correct topology from simulated data, as did SNAPP except in the case of a very unbalanced phylogeny. Both methods failed to retrieve the correct topology when large amounts of data were missing. Bayesian analysis of species level summary data scoring the two alleles of each SNP as independent characters and parsimony analysis of data scoring each SNP as one character produced trees with branch length distributions closest to the true trees on which SNPs were simulated. For empirical data, Bayesian inference and Dollo parsimony analysis of data scored allele-wise produced phylogenies most congruent with the results of SNAPP. In the case of study groups divergent enough for missing data to be phylogenetically informative (because of additional mutations preventing amplification of genomic fragments or bioinformatic establishment of homology), scoring of SNP data as a presence/absence matrix irrespective of allele

  12. Single Nucleotide Polymorphisms in Common Bean: Their Discovery and Genotyping Using a Multiplex Detection System

    Directory of Open Access Journals (Sweden)

    E. Gaitán-Solís

    2008-11-01

    Full Text Available Single nucleotide polymorphism (SNP markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean ( L. by comparing sequences from coding and noncoding regions obtained from the GenBank and genomic DNA and to compare sequencing results with those obtained using single base extension (SBE assays on the Luminex-100 system for use in high-throughput germplasm evaluation. We assessed the frequency of SNPs in 47 fragments of common bean DNA, using SBE as the evaluation methodology. We conducted a sequence analysis of 10 genotypes of cultivated and wild beans belonging to the Mesoamerican and Andean genetic pools of . For the 10 genotypes evaluated, a total of 20,964 bp of sequence were analyzed in each genotype and compared, resulting in the discovery of 239 SNPs and 133 InDels, giving an average SNP frequency of one per 88 bp and an InDel frequency of one per 157 bp. This is the equivalent of a nucleotide diversity (θ of 6.27 × 10. Comparisons with the SNP genotypes previously obtained by direct sequencing showed that the SBE assays on the Luminex-100 were accurate, with 2.5% being miscalled and 1% showing no signal. These results indicate that the Luminex-100 provides a high-throughput system that can be used to analyze SNPs in large samples of genotypes both for purposes of assessing diversity and also for mapping studies.

  13. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    Science.gov (United States)

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  14. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    Science.gov (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  15. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  16. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  17. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Yoshinaga; Ohtake, Tomoko; Okada, Hajime; Fujimoto, Kenzo [School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Ami, Takehiro [Innovation Plaza Ishikawa, Japan Science and Technology Agency, 2-13 Asahidai, Nomi, Ishikawa 923-1211 (Japan); Tsukaguchi, Tadashi, E-mail: kenzo@jaist.ac.j [Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, 1-308 Suematsu, Nonoichi, Ishikawa 921-8836 (Japan)

    2009-06-15

    We describe a simple and inexpensive single-nucleotide polymorphism (SNP) typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  18. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Directory of Open Access Journals (Sweden)

    Yoshinaga Yoshimura, Tomoko Ohtake, Hajime Okada, Takehiro Ami, Tadashi Tsukaguchi and Kenzo Fujimoto

    2009-01-01

    Full Text Available We describe a simple and inexpensive single-nucleotide polymorphism (SNP typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  19. Effects of Single Nucleotide Polymorphism Marker Density on Haplotype Block Partition

    Directory of Open Access Journals (Sweden)

    Sun Ah Kim

    2016-12-01

    Full Text Available Many researchers have found that one of the most important characteristics of the structure of linkage disequilibrium is that the human genome can be divided into non-overlapping block partitions in which only a small number of haplotypes are observed. The location and distribution of haplotype blocks can be seen as a population property influenced by population genetic events such as selection, mutation, recombination and population structure. In this study, we investigate the effects of the density of markers relative to the full set of all polymorphisms in the region on the results of haplotype partitioning for five popular haplotype block partition methods: three methods in Haploview (confidence interval, four gamete test, and solid spine, MIG++ implemented in PLINK 1.9 and S-MIG++. We used several experimental datasets obtained by sampling subsets of single nucleotide polymorphism (SNP markers of chromosome 22 region in the 1000 Genomes Project data and also the HapMap phase 3 data to compare the results of haplotype block partitions by five methods. With decreasing sampling ratio down to 20% of the original SNP markers, the total number of haplotype blocks decreases and the length of haplotype blocks increases for all algorithms. When we examined the marker-independence of the haplotype block locations constructed from the datasets of different density, the results using below 50% of the entire SNP markers were very different from the results using the entire SNP markers. We conclude that the haplotype block construction results should be used and interpreted carefully depending on the selection of markers and the purpose of the study.

  20. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing

    Directory of Open Access Journals (Sweden)

    Guangtu Gao

    2018-04-01

    Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and

  1. Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes.

    Science.gov (United States)

    Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica

    2014-01-01

    The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

  2. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    Science.gov (United States)

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

  3. Association of single nucleotide polymorphisms with carcass traits in Nellore cattle.

    Science.gov (United States)

    Ferraz, J B S; Pinto, L F B; Meirelles, F V; Eler, J P; de Rezende, F M; Oliveira, E C M; Almeida, H B; Woodward, B; Nkrumah, D

    2009-11-17

    The association between two single nucleotide polymorphisms (SNPs), T945M and UCP1SNP1, with hot carcass weight (HCW, kg, N = 618), longissimus dorsi muscle area (REA, cm(2), N = 633), and backfat thickness (BF, mm, N = 625), measured in Nellore cattle in Brazil, was evaluated. Likelihood ratio tests were used to evaluate reduced (fixed effects of general mean, contemporary group, yearling weight, age at slaughter, and random effect of infinitesimal genetic value) and full model (reduced model effects plus quantitative trait locus effects). Additive and dominance effects were tested for each SNP. Genotypic and gene frequencies were also obtained for the SNPs and a descriptive phenotype analysis was made. Mean values for HCW, REA and BF were equal to 288.13 +/- 0.55 kg, 73.14 +/- 0.27 cm(2), and 4.28 +/- 0.07 mm, respectively; the coefficients of variation were 4.74, 9.24, and 42.43%, respectively. Gene frequencies for T945M and UCP1SNP1 were f(C) = 0.89, f(T) = 0.11, f(C) = 0.81, and f(G) = 0.19. The SNP T945M had a genotypic frequency of only three animals for TT genotype. Additive effects were observed for T945M on REA and BF, while UCP1SNP1 affected HCW and BF. Based on the significant additive effects of the SNPs and the gene frequencies that we found, we can expect genetic gains with marker assisted selection.

  4. Accuracy of Assignment of Atlantic Salmon (Salmo salar L.) to Rivers and Regions in Scotland and Northeast England Based on Single Nucleotide Polymorphism (SNP) Markers

    Science.gov (United States)

    Gilbey, John; Cauwelier, Eef; Coulson, Mark W.; Stradmeyer, Lee; Sampayo, James N.; Armstrong, Anja; Verspoor, Eric; Corrigan, Laura; Shelley, Jonathan; Middlemas, Stuart

    2016-01-01

    Understanding the habitat use patterns of migratory fish, such as Atlantic salmon (Salmo salar L.), and the natural and anthropogenic impacts on them, is aided by the ability to identify individuals to their stock of origin. Presented here are the results of an analysis of informative single nucleotide polymorphic (SNP) markers for detecting genetic structuring in Atlantic salmon in Scotland and NE England and their ability to allow accurate genetic stock identification. 3,787 fish from 147 sites covering 27 rivers were screened at 5,568 SNP markers. In order to identify a cost-effective subset of SNPs, they were ranked according to their ability to differentiate between fish from different rivers. A panel of 288 SNPs was used to examine both individual assignments and mixed stock fisheries and eighteen assignment units were defined. The results improved greatly on previously available methods and, for the first time, fish caught in the marine environment can be confidently assigned to geographically coherent units within Scotland and NE England, including individual rivers. As such, this SNP panel has the potential to aid understanding of the various influences acting upon Atlantic salmon on their marine migrations, be they natural environmental variations and/or anthropogenic impacts, such as mixed stock fisheries and interactions with marine power generation installations. PMID:27723810

  5. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    2016-06-01

    Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.

  6. Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit

    Directory of Open Access Journals (Sweden)

    E.M. Abdel-Kafy

    2016-09-01

    Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.

  7. dbSNP

    Data.gov (United States)

    U.S. Department of Health & Human Services — dbSNP is a database of single nucleotide polymorphisms (SNPs) and multiple small-scale variations that include insertions/deletions, microsatellites, and...

  8. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  9. SNP genotyping technologies

    DEFF Research Database (Denmark)

    Studer, Bruno; Kölliker, Roland

    2013-01-01

    In the recent years, single nucleotide polymorphism (SNP) markers have emerged as the marker technology of choice for plant genetics and breeding applications. Besides the efficient technologies available for SNP discovery even in complex genomes, one of the main reasons for this is the availabil...

  10. The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.

    Science.gov (United States)

    Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning

    2017-11-01

    Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

    Directory of Open Access Journals (Sweden)

    Mary Lynn Baniecki

    2015-03-01

    Full Text Available Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs. Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM, we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding. From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana, Africa (Ethiopia and Asia (Sri Lanka. We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1. Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

  12. Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

    Science.gov (United States)

    Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

    2015-01-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

  13. Analyzing a single nucleotide polymorphism in schizophrenia: a meta-analysis approach

    Directory of Open Access Journals (Sweden)

    Falola O

    2017-08-01

    Full Text Available Oluwadamilare Falola,1 Victor Chukwudi Osamor,1,2 Marion Adebiyi,1,2 Ezekiel Adebiyi1,2 1Covenant University Bioinformatics Research (CUBRe, 2Department of Computer and Information Sciences, College of Science and Technology, Covenant University, Ota, Ogun State, Nigeria Background: Schizophrenia is a severe mental disorder affecting >21 million people worldwide. Some genetic studies reported that single nucleotide polymorphism (SNP involving variant rs1344706 from the ZNF804A gene in human beings is associated with the risk of schizophrenia in several populations. Similar results tend to conflict with other reports in literature, indicating that no true significant association exists between rs1344706 and schizophrenia. We seek to determine the level of association of this SNP with schizophrenia in the Asian population using more recent genome-wide association study (GWAS datasets. Methods: Applying a computational approach with inclusion of more recent GWAS datasets, we conducted a meta-analysis to examine the level of association of SNP rs1344706 and the risk of schizophrenia disorder among the Asian population constituting Chinese, Indonesians, Japanese, Kazakhs and Singaporeans. For a total of 21 genetic studies, including a total of 28,842 cases and 35,630 controls, regression analysis, publication bias, Cochran’s Q and I2 tests were performed. The DerSimonian and Laird random-effects model was used to assess the association of the genetic variant to schizophrenia. Leave-one-out sensitivity analysis was also conducted to determine the influence of each study on the final outcome of the association study. Results: Our summarized analysis for Asian population revealed a pooled odds ratio of 1.06, 95% confidence interval of 1.01–1.11 and two-tailed P-value of 0.0228. Our test for heterogeneity showed the presence of large heterogeneity (I2=53.44%, P =0.00207 and Egger’s regression test (P =0.8763 and Begg’s test (P =0

  14. Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing.

    Science.gov (United States)

    Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc

    2013-12-01

    Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

  15. Single nucleotide polymorphisms typing of Mycobacterium leprae reveals focal transmission of leprosy in high endemic regions of India.

    Science.gov (United States)

    Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U

    2013-11-01

    Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  16. Glu504Lys Single Nucleotide Polymorphism of Aldehyde Dehydrogenase 2 Gene and the Risk of Human Diseases

    Directory of Open Access Journals (Sweden)

    Yan Zhao

    2015-01-01

    Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.

  17. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  18. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    Science.gov (United States)

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  19. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  20. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients.

    Science.gov (United States)

    Salmaninejad, Arash; Mahmoudi, Mahdi; Aslani, Saeed; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima

    2017-01-01

    Salmaninejad A, Mahmoudi M, Aslani S, Poursani S, Ziaee V, Rezaei N. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients. Turk J Pediatr 2017; 59: 144-149. Juvenile-onset systemic lupus erythematosus (JSLE) is a complex autoimmune disease, characterized by multi-organ involvement. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene have been reported to have relationship with the risk of several autoimmune diseases. Studies have provided evidence that STAT4 may participate in the pathogenesis of JSLE. Therefore, we aimed to evaluate the association of STAT4 SNPs with JSLE in Iranian population. In this case-control study, two SNPs of STAT4 gene, including rs7574865 and rs7601754 were genotyped in 50 Iranian JSLE patients and 281 matched healthy individuals using real-time PCR allelic discrimination approach. Our experiments demonstrated that G and T alleles of rs7574865 SNP had similar distribution between patients and controls (P = 0.16). Additionally, differences in frequency of GG, GT, and TT genotypes (P = 0.14, 0.29, and 0.54, respectively) were not significant. Likewise, A and G alleles, as well as genotypes of rs7601754 SNP did not show significant differences between JSLE patients and healthy individuals. Lack of association of rs7574865 and rs7601754 SNPs in STAT4 gene with susceptibility to JSLE in Iranian population, despite their association with the risk of adult SLE in the same population, implicates on difference of genetic background of JSLE and SLE.

  1. Mitochondrial DNA single nucleotide polymorphism associated with weight estimated breeding values in Nelore cattle (Bos indicus

    Directory of Open Access Journals (Sweden)

    Fernando Henrique Biase

    2007-01-01

    Full Text Available We sampled 119 Nelore cattle (Bos indicus, 69 harboring B. indicus mtDNA plus 50 carrying Bos taurus mtDNA, to estimate the frequencies of putative mtDNA single nucleotide polymorphisms (SNPs and investigate their association with Nelore weight and scrotal circumference estimated breeding values (EBVs. The PCR restriction fragment length polymorphism (PCR-RFLP method was used to detect polymorphisms in the mitochondrial asparagine, cysteine, glycine, leucine and proline transporter RNA (tRNA genes (tRNAasn, tRNAcys, tRNAgly, tRNAleu and tRNApro. The 50 cattle carrying B. taurus mtDNA were monomorphic for all the tRNA gene SNPs analyzed, suggesting that they are specific to mtDNA from B. indicus cattle. No tRNAcys or tRNAgly polymorphisms were detected in any of the cattle but we did detect polymorphic SNPs in the tRNAasn, tRNAleu and tRNApro genes in the cattle harboring B. indicus mtDNA, with the same allele observed in the B. taurus sequence being present in the following percentage of cattle harboring B. indicus mtDNA: 72.46% for tRNAasn, 95.23% for tRNAleu and 90.62% for tRNApro. Analyses of variance using the tRNAasn SNP as the independent variable and EBVs as the dependent variable showed that the G -> T SNP was significantly associated (p < 0.05 with maternal EBVs for weight at 120 and 210 days (p < 0.05 and animal's EBVs for weight at 210, 365 and 455 days. There was no association of the tRNAasn SNP with the scrotal circumference EBVs. These results confirm that mtDNA can affect weight and that mtDNA polymorphisms can be a source of genetic variation for quantitative traits.

  2. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  3. Lack of Association between STAT4 Single Nucleotide Polymorphisms and Iranian Juvenile Rheumatoid Arthritis Patients.

    Science.gov (United States)

    Aslani, Saeed; Mahmoudi, Mahdi; Salmaninejad, Arash; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima

    2017-06-01

    Juvenile rheumatoid arthritis (JRA) is a common chronic systemic autoimmune disease in children. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene are suspected to have association with the risk of autoimmune diseases. Previous investigations have indicated that the STAT4 rs7574865 T allele was significantly associated with rheumatoid arthritis. In this study, we aimed to evaluate the association of STAT4 SNPs with JRA in Iranian population. T allele of STAT4 rs7574865 SNP was less frequent in patients than in controls, and the difference was not significant (p = 0.19, OR = 0.72, 95% CI: 0.44 -1.17). In addition, G allele of this SNP was frequent but not significant in JRA patients (p = 0.19, OR = 1.38, 95% CI: 0.85-2.25). Neither alleles nor genotypes of rs7601754 SNP of STAT4 gene demonstrated associations with JRA. We recognize that gene variants of STAT4 did not affect JRA susceptibility in Iranian population.

  4. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672

  5. Development of 101 Gene-based Single Nucleotide Polymorphism Markers in Sea Cucumber, Apostichopus japonicus

    Directory of Open Access Journals (Sweden)

    Wei Lu

    2012-06-01

    Full Text Available Single nucleotide polymorphisms (SNPs are currently the marker of choice in a variety of genetic studies. Using the high resolution melting (HRM genotyping approach, 101 gene-based SNP markers were developed for Apostichopus japonicus, a sea cucumber species with economic significance for the aquaculture industry in East Asian countries. HRM analysis revealed that all the loci showed polymorphisms when evaluated using 40 A. japonicus individuals collected from a natural population. The minor allele frequency ranged from 0.035 to 0.489. The observed and expected heterozygosities ranged from 0.050 to 0.833 and 0.073 to 0.907, respectively. Thirteen loci were found to depart significantly from Hardy–Weinberg equilibrium (HWE after Bonferroni corrections. Significant linkage disequilibrium (LD was detected in one pair of markers. These SNP markers are expected to be useful for future quantitative trait loci (QTL analysis, and to facilitate marker-assisted selection (MAS in A. japonicus.

  6. Validation of a single nucleotide polymorphism (SNP) typing assay with 49 SNPs for forensic genetic testing in a laboratory accredited according to the ISO 17025 standard

    DEFF Research Database (Denmark)

    Børsting, Claus; Rockenbauer, Eszter; Morling, Niels

    2009-01-01

    cases and 33 twin cases were typed at least twice for the 49 SNPs. All electropherograms were analysed independently by two expert analysts prior to approval. Based on these results, detailed guidelines for analysis of the SBE products were developed. With these guidelines, the peak height ratio...... of a heterozygous allele call or the signal to noise ratio of a homozygous allele call is compared with previously obtained ratios. A laboratory protocol for analysis of SBE products was developed where allele calls with unusual ratios were highlighted to facilitate the analysis of difficult allele calls......A multiplex assay with 49 autosomal single nucleotide polymorphisms (SNPs) developed for human identification was validated for forensic genetic casework and accredited according to the ISO 17025 standard. The multiplex assay was based on the SNPforID 52plex SNP assay [J.J. Sanchez, C. Phillips, C...

  7. Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.

    Science.gov (United States)

    Martínez-Herrero, Sonia; Martínez, Alfredo

    2013-04-01

    The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.

  8. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.

    2017-01-01

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  9. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  10. Identification and genotyping of feline infectious peritonitis-associated single nucleotide polymorphisms in the feline interferon-γ gene.

    Science.gov (United States)

    Hsieh, Li-En; Chueh, Ling-Ling

    2014-05-21

    Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.

  11. Report on ISFG SNP Panel Discussion

    DEFF Research Database (Denmark)

    Butler, John M.; Budowle, B.; Gill, P.

    2008-01-01

    Six scientists presented their views and experience with single nucleotide polymorphism (SNP) markers, multiplexes, and methods regarding their potential application in forensic identity and relationship testing. Benefits and limitations of SNPs were reviewed, as were different SNP marker...

  12. VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    HyoYoung Kim

    2014-12-01

    Full Text Available Copy number variation (CNV or single nucleotide phlyorphism (SNP is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i the enrichment of genome contents in CNV; ii the physical distribution of CNV or SNP on chromosomes; iii the distribution of log2 ratio of CNVs with criteria of interested; iv the number of CNV or SNP per binning unit; v the distribution of homozygosity of SNP genotype; and vi cytomap of genes within CNV or SNP region.

  13. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    Science.gov (United States)

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  14. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  15. Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    Sukhjiwan Kaur

    2014-01-01

    Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.

  16. Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

    Science.gov (United States)

    Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

    2012-01-01

    Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

  17. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    Science.gov (United States)

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  18. Study on Association between Single Nucleotide Polymorphisms in Murine Double Minute 2 and Susceptibility of Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Xia Wang

    2014-03-01

    Full Text Available Objective: To investigate the relationship between single nucleotide polymorphisms (SNP in murine double minute 2 (MDM2 and susceptibility and biological behavior of hepatocellularcarcinoma (HCC. Methods: MDM2 (rs2279744 site polymorphism in peripheral blood from 166 patients with HCC and 157 healthy controls were detected by SYBR GREEN PCR method and the relationship between MDM2 polymorphism and susceptibility and biological behavior of HCC was analyzed by comparing the differences of genotypes in two populations. Results: There was no statistical significance between two groups in terms of MDM2 allele distribution in research population (P = 0.753. The risk of HCC onset in individuals with GG+ TG genotype was 1.698 times of those with TT genotype in case group (95%CI = 1.027 -2.808. MDM2 SNP was associated with HBV infection and the degree of tumor differentiation (P< 0.05. The incidence of alleles in experimental group (T, 0.49; G, 0.51 was very different from that in control group (T, 0.59; G, 0.41 (P = 0.015. The incidence of GG genotype in patients with HCC (22.29% was significantly higher than those without HCC (13.38%. Compared with TT genotype, G allele or GG genotype had more correlation with HCC onset. Conclusion: Compared with TT genotype, MDM2 promoter SNP309 G allele or GG genotype is more associated with HCC onset in Chinese population.

  19. Gene-based single nucleotide polymorphism markers for genetic and association mapping in common bean.

    Science.gov (United States)

    Galeano, Carlos H; Cortés, Andrés J; Fernández, Andrea C; Soler, Álvaro; Franco-Herrera, Natalia; Makunde, Godwill; Vanderleyden, Jos; Blair, Matthew W

    2012-06-26

    In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. In short, this study illustrates the power of intron-based markers for linkage and association mapping in

  20. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  1. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    Science.gov (United States)

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  2. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

    Science.gov (United States)

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

    2008-07-01

    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (Plink with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  3. Associations between Single-Nucleotide Polymorphisms in Corticotropin-Releasing Hormone-Related Genes and Irritable Bowel Syndrome.

    Directory of Open Access Journals (Sweden)

    Ayaka Sasaki

    Full Text Available Irritable bowel syndrome (IBS is a common functional disorder with distinct features of stress-related pathophysiology. A key mediator of the stress response is corticotropin-releasing hormone (CRH. Although some candidate genes have been identified in stress-related disorders, few studies have examined CRH-related gene polymorphisms. Therefore, we tested our hypothesis that single-nucleotide polymorphisms (SNPs in CRH-related genes influence the features of IBS.In total, 253 individuals (123 men and 130 women participated in this study. They comprised 111 IBS individuals and 142 healthy controls. The SNP genotypes in CRH (rs28364015 and rs6472258 and CRH-binding protein (CRH-BP (rs10474485 were determined by direct sequencing and real-time polymerase chain reaction. The emotional states of the subjects were evaluated using the State-Trait Anxiety Inventory, Perceived Stress Scale, and the Self-rating Depression Scale.Direct sequencing of the rs28364015 SNP of CRH revealed no genetic variation among the study subjects. There was no difference in the genotype distributions and allele frequencies of rs6472258 and rs10474485 between IBS individuals and controls. However, IBS subjects with diarrhea symptoms without the rs10474485 A allele showed a significantly higher emotional state score than carriers.These results suggest that the CRH and CRH-BP genes have no direct effect on IBS status. However, the CRH-BP SNP rs10474485 has some effect on IBS-related emotional abnormalities and resistance to psychosocial stress.

  4. Single nucleotide polymorphism barcoding to evaluate oral cancer risk using odds ratio-based genetic algorithms

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    2012-07-01

    Full Text Available Cancers often involve the synergistic effects of gene–gene interactions, but identifying these interactions remains challenging. Here, we present an odds ratio-based genetic algorithm (OR-GA that is able to solve the problems associated with the simultaneous analysis of multiple independent single nucleotide polymorphisms (SNPs that are associated with oral cancer. The SNP interactions between four SNPs—namely rs1799782, rs2040639, rs861539, rs2075685, and belonging to four genes (XRCC1, XRCC2, XRCC3, and XRCC4—were tested in this study, respectively. The GA decomposes the SNPs sets into different SNP combinations with their corresponding genotypes (called SNP barcodes. The GA can effectively identify a specific SNP barcode that has an optimized fitness value and uses this to calculate the difference between the case and control groups. The SNP barcodes with a low fitness value are naturally removed from the population. Using two to four SNPs, the best SNP barcodes with maximum differences in occurrence between the case and control groups were generated by GA algorithm. Subsequently, the OR provides a quantitative measure of the multiple SNP synergies between the oral cancer and control groups by calculating the risk related to the best SNP barcodes and others. When these were compared to their corresponding non-SNP barcodes, the estimated ORs for oral cancer were found to be great than 1 [approx. 1.72–2.23; confidence intervals (CIs: 0.94–5.30, p < 0.03–0.07] for various specific SNP barcodes with two to four SNPs. In conclusion, the proposed OR-GA method successfully generates SNP barcodes, which allow oral cancer risk to be evaluated and in the process the OR-GA method identifies possible SNP–SNP interactions.

  5. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    Science.gov (United States)

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.

    Science.gov (United States)

    Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang

    2018-05-15

    Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR

  7. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  8. SNPchiMp v.3: integrating and standardizing single nucleotide polymorphism data for livestock species.

    Science.gov (United States)

    Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra

    2015-04-10

    In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.

  9. The role of single nucleotide polymorphism of IL-6 and IL-10 cytokine on pain severity and pain relief after radiotherapy in multiple myeloma patients with painful bone destructions

    OpenAIRE

    Rudzianskiene Milda; Inciura Arturas; Juozaityte Elona; Gerbutavicius Rolandas; Simoliuniene Renata; Ugenskiene Rasa; Raulinaityte Danguole; Rudzianskas Viktoras; Kiavialaitis Greta Emilia

    2014-01-01

    Multiple myeloma (MM) cells interact with bone marrow stromal cells stimulating transcription and secretion of cytokines like IL-6 and IL-10, which are implicated in the progression and dissemination of MM. Regulation of cytokines secretion is under genetic control through genetic polymorphisms in their coding and promoter sequences. It seems that single nucleotide polymorphism (SNP) in the promoter region of various genes may regulate the plasma concentrat...

  10. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  11. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  12. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  13. SNPServer: a real-time SNP discovery tool.

    Science.gov (United States)

    Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

    2005-07-01

    SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

  14. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  15. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  16. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    Science.gov (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  17. Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

    Science.gov (United States)

    Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

    2016-06-01

    Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

  18. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  19. Diagnostic single nucleotide polymorphisms for identifying westslope cutthroat trout (Oncorhynchus clarki lewisi), Yellowstone cutthroat trout (Oncorhynchus clarkii bouvieri) and rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Kalinowski, S T; Novak, B J; Drinan, D P; Jennings, R deM; Vu, N V

    2011-03-01

    We describe 12 diagnostic single nucleotide polymorphism (SNP) assays for use in species identification among rainbow and cutthroat trout: five of these loci have alleles unique to rainbow trout (Oncorhynchus mykiss), three unique to westslope cutthroat trout (O. clarkii lewisi) and four unique to Yellowstone cutthroat trout (O. clarkii bouvieri). These diagnostic assays were identified using a total of 489 individuals from 26 populations and five fish hatchery strains. © 2010 Blackwell Publishing Ltd.

  20. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  1. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  2. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  3. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  4. Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

    Science.gov (United States)

    Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

    2007-06-01

    The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

  5. SNP mining porcine ESTs with MAVIANT, a novel tool for SNP evaluation and annotation

    DEFF Research Database (Denmark)

    Panitz, Frank; Stengaard, Henrik; Hornshoj, Henrik

    2007-01-01

    MOTIVATION: Single nucleotide polymorphisms (SNPs) analysis is an important means to study genetic variation. A fast and cost-efficient approach to identify large numbers of novel candidates is the SNP mining of large scale sequencing projects. The increasing availability of sequence trace data...... manual annotation, which is immediately accessible and can be easily shared with external collaborators. RESULTS: Large-scale SNP mining of polymorphisms bases on porcine EST sequences yielded more than 7900 candidate SNPs in coding regions (cSNPs), which were annotated relative to the human genome. Non...

  6. Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

    Science.gov (United States)

    Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

    2013-01-01

    To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

  7. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    Science.gov (United States)

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  8. SINGLE NUCLEOTIDE POLYMORPHISMS OF LIPOPROTEIN LIPASE GENE AND ITS ASSOCIATION WITH MARBLING QUALITY IN LOCAL SHEEPS

    Directory of Open Access Journals (Sweden)

    H. Hidayati

    2015-09-01

    Full Text Available Lipoprotein lipase (LPL is a key enzyme that plays in metabolism and transport lipoprotein andtherefore has an influence on blood triglyceride levels. LPL controls triacylglycerol partitioning betweenadipose tissue and muscle that increases fat storage or provides energy in the form of fatty acids formuscle growth. The research was aimed to explore Single Nucleotide Polymorphisms of LPL gene andto associate SNP with marbling quality. A total of 66 genomic DNAs consisted of sumatera thin-tail edsheep (50 heads and garut sheep (16 heads were used in this study. Polymerase Chain Reaction wasused to amplify genomic DNA and direct sequencing method was to identify polymorphism sequences.The sequences were analyzed with Bio Edit and MEGA 5.2. The BLAST sequence was obtained fromgene bank X.68308.1. The association between the genotype and marbling quality was analyze by oneway ANOVA and further between mean differences were tested using least sgnificant difference. Theresults showed that 3 novel SNPs i.e. insertion g.26>C; insertion g.27> G and c.192T>C on garut sheepand a SNP insertion g.26>C/G on sumatera thin-tail ed sheep. The diversity of LPL gene at c.192T>Cwas associated with heneicosanoic acid, whereas TT genotype (0.04% was higher than CC (0.03% andCT (0.02%.

  9. A comprehensive experiment for molecular biology: Determination of single nucleotide polymorphism in human REV3 gene using PCR-RFLP.

    Science.gov (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-07-08

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of DNA polymerase ζ and SNPs in this gene are associated with altered susceptibility to cancer. This newly designed experiment is composed of three parts, including genomic DNA extraction, gene amplification by PCR, and genotyping by RFLP. By combining these activities, the students are not only able to learn a series of biotechniques in molecular biology, but also acquire the ability to link the learned knowledge with practical applications. This comprehensive experiment will help the medical students improve the conceptual understanding of SNP and the technical understanding of SNP detection. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):299-304, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  10. Snap: an integrated SNP annotation platform

    DEFF Research Database (Denmark)

    Li, Shengting; Ma, Lijia; Li, Heng

    2007-01-01

    Snap (Single Nucleotide Polymorphism Annotation Platform) is a server designed to comprehensively analyze single genes and relationships between genes basing on SNPs in the human genome. The aim of the platform is to facilitate the study of SNP finding and analysis within the framework of medical...

  11. Analysis of the relationship between single nucleotide polymorphism of the CD209, IL-10, IL-28 and CCR5 D32 genes with the human predisposition to developing tick-borne encephalitis

    Directory of Open Access Journals (Sweden)

    Piotr Czupryna

    2017-01-01

    Full Text Available Introduction: It is known that in the pathogenesis of tick-borne encephalitis (TBE various molecules play a significant role. The most prominent factors include IL-10, IL-28B, CD-209 and CCR5. It is reasonable to search for genetic predispositions to the development of various clinical forms of TBE related to the genetic variation of IL-10, IL-28B, CD-209 and CCR5. In this study we aimed to search for the relationship between single nucleotide polymorphism in the promoter region of the CD209, IL-10, IL-28 and 32 base pair deletion in CCR5 coding region (Δ 32 with the human predisposition to development of various clinical presentations of TBE. We tried to assess the relation between the presence of particular alleles and genotypes with laboratory and clinical parameters. Material/Methods 59 patients with TBE and 57 people, bitten by a tick who never developed TBE (Polish cohort, were included in the study. To assess the distribution of single nucleotide polymorphisms, TaqMan SNP genotyping assays were used for IL10: rs1800872 and rs1800896, for CD 209 rs4804803 and rs2287886, rs12979860 for IL 28B SNPs according to the manufacturer’s protocol using real-time PCR technology on the StepOne thermal cycler. Results Comparison between TBE patients and CG showed that in SNP rs2287886 CD 209 AG heterozygotes were more frequent in the TBE group, while homozygotes GG were more frequent in the CG group. Conclusions SNP rs2287886 CD 209 AG heterozygotes predispose humans to develop TBE. Single nucleotide polymorphism in the promoter region of the CD209, IL-10, IL-28 and CCR5 D32 genes does not correlate with the severity of TBE.

  12. Single nucleotide polymorphisms as susceptibility, prognostic, and therapeutic markers of nonsmall cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zienolddiny S

    2011-12-01

    Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most

  13. (SNP) markers for the Chinese black sleeper, Bostrychus sinensis

    African Journals Online (AJOL)

    We characterized 11 single nucleotide ploymorphism (SNP) markers for the Chinese black sleeper, Bostrychus sinensis. These markers were isolated from a genomic library and tested in ten geographically distant individuals of B. sinensis. Polymorphisms of these SNP loci were assessed using a wild population including ...

  14. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.

    Directory of Open Access Journals (Sweden)

    Michael R Nonnemacher

    Full Text Available The large majority of human immunodeficiency virus type 1 (HIV-1 markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs contained within the viral promoter or long terminal repeat (LTR in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count.

  15. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    Science.gov (United States)

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  16. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

    Science.gov (United States)

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

    2016-01-01

    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  17. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs within potential candidate genes (CGs or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF, Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis

  18. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients.

    Science.gov (United States)

    Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric

    2003-07-01

    The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

  19. Association of single nucleotide polymorphisms in candidate genes previously related to genetic variation in fertility with phenotypic measurements of reproductive function in Holstein cows.

    Science.gov (United States)

    Ortega, M Sofia; Denicol, Anna C; Cole, John B; Null, Daniel J; Taylor, Jeremy F; Schnabel, Robert D; Hansen, Peter J

    2017-05-01

    Many genetic markers related to health or production traits are not evaluated in populations independent of the discovery population or related to phenotype. Here we evaluated 68 single nucleotide polymorphisms (SNP) in candidate genes previously associated with genetic merit for fertility and production traits for association with phenotypic measurements of fertility in a population of Holstein cows that was selected based on predicted transmitting ability (PTA) for daughter pregnancy rate (DPR; high, ≥1, n = 989; low, ≤ -1.0, n = 1,285). Cows with a high PTA for DPR had higher pregnancy rate at first service, fewer services per conception, and fewer days open than cows with a low PTA for DPR. Of the 68 SNP, 11 were associated with pregnancy rate at first service, 16 with services per conception, and 19 with days open. Single nucleotide polymorphisms in 12 genes (BDH2, BSP3, CAST, CD2, CD14, FUT1, FYB, GCNT3, HSD17B7, IBSP, OCLN, and PCCB) had significant associations with 2 fertility traits, and SNP in 4 genes (CSPP1, FCER1G, PMM2, and TBC1D24) had significant associations with each of the 3 traits. Results from this experiment were compared with results from 2 earlier studies in which the SNP were associated with genetic estimates of fertility. One study involved the same animals as used here, and the other study was of an independent population of bulls. A total of 13 SNP associated with 1 or more phenotypic estimates of fertility were directionally associated with genetic estimates of fertility in the same cow population. Moreover, 14 SNP associated with reproductive phenotype were directionally associated with genetic estimates of fertility in the bull population. Nine SNP (located in BCAS, BSP3, CAST, FUT1, HSD17B7, OCLN, PCCB, PMM2, and TBC1D24) had a directional association with fertility in all 3 studies. Examination of the function of the genes with SNP associated with reproduction in more than one study indicates the importance of steroid hormones

  20. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  1. The association between single nucleotide polymorphism in interleukin-27 gene and recurrent pregnancy loss in Iranian women

    Directory of Open Access Journals (Sweden)

    Zeinab Nematollahi

    2015-03-01

    Full Text Available Background: Recurrent pregnancy loss (RPL has been defined as two or more miscarriages before 20th week of gestation. It seems that IL-27 may reduce inflammatory responses and affect the survival of the embryo during human pregnancy. IL-27 polymorphisms may influence RPL by altering the levels or the activity of gene product. Objective: We studied for the first time the association of IL-27 -964 A>G single nucleotide polymorphism (SNP with RPL in Iranian women. Materials and Methods: A case-controlled study was performed on two groups consisting of 150 healthy women with at least one delivery (control group and 150 women with two or more primary RPLs history (RPL group. The -964 A>G SNP in IL-27 gene was determined by PCR-RFLP technique. Genotype and allele frequencies were compared using 2 tests between two groups. Results: There was no difference between the two groups regarding age of women (29±4.4 [control] vs. 30.84±5.2 years [case]. In the RPL group, the genotype frequencies of -964 A>G polymorphism were AG (49.3%, AA (40%, and GG (10.7%, and in the control group, they were AG (43.3%, AA (48.7%, and GG (8%. There was no significant difference between the genotypes of AA, AG, and GG in two groups (p=0.23. As the frequency of allele A was 64.7% in the RPL group and 70.3% in the control group, the difference in frequency of allele A in -964 A>G between two groups was not significant (p=0.19. Conclusion: Our findings indicate that SNP of -964 A>G in IL-27 gene is not a risk factor for RPL in Iranian women.

  2. Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2018-01-01

    DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

  3. Identification of Single Nucleotide Polymorphism (SNP in Mono Amine Oxidase A (MAO-A Gene as a genetic marker for aggressiveness in sheep

    Directory of Open Access Journals (Sweden)

    Eko Handiwirawan

    2012-12-01

    Full Text Available In the population, there are aggressive sheep in a small number which requires special management those specific animal house and routine management. The purpose of this study was to identify the variation of DNA marker SNP (single nucleotide polymorphism as a genetic marker for the aggressive trait in several of sheep breed. The identification of point mutations in exon 8 of MAO-A gene associated with aggressive behavior in sheep may be further useful to become of DNA markers for the aggressive trait in sheep. Five of sheep breed were used, i.e.: Barbados Black belly Cross sheep (BC, Composite Garut (KG, Local Garut (LG, Composite Sumatra (KS and St. Cross Croix (SC. Duration of ten behavior traits, blood serotonin concentrations and DNA sequence of exon 8 of MAO-A gene from the sheep aggressive and nonaggressive were observed. PROC GLM of SAS Ver. 9.0 program was used to analyze variable behavior and blood serotonin concentrations. DNA polymorphism in exon 8 of MAO-A gene was analyzed using the MEGA software Ver. 4.0. The results show that the percentage of the aggressive rams of each breed was less than 10 percent; except for the KS sheep is higher (23%. Based on the duration of behavior, aggressive sheep group was not significantly different with non aggressive sheep group, except duration of care giving and drinking behavior. It is known that concentration of blood serotonin in aggressive and non aggressive rams was not significantly different. The aggressive trait in sheep has a mechanism or a different cause like that occurs in mice and humans. In this study, aggressive behavior in sheep was not associated with a mutation in exon 8 of MAO-A gene.

  4. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  5. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  6. Single-nucleotide polymorphisms in the LRWD1 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

    Science.gov (United States)

    Miyamoto, T; Koh, E; Tsujimura, A; Miyagawa, Y; Saijo, Y; Namiki, M; Sengoku, K

    2014-04-01

    Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, ten novel genes involved in human spermatogenesis, including human LRWD1, have been identified by expression microarray analysis of human testictissue. The human LRWD1 protein mediates the origin recognition complex in chromatin, which is critical for the initiation of pre-replication complex assembly in G1 and chromatin organization in post-G1 cells. The Lrwd1 gene expression is specific to the testis in mice. Therefore, we hypothesized that mutation or polymorphisms of LRWD1 participate in male infertility, especially azoospermia. To investigate whether LRWD1 gene defects are associated with azoospermia caused by SCOS and meiotic arrest (MA), mutational analysis was performed in 100 and 30 Japanese patients by direct sequencing of the coding regions, respectively. Statistical analysis was performed for patients with SCOS and MA and in 100 healthy control men. No mutations were found in LRWD1; however, three coding single-nucleotide polymorphisms (SNP1-SNP3) could be detected in the patients. The genotype and allele frequencies in SNP1 and SNP2 were notably higher in the SCOS group than in the control group (P < 0.05). These results suggest the critical role of LRWD1 in human spermatogenesis. © 2013 Blackwell Verlag GmbH.

  7. Single-nucleotide polymorphisms in base excision repair, nucleotide excision repair, and double strand break genes as markers for response to radiotherapy in patients with Stage I to II head-and-neck cancer

    International Nuclear Information System (INIS)

    Carles, Joan; Monzo, Mariano; Amat, Marta; Jansa, Sonia; Artells, Rosa; Navarro, Alfons; Foro, Palmira; Alameda, Francesc; Gayete, Angel; Gel, Bernat; Miguel, Maribel; Albanell, Joan; Fabregat, Xavier

    2006-01-01

    Purpose: Polymorphisms in DNA repair genes can influence response to radiotherapy. We analyzed single-nucleotide polymorphisms (SNP) in nine DNA repair genes in 108 patients with head-and-neck cancer (HNSCC) who had received radiotherapy only. Methods and Materials: From May 1993 to December 2004, patients with Stage I and II histopathologically confirmed HNSCC underwent radiotherapy. DNA was obtained from paraffin-embedded tissue, and SNP analysis was performed using a real-time polymerase chain reaction allelic discrimination TaqMan assay with minor modifications. Results: Patients were 101 men (93.5%) and 7 (6.5%) women, with a median age of 64 years (range, 40 to 89 years). Of the patients, 76 (70.4%) patients were Stage I and 32 (29.6%) were Stage II. The XPF/ERCC1 SNP at codon 259 and XPG/ERCC5 at codon 46 emerged as significant predictors of progression (p 0.00005 and 0.049, respectively) and survival (p = 0.0089 and 0.0066, respectively). Similarly, when variant alleles of XPF/ERCC1, XPG/ERCC5 and XPA were examined in combination, a greater number of variant alleles was associated with shorter time to progression (p = 0.0003) and survival (p 0.0002). Conclusions: Genetic polymorphisms in XPF/ERCC1, XPG/ERCC5, and XPA may significantly influence response to radiotherapy; large studies are warranted to confirm their role in HNSCC

  8. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  9. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    Science.gov (United States)

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  10. Association between Single Nucleotide Polymorphism rs1044925 and the Risk of Coronary Artery Disease and Ischemic Stroke

    Directory of Open Access Journals (Sweden)

    Dong-Feng Wu

    2014-02-01

    Full Text Available The present study was performed to clarify the association between the acyl-CoA:cholesterol acyltransferase-1 (ACAT-1 single nucleotide polymorphism (SNP rs1044925 and the risk of coronary artery disease (CAD and ischemic stroke (IS in the Guangxi Han population. Polymerase chain reaction and restriction fragment length polymorphism was performed to determine the genotypes of the ACAT-1 SNP rs1044925 in 1730 unrelated subjects (CAD, 587; IS, 555; and healthy controls; 588. The genotypic and allelic frequencies of rs1044925 were significantly different between the CAD patients and controls (p = 0.015 and borderline different between the IS patients and controls (p = 0.05. The AC/CC genotypes and C allele were associated with a decreased risk of CAD and IS (CAD: p = 0.014 for AC/CC vs. AA, p = 0.022 for C vs. A; IS: p = 0.014 for AC/CC vs. AA; p = 0.017 for C vs. A. The AC/CC genotypes in the healthy controls, but not in CAD or IS patients, were associated with an increased serum high-density lipoprotein cholesterol (HDL-C concentration. The present study shows that the C allele carriers of ACAT-1 rs1044925 were associated with an increased serum HDL-C level in the healthy controls and decreased risk in CAD and IS patients.

  11. Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Sujana Ghanta

    Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal

  12. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

    Science.gov (United States)

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

    2012-04-01

    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  13. Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

    Science.gov (United States)

    Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

    2014-06-01

    Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

  14. Whole Genome Association Study to Detect Single Nucleotide Polymorphisms for Behavior in Sapsaree Dog (

    Directory of Open Access Journals (Sweden)

    J. H. Ha

    2015-07-01

    Full Text Available The purpose of this study was to characterize genetic architecture of behavior patterns in Sapsaree dogs. The breed population (n = 8,256 has been constructed since 1990 over 12 generations and managed at the Sapsaree Breeding Research Institute, Gyeongsan, Korea. Seven behavioral traits were investigated for 882 individuals. The traits were classified as a quantitative or a categorical group, and heritabilities (h2 and variance components were estimated under the Animal model using ASREML 2.0 software program. In general, the h2 estimates of the traits ranged between 0.00 and 0.16. Strong genetic (rG and phenotypic (rP correlations were observed between nerve stability, affability and adaptability, i.e. 0.9 to 0.94 and 0.46 to 0.68, respectively. To detect significant single nucleotide polymorphism (SNP for the behavioral traits, a total of 134 and 60 samples were genotyped using the Illumina 22K CanineSNP20 and 170K CanineHD bead chips, respectively. Two datasets comprising 60 (Sap60 and 183 (Sap183 samples were analyzed, respectively, of which the latter was based on the SNPs that were embedded on both the 22K and 170K chips. To perform genome-wide association analysis, each SNP was considered with the residuals of each phenotype that were adjusted for sex and year of birth as fixed effects. A least squares based single marker regression analysis was followed by a stepwise regression procedure for the significant SNPs (p<0.01, to determine a best set of SNPs for each trait. A total of 41 SNPs were detected with the Sap183 samples for the behavior traits. The significant SNPs need to be verified using other samples, so as to be utilized to improve behavior traits via marker-assisted selection in the Sapsaree population.

  15. A high throughput single nucleotide polymorphism multiplex assay for parentage assignment in New Zealand sheep.

    Directory of Open Access Journals (Sweden)

    Shannon M Clarke

    Full Text Available Accurate pedigree information is critical to animal breeding systems to ensure the highest rate of genetic gain and management of inbreeding. The abundance of available genomic data, together with development of high throughput genotyping platforms, means that single nucleotide polymorphisms (SNPs are now the DNA marker of choice for genomic selection studies. Furthermore the superior qualities of SNPs compared to microsatellite markers allows for standardization between laboratories; a property that is crucial for developing an international set of markers for traceability studies. The objective of this study was to develop a high throughput SNP assay for use in the New Zealand sheep industry that gives accurate pedigree assignment and will allow a reduction in breeder input over lambing. This required two phases of development--firstly, a method of extracting quality DNA from ear-punch tissue performed in a high throughput cost efficient manner and secondly a SNP assay that has the ability to assign paternity to progeny resulting from mob mating. A likelihood based approach to infer paternity was used where sires with the highest LOD score (log of the ratio of the likelihood given parentage to likelihood given non-parentage are assigned. An 84 "parentage SNP panel" was developed that assigned, on average, 99% of progeny to a sire in a problem where there were 3,000 progeny from 120 mob mated sires that included numerous half sib sires. In only 6% of those cases was there another sire with at least a 0.02 probability of paternity. Furthermore dam information (either recorded, or by genotyping possible dams was absent, highlighting the SNP test's suitability for paternity testing. Utilization of this parentage SNP assay will allow implementation of progeny testing into large commercial farms where the improved accuracy of sire assignment and genetic evaluations will increase genetic gain in the sheep industry.

  16. Development and application of a 20K SNP array in potato

    NARCIS (Netherlands)

    Vos, Peter

    2016-01-01

    In this thesis the results are described of investigations of various application of genome wide SNP (single nucleotide polymorphism) markers. The set of SNP markers was identified by GBS (genotyping by sequencing) strategy. The resulting dataset of 129,156 SNPs across 83 tetraploid varieties was

  17. An Improved Consensus Linkage Map of Barley Based on Flow-Sorted Chromosomes and Single Nucleotide Polymorphism Markers

    Directory of Open Access Journals (Sweden)

    María Muñoz-Amatriaín

    2011-11-01

    Full Text Available Recent advances in high-throughput genotyping have made it easier to combine information from different mapping populations into consensus genetic maps, which provide increased marker density and genome coverage compared to individual maps. Previously, a single nucleotide polymorphism (SNP-based genotyping platform was developed and used to genotype 373 individuals in four barley ( L. mapping populations. This led to a 2943 SNP consensus genetic map with 975 unique positions. In this work, we add data from six additional populations and more individuals from one of the original populations to develop an improved consensus map from 1133 individuals. A stringent and systematic analysis of each of the 10 populations was performed to achieve uniformity. This involved reexamination of the four populations included in the previous map. As a consequence, we present a robust consensus genetic map that contains 2994 SNP loci mapped to 1163 unique positions. The map spans 1137.3 cM with an average density of one marker bin per 0.99 cM. A novel application of the genotyping platform for gene detection allowed the assignment of 2930 genes to flow-sorted chromosomes or arms, confirmed the position of 2545 SNP-mapped loci, added chromosome or arm allocations to an additional 370 SNP loci, and delineated pericentromeric regions for chromosomes 2H to 7H. Marker order has been improved and map resolution has been increased by almost 20%. These increased precision outcomes enable more optimized SNP selection for marker-assisted breeding and support association genetic analysis and map-based cloning. It will also improve the anchoring of DNA sequence scaffolds and the barley physical map to the genetic map.

  18. A single-nucleotide polymorphism of human neuropeptide s gene originated from Europe shows decreased bioactivity.

    Directory of Open Access Journals (Sweden)

    Cheng Deng

    Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.

  19. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    Directory of Open Access Journals (Sweden)

    Tess V Clendenen

    Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  20. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

    Science.gov (United States)

    2013-01-01

    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  1. The single nucleotide polymorphism Gly482Ser in the PGC-1α gene impairs exercise-induced slow-twitch muscle fibre transformation in humans.

    Directory of Open Access Journals (Sweden)

    Peter Steinbacher

    Full Text Available PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2. Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak. Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.

  2. The single nucleotide polymorphism Gly482Ser in the PGC-1α gene impairs exercise-induced slow-twitch muscle fibre transformation in humans.

    Science.gov (United States)

    Steinbacher, Peter; Feichtinger, René G; Kedenko, Lyudmyla; Kedenko, Igor; Reinhardt, Sandra; Schönauer, Anna-Lena; Leitner, Isabella; Sänger, Alexandra M; Stoiber, Walter; Kofler, Barbara; Förster, Holger; Paulweber, Bernhard; Ring-Dimitriou, Susanne

    2015-01-01

    PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α) is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP) in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2). Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak). Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.

  3. Cohort analysis of a single nucleotide polymorphism on DNA chips.

    Science.gov (United States)

    Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

    2004-11-15

    A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

  4. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  5. SNP-PHAGE – High throughput SNP discovery pipeline

    Directory of Open Access Journals (Sweden)

    Cregan Perry B

    2006-10-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs as defined here are single base sequence changes or short insertion/deletions between or within individuals of a given species. As a result of their abundance and the availability of high throughput analysis technologies SNP markers have begun to replace other traditional markers such as restriction fragment length polymorphisms (RFLPs, amplified fragment length polymorphisms (AFLPs and simple sequence repeats (SSRs or microsatellite markers for fine mapping and association studies in several species. For SNP discovery from chromatogram data, several bioinformatics programs have to be combined to generate an analysis pipeline. Results have to be stored in a relational database to facilitate interrogation through queries or to generate data for further analyses such as determination of linkage disequilibrium and identification of common haplotypes. Although these tasks are routinely performed by several groups, an integrated open source SNP discovery pipeline that can be easily adapted by new groups interested in SNP marker development is currently unavailable. Results We developed SNP-PHAGE (SNP discovery Pipeline with additional features for identification of common haplotypes within a sequence tagged site (Haplotype Analysis and GenBank (-dbSNP submissions. This tool was applied for analyzing sequence traces from diverse soybean genotypes to discover over 10,000 SNPs. This package was developed on UNIX/Linux platform, written in Perl and uses a MySQL database. Scripts to generate a user-friendly web interface are also provided with common queries for preliminary data analysis. A machine learning tool developed by this group for increasing the efficiency of SNP discovery is integrated as a part of this package as an optional feature. The SNP-PHAGE package is being made available open source at http://bfgl.anri.barc.usda.gov/ML/snp-phage/. Conclusion SNP-PHAGE provides a bioinformatics

  6. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  7. Results based on 124 cases of breast cancer and 97 controls from Taiwan suggest that the single nucleotide polymorphism (SNP309) in the MDM2 gene promoter is associated with earlier onset and increased risk of breast cancer

    International Nuclear Information System (INIS)

    Sun, Ying-Fang; Leu, Jyh-Der; Chen, Su-Mei; Lin, I-Feng; Lee, Yi-Jang

    2009-01-01

    It has been suggested that the single nucleotide polymorphism 309 (SNP309, T -> G) in the promoter region of the MDM2 gene is important for tumor development; however, with regards to breast cancer, inconsistent associations have been reported worldwide. It is speculated that these conflicting results may have arisen due to different patient subgroups and ethnicities studied. For the first time, this study explores the effect of the MDM2 SNP309 genotype on Taiwanese breast cancer patients. Genomic DNA was obtained from the whole blood of 124 breast cancer patients and 97 cancer-free healthy women living in Taiwan. MDM2 SNP309 genotyping was carried out by restriction fragment length polymorphism (RFLP) assay. The multivariate logistic regression and the Kaplan-Meier method were used for analyzing the risk association and significance of age at diagnosis among different MDM2 SNP309 genotypes, respectively. Compared to the TT genotype, an increased risk association with breast cancer was apparent for the GG genotype (OR = 3.05, 95% CI = 1.04 to 8.95), and for the TG genotype (OR = 2.12, 95% CI = 0.90 to 5.00) after adjusting for age, cardiovascular disease/diabetes, oral contraceptive usage, and body mass index, which exhibits significant difference between cases and controls. Furthermore, the average ages at diagnosis for breast cancer patients were 53.6, 52 and 47 years for those harboring TT, TG and GG genotypes, respectively. A significant difference in median age of onset for breast cancer between GG and TT+TG genotypes was obtained by the log-rank test (p = 0.0067). Findings based on the current sample size suggest that the MDM2 SNP309 GG genotype may be associated with both the risk of breast cancer and an earlier age of onset in Taiwanese women

  8. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    Science.gov (United States)

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

    2015-01-01

    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  9. The Studies of Decision Tree in Estimation of Breast Cancer Risk by Using Polymorphism Nucleotide

    Directory of Open Access Journals (Sweden)

    Frida Seyedmir

    2017-07-01

    Full Text Available Abstract Introduction:   Decision tree is the data mining tools to collect, accurate prediction and sift information from massive amounts of data that are used widely in the field of computational biology and bioinformatics. In bioinformatics can be predict on diseases, including breast cancer. The use of genomic data including single nucleotide polymorphisms is a very important factor in predicting the risk of diseases. The number of seven important SNP among hundreds of thousands genetic markers were identified as factors associated with breast cancer. The objective of this study is to evaluate the training data on decision tree predictor error of the risk of breast cancer by using single nucleotide polymorphism genotype. Methods: The risk of breast cancer were calculated associated with the use of SNP formula:xj = fo * In human,  The decision tree can be used To predict the probability of disease using single nucleotide polymorphisms .Seven SNP with different odds ratio associated with breast cancer considered and coding and design of decision tree model, C4.5, by  Csharp2013 programming language were done. In the decision tree created with the coding, the four important associated SNP was considered. The decision tree error in two case of coding and using WEKA were assessment and percentage of decision tree accuracy in prediction of breast cancer were calculated. The number of trained samples was obtained with systematic sampling. With coding, two scenarios as well as software WEKA, three scenarios with different sets of data and the number of different learning and testing, were evaluated. Results: In both scenarios of coding, by increasing the training percentage from 66/66 to 86/42, the error reduced from 55/56 to 9/09. Also by running of WEKA on three scenarios with different sets of data, the number of different education, and different tests by increasing records number from 81 to 2187, the error rate decreased from 48/15 to 13

  10. Definition of novel GP6 polymorphisms and major difference in haplotype frequencies between populations by a combination of in-depth exon resequencing and genotyping with tag single nucleotide polymorphisms.

    Science.gov (United States)

    Watkins, N A; O'Connor, M N; Rankin, A; Jennings, N; Wilson, E; Harmer, I J; Davies, L; Smethurst, P A; Dudbridge, F; Farndale, R W; Ouwehand, W H

    2006-06-01

    Common genetic variants of cell surface receptors contribute to differences in functional responses and disease susceptibility. We have previously shown that single nucleotide polymorphisms (SNPs) in platelet glycoprotein VI (GP6) determine the extent of response to agonist. In addition, SNPs in the GP6 gene have been proposed as risk factors for coronary artery disease. To completely characterize genetic variation in the GP6 gene we generated a high-resolution SNP map by sequencing the promoter, exons and consensus splice sequences in 94 non-related Caucasoids. In addition, we sequenced DNA encoding the ligand-binding domains of GP6 from non-human primates to determine the level of evolutionary conservation. Eighteen SNPs were identified, six of which encoded amino acid substitutions in the mature form of the protein. The single non-synonymous SNP identified in the exons encoding the ligand-binding domains, encoding for a 103Leu > Val substitution, resulted in reduced ligand binding. Two common protein isoforms were confirmed in Caucasoid with frequencies of 0.82 and 0.15. Variation at the GP6 locus was characterized further by determining SNP frequency in over 2000 individuals from different ethnic backgrounds. The SNPs were polymorphic in all populations studied although significant differences in allele frequencies were observed. Twelve additional GP6 protein isoforms were identified from the genotyping results and, despite extensive variation in GP6, the sequence of the ligand-binding domains is conserved. Sequences from non-human primates confirmed this observation. These data provide valuable information for the optimal selection of genetic variants for use in future association studies.

  11. Resolving incomplete single nucleotide polymorphism tagging of HLA-DQ2.2 for coeliac disease genotyping using digital droplet PCR.

    Science.gov (United States)

    Hardy, M Y; Ontiveros, N; Varney, M D; Tye-Din, J A

    2018-04-01

    A hallmark of coeliac disease (CD) is the exceptionally strong genetic association with HLA-DQ2.5, DQ8, and DQ2.2. HLA typing provides information on CD risk important to both clinicians and researchers. A method that enables simple and fast detection of all CD risk genotypes is particularly desirable for the study of large populations. Single nucleotide polymorphism (SNP)-based HLA typing can detect the CD risk genotypes by detecting a combination of six SNPs but this approach can struggle to resolve HLA-DQ2.2, seen in 4% of European CD patients, because of the low resolution of one negatively predicting SNP. We sought to optimise SNP-based HLA typing by harnessing the additional resolution of digital droplet PCR to resolve HLA-DQ2.2. Here we test this two-step approach in an unselected sample of Mexican DNA and compare its accuracy to DNA typed using traditional exon detection. The addition of digital droplet PCR for samples requiring negative prediction of HLA-DQ2.2 enabled HLA-DQ2.2 to be accurately typed. This technique is a simple addition to a SNP-based typing strategy and enables comprehensive definition of all at-risk HLA genotypes in CD in a timely and cost-effective manner. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  13. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  14. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  15. Wheat in the Mediterranean revisited--tetraploid wheat landraces assessed with elite bread wheat Single Nucleotide Polymorphism markers.

    Science.gov (United States)

    Oliveira, Hugo R; Hagenblad, Jenny; Leino, Matti W; Leigh, Fiona J; Lister, Diane L; Penã-Chocarro, Leonor; Jones, Martin K

    2014-05-08

    Single Nucleotide Polymorphism (SNP) panels recently developed for the assessment of genetic diversity in wheat are primarily based on elite varieties, mostly those of bread wheat. The usefulness of such SNP panels for studying wheat evolution and domestication has not yet been fully explored and ascertainment bias issues can potentially affect their applicability when studying landraces and tetraploid ancestors of bread wheat. We here evaluate whether population structure and evolutionary history can be assessed in tetraploid landrace wheats using SNP markers previously developed for the analysis of elite cultivars of hexaploid wheat. We genotyped more than 100 tetraploid wheat landraces and wild emmer wheat accessions, some of which had previously been screened with SSR markers, for an existing SNP panel and obtained publically available genotypes for the same SNPs for hexaploid wheat varieties and landraces. Results showed that quantification of genetic diversity can be affected by ascertainment bias but that the effects of ascertainment bias can at least partly be alleviated by merging SNPs to haplotypes. Analyses of population structure and genetic differentiation show strong subdivision between the tetraploid wheat subspecies, except for durum and rivet that are not separable. A more detailed population structure of durum landraces could be obtained than with SSR markers. The results also suggest an emmer, rather than durum, ancestry of bread wheat and with gene flow from wild emmer. SNP markers developed for elite cultivars show great potential for inferring population structure and can address evolutionary questions in landrace wheat. Issues of marker genome specificity and mapping need, however, to be addressed. Ascertainment bias does not seem to interfere with the ability of a SNP marker system developed for elite bread wheat accessions to detect population structure in other types of wheat.

  16. Highly significant association between two common single nucleotide polymorphisms in CORIN gene and preeclampsia in Caucasian women.

    Directory of Open Access Journals (Sweden)

    Alain Stepanian

    Full Text Available Preeclampsia is a frequent medical complication during pregnancy. Corin, a serine protease which activates pro-atrial natriuretic peptide, has recently been shown to be involved in the pathophysiology of preeclampsia. The aim of this study was to search for CORIN gene variations and their association to preeclampsia in Caucasian and African women. Our study population was composed of 571 pregnant women (295 with preeclampsia and 276 normotensive controls matched for maternal and gestational age, and ethnic origin. The 22 exons of the CORIN gene were sequenced in a discovery sample (n = 260, where 31 single nucleotide polymorphisms were identified. In a replication sample (n = 311, 4 single nucleotide polymorphisms were tested. Two minor alleles (C for rs2271036 and G for rs2271037 were significantly associated to preeclampsia. Adjusted odds ratios [95% confidence interval] were 2.5 [1.2-3.8] (p = 0.007 and 2.3 [1.5-3.5] (p = 1.3 × 10(-4, respectively. These associations were ethnic-specific, as only found in the Caucasian of subjects (odds ratio = 3.5 [1.8-6.6], p = 1.1 × 10(-4; odds ratio = 3.1 [1.7-5.8], p = 2.1 × 10(-4, for each single nucleotide polymorphism, respectively. The two single nucleotide polymorphisms are in almost perfect linkage disequilibrium (r(2 = 0.93. No specific association was found with severe preeclampsia, early-onset preeclampsia nor fetal growth retardation. In conclusion, this is the first report of a highly significant association between these two single nucleotide polymorphisms in CORIN gene and preeclampsia. Our findings further support the probability of a critical role of corin in preeclamspia pathophysiology at the uteroplacental interface.

  17. Risk of radiation-induced subcutaneous fibrosis in relation to single nucleotide polymorphisms in TGFB1, SOD2, XRCC1, XRCC3, APEX and ATM - a study based on DNA from formalin fixed paraffin embedded tissue samples

    DEFF Research Database (Denmark)

    Andreassen, Christian Nicolaj; Alsner, Jan; Overgaard, Marie

    2006-01-01

    Purpose: In two previously published studies, associations with risk of radiation-induced subcutaneous fibrosis were found for single nucleotide polymorphisms (SNP) in TGFB1 (transforming growth factor beta 1 gene), XRCC1 (X-ray repair cross-complementing 1 gene), XRCC3 (X-ray repair cross...... the influence of genetic variation upon normal tissue radiosensitivity...

  18. A study of single nucleotide polymorphism in the ystB gene of Yersinia enterocolitica strains isolated from various wild animal species.

    Science.gov (United States)

    Bancerz-Kisiel, Agata; Szczerba-Turek, Anna; Platt-Samoraj, Aleksandra; Michalczyk, Maria; Szweda, Wojciech

    2017-03-01

    Y. enterocolitica is the causative agent of yersiniosis. The objective of the article was a study of single nucleotide polymorphism in the ystB gene of Y. enterocolitica strains isolated from various wild animal species. High-resolution melting (HRM) analysis was applied to identify single nucleotide polymorphism (SNP) of ystB gene fragments of 88 Y. enterocolitica biotype 1A strains isolated from wild boar, roe deer, red deer and wild ducks. HRM analysis revealed 14 different melting profiles - 4 of them were defined as regular genotypes (G1, G2, G3, G4), whereas 10 as variations. 24 of the examined Y. enterocolitica strains were classified as G1, 18 strains as a G2, 21 strains as a G3, and 15 strains as a G4. Nucleotide sequences classified as G1 revealed 100% similarity with the Y. enterocolitica D88145.1 sequence (NCBI). Analysis of G2 revealed one point mutation - transition T111A. One mutation was also found in G3, but SNP was placed in a different gene region - transition G193A. Two SNPs - transitions G92C and T111A - were identified in G4. Direct sequencing of 10 variations revealed 5 new variants of the ystB nucleotide sequence: V1 - transition G129A (3 strains); V2 - transitions T111A and G193A (2 strains); V3 - transitions C118T and G193A (1 strain); V4 - transitions C141A and G193A (2 strains); and V5 characterized by 19 SNPs: G83A, T93A, A109G, G114T, C116T, A123G, T134C, T142G, T144C, A150C, G162A, T165G, T170G, T174A, T177G, G178A, A179G, A184G and G193A (2 strains). The predominant genotype in isolates from wild ducks was G1; in red deer G2; in wild boar G3; in roe deer G1 and G4. The proposed HRM method could be used to analyze Y. enterocolitica biotype 1A strains isolated from different sources, including humans.

  19. Heap: a highly sensitive and accurate SNP detection tool for low-coverage high-throughput sequencing data

    KAUST Repository

    Kobayashi, Masaaki; Ohyanagi, Hajime; Takanashi, Hideki; Asano, Satomi; Kudo, Toru; Kajiya-Kanegae, Hiromi; Nagano, Atsushi J.; Tainaka, Hitoshi; Tokunaga, Tsuyoshi; Sazuka, Takashi; Iwata, Hiroyoshi; Tsutsumi, Nobuhiro; Yano, Kentaro

    2017-01-01

    and GP depends on not only their mathematical models, but the quality and quantity of variants employed in the analysis. In NGS single nucleotide polymorphism (SNP) calling, conventional tools ideally require more reads for higher SNP sensitivity

  20. Polymorphisms of Tumor Necrosis Factor Alpha in Moroccan Patients with Gastric Pathology: New Single-Nucleotide Polymorphisms in TNF-α−193 (G/A

    Directory of Open Access Journals (Sweden)

    A. Essadik

    2015-01-01

    Full Text Available Polymorphisms in tumor necrosis factor alpha (TNF-α gene are emerging as key determinants of gastric diseases. The TNF-α−308 (G/A and TNF-α−238 (G/A single-nucleotide polymorphisms SNPs are the most extensively studied. However, all these studies are conducted in Caucasian and Asian populations. Thus, for the first time in Africa, we sought to investigate whether polymorphisms in TNF-α gene were associated with the development of gastric pathology in Morocco. Two SNPs located in the promoter region (positions −308 and −238 in TNF-α gene were genotyped in 244 individuals (170 patients and 74 healthy controls. Odds ratios (ORs and 95% confidence intervals (CI were estimated using logistic regression analysis. The TNF-α−238 (G/A genotype was significantly associated with a high risk of gastritis and gastric cancer (GC (P=0.001 and P=0.002, resp.. Furthermore, a new polymorphism located in the promoter region at position −193 in TNF-α gene was identified. The distribution of this SNP was markedly different in patients suffering from ulcers. The association between TNF-α−193 (G/A genotype and high risk of ulcer was significant (P=0.03. These results suggest that the TNF-α−193 (G/A allele has a protective function against gastric cancer by developing ulcer.

  1. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  2. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  3. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2009-01-01

    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  4. Population genetic analysis of ascertained SNP data

    Directory of Open Access Journals (Sweden)

    Nielsen Rasmus

    2004-03-01

    Full Text Available Abstract The large single nucleotide polymorphism (SNP typing projects have provided an invaluable data resource for human population geneticists. Almost all of the available SNP loci, however, have been identified through a SNP discovery protocol that will influence the allelic distributions in the sampled loci. Standard methods for population genetic analysis based on the available SNP data will, therefore, be biased. This paper discusses the effect of this ascertainment bias on allelic distributions and on methods for quantifying linkage disequilibrium and estimating demographic parameters. Several recently developed methods for correcting for the ascertainment bias will also be discussed.

  5. Polymorphism of the VEGF gene and its association with growth ...

    African Journals Online (AJOL)

    User

    Keywords: VEGF gene, caprine, single nucleotide polymorphism (SNP), genetic variation, PCR-SSCP ... This field is strongly focusing on gene loci and polymorphisms that have ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining. Anal.

  6. A Whole Genome Association Study to Detect Single Nucleotide Polymorphisms for Blood Components (Immunity in a Cross between Korean Native Pig and Yorkshire

    Directory of Open Access Journals (Sweden)

    Y.-M. Lee

    2012-12-01

    Full Text Available The purpose of this study was to detect significant SNPs for blood components that were related to immunity using high single nucleotide polymorphism (SNP density panels in a Korean native pig (KNP×Yorkshire (YK cross population. A reciprocal design of KNP×YK produced 249 F2 individuals that were genotyped for a total of 46,865 available SNPs in the Illumina porcine 60K beadchip. To perform whole genome association analysis (WGA, phenotypes were regressed on each SNP under a simple linear regression model after adjustment for sex and slaughter age. To set up a significance threshold, 0.1% point-wise p value from F distribution was used for each SNP test. Among the significant SNPs for a trait, the best set of SNP markers were determined using a stepwise regression procedure with the rates of inclusion and exclusion of each SNP out of the model at 0.001 level. A total of 54 SNPs were detected; 10, 6, 4, 4, 5, 4, 5, 10, and 6 SNPs for neutrophil, lymphocyte, monocyte, eosinophil, basophil, atypical lymph, immunoglobulin, insulin, and insulin-like growth factor-I, respectively. Each set of significant SNPs per trait explained 24 to 42% of phenotypic variance. Several pleiotropic SNPs were detected on SSCs 4, 13, 14 and 15.

  7. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  8. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  9. SNP typing on the NanoChip electronic microarray

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez Sanchez, Juan Jose; Morling, Niels

    2005-01-01

    We describe a single nucleotide polymorphism (SNP) typing protocol developed for the NanoChip electronic microarray. The NanoChip array consists of 100 electrodes covered by a thin hydrogel layer containing streptavidin. An electric currency can be applied to one, several, or all electrodes...

  10. High performance computing enabling exhaustive analysis of higher order single nucleotide polymorphism interaction in Genome Wide Association Studies.

    Science.gov (United States)

    Goudey, Benjamin; Abedini, Mani; Hopper, John L; Inouye, Michael; Makalic, Enes; Schmidt, Daniel F; Wagner, John; Zhou, Zeyu; Zobel, Justin; Reumann, Matthias

    2015-01-01

    Genome-wide association studies (GWAS) are a common approach for systematic discovery of single nucleotide polymorphisms (SNPs) which are associated with a given disease. Univariate analysis approaches commonly employed may miss important SNP associations that only appear through multivariate analysis in complex diseases. However, multivariate SNP analysis is currently limited by its inherent computational complexity. In this work, we present a computational framework that harnesses supercomputers. Based on our results, we estimate a three-way interaction analysis on 1.1 million SNP GWAS data requiring over 5.8 years on the full "Avoca" IBM Blue Gene/Q installation at the Victorian Life Sciences Computation Initiative. This is hundreds of times faster than estimates for other CPU based methods and four times faster than runtimes estimated for GPU methods, indicating how the improvement in the level of hardware applied to interaction analysis may alter the types of analysis that can be performed. Furthermore, the same analysis would take under 3 months on the currently largest IBM Blue Gene/Q supercomputer "Sequoia" at the Lawrence Livermore National Laboratory assuming linear scaling is maintained as our results suggest. Given that the implementation used in this study can be further optimised, this runtime means it is becoming feasible to carry out exhaustive analysis of higher order interaction studies on large modern GWAS.

  11. Identification and analysis of Single Nucleotide Polymorphisms (SNPs in the mosquito Anopheles funestus, malaria vector

    Directory of Open Access Journals (Sweden)

    Hemingway Janet

    2007-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common source of genetic variation in eukaryotic species and have become an important marker for genetic studies. The mosquito Anopheles funestus is one of the major malaria vectors in Africa and yet, prior to this study, no SNPs have been described for this species. Here we report a genome-wide set of SNP markers for use in genetic studies on this important human disease vector. Results DNA fragments from 50 genes were amplified and sequenced from 21 specimens of An. funestus. A third of specimens were field collected in Malawi, a third from a colony of Mozambican origin and a third form a colony of Angolan origin. A total of 494 SNPs including 303 within the coding regions of genes and 5 indels were identified. The physical positions of these SNPs in the genome are known. There were on average 7 SNPs per kilobase similar to that observed in An. gambiae and Drosophila melanogaster. Transitions outnumbered transversions, at a ratio of 2:1. The increased frequency of transition substitutions in coding regions is likely due to the structure of the genetic code and selective constraints. Synonymous sites within coding regions showed a higher polymorphism rate than non-coding introns or 3' and 5'flanking DNA with most of the substitutions in coding regions being observed at the 3rd codon position. A positive correlation in the level of polymorphism was observed between coding and non-coding regions within a gene. By genotyping a subset of 30 SNPs, we confirmed the validity of the SNPs identified during this study. Conclusion This set of SNP markers represents a useful tool for genetic studies in An. funestus, and will be useful in identifying candidate genes that affect diverse ranges of phenotypes that impact on vector control, such as resistance insecticide, mosquito behavior and vector competence.

  12. Association study of genetic variants at single nucleotide polymorphism rs109231409 of mannose-binding lectins 1 gene with mastitis susceptibility in Vrindavani crossbred cattle

    Directory of Open Access Journals (Sweden)

    V. N. Muhasin Asaf

    2014-10-01

    Full Text Available Aim: The present study was undertaken to identify whether single nucleotide polymorphism (SNP rs109231409 located on mannose-binding lectins 1 (MBL1 gene was associated with mastitis tolerance/susceptibility. Materials and Methods: After grouping 100 Vrindavani crossbred cattle as mastitis positive and negative animals, they were genotyped using polymerase chain reaction (PCR-restriction fragment length polymorphisms method. Gene and genotype frequencies of different patterns were estimated by standard procedure (POPGENE version 1.32, (University of Alberta, Canada and statistical analysis was carried out by logistic regression methods using STATA 12 software (StataCorp LP, USA. Results: The 588 bp fragment of MBL1 gene was amplified using PCR. PCR product was digested with ApaI restriction enzyme showed two distinct genotypes viz., GG (311 bp and 272 bp fragments and GA (588 bp, 311 bp and 277 bp fragments. The gene, genotype frequencies, average heterozygosity, polymorphic information content and χ2 values for the locus rs109231409 was ascertained. Conclusions: No significant association between SNP “rs109231409” with mastitis tolerance was found. Although there is a lack of association, further studies have to be undertaken in a large population in order to validate the impact of rs109231409 (g.855G >A on mastitis tolerance.

  13. G16R single nucleotide polymorphism but not haplotypes of the ß2-adrenergic receptor gene alters cardiac output in humans

    DEFF Research Database (Denmark)

    Rokamp, Kim Z; Staalsø, Jonatan M; Gartmann, Martin

    2013-01-01

    Variation in genes encoding the ß2-adrenergic receptor (ADRB2) and angiotensin-converting enzyme (ACE) may influence Q¿ (cardiac output). The 46G>A (G16R) SNP (single nucleotide polymorphism) has been associated with ß2-mediated vasodilation, but the effect of ADRB2 haplotypes on Q¿ has not been...... studied. Five SNPs within ADRB2 (46G>A, 79C>G, 491C>T, 523C>A and 1053G>C by a pairwise tagging principle) and the I/D (insertion/deletion) polymorphism in ACE were genotyped in 143 subjects. Cardiovascular variables were evaluated by the Model flow method at rest and during incremental cycling exercise...... V¿O2 (oxygen uptake) in G16G subjects, but the increase was 0.5 (0.0-0.9) l/min lower in Arg16 carriers (P=0.035). A similar effect size was observed for the Arg16 haplotypes ACCCG and ACCCC. No interaction was found between ADRB2 and ACE polymorphisms. During exercise, the increase in Q¿ was 0...

  14. Sirtuin1 single nucleotide polymorphism (A2191G is a diagnostic marker for vibration-induced white finger disease

    Directory of Open Access Journals (Sweden)

    Voelter-Mahlknecht Susanne

    2012-10-01

    Full Text Available Abstract Background Vibration-induced white finger disease (VWF, also known as hand-arm vibration syndrome, is a secondary form of Raynaud’s disease, affecting the blood vessels and nerves. So far, little is known about the pathogenesisof the disease. VWF is associated with an episodic reduction in peripheral blood flow. Sirtuin 1, a class III histone deacetylase, has been described to regulate the endothelium dependent vasodilation by targeting endothelial nitric oxide synthase. We assessed Sirt1single nucleotide polymorphisms in patients with VWF to further elucidate the role of sirtuin 1 in the pathogenesis of VWF. Methods Peripheral blood samples were obtained from 74 patients with VWF (male 93.2%, female 6.8%, median age 53 years and from 317 healthy volunteers (gender equally distributed, below 30 years of age. Genomic DNA was extracted from peripheral blood mononuclear cells and screened for potential Sirt1single nucleotide polymorphisms. Four putative genetic polymorphisms out of 113 within the Sirt1 genomic region (NCBI Gene Reference: NM_012238.3 were assessed. Allelic discrimination was performed by TaqMan-polymerasechainreaction-based allele-specific genotyping single nucleotide polymorphism assays. Results Sirt1single nucleotide polymorphism A2191G (Assay C_25611590_10, rs35224060 was identified within Sirt1 exon 9 (amino acid position 731, Ile → Val, with differing allelic frequencies in the VWF population (A/A: 70.5%, A/G: 29.5%, G/G: 0% and the control population (A/A: 99.7%, A/G: 0.3%, G/G: 0.5%, with significance levels of P U test (two-tailed P t-test and Chi-square test with Yates correction (all two-tailed: P Conclusion We identified theSirt1A2191Gsingle nucleotide polymorphism as a diagnostic marker for VWF.

  15. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  16. Single nucleotide polymorphism typing of Mycobacterium ulcerans reveals focal transmission of buruli ulcer in a highly endemic region of Ghana.

    Directory of Open Access Journals (Sweden)

    Katharina Röltgen

    Full Text Available Buruli ulcer (BU is an emerging necrotizing disease of the skin and subcutaneous tissue caused by Mycobacterium ulcerans. While proximity to stagnant or slow flowing water bodies is a risk factor for acquiring BU, the epidemiology and mode of M. ulcerans transmission is poorly understood. Here we have used high-throughput DNA sequencing and comparisons of the genomes of seven M. ulcerans isolates that appeared monomorphic by existing typing methods. We identified a limited number of single nucleotide polymorphisms (SNPs and developed a real-time PCR SNP typing method based on these differences. We then investigated clinical isolates of M. ulcerans on which we had detailed information concerning patient location and time of diagnosis. Within the Densu river basin of Ghana we observed dominance of one clonal complex and local clustering of some of the variants belonging to this complex. These results reveal focal transmission and demonstrate, that micro-epidemiological analyses by SNP typing has great potential to help us understand how M. ulcerans is transmitted.

  17. Identification of field caught Anopheles gambiae s.s. and Anopheles arabiensis by TaqMan single nucleotide polymorphism genotyping

    Directory of Open Access Journals (Sweden)

    Bayoh Nabie M

    2007-02-01

    Full Text Available Abstract Background Identification of Anopheles gambiae s.s. and Anopheles arabiensis from field-collected Anopheles gambiae s.l. is often necessary in basic and applied research, and in operational control programmes. The currently accepted method involves use of standard polymerase chain reaction amplification of ribosomal DNA (rDNA from the 3' 28S to 5' intergenic spacer region of the genome, and visual confirmation of amplicons of predicted size on agarose gels, after electrophoresis. This report describes development and evaluation of an automated, quantitative PCR method based upon TaqMan™ single nucleotide polymorphism (SNP genotyping. Methods Standard PCR, and TaqMan SNP genotyping with newly designed primers and fluorophore-labeled probes hybridizing to sequences of complementary rDNA specific for either An. gambiae s.s. or An. arabiensis, were conducted in three experiments involving field-collected An. gambiae s.l. from western Kenya, and defined laboratory strains. DNA extraction was from a single leg, sonicated for five minutes in buffer in wells of 96-well PCR plates. Results TaqMan SNP genotyping showed a reaction success rate, sensitivity, and species specificity comparable to that of standard PCR. In an extensive field study, only 29 of 3,041 (0.95% were determined to be hybrids by TaqMan (i.e., having rDNA sequences from both species, however, all but one were An. arabiensis by standard PCR, suggesting an acceptably low (ca. 1% error rate for TaqMan genotyping in mistakenly identifying species hybrids. Conclusion TaqMan SNP genotyping proved to be a sensitive and rapid method for identification of An. gambiae s.l. and An. arabiensis, with a high success rate, specific results, and congruence with the standard PCR method.

  18. Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Xie LG

    2015-12-01

    this single nucleotide polymorphism may be associated with genetic susceptibility of bladder cancer among Caucasians. Keywords: bladder cancer, MDM2, single nucleotide polymorphism, rs2279744, recurrence, meta-analysis

  19. Assessment of single nucleotide polymorphisms in screening 52 DNA repair and cell cycle control genes in Fanconi anemia patients

    Directory of Open Access Journals (Sweden)

    Petrović Sandra

    2015-01-01

    Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046

  20. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  1. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  2. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  3. Large SNP arrays for genotyping in crop plants

    Indian Academy of Sciences (India)

    Genotyping with large numbers of molecular markers is now an indispensable tool within plant genetics and breeding. Especially through the identification of large numbers of single nucleotide polymorphism (SNP) markers using the novel high-throughput sequencing technologies, it is now possible to reliably identify many ...

  4. Cell Line Controls for the Genotyping of a Spectrum of Human Single Nucleotide Polymorphisms in the Clinical Laboratory.

    Science.gov (United States)

    Kimbacher, Christine; Paar, Christian; Freystetter, Andrea; Berg, Joerg

    2018-05-01

    Genotyping for clinically important single nucleotide polymorphisms (SNPs) is performed by many clinical routine laboratories. To support testing, quality controls and reference materials are needed. Those may be derived from residual patient samples, left over samples of external quality assurance schemes, plasmid DNA or DNA from cell lines. DNAs from cell lines are commutable and available in large amounts. DNA from 38 cell lines were examined for suitability as controls in 11 SNP assays that are frequently used in a clinical routine laboratory: FV (1691G>A), FII (20210G>A), PAI-1 4G/5G polymorphism, MTHFR (677C>T, 1298A>C), HFE (H63D, S65C, C282Y), APOE (E2, E3, E4), LPH (-13910C>T), UGT1A1 (*28, *36, *37), TPMT (*2, *3A, *3B, *3C), VKORC1 (-1639G>A, 1173C>T), CYP2C9 (*2, *3, *5). Genotyping was performed by real-time PCR with melting curve analysis and confirmed by bi-directional sequencing. We find an almost complete spectrum of genotypic constellations within these 38 cell lines. About 12 cell lines appear sufficient as genotypic controls for the 11 SNP assays by covering almost all of the genotypes. However, hetero- and homozygous genotypes for FII and the alleles TPMT*2, UGT1A1*37 and CYP2C9*5 were not detected in any of the cell lines. DNA from most of the examined cell lines appear suitable as quality controls for these SNP assays in the laboratory routine, as to the implementation of those assays or to prepare samples for quality assurance schemes. Our study may serve as a pilot to further characterize these cell lines to arrive at the status of reference materials.

  5. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

    Science.gov (United States)

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

    2014-07-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  6. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  7. Short communication: relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle.

    Science.gov (United States)

    Cooper, T A; Wiggans, G R; VanRaden, P M

    2013-05-01

    Call rates on both a single nucleotide polymorphism (SNP) basis and an animal basis are used as measures of data quality and as screening tools for genomic studies and evaluations of dairy cattle. To investigate the relationship of SNP call rate and genotype accuracy for individual SNP, the correlation between percentages of missing genotypes and parent-progeny conflicts for each SNP was calculated for 103,313 Holsteins. Correlations ranged from 0.14 to 0.38 for the BovineSNP50 and BovineLD (Illumina Inc., San Diego, CA) and GeneSeek Genomic Profiler (Neogen Corp., Lincoln, NE) chips, with lower correlations for newer chips. For US genomic evaluations, genotypes are excluded for animals with a call rate of call rate for 220,175 Holstein, Jersey, and Brown Swiss genotypes was 99.6%. Animal genotypes with a call rate of ≤99% were examined from the US Department of Agriculture genotype database to determine how genotype call rate is related to accuracy of calls on an animal basis. Animal call rate was determined from SNP used in genomic evaluation and is the number of called autosomal and X-specific SNP genotypes divided by the number of SNP from that type of chip. To investigate the relationship of animal call rate and parentage validation, conflicts between a genotyped animal and its sire or dam were determined through a duo test (opposite homozygous SNP genotypes between sire and progeny; 1,374 animal genotypes) and a trio test (also including conflicts with dam and heterozygous SNP genotype for the animal when both parents are the same homozygote; 482 animal genotypes). When animal call rate was ≤ 80%, parentage validation was no longer reliable with the duo test. With the trio test, parentage validation was no longer reliable when animal call rate was ≤ 90%. To investigate how animal call rate was related to genotyping accuracy for animals with multiple genotypes, concordance between genotypes for 1,216 animals that had a genotype with a call rate of ≤ 99

  8. Phenylethynylpyrene excimer forming hybridization probes for fluorescence SNP detection

    DEFF Research Database (Denmark)

    Prokhorenko, Igor A.; Astakhova, Irina V.; Momynaliev, Kuvat T.

    2009-01-01

    Excimer formation is a unique feature of some fluorescent dyes (e.g., pyrene) which can be used for probing the proximity of biomolecules. Pyrene excimer fluorescence has previously been used for homogeneous detection of single nucleotide polymorphism (SNP) on DNA. 1-Phenylethynylpyrene (1-1-PEPy...

  9. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  10. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    Science.gov (United States)

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  11. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

    Science.gov (United States)

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

    2015-11-14

    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

  12. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    Science.gov (United States)

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  13. Associations between single nucleotide polymorphisms in iron-related genes and iron status in multiethnic populations.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    Full Text Available The existence of multiple inherited disorders of iron metabolism suggests genetic contributions to iron deficiency. We previously performed a genome-wide association study of iron-related single nucleotide polymorphisms (SNPs using DNA from white men aged ≥ 25 y and women ≥ 50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF ≤ 12 µg/L (cases and controls (SF >100 µg/L in men, SF >50 µg/L in women. We report a follow-up study of white, African-American, Hispanic, and Asian HEIRS participants, analyzed for association between SNPs and eight iron-related outcomes. Three chromosomal regions showed association across multiple populations, including SNPs in the TF and TMPRSS6 genes, and on chromosome 18q21. A novel SNP rs1421312 in TMPRSS6 was associated with serum iron in whites (p = 3.7 × 10(-6 and replicated in African Americans (p = 0.0012.Twenty SNPs in the TF gene region were associated with total iron-binding capacity in whites (p<4.4 × 10(-5; six SNPs replicated in other ethnicities (p<0.01. SNP rs10904850 in the CUBN gene on 10p13 was associated with serum iron in African Americans (P = 1.0 × 10(-5. These results confirm known associations with iron measures and give unique evidence of their role in different ethnicities, suggesting origins in a common founder.

  14. Imputation Accuracy from Low to Moderate Density Single Nucleotide Polymorphism Chips in a Thai Multibreed Dairy Cattle Population

    Directory of Open Access Journals (Sweden)

    Danai Jattawa

    2016-04-01

    Full Text Available The objective of this study was to investigate the accuracy of imputation from low density (LDC to moderate density SNP chips (MDC in a Thai Holstein-Other multibreed dairy cattle population. Dairy cattle with complete pedigree information (n = 1,244 from 145 dairy farms were genotyped with GeneSeek GGP20K (n = 570, GGP26K (n = 540 and GGP80K (n = 134 chips. After checking for single nucleotide polymorphism (SNP quality, 17,779 SNP markers in common between the GGP20K, GGP26K, and GGP80K were used to represent MDC. Animals were divided into two groups, a reference group (n = 912 and a test group (n = 332. The SNP markers chosen for the test group were those located in positions corresponding to GeneSeek GGP9K (n = 7,652. The LDC to MDC genotype imputation was carried out using three different software packages, namely Beagle 3.3 (population-based algorithm, FImpute 2.2 (combined family- and population-based algorithms and Findhap 4 (combined family- and population-based algorithms. Imputation accuracies within and across chromosomes were calculated as ratios of correctly imputed SNP markers to overall imputed SNP markers. Imputation accuracy for the three software packages ranged from 76.79% to 93.94%. FImpute had higher imputation accuracy (93.94% than Findhap (84.64% and Beagle (76.79%. Imputation accuracies were similar and consistent across chromosomes for FImpute, but not for Findhap and Beagle. Most chromosomes that showed either high (73% or low (80% imputation accuracies were the same chromosomes that had above and below average linkage disequilibrium (LD; defined here as the correlation between pairs of adjacent SNP within chromosomes less than or equal to 1 Mb apart. Results indicated that FImpute was more suitable than Findhap and Beagle for genotype imputation in this Thai multibreed population. Perhaps additional increments in imputation accuracy could be achieved by increasing the completeness of pedigree information.

  15. Impacts of Nonsynonymous Single Nucleotide Polymorphisms of Adiponectin Receptor 1 Gene on Corresponding Protein Stability: A Computational Approach

    Directory of Open Access Journals (Sweden)

    Md. Abu Saleh

    2016-01-01

    Full Text Available Despite the reported association of adiponectin receptor 1 (ADIPOR1 gene mutations with vulnerability to several human metabolic diseases, there is lack of computational analysis on the functional and structural impacts of single nucleotide polymorphisms (SNPs of the human ADIPOR1 at protein level. Therefore, sequence- and structure-based computational tools were employed in this study to functionally and structurally characterize the coding nsSNPs of ADIPOR1 gene listed in the dbSNP database. Our in silico analysis by SIFT, nsSNPAnalyzer, PolyPhen-2, Fathmm, I-Mutant 2.0, SNPs&GO, PhD-SNP, PANTHER, and SNPeffect tools identified the nsSNPs with distorting functional impacts, namely, rs765425383 (A348G, rs752071352 (H341Y, rs759555652 (R324L, rs200326086 (L224F, and rs766267373 (L143P from 74 nsSNPs of ADIPOR1 gene. Finally the aforementioned five deleterious nsSNPs were introduced using Swiss-PDB Viewer package within the X-ray crystal structure of ADIPOR1 protein, and changes in free energy for these mutations were computed. Although increased free energy was observed for all the mutants, the nsSNP H341Y caused the highest energy increase amongst all. RMSD and TM scores predicted that mutants were structurally similar to wild type protein. Our analyses suggested that the aforementioned variants especially H341Y could directly or indirectly destabilize the amino acid interactions and hydrogen bonding networks of ADIPOR1.

  16. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  17. Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

    Science.gov (United States)

    Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

    2013-03-15

    We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. T-786C single-nucleotide polymorphism (SNP) of endothelial nitric ...

    African Journals Online (AJOL)

    The study was designed to investigate the frequency of T-786C polymorphism of the gene in patients suffering from coronary artery disease (CAD) in North West of Iran. One hundred and twenty (120) subjects including 60 patients with angiographically diagnosed CAD and 60 age and sex matched CAD-free subjects as ...

  19. Integrative analysis of single nucleotide polymorphisms and gene expression efficiently distinguishes samples from closely related ethnic populations

    Directory of Open Access Journals (Sweden)

    Yang Hsin-Chou

    2012-07-01

    Full Text Available Abstract Background Ancestry informative markers (AIMs are a type of genetic marker that is informative for tracing the ancestral ethnicity of individuals. Application of AIMs has gained substantial attention in population genetics, forensic sciences, and medical genetics. Single nucleotide polymorphisms (SNPs, the materials of AIMs, are useful for classifying individuals from distinct continental origins but cannot discriminate individuals with subtle genetic differences from closely related ancestral lineages. Proof-of-principle studies have shown that gene expression (GE also is a heritable human variation that exhibits differential intensity distributions among ethnic groups. GE supplies ethnic information supplemental to SNPs; this motivated us to integrate SNP and GE markers to construct AIM panels with a reduced number of required markers and provide high accuracy in ancestry inference. Few studies in the literature have considered GE in this aspect, and none have integrated SNP and GE markers to aid classification of samples from closely related ethnic populations. Results We integrated a forward variable selection procedure into flexible discriminant analysis to identify key SNP and/or GE markers with the highest cross-validation prediction accuracy. By analyzing genome-wide SNP and/or GE markers in 210 independent samples from four ethnic groups in the HapMap II Project, we found that average testing accuracies for a majority of classification analyses were quite high, except for SNP-only analyses that were performed to discern study samples containing individuals from two close Asian populations. The average testing accuracies ranged from 0.53 to 0.79 for SNP-only analyses and increased to around 0.90 when GE markers were integrated together with SNP markers for the classification of samples from closely related Asian populations. Compared to GE-only analyses, integrative analyses of SNP and GE markers showed comparable testing

  20. The importance of -460 C/T and +405 G/C single nucleotide polymorphisms to the function of vascular endothelial growth factor A in colorectal cancer

    DEFF Research Database (Denmark)

    Hansen, Torben F; Spindler, Karen-Lise G; Lorentzen, Karen A

    2010-01-01

    collected from 113 patients surgically resected for colorectal cancer. SNPs were analysed from genomic DNA by PCR, the VEGF-A gene expression analysis was performed by RT-PCR and protein analysis by ELISA. RESULTS: The T-allele in the -460 C/T SNP and the C-allele in the +405 G/C SNP were associated...... with significantly lower VEGF-A protein levels in normal colorectal tissue. There were no differences in protein levels in the malignant tissue according to genotypes. No differences were observed at the gene expression levels either. CONCLUSION: The results indicate that the two SNPs have a functional influence......PURPOSE: The present study investigated the functional influence of the single nucleotide polymorphisms (SNPs) -460 C/T and +405 G/C at vascular endothelial growth factor A (VEGF-A), mRNA and protein levels in colorectal cancer (CRC) and normal colorectal tissue. METHODS: Blood and tissue were...

  1. Novel Single-Nucleotide Polymorphism Markers Predictive of Pathologic Response to Preoperative Chemoradiation Therapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Kim, Jin C.; Ha, Ye J.; Roh, Seon A.; Cho, Dong H.; Choi, Eun Y.; Kim, Tae W.; Kim, Jong H.; Kang, Tae W.; Kim, Seon Y.; Kim, Yong S.

    2013-01-01

    Purpose: Studies aimed at predicting individual responsiveness to preoperative chemoradiation therapy (CRT) are urgently needed, especially considering the risks associated with poorly responsive patients. Methods and Materials: A 3-step strategy for the determination of CRT sensitivity is proposed based on (1) the screening of a human genome-wide single-nucleotide polymorphism (SNP) array in correlation with histopathologic tumor regression grade (TRG); (2) clinical association analysis of 113 patients treated with preoperative CRT; and (3) a cell-based functional assay for biological validation. Results: Genome-wide screening identified 9 SNPs associated with preoperative CRT responses. Positive responses (TRG 1-3) were obtained more frequently in patients carrying the reference allele (C) of the SNP CORO2A rs1985859 than in those with the substitution allele (T) (P=.01). Downregulation of CORO2A was significantly associated with reduced early apoptosis by 27% (P=.048) and 39% (P=.023) in RKO and COLO320DM colorectal cancer cells, respectively, as determined by flow cytometry. Reduced radiosensitivity was confirmed by colony-forming assays in the 2 colorectal cancer cells (P=.034 and .015, respectively). The SNP FAM101A rs7955740 was not associated with radiosensitivity in the clinical association analysis. However, downregulation of FAM101A significantly reduced early apoptosis by 29% in RKO cells (P=.047), and it enhanced colony formation in RKO cells (P=.001) and COLO320DM cells (P=.002). Conclusion: CRT-sensitive SNP markers were identified using a novel 3-step process. The candidate marker CORO2A rs1985859 and the putative marker FAM101A rs7955740 may be of value for the prediction of radiosensitivity to preoperative CRT, although further validation is needed in large cohorts

  2. Single nucleotide polymorphism array lesions, TET2, DNMT3A, ASXL1 and CBL mutations are present in systemic mastocytosis.

    Directory of Open Access Journals (Sweden)

    Fabiola Traina

    Full Text Available We hypothesized that analysis of single nucleotide polymorphism arrays (SNP-A and new molecular defects may provide new insight in the pathogenesis of systemic mastocytosis (SM. SNP-A karyotyping was applied to identify recurrent areas of loss of heterozygosity and bidirectional sequencing was performed to evaluate the mutational status of TET2, DNMT3A, ASXL1, EZH2, IDH1/IDH2 and the CBL gene family. Overall survival (OS was analyzed using the Kaplan-Meier method. We studied a total of 26 patients with SM. In 67% of SM patients, SNP-A karyotyping showed new chromosomal abnormalities including uniparental disomy of 4q and 2p spanning TET2/KIT and DNMT3A. Mutations in TET2, DNMT3A, ASXL1 and CBL were found in 23%, 12%, 12%, and 4% of SM patients, respectively. No mutations were observed in EZH2 and IDH1/IDH2. Significant differences in OS were observed for SM mutated patients grouped based on the presence of combined TET2/DNMT3A/ASXL1 mutations independent of KIT (P = 0.04 and sole TET2 mutations (P<0.001. In conclusion, TET2, DNMT3A and ASXL1 mutations are also present in mastocytosis and these mutations may affect prognosis, as demonstrated by worse OS in mutated patients.

  3. SNP Arrays

    Directory of Open Access Journals (Sweden)

    Jari Louhelainen

    2016-10-01

    Full Text Available The papers published in this Special Issue “SNP arrays” (Single Nucleotide Polymorphism Arrays focus on several perspectives associated with arrays of this type. The range of papers vary from a case report to reviews, thereby targeting wider audiences working in this field. The research focus of SNP arrays is often human cancers but this Issue expands that focus to include areas such as rare conditions, animal breeding and bioinformatics tools. Given the limited scope, the spectrum of papers is nothing short of remarkable and even from a technical point of view these papers will contribute to the field at a general level. Three of the papers published in this Special Issue focus on the use of various SNP array approaches in the analysis of three different cancer types. Two of the papers concentrate on two very different rare conditions, applying the SNP arrays slightly differently. Finally, two other papers evaluate the use of the SNP arrays in the context of genetic analysis of livestock. The findings reported in these papers help to close gaps in the current literature and also to give guidelines for future applications of SNP arrays.

  4. Multi-generational imputation of single nucleotide polymorphism marker genotypes and accuracy of genomic selection.

    Science.gov (United States)

    Toghiani, S; Aggrey, S E; Rekaya, R

    2016-07-01

    Availability of high-density single nucleotide polymorphism (SNP) genotyping platforms provided unprecedented opportunities to enhance breeding programmes in livestock, poultry and plant species, and to better understand the genetic basis of complex traits. Using this genomic information, genomic breeding values (GEBVs), which are more accurate than conventional breeding values. The superiority of genomic selection is possible only when high-density SNP panels are used to track genes and QTLs affecting the trait. Unfortunately, even with the continuous decrease in genotyping costs, only a small fraction of the population has been genotyped with these high-density panels. It is often the case that a larger portion of the population is genotyped with low-density and low-cost SNP panels and then imputed to a higher density. Accuracy of SNP genotype imputation tends to be high when minimum requirements are met. Nevertheless, a certain rate of genotype imputation errors is unavoidable. Thus, it is reasonable to assume that the accuracy of GEBVs will be affected by imputation errors; especially, their cumulative effects over time. To evaluate the impact of multi-generational selection on the accuracy of SNP genotypes imputation and the reliability of resulting GEBVs, a simulation was carried out under varying updating of the reference population, distance between the reference and testing sets, and the approach used for the estimation of GEBVs. Using fixed reference populations, imputation accuracy decayed by about 0.5% per generation. In fact, after 25 generations, the accuracy was only 7% lower than the first generation. When the reference population was updated by either 1% or 5% of the top animals in the previous generations, decay of imputation accuracy was substantially reduced. These results indicate that low-density panels are useful, especially when the generational interval between reference and testing population is small. As the generational interval

  5. Gut metagenomes of type 2 diabetic patients have characteristic single-nucleotide polymorphism distribution in Bacteroides coprocola.

    Science.gov (United States)

    Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin

    2017-02-01

    Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.

  6. A large-scale chromosome-specific SNP discovery guideline.

    Science.gov (United States)

    Akpinar, Bala Ani; Lucas, Stuart; Budak, Hikmet

    2017-01-01

    Single-nucleotide polymorphisms (SNPs) are the most prevalent type of variation in genomes that are increasingly being used as molecular markers in diversity analyses, mapping and cloning of genes, and germplasm characterization. However, only a few studies reported large-scale SNP discovery in Aegilops tauschii, restricting their potential use as markers for the low-polymorphic D genome. Here, we report 68,592 SNPs found on the gene-related sequences of the 5D chromosome of Ae. tauschii genotype MvGB589 using genomic and transcriptomic sequences from seven Ae. tauschii accessions, including AL8/78, the only genotype for which a draft genome sequence is available at present. We also suggest a workflow to compare SNP positions in homologous regions on the 5D chromosome of Triticum aestivum, bread wheat, to mark single nucleotide variations between these closely related species. Overall, the identified SNPs define a density of 4.49 SNPs per kilobyte, among the highest reported for the genic regions of Ae. tauschii so far. To our knowledge, this study also presents the first chromosome-specific SNP catalog in Ae. tauschii that should facilitate the association of these SNPs with morphological traits on chromosome 5D to be ultimately targeted for wheat improvement.

  7. High-throughput single nucleotide polymorphism genotyping using nanofluidic Dynamic Arrays

    Directory of Open Access Journals (Sweden)

    Crenshaw Andrew

    2009-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have emerged as the genetic marker of choice for mapping disease loci and candidate gene association studies, because of their high density and relatively even distribution in the human genomes. There is a need for systems allowing medium multiplexing (ten to hundreds of SNPs with high throughput, which can efficiently and cost-effectively generate genotypes for a very large sample set (thousands of individuals. Methods that are flexible, fast, accurate and cost-effective are urgently needed. This is also important for those who work on high throughput genotyping in non-model systems where off-the-shelf assays are not available and a flexible platform is needed. Results We demonstrate the use of a nanofluidic Integrated Fluidic Circuit (IFC - based genotyping system for medium-throughput multiplexing known as the Dynamic Array, by genotyping 994 individual human DNA samples on 47 different SNP assays, using nanoliter volumes of reagents. Call rates of greater than 99.5% and call accuracies of greater than 99.8% were achieved from our study, which demonstrates that this is a formidable genotyping platform. The experimental set up is very simple, with a time-to-result for each sample of about 3 hours. Conclusion Our results demonstrate that the Dynamic Array is an excellent genotyping system for medium-throughput multiplexing (30-300 SNPs, which is simple to use and combines rapid throughput with excellent call rates, high concordance and low cost. The exceptional call rates and call accuracy obtained may be of particular interest to those working on validation and replication of genome- wide- association (GWA studies.

  8. Association of single nucleotide polymorphism at position 45 in adiponectin gene with plasma adiponectin level and insulin resistance in obesity

    International Nuclear Information System (INIS)

    Chen Xiaoyu; Li Xisheng; Lin Xiahong; Gao Hongzhi; Li Qiulan; Zha Jinshun

    2012-01-01

    Objective: To explore the association of single nucleotide polymorphism at position 45 (SNP45) in adiponectin gene with plasma adiponectin level and insulin resistance in obesity in Quanzhou area of Fujian province. Methods: Two hundred and forty-eight patients with obesity and 225 normal control subjects were enrolled in this study.Fasting insulin (FINS) were measured by radioimmunoassay and fasting plasma glucose (FPG), total cholesterol (TC), triglyceride (TG), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) were measured by BECKMAN DXC800 biochemistry analyzer. Body mass index (BMI), waist to hip ratio,homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Plasma adiponectin levels were examined by means of enzyme-linked immunosorbentassy. The adiponectin gene SNP45 was identified by PCR-restriction fragment length polymorphism. Results: (1) Frequencies of GG+GT genotype in obesity group and normal control group were 61% and 44% respectively (χ 2 =14.182, P<0.01), and G allele frequencies were 35% and 25% (χ 2 =10.708, P<0.01). (2) In obesity group,the subjects with SNP45 GG+GT genotype had higher TG and LDL-C levels than those with TT genotype (t=2.604, P<0.01; t=5.507, P<0.01), and had lower adiponectin level than those with TT genotype (t=2.275, P<0.05), and had significantly lower HDL-L level than those with TT genotype (t=10.100, P< 0.01). (3) In normal control group,the subjects with SNP45 GG +GT genotype had significantly lower adiponectin,TG,TC levels than those with TT genotype (t=2.510, P<0.05; t=2.922, P<0.01; t=3.272, P< 0.01). (4) Logistic analysis proved that the SNP45 GG+GT genotype in obesity group was associated with decreased risk of plasma adiponectin level (OR=0.810, 95% CI : 0.673-0.975, P<0.05), and with increased risk of HOMA-IR (OR=1.746, 95% CI : 1.060-2.875, P<0.05). The SNP45 GG+GT genotype in normal control group was associated with increased risk of HOMA-IR (OR=3

  9. The Influence of Single Nucleotide Polymorphism Microarray-Based Molecular Karyotype on Preimplantation Embryonic Development Potential.

    Directory of Open Access Journals (Sweden)

    Gang Li

    Full Text Available In order to investigate the influence of the molecular karyotype based on single nucleotide polymorphism (SNP microarray on embryonic development potential in preimplantation genetic diagnosis (PGD, we retrospectively analyzed the clinical data generated by PGD using embryos retrieved from parents with chromosome rearrangements in our center. In total, 929 embryos from 119 couples had exact diagnosis and development status. The blastocyst formation rate of balanced molecular karyotype embryos was 56.6% (276/488, which was significantly higher than that of genetic imbalanced embryos 24.5% (108/441 (P35 respectively. Blastocyst formation rates of male and female embryos were 44.5% (183/411 and 38.8% (201/518 respectively, with no significant difference between them (P>0.05. The rates of balanced molecular karyotype embryos vary from groups of embryos with different cell numbers at 68 hours after insemination. The blastocyst formation rate of embryos with 6-8 cells (48.1% was significantly higher than that of embryos with 8 cells (42.9% (P8 cells, embryos with 6-8 blastomeres have higher rate of balanced molecular karyotype and blastocyst formation.

  10. The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Stephen eSalton

    2013-08-01

    Full Text Available The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs, where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs, with neuropsychiatric, endocrine and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A of the human brain-derived neurotrophic factor (BDNF gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

  11. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  12. Prediction of a deletion copy number variant by a dense SNP panel

    NARCIS (Netherlands)

    Kadri, N.K.; Koks, P.D.; Meuwissen, T.H.E.

    2012-01-01

    Background: A newly recognized type of genetic variation, Copy Number Variation (CNV), is detected in mammalian genomes, e.g. the cattle genome. This form of variation can potentially cause phenotypic variation. Our objective was to determine whether dense SNP (single nucleotide polymorphisms)

  13. Generation of Transcript Assemblies and Identification of Single Nucleotide Polymorphisms from Seven Lowland and Upland Cultivars of Switchgrass

    Directory of Open Access Journals (Sweden)

    Kevin L. Childs

    2014-07-01

    Full Text Available Switchgrass is a North American perennial prairie species that has been used as a rangeland and forage crop and has recently been targeted as a potential biofuel feedstock species. Switchgrass, which occurs as tetraploid and octoploid forms, is classified into lowland or upland ecotypes that differ in growth phenotypes and adaptation to distinct habitats. Using RNA-sequencing (RNA-seq reads derived from crown, young shoot, and leaf tissues, we generated sequence data from seven switchgrass cultivars, three lowland and four upland, to enable comparative analyses between switchgrass cultivars and to identify single nucleotide polymorphisms (SNPs for use in breeding and genetic analysis. We also generated individual transcript assemblies for each of the cultivars. Transcript data indicate that subgenomes of octoploid switchgrass are not substantially different from subgenomes of tetraploids as expected for an autopolyploid origin of switchgrass octoploids. Using RNA-seq reads aligned to the switchgrass Release 0 AP13 reference genome, we identified 1,305,976 high-confidence SNPs. Of these SNPs, 438,464 were unique to lowland cultivars, but only 12,002 were found in all lowlands. Conversely, 723,678 SNPs were unique to upland cultivars, with only 34,665 observed in all uplands. Comparison of our high-confidence transcriptome-derived SNPs with SNPs previously identified in a genotyping-by-sequencing (GBS study of an association panel revealed limited overlap between the two methods, highlighting the utility of transcriptome-based SNP discovery in augmenting genome diversity polymorphism datasets. The transcript and SNP data described here provide a useful resource for switchgrass gene annotation and marker-based analyses of the switchgrass genome.

  14. Development of a TaqMan Allelic Discrimination Assay for detection of Single Nucleotides Polymorphisms associated with anti-malarial drug resistance

    Directory of Open Access Journals (Sweden)

    Kamau Edwin

    2012-01-01

    Full Text Available Abstract Background Anti-malarial drug resistance poses a threat to current global efforts towards control and elimination of malaria. Several methods are used in monitoring anti-malarial drug resistance. Molecular markers such as single nucleotide polymorphism (SNP for example are increasingly being used to identify genetic mutations related to anti-malarial drug resistance. Several methods are currently being used in analysis of SNP associated with anti-malarial drug resistance and although each one of these methods has unique strengths and shortcoming, there is still need to improve and/or develop new methods that will close the gap found in the current methods. Methods TaqMan Allelic Discrimination assays for detection of SNPs associated with anti-malarial drug resistance were designed for analysis on Applied Biosystems PCR platform. These assays were designed by submitting SNP sequences associated with anti-malarial drug resistance to Applied Biosystems website. Eleven SNPs associated with resistance to anti-malarial drugs were selected and tested. The performance of each SNP assay was tested by creating plasmid DNAs carrying codons of interests and analysing them for analysis. To test the sensitivity and specificity of each SNP assay, 12 clinical samples were sequenced at codons of interest and used in the analysis. Plasmid DNAs were used to establish the Limit of Detection (LoD for each assay. Results Data from genetic profiles of the Plasmodium falciparum laboratory strains and sequence data from 12 clinical samples was used as the reference method with which the performance of the SNP assays were compared to. The sensitivity and specificity of each SNP assay was establish at 100%. LoD for each assay was established at 2 GE, equivalent to less than 1 parasite/μL. SNP assays performed well in detecting mixed infection and analysis of clinical samples. Conclusion TaqMan Allelic Discrimination assay provides a good alternative tool in

  15. Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

    Science.gov (United States)

    Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

    2013-01-01

    Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

  16. The potential effect of metallothionein 2A - 5 A/G single nucleotide polymorphism on blood cadmium, lead, zinc and copper levels

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Aliyev, Vugar; Soeylemezoglu, Tuelin

    2011-01-01

    Metallothioneins (MTs) are low molecular weight, cysteine-rich, metal-binding proteins. Because of their rich thiol groups, MTs bind to the biologically essential metals and perform these metals' homeostatic regulations; absorb the heavy metals and assist with their transportation and extraction. The aim of this study was to investigate the association between the metallothionein 2A (MT2A) core promoter region - 5 A/G single nucleotide polymorphism (SNP) and Cd, Pb, Zn and Cu levels in the blood samples. MT2A polymorphism was determined by the standard polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique using the 616 blood samples and the genotype frequencies were found as 86.6% homozygote typical (AA), 12.8% heterozygote (AG) and 0.6% homozygote atypical (GG). Metal levels were analyzed by dual atomic absorption spectrophotometer system and the average levels of Cd, Pb, Zn and Cu in the blood samples were 1.69 ± 1.57 ppb, 30.62 ± 14.13 ppb, 0.98 ± 0.49 ppm and 1.04 ± 0.45 ppm, respectively. As a result; highly statistically significant associations were detected between the - 5 A/G core promoter region SNP in the MT2A gene and Cd, Pb and Zn levels (p = 0.004, p = 0.012 and p = 0.002, respectively), but no association was found with Cu level (p = 0.595). Individuals with the GG genotype had statistically lower Zn level and higher Cd and Pb levels in the blood samples than individuals with AA and AG genotypes. This study suggests that having the GG genotype individuals may be more sensitive for the metal toxicity and they should be more careful about protecting their health against the toxic effects of the heavy metals. - Highlights: → MT2A -5A/G SNP has strong effect on the Cd, Pb and Zn levels in the blood. → MT2A GG individuals should be more careful for their health against metal toxicity. → This SNP might be considered as a biomarker for risk of disease related to metals.

  17. A Long-Read Transcriptome Assembly of Cotton (Gossypium hirsutum L. and Intraspecific Single Nucleotide Polymorphism Discovery

    Directory of Open Access Journals (Sweden)

    Hamid Ashrafi

    2015-07-01

    Full Text Available Upland cotton ( L. has a narrow germplasm base, which constrains marker development and hampers intraspecific breeding. A pressing need exists for high-throughput single nucleotide polymorphism (SNP markers that can be readily applied to germplasm in breeding and breeding-related research programs. Despite progress made in developing new sequencing technologies during the past decade, the cost of sequencing remains substantial when one is dealing with numerous samples and large genomes. Several strategies have been proposed to lower the cost of sequencing for multiple genotypes of large-genome species like cotton, such as transcriptome sequencing and reduced-representation DNA sequencing. This paper reports the development of a transcriptome assembly of the inbred line Texas Marker-1 (TM-1, a genetic standard for cotton, its usefulness as a reference for RNA sequencing (RNA-seq-based SNP identification, and the availability of transcriptome sequences of four other cotton cultivars. An assembly of TM-1 was made using Roche 454 transcriptome reads combined with an assembly of all available public expressed sequence tag (EST sequences of TM-1. The TM-1 assembly consists of 72,450 contigs with a total of 70 million bp. Functional predictions of the transcripts were estimated by alignment to selected protein databases. Transcriptome sequences of the five lines, including TM-1, were obtained using an Illumina Genome Analyzer-II, and the short reads were mapped to the TM-1 assembly to discover SNPs among the five lines. We identified >14,000 unfiltered allelic SNPs, of which ∼3,700 SNPs were retained for assay development after applying several rigorous filters. This paper reports availability of the reference transcriptome assembly and shows its utility in developing intraspecific SNP markers in upland cotton.

  18. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  19. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  20. A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses.

    Directory of Open Access Journals (Sweden)

    Cristina J Wittkopp

    2016-10-01

    Full Text Available Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188 that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses.

  1. saSNP Approach for Scalable SNP Analyses of Multiple Bacterial or Viral Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, Shea [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Slezak, Tom [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2010-07-27

    With the flood of whole genome finished and draft microbial sequences, we need faster, more scalable bioinformatics tools for sequence comparison. An algorithm is described to find single nucleotide polymorphisms (SNPs) in whole genome data. It scales to hundreds of bacterial or viral genomes, and can be used for finished and/or draft genomes available as unassembled contigs. The method is fast to compute, finding SNPs and building a SNP phylogeny in seconds to hours. We use it to identify thousands of putative SNPs from all publicly available Filoviridae, Poxviridae, foot-and-mouth disease virus, Bacillus, and Escherichia coli genomes and plasmids. The SNP-based trees that result are consistent with known taxonomy and trees determined in other studies. The approach we describe can handle as input hundreds of gigabases of sequence in a single run. The algorithm is based on k-mer analysis using a suffix array, so we call it saSNP.

  2. Comparison of three PCR-based assays for SNP genotyping in sugar beet

    Science.gov (United States)

    Background: PCR allelic discrimination technologies have broad applications in the detection of single nucleotide polymorphisms (SNPs) in genetics and genomics. The use of fluorescence-tagged probes is the leading method for targeted SNP detection, but assay costs and error rates could be improved t...

  3. Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women

    Directory of Open Access Journals (Sweden)

    Jéssica de Oliveira

    2017-05-01

    Full Text Available Abstract Butyrylcholinesterase (BChE activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs in the BCHE gene: -116G > A (rs1126680, 1615GA (rs1803274, 1914A 0.05. The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

  4. SNP discovery in nonmodel organisms: strand bias and base-substitution errors reduce conversion rates.

    Science.gov (United States)

    Gonçalves da Silva, Anders; Barendse, William; Kijas, James W; Barris, Wes C; McWilliam, Sean; Bunch, Rowan J; McCullough, Russell; Harrison, Blair; Hoelzel, A Rus; England, Phillip R

    2015-07-01

    Single nucleotide polymorphisms (SNPs) have become the marker of choice for genetic studies in organisms of conservation, commercial or biological interest. Most SNP discovery projects in nonmodel organisms apply a strategy for identifying putative SNPs based on filtering rules that account for random sequencing errors. Here, we analyse data used to develop 4723 novel SNPs for the commercially important deep-sea fish, orange roughy (Hoplostethus atlanticus), to assess the impact of not accounting for systematic sequencing errors when filtering identified polymorphisms when discovering SNPs. We used SAMtools to identify polymorphisms in a velvet assembly of genomic DNA sequence data from seven individuals. The resulting set of polymorphisms were filtered to minimize 'bycatch'-polymorphisms caused by sequencing or assembly error. An Illumina Infinium SNP chip was used to genotype a final set of 7714 polymorphisms across 1734 individuals. Five predictors were examined for their effect on the probability of obtaining an assayable SNP: depth of coverage, number of reads that support a variant, polymorphism type (e.g. A/C), strand-bias and Illumina SNP probe design score. Our results indicate that filtering out systematic sequencing errors could substantially improve the efficiency of SNP discovery. We show that BLASTX can be used as an efficient tool to identify single-copy genomic regions in the absence of a reference genome. The results have implications for research aiming to identify assayable SNPs and build SNP genotyping assays for nonmodel organisms. © 2014 John Wiley & Sons Ltd.

  5. The Brachyury Gly177Asp SNP Is not Associated with a Risk of Skull Base Chordoma in the Chinese Population

    Directory of Open Access Journals (Sweden)

    Zhen Wu

    2013-10-01

    Full Text Available A recent chordoma cancer genotyping study reveals that the rs2305089, a single nucleotide polymorphism (SNP located in brachyury gene and a key gene in the development of notochord, is significantly associated with chordoma risk. The brachyury gene is believed to be one of the key genes involved in the pathogenesis of chordoma, a rare primary bone tumor originating along the spinal column or at the base of the skull. The association between the brachyury Gly177Asp single nucleotide polymorphism (SNP and the risk of skull base chordoma in Chinese populations is currently unknown. We investigated the genotype distribution of this SNP in 65 skull-base chordoma cases and 120 healthy subjects. Comparisons of the genotype distributions and allele frequencies did not reveal any significant difference between the groups. Our data suggest that the brachyury Gly177Asp SNP is not involved in the risks of skull-base chordoma, at least in the Chinese population.

  6. Association analysis of two single-nucleotide polymorphisms of the RELN gene with autism in the South African population

    KAUST Repository

    Sharma, Jyoti Rajan

    2013-02-01

    Background: Autism (MIM209850) is a neurodevelopmental disorder characterized by a triad of impairments, namely impairment in social interaction, impaired communication skills, and restrictive and repetitive behavior. A number of family and twin studies have demonstrated that genetic factors play a pivotal role in the etiology of autistic disorder. Various reports of reduced levels of reelin protein in the brain and plasma in autistic patients highlighted the role of the reelin gene (RELN) in autism. There is no such published study on the South African (SA) population. Aims: The aim of the present study was to find the genetic association of intronic rs736707 and exonic rs362691 (single-nucleotide polymorphisms [SNPs] of the RELN gene) with autism in a SA population. Methods: Genomic DNA was isolated from cheek cell swabs from autistic (136) as well as control (208) subjects. The TaqMan ® Real-Time polymerase chain reaction and genotyping assay was utilized to determine the genotypes. Results: A significant association of SNP rs736707, but not for SNP rs362691, with autism in the SA population is observed. Conclusion: There might be a possible role of RELN in autism, especially for SA populations. The present study represents the first report on genetic association studies on the RELN gene in the SA population. © 2013, Mary Ann Liebert, Inc.

  7. Single Nucleotide Polymorphisms in B-Genome Specific UDP-Glucosyl Transferases Associated with Fusarium Head Blight Resistance and Reduced Deoxynivalenol Accumulation in Wheat Grain.

    Science.gov (United States)

    Sharma, Pallavi; Gangola, Manu P; Huang, Chen; Kutcher, H Randy; Ganeshan, Seedhabadee; Chibbar, Ravindra N

    2018-01-01

    An in vitro spike culture method was optimized to evaluate Fusarium head blight (FHB) resistance in wheat (Triticum aestivum) and used to screen a population of ethyl methane sulfonate treated spike culture-derived variants (SCDV). Of the 134 SCDV evaluated, the disease severity score of 47 of the variants was ≤30%. Single nucleotide polymorphisms (SNP) in the UDP-glucosyltransferase (UGT) genes, TaUGT-2B, TaUGT-3B, and TaUGT-EST, differed between AC Nanda (an FHB-susceptible wheat variety) and Sumai-3 (an FHB-resistant wheat cultivar). SNP at 450 and 1,558 bp from the translation initiation site in TaUGT-2B and TaUGT-3B, respectively were negatively correlated with FHB severity in the SCDV population, whereas the SNP in TaUGT-EST was not associated with FHB severity. Fusarium graminearum strain M7-07-1 induced early expression of TaUGT-2B and TaUGT-3B in FHB-resistant SCDV lines, which were associated with deoxynivalenol accumulation and reduced FHB disease progression. At 8 days after inoculation, deoxynivalenol concentration varied from 767 ppm in FHB-resistant variants to 2,576 ppm in FHB-susceptible variants. The FHB-resistant SCDV identified can be used as new sources of FHB resistance in wheat improvement programs.

  8. The Prediction of the Expected Current Selection Coefficient of Single Nucleotide Polymorphism Associated with Holstein Milk Yield, Fat and Protein Contents

    Directory of Open Access Journals (Sweden)

    Young-Sup Lee

    2016-01-01

    Full Text Available Milk-related traits (milk yield, fat and protein have been crucial to selection of Holstein. It is essential to find the current selection trends of Holstein. Despite this, uncovering the current trends of selection have been ignored in previous studies. We suggest a new formula to detect the current selection trends based on single nucleotide polymorphisms (SNP. This suggestion is based on the best linear unbiased prediction (BLUP and the Fisher’s fundamental theorem of natural selection both of which are trait-dependent. Fisher’s theorem links the additive genetic variance to the selection coefficient. For Holstein milk production traits, we estimated the additive genetic variance using SNP effect from BLUP and selection coefficients based on genetic variance to search highly selective SNPs. Through these processes, we identified significantly selective SNPs. The number of genes containing highly selective SNPs with p-value <0.01 (nearly top 1% SNPs in all traits and p-value <0.001 (nearly top 0.1% in any traits was 14. They are phosphodiesterase 4B (PDE4B, serine/threonine kinase 40 (STK40, collagen, type XI, alpha 1 (COL11A1, ephrin-A1 (EFNA1, netrin 4 (NTN4, neuron specific gene family member 1 (NSG1, estrogen receptor 1 (ESR1, neurexin 3 (NRXN3, spectrin, beta, non-erythrocytic 1 (SPTBN1, ADP-ribosylation factor interacting protein 1 (ARFIP1, mutL homolog 1 (MLH1, transmembrane channel-like 7 (TMC7, carboxypeptidase X, member 2 (CPXM2 and ADAM metallopeptidase domain 12 (ADAM12. These genes may be important for future artificial selection trends. Also, we found that the SNP effect predicted from BLUP was the key factor to determine the expected current selection coefficient of SNP. Under Hardy-Weinberg equilibrium of SNP markers in current generation, the selection coefficient is equivalent to 2*SNP effect.

  9. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Mohamed N. Saad

    2016-01-01

    Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.

  10. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    Science.gov (United States)

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  11. Correlation of Fetuin-A gene rs1071592 and rs2593813 single nucleotide polymorphisms with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Juan YI

    2016-10-01

    Full Text Available Objective  To investigate the relations of Fetuin-A gene rs1071592 and rs2593813 single nucleotide polymorphisms (SNPs with the affect ability to polycystic ovary syndrome (PCOS and its endocrine and metabolic characteristics in Chongqing Han population. Methods  A case-control study was performed in Chinese Han subjects. The clinical data of 156 cases of normal control and 147 cases of PCOS patients were collected, and their blood glucose, lipids, sex hormone and other biochemical indexes were determined, the SNPs of rs1071592 and rs2593813 were genotyped by TaqMan SNP Genotyping Assay. Hyperinsulinemic-euglycemic clamp was performed in 147 PCOS women and 20 controls. The relative risk of developing PCOS in women with rs1071592 genotype was assessed using a binary logistic regression analysis. Results  The distribution frequency of Fetuin-A gene homozygous rs1071592 AA genotype and A allele was significantly increased in PCOS patients than in controls (Pc0.05. Binary logistic regression analysis showed that the risk of developing PCOS was 4.93 times high in women with AA genotype of rs1071592 (OR=4.933, 95%CI 1.593-15.278, P0.05. Conclusion  People with SNPs variants of rs1071592 in Fetuin-A gene may have an increased genetic susceptibility to PCOS. However, there won't be significant relationship between SNP of rs2593813 at Fetuin-A gene and PCOS. DOI: 10.11855/j.issn.0577-7402.2016.09.07

  12. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  13. Single nucleotide polymorphism in toll-like receptor 6 is associated with a decreased risk for ureaplasma respiratory tract colonization and bronchopulmonary dysplasia in preterm infants.

    Science.gov (United States)

    Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M

    2013-08-01

    Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.

  14. Association of polycystic ovary syndrome susceptibility single nucleotide polymorphism rs2479106 and PCOS in Caucasian patients with PCOS or hirsutism as referral diagnosis

    DEFF Research Database (Denmark)

    Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne

    2012-01-01

    Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women.......Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women....

  15. An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

    Science.gov (United States)

    This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

  16. High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: assay success, polymorphism and transferability across species

    Science.gov (United States)

    2011-01-01

    Background High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity ≥2%. The development of a much larger array of informative SNPs across

  17. Detection of Hereditary 1,25-Hydroxyvitamin D-Resistant Rickets Caused by Uniparental Disomy of Chromosome 12 Using Genome-Wide Single Nucleotide Polymorphism Array.

    Directory of Open Access Journals (Sweden)

    Mayuko Tamura

    Full Text Available Hereditary 1,25-dihydroxyvitamin D-resistant rickets (HVDRR is an autosomal recessive disease caused by biallelic mutations in the vitamin D receptor (VDR gene. No patients have been reported with uniparental disomy (UPD.Using genome-wide single nucleotide polymorphism (SNP array to confirm whether HVDRR was caused by UPD of chromosome 12.A 2-year-old girl with alopecia and short stature and without any family history of consanguinity was diagnosed with HVDRR by typical laboratory data findings and clinical features of rickets. Sequence analysis of VDR was performed, and the origin of the homozygous mutation was investigated by target SNP sequencing, short tandem repeat analysis, and genome-wide SNP array.The patient had a homozygous p.Arg73Ter nonsense mutation. Her mother was heterozygous for the mutation, but her father was negative. We excluded gross deletion of the father's allele or paternal discordance. Genome-wide SNP array of the family (the patient and her parents showed complete maternal isodisomy of chromosome 12. She was successfully treated with high-dose oral calcium.This is the first report of HVDRR caused by UPD, and the third case of complete UPD of chromosome 12, in the published literature. Genome-wide SNP array was useful for detecting isodisomy and the parental origin of the allele. Comprehensive examination of the homozygous state is essential for accurate genetic counseling of recurrence risk and appropriate monitoring for other chromosome 12 related disorders. Furthermore, oral calcium therapy was effective as an initial treatment for rickets in this instance.

  18. Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

    Science.gov (United States)

    Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

    2015-05-01

    Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

  19. Analyses of single nucleotide polymorphisms in selected nutrient-sensitive genes in weight-regain prevention: the DIOGENES study.

    Science.gov (United States)

    Larsen, Lesli H; Angquist, Lars; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Kunesova, Marie; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild Ia; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

    2012-05-01

    Differences in the interindividual response to dietary intervention could be modified by genetic variation in nutrient-sensitive genes. This study examined single nucleotide polymorphisms (SNPs) in presumed nutrient-sensitive candidate genes for obesity and obesity-related diseases for main and dietary interaction effects on weight, waist circumference, and fat mass regain over 6 mo. In total, 742 participants who had lost ≥ 8% of their initial body weight were randomly assigned to follow 1 of 5 different ad libitum diets with different glycemic indexes and contents of dietary protein. The SNP main and SNP-diet interaction effects were analyzed by using linear regression models, corrected for multiple testing by using Bonferroni correction and evaluated by using quantile-quantile (Q-Q) plots. After correction for multiple testing, none of the SNPs were significantly associated with weight, waist circumference, or fat mass regain. Q-Q plots showed that ALOX5AP rs4769873 showed a higher observed than predicted P value for the association with less waist circumference regain over 6 mo (-3.1 cm/allele; 95% CI: -4.6, -1.6; P/Bonferroni-corrected P = 0.000039/0.076), independently of diet. Additional associations were identified by using Q-Q plots for SNPs in ALOX5AP, TNF, and KCNJ11 for main effects; in LPL and TUB for glycemic index interaction effects on waist circumference regain; in GHRL, CCK, MLXIPL, and LEPR on weight; in PPARC1A, PCK2, ALOX5AP, PYY, and ADRB3 on waist circumference; and in PPARD, FABP1, PLAUR, and LPIN1 on fat mass regain for dietary protein interaction. The observed effects of SNP-diet interactions on weight, waist, and fat mass regain suggest that genetic variation in nutrient-sensitive genes can modify the response to diet. This trial was registered at clinicaltrials.gov as NCT00390637.

  20. A single nucleotide polymorphism in cBIM is associated with a slower achievement of major molecular response in chronic myeloid leukaemia treated with imatinib.

    Directory of Open Access Journals (Sweden)

    Vanessa Augis

    Full Text Available BIM is essential for the response to tyrosine-kinase inhibitors (TKI in chronic myeloid leukaemia (CML patients. Recently, a deletion polymorphism in intron 2 of the BIM gene was demonstrated to confer an intrinsic TKI resistance in Asian patients. The present study aimed at identifying mutations in the BIM sequence that could lead to imatinib resistance independently of BCR-ABL mutations.BIM coding sequence analysis was performed in 72 imatinib-treated CML patients from a French population of our centre and in 29 healthy controls (reference population as a case-control study. Real-time quantitative PCR (RT qPCR was performed to assess Bim expression in our reference population.No mutation with amino-acid change was found in the BIM coding sequence. However, we observed a silent single nucleotide polymorphism (SNP c465C>T (rs724710. A strong statistical link was found between the presence of the T allele and the high Sokal risk group (p = 0.0065. T allele frequency was higher in non responsive patients than in the reference population (p = 0.0049. Similarly, this T allele was associated with the mutation frequency on the tyrosine kinase domain of BCR-ABL (pT SNP of BIM could be useful for predicting the outcome of imatinib-treated CML patients.

  1. A at single nucleotide polymorphism-358 is required for G at -420 to confer the highest plasma resistin in the general Japanese population.

    Directory of Open Access Journals (Sweden)

    Hiroshi Onuma

    Full Text Available Insulin resistance is a feature of type 2 diabetes. Resistin, secreted from adipocytes, causes insulin resistance in mice. We previously reported that the G/G genotype of single nucleotide polymorphism (SNP at -420 (rs1862513 in the human resistin gene (RETN increased susceptibility to type 2 diabetes by enhancing its promoter activity. Plasma resistin was highest in Japanese subjects with G/G genotype, followed by C/G, and C/C. In this study, we cross-sectionally analyzed plasma resistin and SNPs in the RETN region in 2,019 community-dwelling Japanese subjects. Plasma resistin was associated with SNP-638 (rs34861192, SNP-537 (rs34124816, SNP-420, SNP-358 (rs3219175, SNP+299 (rs3745367, and SNP+1263 (rs3745369 (P<10(-13 in all cases. SNP-638, SNP -420, SNP-358, and SNP+157 were in the same linkage disequilibrium (LD block. SNP-358 and SNP-638 were nearly in complete LD (r(2 = 0.98, and were tightly correlated with SNP-420 (r(2 = 0.50, and 0.51, respectively. The correlation between either SNP-358 (or SNP-638 or SNP-420 and plasma resistin appeared to be strong (risk alleles for high plasma resistin; A at SNP-358, r(2 = 0.5224, P = 4.94x10(-324; G at SNP-420, r(2 = 0.2616, P = 1.71x10(-133. In haplotypes determined by SNP-420 and SNP-358, the estimated frequencies for C-G, G-A, and G-G were 0.6700, 0.2005, and 0.1284, respectively, and C-A was rare (0.0011, suggesting that subjects with A at -358, generally had G at -420. This G-A haplotype conferred the highest plasma resistin (8.24 ng/ml difference/allele compared to C-G, P<0.0001. In THP-1 cells, the RETN promoter with the G-A haplotype showed the highest activity. Nuclear proteins specifically recognized one base difference at SNP-358, but not at SNP-638. Therefore, A at -358 is required for G at -420 to confer the highest plasma resistin in the general Japanese population. In Caucasians, the association between SNP-420 and plasma resistin is not strong, and A at -358 may not exist

  2. A Single-Nucleotide Polymorphism in Serine-Threonine Kinase 11, the Gene Encoding Liver Kinase B1, Is a Risk Factor for Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Anne I. Boullerne

    2015-02-01

    Full Text Available We identified a family in which five siblings were diagnosed with multiple sclerosis (MS or clinically isolated syndrome. Several women in the maternal lineage have comorbidities typically associated with Peutz Jeghers Syndrome, a rare autosomal-dominant disease caused by mutations in the serine-threonine-kinase 11 (STK11 gene, which encodes liver kinase B1. Sequence analysis of DNA from one sibling identified a single-nucleotide polymorphism (SNP within STK11 intron 5. This SNP (dbSNP ID: rs9282860 was identified by TaqMan polymerase chain reaction (PCR assays in DNA samples available from two other siblings. Further screening was carried out in samples from 654 relapsing-remitting MS patients, 100 primary progressive MS patients, and 661 controls. The STK11-SNP has increased frequency in all female patients versus controls (odds ratio = 1.66, 95% CI = 1.05, 2.64, p = .032. The STK11-SNP was not associated with disease duration or onset; however, it was significantly associated with reduced severity (assessed by MS severity scores, with the lowest scores in patients who also harbored the HLA-DRB1*1501 allele. In vitro studies showed that peripheral blood mononuclear cells from members of the family were more sensitive to the mitochondrial inhibitor metformin than cells from MS patients with the major STK11 allele. The increased association of SNP rs9282860 in women with MS defines this variant as a genetic risk factor. The lower disease severity observed in the context of HLA-DRB1*1501 combined with limited in vitro studies raises the provocative possibility that cells harboring the STK11-SNP could be targeted by drugs which increase metabolic stress.

  3. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    Science.gov (United States)

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (pGraves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  4. Analysis of single nucleotide polymorphisms of CRYGA and CRYGB genes in control population of western Indian origin

    Directory of Open Access Journals (Sweden)

    Kapur Suman

    2009-01-01

    Full Text Available Aim: Polymorphisms in γ-crystallins ( CRYG can serve as markers for lens differentiation and eye disorders leading to cataract. Several investigators have reported the presence of sequence variations within crystallin genes, with or without apparent effects on the function of the proteins both in mice and humans. Delineation of these polymorphic sites may explain the differences observed in the susceptibility to cataract observed among various ethnic groups. An easier Restriction Fragment Length Polymorphism (RFLP-based method has been used to detect the frequency of four single nucleotide polymorphisms (SNPs in CRYGA / CRYGB genes in control subjects of western Indian origin. Materials and Methods: A total of 137 healthy volunteers from western India were studied. Examination was performed to exclude volunteers with any ocular defects. Polymerase chain reaction (PCR-RFLP based method was developed for genotyping of G198A (Intron A, T196C (Exon 3 of CRYGA and T47C (Promoter, G449T (Exon 2 of CRYGB genes. Results: The exonic SNPs in CRYGA and CRYGB were found to have an allele frequency 0.03 and 1.00 for ancestral allele respectively, while frequency of non-coding SNP in CRYGA was 0.72. Allele frequency of T90C of CRYGB varied significantly ( P = 0.02 among different age groups. An in-silico analysis reveals that this sequence variation in CRYGB promoter impacts the binding of two transcription factors, ACE2 (Member of CLB2 cluster and Progesterone Receptor (PR which may impact the expression of CRYGB gene. Conclusions: This study establishes baseline frequency data for four SNPs in CRYGA and CRYGB genes for future case control studies on the role of these SNPs in the genetic basis of cataract.

  5. A Genome Wide Association Study on Age at First Calving Using High Density Single Nucleotide Polymorphism Chips in Hanwoo (

    Directory of Open Access Journals (Sweden)

    K.-E. Hyeong

    2014-10-01

    Full Text Available Age at first calving is an important trait for achieving earlier reproductive performance. To detect quantitative trait loci (QTL for reproductive traits, a genome wide association study was conducted on the 96 Hanwoo cows that were born between 2008 and 2010 from 13 sires in a local farm (Juk-Am Hanwoo farm, Suncheon, Korea and genotyped with the Illumina 50K bovine single nucleotide polymorphism (SNP chips. Phenotypes were regressed on additive and dominance effects for each SNP using a simple linear regression model after the effects of birth-year-month and polygenes were considered. A forward regression procedure was applied to determine the best set of SNPs for age at first calving. A total of 15 QTL were detected at the comparison-wise 0.001 level. Two QTL with strong statistical evidence were found at 128.9 Mb and 111.1 Mb on bovine chromosomes (BTA 2 and 7, respectively, each of which accounted for 22% of the phenotypic variance. Also, five significant SNPs were detected on BTAs 10, 16, 20, 26, and 29. Multiple QTL were found on BTAs 1, 2, 7, and 14. The significant QTLs may be applied via marker assisted selection to increase rate of genetic gain for the trait, after validation tests in other Hanwoo cow populations.

  6. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  7. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    Science.gov (United States)

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  8. Signatures of selection in the Iberian honey bee (Apis mellifera iberiensis) revealed by a genome scan analysis of single nucleotide polymorphisms.

    Science.gov (United States)

    Chávez-Galarza, Julio; Henriques, Dora; Johnston, J Spencer; Azevedo, João C; Patton, John C; Muñoz, Irene; De la Rúa, Pilar; Pinto, M Alice

    2013-12-01

    Understanding the genetic mechanisms of adaptive population divergence is one of the most fundamental endeavours in evolutionary biology and is becoming increasingly important as it will allow predictions about how organisms will respond to global environmental crisis. This is particularly important for the honey bee, a species of unquestionable ecological and economical importance that has been exposed to increasing human-mediated selection pressures. Here, we conducted a single nucleotide polymorphism (SNP)-based genome scan in honey bees collected across an environmental gradient in Iberia and used four FST -based outlier tests to identify genomic regions exhibiting signatures of selection. Additionally, we analysed associations between genetic and environmental data for the identification of factors that might be correlated or act as selective pressures. With these approaches, 4.4% (17 of 383) of outlier loci were cross-validated by four FST -based methods, and 8.9% (34 of 383) were cross-validated by at least three methods. Of the 34 outliers, 15 were found to be strongly associated with one or more environmental variables. Further support for selection, provided by functional genomic information, was particularly compelling for SNP outliers mapped to different genes putatively involved in the same function such as vision, xenobiotic detoxification and innate immune response. This study enabled a more rigorous consideration of selection as the underlying cause of diversity patterns in Iberian honey bees, representing an important first step towards the identification of polymorphisms implicated in local adaptation and possibly in response to recent human-mediated environmental changes. © 2013 John Wiley & Sons Ltd.

  9. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  10. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    Science.gov (United States)

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  11. Single Nucleotide Polymorphism TGFβ1 R25P Correlates with Acute Toxicity during Neoadjuvant Chemoradiotherapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Smith, J. Joshua; Wasserman, Isaac; Milgrom, Sarah A.; Chow, Oliver S.; Chen, Chin-Tung; Patil, Sujata; Goodman, Karyn A.; Garcia-Aguilar, Julio

    2017-01-01

    Purpose: To validate the finding of an association between single nucleotide polymorphisms (SNPs) and toxicity during chemoradiotherapy (CRT) in rectal cancer patients, in an independent population. Methods and Materials: The cohort consisted of 165 patients who received CRT for rectal cancer from 2006 to 2012. Prospectively recorded toxicity information, graded according to the Common Terminology Criteria for Adverse Events version 3.0, was retrieved from the medical record. Additionally, a subset of 52 patients recorded their gastrointestinal symptoms weekly during CRT, using the 7-item Bowel Problems Scale. Deoxyribonucleic acid was extracted from normal tissue in the proctectomy specimens and screened for 3 SNPs: XRCC1 R399Q, XPD K751Q, and TGFβ1 R25P. Univariable and multivariable logistic regression models were constructed. Results: The median radiation dose was 50.4 Gy, and all patients received concurrent chemotherapy. Toxicities measured by the Common Terminology Criteria for Adverse Events were closely associated with patient-reported outcomes for the patients who completed the 7-item Bowel Problems Scale. Grade ≥3 toxicity occurred during CRT in 14 patients (8%). All 14 patients had either XRCC1 R399Q or TGFβ1 R25P polymorphisms. The TGFβ1 R25P polymorphism was significantly associated with grade ≥3 toxicity (odds ratio [OR] 3.47, P=.04) and, in patients who completed the Bowel Problems Scale, with grade ≥4 toxicity (OR 5.61, P=.02). The latter finding persisted in a multivariable logistic regression model controlling for ethnicity, age, and sex (adjusted OR 1.83, P=.02). Conclusions: We have validated the correlation between the TGFβ1 R25P SNP and acute toxicity during CRT in an independent cohort using both clinician- and patient-reported toxicity. The information from our study could be used as a basis to formulate a prospective trial testing the utility of this SNP as a biomarker of acute toxicity during neoadjuvant treatment in locally

  12. Single Nucleotide Polymorphism TGFβ1 R25P Correlates with Acute Toxicity during Neoadjuvant Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Smith, J. Joshua [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Wasserman, Isaac [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Icahn School of Medicine at Mount Sinai, New York, New York (United States); Milgrom, Sarah A. [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Chow, Oliver S.; Chen, Chin-Tung [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Patil, Sujata [Department of Epidemiology and Biostatistics, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Goodman, Karyn A. [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Garcia-Aguilar, Julio, E-mail: garciaaj@mskcc.org [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States)

    2017-04-01

    Purpose: To validate the finding of an association between single nucleotide polymorphisms (SNPs) and toxicity during chemoradiotherapy (CRT) in rectal cancer patients, in an independent population. Methods and Materials: The cohort consisted of 165 patients who received CRT for rectal cancer from 2006 to 2012. Prospectively recorded toxicity information, graded according to the Common Terminology Criteria for Adverse Events version 3.0, was retrieved from the medical record. Additionally, a subset of 52 patients recorded their gastrointestinal symptoms weekly during CRT, using the 7-item Bowel Problems Scale. Deoxyribonucleic acid was extracted from normal tissue in the proctectomy specimens and screened for 3 SNPs: XRCC1 R399Q, XPD K751Q, and TGFβ1 R25P. Univariable and multivariable logistic regression models were constructed. Results: The median radiation dose was 50.4 Gy, and all patients received concurrent chemotherapy. Toxicities measured by the Common Terminology Criteria for Adverse Events were closely associated with patient-reported outcomes for the patients who completed the 7-item Bowel Problems Scale. Grade ≥3 toxicity occurred during CRT in 14 patients (8%). All 14 patients had either XRCC1 R399Q or TGFβ1 R25P polymorphisms. The TGFβ1 R25P polymorphism was significantly associated with grade ≥3 toxicity (odds ratio [OR] 3.47, P=.04) and, in patients who completed the Bowel Problems Scale, with grade ≥4 toxicity (OR 5.61, P=.02). The latter finding persisted in a multivariable logistic regression model controlling for ethnicity, age, and sex (adjusted OR 1.83, P=.02). Conclusions: We have validated the correlation between the TGFβ1 R25P SNP and acute toxicity during CRT in an independent cohort using both clinician- and patient-reported toxicity. The information from our study could be used as a basis to formulate a prospective trial testing the utility of this SNP as a biomarker of acute toxicity during neoadjuvant treatment in locally

  13. Development and validation of a 20K single nucleotide polymorphism (SNP) whole genome genotyping array for apple (Malus × domestica Borkh).

    Science.gov (United States)

    Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela

    2014-01-01

    High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs.

  14. Development and validation of a 20K single nucleotide polymorphism (SNP whole genome genotyping array for apple (Malus × domestica Borkh.

    Directory of Open Access Journals (Sweden)

    Luca Bianco

    Full Text Available High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus. A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs. Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs.

  15. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh)

    Science.gov (United States)

    Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela

    2014-01-01

    High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs. PMID:25303088

  16. Assembling a dual purpose TaqMan-based panel of single-nucleotide polymorphism markers in rainbow trout and steelhead (Oncorhynchus mykiss) for association mapping and population genetics analysis

    DEFF Research Database (Denmark)

    Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede

    2011-01-01

    We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...

  17. Single Nucleotide Polymorphisms in STAT3 and STAT4 and Risk of Hepatocellular Carcinoma in Thai Patients with Chronic Hepatitis B.

    Science.gov (United States)

    Chanthra, Nawin; Payungporn, Sunchai; Chuaypen, Natthaya; Piratanantatavorn, Kesmanee; Pinjaroen, Nutcha; Poovorawan, Yong; Tangkijvanich, Pisit

    2015-01-01

    Hepatitis B virus (HBV) infection is the leading cause of hepatocellular carcinoma (HCC) development. Recent studies demonstrated that single nucleotide polymorphisms (SNPs) rs2293152 in signal transducer and activator of transcription 3 (STAT3) and rs7574865 in signal transducer and activator of transcription 4 (STAT4) are associated with chronic hepatitis B (CHB)-related HCC in the Chinese population. We hypothesized that these polymorphisms might be related to HCC susceptibility in Thai population as well. Study subjects were divided into 3 groups consisting of CHB-related HCC (n=192), CHB without HCC (n=200) and healthy controls (n=190). The studied SNPs were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The results showed that the distribution of different genotypes for both polymorphisms were in Hardy-Weinberg equilibrium (P>0.05). Our data demonstrated positive association of rs7574865 with HCC risk when compared to healthy controls under an additive model (GG versus TT: odds ratio (OR) =2.07, 95% confidence interval (CI)=1.06-4.03, P=0.033). This correlation remained significant under allelic and recessive models (OR=1.46, 95% CI=1.09-1.96, P=0.012 and OR=1.71, 95% CI=1.13-2.59, P=0.011, respectively). However, no significant association between rs2293152 and HCC development was observed. These data suggest that SNP rs7574865 in STAT4 might contribute to progression to HCC in the Thai population.

  18. Rapid Identification of Echinococcus granulosus and E. canadensis Using High-Resolution Melting (HRM) Analysis by Focusing on a Single Nucleotide Polymorphism.

    Science.gov (United States)

    Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader

    2016-07-22

    High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.

  19. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  20. Association of 308G/A TNF-α gene polymorphism and spontaneous ...

    African Journals Online (AJOL)

    Background: Single nucleotide polymorphism (SNP) within tumor necrosis factor alpha (TNF-α) gene promoter (308G/A TNFA) is associated with higher gene expression. The role of this SNP as a risk factor for spontaneous preterm birth has been assessed in some regions and the findings were significantly different ...

  1. In silico Analysis of the Functional and Structural Impacts of Non-synonymous Single Nucleotide Polymorphisms in the Human Paraxonase 1 Gene

    Directory of Open Access Journals (Sweden)

    Sudip Paul

    2015-09-01

    Full Text Available Computational approaches could help in identifying deleterious non-synonymous single nucleotide polymorphisms (nsSNPs in a disease related gene which is a difficult and laborious task through laboratory experiments. In the present study, we analyzed the impacts of nsSNPs on structure and function of Paraxonase 1 (PON1 using different bioinformatics tools. The human PON1 protein sequence and its corresponding gene's SNP information were collected from UniProt and dbSNP databases, respectively. We utilized SIFT, Polyphen, I-Mutant 2.0, MutPred, SNP and GO, PhD-SNP and PANTHER tools in order to examine the total 39 nsSNPs occurring in the PON1 coding region. We filtered the most pathological mutations by combining the scores of the aforementioned servers and found 8 SNPs (G344C, S302L, W281C, D279Y, H134R, F120S, L90P, C42R as deleterious and disease causing. The PDB structure of PON1 protein was obtained from RCSB Protein Data Bank (PDB ID: 1V04. The deleterious SNPs in native PON1 were introduced using Swiss-PDB Viewer package and changes in free energy were observed for six out of eight mutant structures. Two SNPs, S302L (substitution of serine to leucine at 302 position in amino acid sequence and L90P (substitution of leucine to proline at 90 position in amino acid sequence caused the highest energy increase amongst all. The findings implicate that these nsSNPs would be analyzed further in detail to enumerate their possible association with the protein deteriorating and disease causal potentialities.

  2. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    Science.gov (United States)

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  3. Single nucleotide polymorphism in gene encoding transcription factor Prep1 is associated with HIV-1-associated dementia.

    Directory of Open Access Journals (Sweden)

    Sebastiaan M Bol

    Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.

  4. Impact of genetic polymorphisms of four cytokine genes on treatment ...

    African Journals Online (AJOL)

    Background: Many factors contribute for viral clearance and response to antiviral therapy. Genetic polymorphisms of cytokines, chemokines, and their receptors can alter the immune response against Hepatitis C virus (HCV). Aim of the study: The aim of the current study is to assess single nucleotide polymorphism (SNP) in ...

  5. Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding.

    Science.gov (United States)

    Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken

    2014-12-01

    In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  6. Identification of novel single nucleotide polymorphisms associated with acute respiratory distress syndrome by exome-seq.

    Directory of Open Access Journals (Sweden)

    Katherine Shortt

    Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.

  7. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

    Science.gov (United States)

    Waterfall, C M; Cobb, B D

    2001-12-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

  8. Association of a specific major histocompatibility complex class IIβ single nucleotide polymorphism with resistance to lactococcosis in rainbow trout, Oncorhynchus mykiss (Walbaum).

    Science.gov (United States)

    Colussi, S; Prearo, M; Bertuzzi, S A; Scanzio, T; Peletto, S; Favaro, L; Modesto, P; Maniaci, M G; Ru, G; Desiato, R; Acutis, P L

    2015-01-01

    Major histocompatibility complex (MHC) loci encode glycoproteins that bind to foreign peptides and initiate immune responses through their interaction with T cells. MHC class II molecules are heterodimers consisting of α and β chains encoded by extremely variable genes; variation in exon 2 is responsible for the majority of observed polymorphisms, mostly concentrated in the codons specifying the peptide-binding region. Lactococcus garvieae is the causative agent of lactococcosis, a warm-water bacterial infection pathogenic for cultured freshwater and marine fish. It causes considerable economic losses, limiting the profitability and development of fish industries in general and the intensive production of rainbow trout, Oncorhynchus mykiss (Walbaum), in particular. The disease is currently controlled with vaccines and antibiotics; however, vaccines have short-term efficacy, and increasing concerns regarding antibiotic residues have called for alternative strategies. To explore the involvement of the MHC class II β-1 domain as a candidate gene for resistance to lactococcosis, we exposed 400 rainbow trout to naturally contaminated water. One single nucleotide polymorphism (SNP) and one haplotype were associated with resistance (P trout resistant to lactococcosis. © 2014 John Wiley & Sons Ltd.

  9. A single nucleotide polymorphism in the promoter of the LOXL1 gene and its relationship to pelvic organ prolapse and preterm premature rupture of membranes.

    Science.gov (United States)

    Ferrell, Georgia; Lu, Minyan; Stoddard, Paul; Sammel, Mary D; Romero, Roberto; Strauss, Jerome F; Matthews, Catherine A

    2009-05-01

    Pelvic organ prolapse and preterm premature rupture of membranes, the 2 conditions which have in common weakening of the tensile strength of tissues, are thought to be caused, in part, by abnormal extracellular matrix synthesis and/or catabolism. We identified a new single nucleotide polymorphism (NT_010194(LOXL1):g.45008784A>C) in the promoter of the LOXL1 gene, which is essential for elastin synthesis. Promoter studies showed that the minor "C'' allele had significantly greater activity than the major "A'' allele. Case-control studies examined the association of the alleles of this single nucleotide polymorphism with pelvic organ prolapse and preterm premature rupture of membranes. When comparing allele frequencies and genotypes in pelvic organ prolapse cases versus controls, no significant associations were found. A case-control study conducted in African American neonates also found no significant associations between the promoter alleles and preterm premature rupture of membranes. We conclude that a functional single nucleotide polymorphism exists in the promoter region of the LOXL1 gene. Association studies suggest that the promoter single nucleotide polymorphism does not contribute significantly to risk of pelvic organ prolapse or preterm premature rupture of membranes.

  10. Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

    Science.gov (United States)

    Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

    2017-04-01

    Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

  11. A single nucleotide polymorphism in the dimethylarginine dimethylaminohydrolase gene is associated with lower risk of pulmonary hypertension in bronchopulmonary dysplasia

    Science.gov (United States)

    Trittmann, JK; Gastier-Foster, JM; Zmuda, EJ; Frick, J; Rogers, LK; Vieland, VJ; Chicoine, LG; Nelin, LD

    2016-01-01

    Aim Pulmonary hypertension (PH) develops in 25–40% of bronchopulmonary dysplasia (BPD) patients, substantially increasing mortality. We have previously found that asymmetric dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide (NO) production, is elevated in patients with BPD-associated PH. ADMA is metabolized by NG,NG- dimethylarginine dimethylaminohydrolase (DDAH). Presently, we test the hypothesis that there are single nucleotide polymorphisms (SNPs) in DDAH1 and/or DDAH2 associated with the development of PH in BPD patients. Methods BPD patients were enrolled (n=98) at Nationwide Children’s Hospital. Clinical characteristics and 36 SNPs in DDAH1 and DDAH2 were compared between BPD-associated PH patients (cases) and BPD-alone patients (controls). Results In BPD patients, 25 (26%) had echocardiographic evidence of PH (cases). In this cohort, DDAH1 wildtype rs480414 was 92% sensitive and 53% specific for PH in BPD, and the DDAH1 SNP rs480414 decreased the risk of PH in an additive model of inheritance (OR=0.39; 95% CI [0.18–0.88], p=0.01). Conclusion The rs480414 SNP in DDAH1 may be protective against the development of PH in patients with BPD. Furthermore, the DDAH1 rs480414 may be a useful biomarker in developing predictive models for PH in patients with BPD. PMID:26663142

  12. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  13. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Science.gov (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

    2015-11-01

    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  14. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  15. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

    Science.gov (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

    2012-07-01

    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

    Science.gov (United States)

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

    2015-07-01

    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

  17. Landscape genomics and biased FST approaches reveal single nucleotide polymorphisms under selection in goat breeds of North-East Mediterranean

    Directory of Open Access Journals (Sweden)

    Joost Stephane

    2009-02-01

    Full Text Available Abstract Background In this study we compare outlier loci detected using a FST based method with those identified by a recently described method based on spatial analysis (SAM. We tested a panel of single nucleotide polymorphisms (SNPs previously genotyped in individuals of goat breeds of southern areas of the Mediterranean basin (Italy, Greece and Albania. We evaluate how the SAM method performs with SNPs, which are increasingly employed due to their high number, low cost and easy of scoring. Results The combined use of the two outlier detection approaches, never tested before using SNP polymorphisms, resulted in the identification of the same three loci involved in milk and meat quality data by using the two methods, while the FST based method identified 3 more loci as under selection sweep in the breeds examined. Conclusion Data appear congruent by using the two methods for FST values exceeding the 99% confidence limits. The methods of FST and SAM can independently detect signatures of selection and therefore can reduce the probability of finding false positives if employed together. The outlier loci identified in this study could indicate adaptive variation in the analysed species, characterized by a large range of climatic conditions in the rearing areas and by a history of intense trade, that implies plasticity in adapting to new environments.

  18. Dual association of a TRKA polymorphism with schizophrenia

    DEFF Research Database (Denmark)

    Van Schijndel, Jessica E; Van Zweeden, Martine; Van Loo, Karen M J

    2011-01-01

    OBJECTIVE: An interaction between predisposing genes and environmental stressors is thought to underlie the neurodevelopmental disorder schizophrenia. In a targeted gene screening, we previously found that the minor allele of the single nucleotide polymorphism (SNP) rs6336 in the neurotrophic...

  19. A single nucleotide polymorphism in the zona pellucida 3 gene is associated with the first parity litter size in Hu sheep.

    Science.gov (United States)

    Chong, Yuqing; Huang, Huarong; Liu, Guiqiong; Jiang, Xunping; Rong, Weiheng

    2018-03-31

    Zona pellucida 3 (ZP3) is a primary sperm receptor and acrosome reaction inducer. As a candidate gene, the ZP3 gene has been widely studied since it has great influence on reproductive traits in farm animals. However, little is known about the association between polymorphisms of the coding region of the ZP3 gene and the first parity litter size in Hu sheep. Therefore, the objective of this study was to identify single nucleotide polymorphisms (SNPs) of the ZP3 gene associated with the first parity litter size in Hu sheep. A total of 462 female Hu sheep were sampled to detect SNPs in the coding region of the ZP3 gene. Six SNPs were identified and the reliability of all estimated allele frequencies reached 0.9545 except for one locus (g.2293C > T). SNP (rs401271989) was identified as that involved in amino acid change (Ile → Leu). This amino acid was located at the beginning of a β-strand and outside of the ZP3 protein membrane, and it was most likely to be a ligand-binding site (the possibility was 0.917). At this locus, individuals with AC genotype had a larger litter size than those with CC genotype in the first parity (2.050 vs 1.727, p size in Hu sheep, and it may affect the function of ZP3 protein by impacting the secondary and tertiary protein structures. The present study demonstrates that SNP (rs401271989) could be used in marker-assisted selection of the first parity litter size in Hu sheep. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr in human poliovirus receptor gene

    Directory of Open Access Journals (Sweden)

    Shyam Sundar Nandi

    2016-01-01

    Results: A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150 of DNA samples tested by both SNP detection assay and sequencing. Interpretation & conclusions: The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

  1. Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

    Science.gov (United States)

    Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

    2013-11-01

    Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

  2. Caveolin-1 single nucleotide polymorphism in antineutrophil cytoplasmic antibody associated vasculitis.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Immunosuppression is cornerstone treatment of antineutrophil cytoplasmic antibody associated vasculitis (AAV but is later complicated by infection, cancer, cardiovascular and chronic kidney disease. Caveolin-1 is an essential structural protein for small cell membrane invaginations known as caveolae. Its functional role has been associated with these complications. For the first time, caveolin-1 (CAV1 gene variation is studied in AAV.CAV1 single nucleotide polymorphism rs4730751 was analysed in genomic DNA from 187 white patients with AAV from Birmingham, United Kingdom. The primary outcome measure was the composite endpoint of time to all-cause mortality or renal replacement therapy. Secondary endpoints included time to all-cause mortality, death from sepsis or vascular disease, cancer and renal replacement therapy. Validation of results was sought from 589 white AAV patients, from two European cohorts.The primary outcome occurred in 41.7% of Birmingham patients. In a multivariate model, non-CC genotype variation at the studied single nucleotide polymorphism was associated with increased risk from: the primary outcome measure [HR 1.86; 95% CI: 1.14-3.04; p=0.013], all-cause mortality [HR:1.83; 95% CI: 1.02-3.27; p=0.042], death from infection [HR:3.71; 95% CI: 1.28-10.77; p=0.016], death from vascular disease [HR:3.13; 95% CI: 1.07-9.10; p=0.037], and cancer [HR:5.55; 95% CI: 1.59-19.31; p=0.007]. In the validation cohort, the primary outcome rate was far lower (10.4%; no association between genotype and the studied endpoints was evident.The presence of a CC genotype in Birmingham is associated with protection from adverse outcomes of immunosuppression treated AAV. Lack of replication in the European cohort may have resulted from low clinical event rates. These findings are worthy of further study in larger cohorts.

  3. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.

    Science.gov (United States)

    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ~4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification pr...

  4. A selective genotyping approach identifies single nucleotide polymorphisms in porcine chromosome 2 genes associated with production and carcass traits in Italian heavy pigs

    Directory of Open Access Journals (Sweden)

    Vincenzo Russo

    2011-04-01

    Full Text Available Several studies have shown that porcine chromosome 2 (SSC2 harbors important quantitative trait loci (QTL for production traits. In particular, an imprinted QTL for muscle mass production is determined by a mutation in the IGF2 gene (intron3-g.3072G>A. We recently identified and analysed single nucleotide polymorphisms (SNPs in genes (cathepsin D, CTSD g.70G>A; cathepsin F, CTSF g.22G>C; lactate dehydrogenase A, LDHA g.46G>T localized on SSC2 (including the IGF2 intron3-g.3072G>A SNP showing association with production traits in Italian Large White pigs and/or localizing them on QTL regions. Here we analysed these markers applying a selective genotyping approach based on estimated breeding values (EBVs. Three groups of Italian Large White pigs each made by animals with the most positive (n. 50 and most negative (n. 50 EBVs for average daily gain (ADG, backfat thickness (BFT or weight of lean cuts (LC and one group of Italian Duroc pigs made by 50 animals with most positive and 50 animals with most negative EBV for visible intermuscular fat (VIF were genotyped. In Italian Large White pigs, allele frequency differences for the IGF2 intron3-g.3072G>A SNP between the two extreme tails for all groups were highly significant (considering all analysed animals: P=9.53E-20 for LC; P=3.16E-15 for BFT; P=4.41E-6 for ADG. Significant allele frequency differences were also observed for the CTSD g.70G>A (P=0.0002 for ADG; P=0.00068 and LDHA g.46G>T (P=2.32E-5 for ADG polymorphisms. These results provide further support on the effects of these polymorphisms or genes whose application on marker assisted selection programs could be envisaged.

  5. Forensic SNP genotyping with SNaPshot

    DEFF Research Database (Denmark)

    Fondevila, M; Børsting, C; Phillips, C

    2017-01-01

    to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics......This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique...... of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides...

  6. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  7. Microsatellite genotyping and genome-wide single nucleotide polymorphism-based indices of Plasmodium falciparum diversity within clinical infections.

    Science.gov (United States)

    Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J

    2016-05-12

    In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P 10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).

  8. [Single nucleotide polymorphisms of HIV coreceptor CCR5 gene in Chinese Yi ethnic group and its association with HIV infection].

    Science.gov (United States)

    Ma, Li-ying; Hong, Kun-xue; Lu, Xiao-zhi; Qin, Guang-ming; Chen, Jian-ping; Chen, Kang-lin; Ruan, Yu-hua; Xing, Hui; Zhu, Jia-hong; Shao, Yi-ming

    2005-11-30

    To investigate the single nucleotide polymorphism (SNP) of HIV-1 coreceptor CCR5 gene in Chinese Yi ethnic group and the association between these SNPs and HIV/AIDS. Peripheral blood samples of 102 HIV negative persons of Chinese Yi nationality, 87 males amd 15 females, aged 23 (12-37), and 68 HIV carriers, 61 males and 7 females, aged 27 (17-51). The regulatory and structural regions of the HIV coreceptor CCR5 gene were amplified from the genomic DNA by nested PCR, each of the two regions was divided into three gene fragments which were overlapped. High throughput DHPLC was used for screening of unknown mutations in each gene fragment. The PCR products showing different peak traces from wild types in DHPLC were sequenced by forward and reverse primers respectively. The sequences were analyzed with the help of Sequence Navigator software to search for SNP loci. Statistical analysis by SPSS and PPAP softwares were made to study the association between these SNPs and HIV infection. Five SNPs (A77G, G316A, T532C, C921T, and G668A) and a AGA deletion of the 686-688 nucleotides were discovered in the coding region of this gene in Chinese Yi ethnic group. C921T mutation was a nonsense mutation, and the other SNPs (A77G, G316A, T532C, and G668A) are sense mutation, with the amino acid changes of K26R, G106R, C178R, and R223Q. Only the frequency of R223Q allelic gene was high (0.08) but those of the others were low (less than 0.01). There was no significant difference in the allele frequency between the HIV negative and HIV positive groups (all P > 0.05). Five SNP loci (T58934G, G59029A, T59353C, G59402A, and C59653T) were found in the regulatory region of CCR5 gene with high allelic frequencies of 0.1912-0.2941. Between the HIV negative and HIV positive groups, there were no differences in the SNP loc (all P > 0.05). Statistical analysis of the association between the linkage of mutation loci with HIV infection suggested a significant difference in the haplotype frequency

  9. Genotype-Phenotype Associations of the CD-Associated Single Nucleotide Polymorphism within the Gene Locus Encoding Protein Tyrosine Phosphatase Non-Receptor Type 22 in Patients of the Swiss IBD Cohort.

    Directory of Open Access Journals (Sweden)

    Marianne R Spalinger

    Full Text Available Protein tyrosine phosphatase non-receptor type 22 (PTPN22 plays an important role in immune cell function and intestinal homeostasis. The single nucleotide polymorphism (SNP rs2476601 within the PTPN22 gene locus results in aberrant function of PTPN22 protein and protects from Crohn's disease (CD. Here, we investigated associations of PTPN22 SNP rs2476601 in inflammatory bowel disease (IBD patients in the Swiss IBD Cohort Study (SIBDCS.2'028 SIBDCS patients (1173 CD and 855 ulcerative colitis (UC patients were included. The clinical characteristics were analysed for an association with the presence of the PTPN22 SNP rs2476601 genotypes 'homozygous variant' (AA, 'heterozygous' (GA and 'homozygous wild-type' (GG.13 patients (0.6% were homozygous variant (AA for the PTPN22 polymorphism, 269 (13.3% heterozygous variant (GA and 1'746 (86.1% homozygous wild-type (GG. In CD, AA and GA genotypes were associated with less use of steroids and antibiotics, and reduced prevalence of vitamin D and calcium deficiency. In UC the AA and GA genotype was associated with increased use of azathioprine and anti-TNF antibodies, but significantly less patients with the PTPN22 variant featured malabsorption syndrome (p = 0.026.Our study for the first time addressed how presence of SNP rs2476601 within the PTPN22 gene affects clinical characteristics in IBD-patients. Several factors that correlate with more severe disease were found to be less common in CD patients carrying the A-allele, pointing towards a protective role for this variant in affected CD patients. In UC patients however, we found the opposite trend, suggesting a disease-promoting effect of the A-allele.

  10. Usefulness of the SNP microarray technology to identify rare mutations in the case of perinatal death

    DEFF Research Database (Denmark)

    Hoeffding, L. K.; Kock, K. F.; Johnsen, Iben Birgit Gade

    2015-01-01

    The single nucleotide polymorphism (SNP) microarray technology has emerged as a powerful tool to screen the whole genome for sub-microscopic duplications and deletions that are not detectable by traditional cytogenetic analysis. Case: We report a case of a female twin born at 27th week of gestation...

  11. Presence of sequence and SNP variation in the IRF6 gene in healthy residents of Guangdong Province

    Directory of Open Access Journals (Sweden)

    Wu Wenli

    2016-01-01

    Full Text Available This study was to investigate the single nucleotide polymorphism (SNP in the interferon regulatory factor 6 (IRF6 gene in healthy residents of Guangdong Province, China, for further analysis of their associations with the development of cleft lip with or without palate (CL/P.

  12. Transcriptome-Wide Single Nucleotide Polymorphisms (SNPs for Abalone (Haliotis midae: Validation and Application Using GoldenGate Medium-Throughput Genotyping Assays

    Directory of Open Access Journals (Sweden)

    Rouvay Roodt-Wilding

    2013-09-01

    Full Text Available Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and Single Nucleotide Polymorphisms (SNPs . Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%−69% conversion rate (percentage polymorphic markers with a global genotyping success rate of 76%−85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174 were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50 located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

  13. Interim report on updated microarray probes for the LLNL Burkholderia pseudomallei SNP array

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S; Jaing, C

    2012-03-27

    The overall goal of this project is to forensically characterize 100 unknown Burkholderia isolates in the US-Australia collaboration. We will identify genome-wide single nucleotide polymorphisms (SNPs) from B. pseudomallei and near neighbor species including B. mallei, B. thailandensis and B. oklahomensis. We will design microarray probes to detect these SNP markers and analyze 100 Burkholderia genomic DNAs extracted from environmental, clinical and near neighbor isolates from Australian collaborators on the Burkholderia SNP microarray. We will analyze the microarray genotyping results to characterize the genetic diversity of these new isolates and triage the samples for whole genome sequencing. In this interim report, we described the SNP analysis and the microarray probe design for the Burkholderia SNP microarray.

  14. Methylenetetrahydrofolate Reductase C677T Polymorphism And ...

    African Journals Online (AJOL)

    reduction of 5, 10-methylenetetrahydrofolate to 5- methyltetrahydrofolate. A 677 C/T single nucleotide polymorphism (SNP) localized in the MTHFR gene was associated with both thermo ability and reduced activity of the enzyme and is associated with increased homocysteine levels. The aim of this study was to establish

  15. Frequency of single nucleotide polymorphisms of some immune response genes in a population sample from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Léa Campos de Oliveira

    2011-09-01

    Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.

  16. A single-tube 27-plex SNP assay for estimating individual ancestry and admixture from three continents.

    Science.gov (United States)

    Wei, Yi-Liang; Wei, Li; Zhao, Lei; Sun, Qi-Fan; Jiang, Li; Zhang, Tao; Liu, Hai-Bo; Chen, Jian-Gang; Ye, Jian; Hu, Lan; Li, Cai-Xia

    2016-01-01

    A single-tube multiplex assay of a small set of ancestry-informative markers (AIMs) for effectively estimating individual ancestry and admixture is an ideal forensic tool to trace the population origin of an unknown DNA sample. We present a newly developed 27-plex single nucleotide polymorphism (SNP) panel with highly robust and balanced differential power to perfectly assign individuals to African, European, and East Asian ancestries. Evaluating 968 previously described intercontinental AIMs from three HapMap population genotyping datasets (Yoruban in Ibadan, Nigeria (YRI); Utah residents with Northern and Western European ancestry from the Centre de'Etude du Polymorphism Humain (CEPH) collection (CEU); and Han Chinese in Beijing, China (CHB)), the best set of markers was selected on the basis of Hardy-Weinberg equilibrium (p > 0.00001), population-specific allele frequency (two of three δ values >0.5), according to linkage disequilibrium (r (2) ancestry of the 11 populations in the HapMap project. Then, we tested the 27-plex SNP assay with 1164 individuals from 17 additional populations. The results demonstrated that the SNP panel was successful for ancestry inference of individuals with African, European, and East Asian ancestry. Furthermore, the system performed well when inferring the admixture of Eurasians (EUR/EAS) after analyzing admixed populations from Xinjiang (Central Asian) as follows: Tajik (68:27), Uyghur (49:46), Kirgiz (40:57), and Kazak (36:60). For individual analyses, we interpreted each sample with a three-ancestry component percentage and a population match probability sequence. This multiplex assay is a convenient and cost-effective tool to assist in criminal investigations, as well as to correct for the effects of population stratification for case-control studies.

  17. A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Shiro Maeda

    2010-02-01

    Full Text Available It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A carboxylase beta (ACACB as a candidate for a susceptibility to diabetic nephropathy; the landmark SNP was found in the intron 18 of ACACB (rs2268388: intron 18 +4139 C > T, p = 1.4x10(-6, odds ratio = 1.61, 95% confidence interval [CI]: 1.33-1.96. The association of this SNP with diabetic nephropathy was examined in 9 independent studies (4 from Japan including the original study, one Singaporean, one Korean, and two European with type 2 diabetes. One case-control study involving European patients with type 1 diabetes was included. The frequency of the T allele for SNP rs2268388 was consistently higher among patients with type 2 diabetes and proteinuria. A meta-analysis revealed that rs2268388 was significantly associated with proteinuria in Japanese patients with type 2 diabetes (p = 5.35 x 10(-8, odds ratio = 1.61, 95% Cl: 1.35-1.91. Rs2268388 was also associated with type 2 diabetes-associated end-stage renal disease (ESRD in European Americans (p = 6 x 10(-4, odds ratio = 1.61, 95% Cl: 1.22-2.13. Significant association was not detected between this SNP and nephropathy in those with type 1 diabetes. A subsequent in vitro functional analysis revealed that a 29-bp DNA fragment, including rs2268388, had significant enhancer activity in cultured human renal proximal tubular epithelial cells. Fragments corresponding to the disease susceptibility allele (T had higher enhancer activity than those of the major allele. These results suggest that ACACB is a strong candidate for conferring susceptibility for proteinuria in patients with type 2 diabetes.

  18. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data

    Directory of Open Access Journals (Sweden)

    Steve Davis

    2015-08-01

    Full Text Available The analysis of next-generation sequence (NGS data is often a fragmented step-wise process. For example, multiple pieces of software are typically needed to map NGS reads, extract variant sites, and construct a DNA sequence matrix containing only single nucleotide polymorphisms (i.e., a SNP matrix for a set of individuals. The management and chaining of these software pieces and their outputs can often be a cumbersome and difficult task. Here, we present CFSAN SNP Pipeline, which combines into a single package the mapping of NGS reads to a reference genome with Bowtie2, processing of those mapping (BAM files using SAMtools, identification of variant sites using VarScan, and production of a SNP matrix using custom Python scripts. We also introduce a Python package (CFSAN SNP Mutator that when given a reference genome will generate variants of known position against which we validate our pipeline. We created 1,000 simulated Salmonella enterica sp. enterica Serovar Agona genomes at 100× and 20× coverage, each containing 500 SNPs, 20 single-base insertions and 20 single-base deletions. For the 100× dataset, the CFSAN SNP Pipeline recovered 98.9% of the introduced SNPs and had a false positive rate of 1.04 × 10−6; for the 20× dataset 98.8% of SNPs were recovered and the false positive rate was 8.34 × 10−7. Based on these results, CFSAN SNP Pipeline is a robust and accurate tool that it is among the first to combine into a single executable the myriad steps required to produce a SNP matrix from NGS data. Such a tool is useful to those working in an applied setting (e.g., food safety traceback investigations as well as for those interested in evolutionary questions.

  19. Novel Single Nucleotide Polymorphisms of the Insulin-Like Growth Factor-I Gene and Their Associations with Growth Traits in Common Carp (Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Xiu Feng

    2014-12-01

    Full Text Available Insulin-like growth factor-I (IGF-I plays an important role in the growth and development of vertebrates. To study polymorphisms of IGF-I, we screened a total of 4555 bp of genomic sequences in four exons and partial introns for the discovery of single nucleotide polymorphism (SNP in common carp (Cyprinus carpio. Three SNPs (g.3759T>G, g.7627T>A and g.7722T>C in intron 2 and a nonsynonymous SNP (g.7892C>T in exon 3 were identified in a pilot population including random parents and their progenies. 289 progenies were further genotyped for studying possible associations between genotypes or combined genotypes and growth traits. The results showed that the locus g.7627T>A was significantly associated with body weight and body length, and fish with genotype AA had a mean body weight 5.9% higher than those with genotype TT. No significant associations were observed between genotypes of other loci and growth traits. However, when both g.7627T>A and g.7722T>C were considered, the combined genotype TT/TT was extremely associated with the lowest values of body length and body weight and the highest K value in comparison with other diplotypes (p < 0.01. These results suggest that genotype AA at g.7627T>A and its combined genotypes with alleles from another locus have positive effects on growth traits, which would be a candidate molecular marker for further studies in marker-assisted selection in common carp.

  20. Single Nucleotide Polymorphisms in Taste Receptor Genes Are Associated with Snacking Patterns of Preschool-Aged Children in the Guelph Family Health Study: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Elie Chamoun

    2018-01-01

    Full Text Available Snacking is an integral component of eating habits in young children that is often overlooked in nutrition research. While snacking is a substantial source of calories in preschoolers’ diets, there is limited knowledge about the factors that drive snacking patterns. The genetics of taste may help to better understand the snacking patterns of children. The rs1761667 single nucleotide polymorphism (SNP in the CD36 gene has been linked to fat taste sensitivity, the rs35874116 SNP in the TAS1R2 gene has been related to sweet taste preference, and the rs713598 SNP in the TAS2R38 gene has been associated with aversion to bitter, green leafy vegetables. This study seeks to determine the cross-sectional associations between three taste receptor SNPs and snacking patterns among preschoolers in the Guelph Family Health Study. Preschoolers’ snack quality, quantity, and frequency were assessed using three-day food records and saliva was collected for SNP genotyping (n = 47. Children with the TT genotype in TAS1R2 consumed snacks with significantly more calories from sugar, and these snacks were consumed mostly in the evening. Total energy density of snacks was highest in the CC and CG genotypes compared to the GG genotype in TAS2R38, and also greater in the AA genotype in CD36 compared to G allele carriers, however this difference was not individually attributable to energy from fat, carbohydrates, sugar, or protein. Genetic variation in taste receptors may influence snacking patterns of preschoolers.

  1. Investigation of single nucleotide polymorphisms and biological pathways associated with response to TNFα inhibitors in patients with rheumatoid arthritis

    DEFF Research Database (Denmark)

    Krintel, Sophine B; Palermo, Giuseppe; Johansen, Julia S

    2012-01-01

    Recently, two genome-wide association studies identified single nucleotide polymorphisms (SNPs) significantly associated with the treatment response to tumor necrosis factor α (TNFα) inhibitors in patients with rheumatoid arthritis (RA). We aimed to replicate these results and identify SNPs and t...

  2. TET2, ASXL1, IDH1, and IDH2 Single Nucleotide Polymorphisms in Turkish Patients with Chronic Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Nur Soyer

    2017-06-01

    Full Text Available We aimed to determine the genotype distribution, allele frequency, and prognostic impact of IDH1/2, TET2, and ASXL1 single nucleotide polymorphisms (SNPs in myeloproliferative neoplasms (MPNs. TET2 (rs763480, ASXL1 (rs2208131, and IDH1 (rs11554137 variant homozygous genotype frequencies were found at rates of 1.5%, 9.2%, and 2.3%, respectively. No IDH2 SNP was identified. IDH1 and TET2 frequencies were 5% in essential thrombocythemia (ET and 1.7% in ET and 5% in primary myelofibrosis (PMF, respectively. ASXL1 frequencies were 8.3%-10% in MPN subgroups. The TET2 mutant allele T and ASXL1 mutant allele G had the highest frequencies with 0.272 in the PMF and 0.322 in the polycythemia vera (PV group, respectively. There was no impact of the SNPs on prognosis. IDH1 frequency in MPNs was found similar to the literature. ASXL1 frequencies were similar between ET, PV, and PMF patients. The ASXL1 and TET2 allele frequencies of the Turkish population are similar to those of the European population. The role of SNPs in MPNs might be further evaluated in larger multicenter studies.

  3. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2008-01-01

    Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop

  4. Identification of single nucleotide polymorphisms in the bovine Toll-like receptor 1 gene and association with health traits in cattle

    Directory of Open Access Journals (Sweden)

    Russell Christopher D

    2012-03-01

    Full Text Available Abstract Bovine mastitis remains the most common and costly disease of dairy cattle worldwide. A complementary control measure to herd hygiene and vaccine development would be to selectively breed cattle with greater resistance to mammary infection. Toll-like receptor 1 (TLR1 has an integral role for the initiation and regulation of the immune response to microbial pathogens, and has been linked to numerous inflammatory diseases. The objective of this study was to investigate whether single nucleotide polymorphisms (SNPs within the bovine TLR1 gene (boTLR1 are associated with clinical mastitis (CM. Selected boTLR1 SNPs were analysed within a Holstein Friesian herd. Significant associations were found for the tagging SNP -79 T > G and the 3'UTR SNP +2463 C > T. We observed favourable linkage of reduced CM with increased milk fat and protein, indicating selection for these markers would not be detrimental to milk quality. Furthermore, we present evidence that some of these boTLR1 SNPs underpin functional variation in bovine TLR1. Animals with the GG genotype (from the tag SNP -79 T > G had significantly lower boTLR1 expression in milk somatic cells when compared with TT or TG animals. In addition, stimulation of leucocytes from GG animals with the TLR1-ligand Pam3csk4 resulted in significantly lower levels of CXCL8 mRNA and protein. SNPs in boTLR1 were significantly associated with CM. In addition we have identified a bovine population with impaired boTLR1 expression and function. This may have additional implications for animal health and warrants further investigation to determine the suitability of identified SNPs as markers for disease susceptibility.

  5. An Integrated Pipeline of Open Source Software Adapted for Multi-CPU Architectures: Use in the Large-Scale Identification of Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    B. Jayashree

    2007-01-01

    Full Text Available The large amounts of EST sequence data available from a single species of an organism as well as for several species within a genus provide an easy source of identification of intra- and interspecies single nucleotide polymorphisms (SNPs. In the case of model organisms, the data available are numerous, given the degree of redundancy in the deposited EST data. There are several available bioinformatics tools that can be used to mine this data; however, using them requires a certain level of expertise: the tools have to be used sequentially with accompanying format conversion and steps like clustering and assembly of sequences become time-intensive jobs even for moderately sized datasets. We report here a pipeline of open source software extended to run on multiple CPU architectures that can be used to mine large EST datasets for SNPs and identify restriction sites for assaying the SNPs so that cost-effective CAPS assays can be developed for SNP genotyping in genetics and breeding applications. At the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT, the pipeline has been implemented to run on a Paracel high-performance system consisting of four dual AMD Opteron processors running Linux with MPICH. The pipeline can be accessed through user-friendly web interfaces at http://hpc.icrisat.cgiar.org/PBSWeb and is available on request for academic use. We have validated the developed pipeline by mining chickpea ESTs for interspecies SNPs, development of CAPS assays for SNP genotyping, and confirmation of restriction digestion pattern at the sequence level.

  6. No association between a common single nucleotide polymorphism, rs4141463, in the MACROD2 gene and autism spectrum disorder.

    NARCIS (Netherlands)

    Curran, S.; Bolton, P.; Rozsnyai, K.; Chiocchetti, A.; Klauck, S.M.; Duketis, E.; Poustka, F.; Schlitt, S.; Freitag, C.M.; Lee, I. van der; Muglia, P.; Poot, M.; Staal, W.G.; Jonge, M.V. de; Ophoff, R.A.; Lewis, C.; Skuse, D.; Mandy, W.; Vassos, E.; Fossdal, R.; Magnusson, P.; Hreidarsson, S.; Saemundsen, E.; Stefansson, H.; Stefansson, K.; Collier, D.

    2011-01-01

    The Autism Genome Project (AGP) Consortium recently reported genome-wide significant association between autism and an intronic single nucleotide polymorphism marker, rs4141463, within the MACROD2 gene. In the present study we attempted to replicate this finding using an independent case-control

  7. HRM and SNaPshot as alternative forensic SNP genotyping methods.

    Science.gov (United States)

    Mehta, Bhavik; Daniel, Runa; McNevin, Dennis

    2017-09-01

    Single nucleotide polymorphisms (SNPs) have been widely used in forensics for prediction of identity, biogeographical ancestry (BGA) and externally visible characteristics (EVCs). Single base extension (SBE) assays, most notably SNaPshot® (Thermo Fisher Scientific), are commonly used for forensic SNP genotyping as they can be employed on standard instrumentation in forensic laboratories (e.g. capillary electrophoresis). High resolution melt (HRM) analysis is an alternative method and is a simple, fast, single tube assay for low throughput SNP typing. This study compares HRM and SNaPshot®. HRM produced reproducible and concordant genotypes at 500 pg, however, difficulties were encountered when genotyping SNPs with high GC content in flanking regions and differentiating variants of symmetrical SNPs. SNaPshot® was reproducible at 100 pg and is less dependent on SNP choice. HRM has a shorter processing time in comparison to SNaPshot®, avoids post PCR contamination risk and has potential as a screening tool for many forensic applications.

  8. Association of single nucleotide polymorphisms in the MVP gene with platinum resistance and survival in patients with epithelial ovarian cancer.

    Science.gov (United States)

    Zhao, Ya-Nan; He, Dong-Ning; Wang, Ya-DI; Li, Jun-Jie; Ha, Min-Wen

    2016-04-01

    The human major vault protein (MVP) has been linked to the development of multidrug resistance in cancer cells, and overexpression of MVP has been observed in ovarian cancer tissues. The aim of the present study was to investigate the association between single nucleotide polymorphisms (SNPs) in the MVP gene and the tumor response to platinum-based chemotherapy and survival of patients affected by epithelial ovarian cancer (EOC), in addition to confirm whether tetra-primer amplification-refractory mutation system (ARMS)-polymerase chain reaction (PCR) is an accurate genotyping method. For this purpose, two polymorphisms in the MVP gene, namely reference SNP (rs)1057451 and rs4788186, were selected from the data obtained by the International haplotype map (HapMap) Project regarding Chinese Han population, and were evaluated by tetra-primer ARMS-PCR. Upon validation by DNA sequencing, the association of these polymorphisms with platinum resistance, progression-free survival (PFS) and overall survival (OS) in patients with EOC was assessed. The results of tetra-primer ARMS-PCR were in agreement with those derived from DNA sequencing. No significant differences were observed between platinum-sensitive and platinum-resistant cohorts in terms of allele and genotype distribution of these two polymorphisms in the MVP gene, which were not associated with PFS or OS. However, a trend toward prolonged PFS was observed in patients carrying the heterozygous AG allele at the rs4788186 locus. These results suggest that rs1057451 and rs4788186 variants in the MVP gene are not associated with favorable therapeutic response to platinum or longer survival in Chinese Han patients affected by EOC. In addition, the data of the present study confirm that tetra-primer ARMS-PCR is a trustworthy and economical genotyping method.

  9. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Yih-Horng Shiao

    Full Text Available BACKGROUND: Ribosomal RNA (rRNA is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1 and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014. During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014. Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. CONCLUSIONS/SIGNIFICANCE: The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  10. Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism

  11. Predicting the disease of Alzheimer with SNP biomarkers and clinical data using data mining classification approach: decision tree.

    Science.gov (United States)

    Erdoğan, Onur; Aydin Son, Yeşim

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) are the most common genomic variations where only a single nucleotide differs between individuals. Individual SNPs and SNP profiles associated with diseases can be utilized as biological markers. But there is a need to determine the SNP subsets and patients' clinical data which is informative for the diagnosis. Data mining approaches have the highest potential for extracting the knowledge from genomic datasets and selecting the representative SNPs as well as most effective and informative clinical features for the clinical diagnosis of the diseases. In this study, we have applied one of the widely used data mining classification methodology: "decision tree" for associating the SNP biomarkers and significant clinical data with the Alzheimer's disease (AD), which is the most common form of "dementia". Different tree construction parameters have been compared for the optimization, and the most accurate tree for predicting the AD is presented.

  12. V-MitoSNP: visualization of human mitochondrial SNPs

    Directory of Open Access Journals (Sweden)

    Tsui Ke-Hung

    2006-08-01

    Full Text Available Abstract Background Mitochondrial single nucleotide polymorphisms (mtSNPs constitute important data when trying to shed some light on human diseases and cancers. Unfortunately, providing relevant mtSNP genotyping information in mtDNA databases in a neatly organized and transparent visual manner still remains a challenge. Amongst the many methods reported for SNP genotyping, determining the restriction fragment length polymorphisms (RFLPs is still one of the most convenient and cost-saving methods. In this study, we prepared the visualization of the mtDNA genome in a way, which integrates the RFLP genotyping information with mitochondria related cancers and diseases in a user-friendly, intuitive and interactive manner. The inherent problem associated with mtDNA sequences in BLAST of the NCBI database was also solved. Description V-MitoSNP provides complete mtSNP information for four different kinds of inputs: (1 color-coded visual input by selecting genes of interest on the genome graph, (2 keyword search by locus, disease and mtSNP rs# ID, (3 visualized input of nucleotide range by clicking the selected region of the mtDNA sequence, and (4 sequences mtBLAST. The V-MitoSNP output provides 500 bp (base pairs flanking sequences for each SNP coupled with the RFLP enzyme and the corresponding natural or mismatched primer sets. The output format enables users to see the SNP genotype pattern of the RFLP by virtual electrophoresis of each mtSNP. The rate of successful design of enzymes and primers for RFLPs in all mtSNPs was 99.1%. The RFLP information was validated by actual agarose electrophoresis and showed successful results for all mtSNPs tested. The mtBLAST function in V-MitoSNP provides the gene information within the input sequence rather than providing the complete mitochondrial chromosome as in the NCBI BLAST database. All mtSNPs with rs number entries in NCBI are integrated in the corresponding SNP in V-MitoSNP. Conclusion V-MitoSNP is a web

  13. Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

    Science.gov (United States)

    Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2011-06-01

    Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

  14. Functional single nucleotide polymorphisms within the cyclin-dependent kinase inhibitor 2A/2B region affect pancreatic cancer risk

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Pastore, M.; Gentiluomo, M.; Talar-Wojnarowska, R.; Kupcinskas, J.; Malecka-Panas, E.; Neoptolemos, J. P.; Niesen, W.; Vodička, Pavel; Delle Fave, G.; Bueno-de-Mesquita, H. B.; Gazouli, M.; Pacetti, P.; Di Leo, M.; Ito, H.; Klüter, H.; Souček, P.; Corbo, V.; Yamao, K.; Hosono, S.; Kaaks, R.; Vashist, Y.; Gioffreda, D.; Strobel, O.; Shimizu, Y.; Dijk, F.; Andriulli, A.; Ivanauskas, A.; Bugert, P.; Tavano, F.; Vodičková, L.; Zambon, C.F.; Lovecek, M.; Landi, S.; Key, T. J.; Boggi, U.; Pezzilli, R.; Jamroziak, K.; Mohelníková-Duchoňová, B.; Mambrini, A.; Bambi, F.; Busch, O.; Pazienza, V.; Valente, R.; Theodoropoulos, G.E.; Hackert, T.; Capurso, G.; Cavestro, G.M.; Pasquali, C.; Basso, D.; Sperti, C.; Matsuo, K.; Büchler, M.; Khaw, K. T.; Izbicki, J.; Costello, E.; Katzke, V.; Michalski, Ch.; Stepien, A.; Rizzato, C.; Canzian, F.

    2016-01-01

    Roč. 7, č. 35 (2016), s. 57011-57020 ISSN 1949-2553 R&D Projects: GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : pancreatic cancer * CDKN2A * single nucleotide polymorphisms Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.168, year: 2016

  15. Identification of Splice Variants, Targeted MicroRNAs and Functional Single Nucleotide Polymorphisms of the BOLA-DQA2 Gene in Dairy Cattle

    Science.gov (United States)

    Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai

    2012-01-01

    Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (pmastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (pmastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936

  16. Two Single-Nucleotide Polymorphisms in ADAM12 Gene Are Associated with Early and Late Radiographic Knee Osteoarthritis in Estonian Population

    Directory of Open Access Journals (Sweden)

    Irina Kerna

    2013-01-01

    Full Text Available Objectives. To investigate associations of selected single-nucleotide polymorphisms (SNPs in ADAM12 gene with radiographic knee osteoarthritis (rKOA in Estonian population. Methods. The rs3740199, rs1871054, rs1278279, and rs1044122 SNPs in ADAM12 gene were genotyped in 438 subjects (303 women from population-based cohort, aged 32 to 57 (mean 45.4. The rKOA features were evaluated in the tibiofemoral joint (TFJ and patellofemoral joint. Results. The early rKOA was found in 51.4% of investigated subjects (72% women and 12.3% of participants (63% women had advanced stage of diseases. The A allele of synonymous SNP rs1044122 was associated with early rKOA in TFJ, predominantly with the presence of osteophytes in females (OR 1.57; 95% CI 1.08–2.29, . The C allele of intron polymorphism rs1871054 carried risk for advanced rKOA, mostly to osteophyte formation in TFJ in males (OR 3.03; 95% CI 1.11–7.53, . Also the CCAA haplotype of ADAM12 was associated with osteophytosis, again mostly in TFJ in males (. For rs3740199 and rs1278279, no statistically significant associations were observed. Conclusion.  ADAM12 gene variants are related to rKOA risk during the early and late stages of diseases. The genetic risk seems to be predominantly associated with the appearance of osteophytes—a marker of bone remodelling and neochondrogenesis.

  17. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    Directory of Open Access Journals (Sweden)

    Mônica Barcellos Arruda

    Full Text Available Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs, and 8 to protease inhibitors (PIs containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001, while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009. Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

  18. SNP calling using genotype model selection on high-throughput sequencing data

    KAUST Repository

    You, Na

    2012-01-16

    Motivation: A review of the available single nucleotide polymorphism (SNP) calling procedures for Illumina high-throughput sequencing (HTS) platform data reveals that most rely mainly on base-calling and mapping qualities as sources of error when calling SNPs. Thus, errors not involved in base-calling or alignment, such as those in genomic sample preparation, are not accounted for.Results: A novel method of consensus and SNP calling, Genotype Model Selection (GeMS), is given which accounts for the errors that occur during the preparation of the genomic sample. Simulations and real data analyses indicate that GeMS has the best performance balance of sensitivity and positive predictive value among the tested SNP callers. © The Author 2012. Published by Oxford University Press. All rights reserved.

  19. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  20. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  1. The influence of a single nucleotide polymorphism within CNDP1 on susceptibility to diabetic nephropathy in Japanese women with type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Mahiro Kurashige

    Full Text Available BACKGROUND: Several linkage analyses have mapped a susceptibility locus for diabetic nephropathy to chromosome 18q22-23, and polymorphisms within the carnosine dipeptidase 1 gene (CNDP1, located on 18q22.3, have been shown to be associated with diabetic nephropathy in European subjects with type 2 diabetes. However, the association of this locus with diabetic nephropathy has not been evaluated in the Japanese population. In this study, we examined the association of polymorphisms within the CNDP1/CNDP 2 locus with diabetic nephropathy in Japanese subjects with type 2 diabetes. METHODOLOGY/PRINCIPAL FINDINGS: We genotyped a leucine repeat polymorphism (D18S880 that is within CNDP1 along with 29 single nucleotide polymorphisms (SNPs in the CNDP1/CNDP2 locus for 2,740 Japanese subjects with type 2 diabetes (1,205 nephropathy cases with overt nephropathy or with end-stage renal disease [ESRD], and 1,535 controls with normoalbuminuria. The association of each polymorphism with diabetic nephropathy was analysed by performing logistic regression analysis. We did not observe any association between D18S880 and diabetic nephropathy in Japanese subjects with type 2 diabetes. None of the 29 SNPs within the CNDP1/CNDP2 locus were associated with diabetic nephropathy, but a subsequent sex-stratified analysis revealed that 1 SNP in CNDP1 was nominally associated with diabetic nephropathy in women (rs12604675-A; p = 0.005, odds ratio [OR] = 1.76, 95% confidence interval [CI], 1.19-2.61. Rs12604675 was associated with overt proteinuria (p = 0.002, OR = 2.18, 95% CI, 1.32-3.60, but not with ESRD in Japanese women with type 2 diabetes. CONCLUSIONS/SIGNIFICANCE: Rs12604675-A in CNDP1 may confer susceptibility to overt proteinuria in Japanese women with type 2 diabetes.

  2. Single nucleotide polymorphism in IL1B is associated with infection risk in paediatric acute myeloid leukaemia.

    Science.gov (United States)

    Sung, L; Dix, D; Cellot, S; Gillmeister, B; Ethier, M C; Roslin, N M; Johnston, D L; Feusner, J; Mitchell, D; Lewis, V; Aplenc, R; Yanofsky, R; Portwine, C; Price, V; Zelcer, S; Silva, M; Bowes, L; Michon, B; Stobart, K; Traubici, J; Allen, U; Beyene, J; den Hollander, N; Paterson, A D

    2016-06-01

    We evaluated single nucleotide polymorphisms (SNPs) associated with infection risk in children with newly diagnosed acute myeloid leukaemia (AML). We conducted a multicentre, prospective cohort study that included children aged ≤18 years with de novo AML. DNA was isolated from blood lymphocytes or buccal swabs, and candidate gene SNP analysis was conducted. Primary outcome was the occurrence of microbiologically documented sterile site infection during chemotherapy. Secondary outcomes were Gram-positive and -negative infections, viridans group streptococcal infection and proven/probable invasive fungal infection. Interpretation was guided by consistency in risk alleles and microbiologic agent with previous literature. Over the study period 254 children and adolescents with AML were enrolled. Overall, 190 (74.8%) had at least one sterile site microbiologically documented infection. Among the 172 with inferred European ancestry and DNA available, nine significant associations were observed; two were consistent with previous literature. Allele A at IL1B (rs16944) was associated with decreased microbiologically documented infection, and allele G at IL10 (rs1800896) was associated with increased risk of Gram-positive infection. We identified SNPs associated with infection risk in paediatric AML. Genotype may provide insight into mechanisms of infection risk that could be used for supportive-care novel treatments. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    Science.gov (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  4. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  5. Impact of IL28B-Related Single Nucleotide Polymorphisms on Liver Histopathology in Chronic Hepatitis C Genotype 2 and 3

    DEFF Research Database (Denmark)

    Rembeck, Karolina; Alsiö, Asa; Christensen, Peer Brehm

    2012-01-01

    Recently, several genome-wide association studies have revealed that single nucleotide polymorphisms (SNPs) in proximity to IL28B predict spontaneous clearance of HCV infection as well as outcome following peginterferon and ribavirin therapy among HCV genotype 1 infected patients. The present stu...

  6. Comparison of single nucleotide polymorphisms and microsatellites in non-invasive genetic monitoring of a wolf population

    DEFF Research Database (Denmark)

    Fabbri, Elena; Caniglia, R.; Mucci, Nadia

    2012-01-01

    Single nucleotide polymorphisms (SNPs) which represent the most widespread source of sequence variation in genomes, are becoming a routine application in several fields such as forensics, ecology and conservation genetics. Their use, requiring short amplifications, may allow a more efficient geno....... We evaluated the cost, laboratory effort and reliability of these different markers and discuss the possible future use of VeraCode, SNPlex and Fluidigm EP1 system in wild population monitoring....

  7. Characterization of novel and uncharacterized p53 SNPs in the Chinese population--intron 2 SNP co-segregates with the common codon 72 polymorphism.

    Directory of Open Access Journals (Sweden)

    Beng Hooi Phang

    Full Text Available Multiple single nucleotide polymorphisms (SNPs have been identified in the tumor suppressor gene p53, though the relevance of many of them is unclear. Some of them are also differentially distributed in various ethnic populations, suggesting selective functionality. We have therefore sequenced all exons and flanking regions of p53 from the Singaporean Chinese population and report here the characterization of some novel and uncharacterized SNPs - four in intron 1 (nucleotide positions 8759/10361/10506/11130, three in intron 3 (11968/11969/11974 and two in the 3'UTR (19168/19514. Allelic frequencies were determined for all these and some known SNPs, and were compared in a limited scale to leukemia and lung cancer patient samples. Intron 2 (11827 and 7 (14181/14201 SNPs were found to have a high minor allele frequency of between 26-47%, in contrast to the lower frequencies found in the US population, but similar in trend to the codon 72 polymorphism (SNP12139 that shows a distribution pattern correlative with latitude. Several of the SNPs were linked, such as those in introns 1, 3 and 7. Most interestingly, we noticed the co-segregation of the intron 2 and the codon 72 SNPs, the latter which has been shown to be expressed in an allele-specific manner, suggesting possible regulatory cross-talk. Association analysis indicated that the T/G alleles in both the co-segregating intron 7 SNPs and a 4tagSNP haplotype was strongly associated increased susceptibility to lung cancer in non-smoker females [OR: 1.97 (1.32, 3.394]. These data together demonstrate high SNP diversity in p53 gene between different populations, highlighting ethnicity-based differences, and their association with cancer risk.

  8. SNPer: an R library for quantitative variant analysis on single nucleotide polymorphisms among influenza virus populations.

    Directory of Open Access Journals (Sweden)

    Unitsa Sangket

    Full Text Available Influenza virus (IFV can evolve rapidly leading to genetic drifts and shifts resulting in human and animal influenza epidemics and pandemics. The genetic shift that gave rise to the 2009 influenza A/H1N1 pandemic originated from a triple gene reassortment of avian, swine and human IFVs. More minor genetic alterations in genetic drift can lead to influenza drug resistance such as the H274Y mutation associated with oseltamivir resistance. Hence, a rapid tool to detect IFV mutations and the potential emergence of new virulent strains can better prepare us for seasonal influenza outbreaks as well as potential pandemics. Furthermore, identification of specific mutations by closely examining single nucleotide polymorphisms (SNPs in IFV sequences is essential to classify potential genetic markers associated with potentially dangerous IFV phenotypes. In this study, we developed a novel R library called "SNPer" to analyze quantitative variants in SNPs among IFV subpopulations. The computational SNPer program was applied to three different subpopulations of published IFV genomic information. SNPer queried SNPs data and grouped the SNPs into (1 universal SNPs, (2 likely common SNPs, and (3 unique SNPs. SNPer outperformed manual visualization in terms of time and labor. SNPer took only three seconds with no errors in SNP comparison events compared with 40 hours with errors using manual visualization. The SNPer tool can accelerate the capacity to capture new and potentially dangerous IFV strains to mitigate future influenza outbreaks.

  9. A study on single nucleotide polymorphism of exon 7 T/C (locus 593 of platelet-activating factor acetylhydrolase gene in healthy Han population in the Shanghai region

    Directory of Open Access Journals (Sweden)

    Tian-bao XIA

    2012-08-01

    Full Text Available Objective To investigate the distribution of single nucleotide polymorphism (SNP in platelet-activating factor acetylhydrolase (PAF-AH gene exon 7 T/C (locus 593 in healthy Han population in Shanghai region and the features different from other races. Methods The SNP in PAF-AH gene exon 7 T/C (locus 593 was detected and analyzed by PCR and sequencing in 110 healthy Han people from Shanghai areas. The genotype and allele frequency were then calculated and compared with that in other races in combination with review of relevant literature. Results The amplified product of the SNP in PAF-AH gene exon 7 T/C (locus 593 was 240 bp in 110 healthy Han people, of whom 97 were with TT genotype and 13 with TC genotype, but no CC genotype was found. As to the allele frequency distribution, T type allele took the highest position, and C type followed. The genotype frequency of TT and TC was 88.2% and 11.8%, respectively, and they were markedly different from that in German population (0.95%, while not statistically significant different from that in British population (7.67%. Conclusions There exists SNP in PAF-AH gene exon 7 T/C (position 593 in healthy Han people in Shanghai region, with a higher frequency of T→C mutation. The mutational genotype frequency is found to be located at the locus 593 is 11.81%, and it is markedly different from that in German population, but not significantly different from that in British population.

  10. [Single nucleotide polymorphism of STAT4 rs7574865 is associated with the susceptibility of primary biliary cirrhosis in Han population of partial regions of Jiangsu province].

    Science.gov (United States)

    Zheng, Liming; Zhou, Hong

    2017-04-01

    Objective To investigate the correlation of single nucleotide polymorphism (SNP) of signal transducer and activator of transcription 4 (STAT4) rs7574865 gene with primary biliary cirrhosis (PBC) in Han population of Jiangsu province. Methods The peripheral blood samples were collected from 138 inpatients with PBC and 116 unrelated healthy donors in the Third People's Hospital of Changzhou City in Jiangsu province. The STAT4 rs7574865 SNP was determined by polymerase chain reaction-sequence specific primer (PCR-SSP) assay. The distributions of genotype and allele frequencies in the two groups were analyzed by the Chi-squared test in order to identify whether rs7574865 was the susceptible locus of PBC. Then, the associations between rs7574865 and the serum levels of anti-mitochondrial antibody M2 (AMA-M2), anti-nuclear antibody (ANA), anti-Cenp B antibody, anti-GP210 antibody, anti-SP100 antibody in PBC were investigated. Results Three genotypes, GG, GT and TT, were found at position rs7574865 of STAT4. The TT genotype frequency in the PBC group (20.3%) was significantly higher than that in healthy controls (6.9%) and the odds rations (OR) value was 3.436. The T allele frequencies were 42.4% and 31.9% in the PBC group and healthy controls, respectively, and OR value was 1.571. There were no statistically differences between rs7574865 and the levels of serum autoantibodies in the patients with PBC. Conclusion STAT4 rs7574865 gene polymorphism is associated with the susceptibility of PBC in the Han population of Jiangsu province.

  11. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).

    Science.gov (United States)

    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco

    2013-04-01

    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. A Single-Nucleotide Polymorphism in an Endo-1,4-β-Glucanase Gene Controls Seed Coat Permeability in Soybean.

    Directory of Open Access Journals (Sweden)

    Seong-Jin Jang

    Full Text Available Physical dormancy, a structural feature of the seed coat known as hard seededness, is an important characteristic for adaptation of plants against unstable and unpredictable environments. To dissect the molecular basis of qHS1, a quantitative trait locus for hard seededness in soybean (Glycine max (L Merr., we developed a near-isogenic line (NIL of a permeable (soft-seeded cultivar, Tachinagaha, containing a hard-seed allele from wild soybean (G. soja introduced by successive backcrossings. The hard-seed allele made the seed coat of Tachinagaha more rigid by increasing the amount of β-1,4-glucans in the outer layer of palisade cells of the seed coat on the dorsal side of seeds, known to be a point of entrance of water. Fine-mapping and subsequent expression and sequencing analyses revealed that qHS1 encodes an endo-1,4-β-glucanase. A single-nucleotide polymorphism (SNP introduced an amino acid substitution in a substrate-binding cleft of the enzyme, possibly reducing or eliminating its affinity for substrates in permeable cultivars. Introduction of the genomic region of qHS1 from the impermeable (hard-seeded NIL into the permeable cultivar Kariyutaka resulted in accumulation of β-1,4-glucan in the outer layer of palisade cells and production of hard seeds. The SNP allele found in the NIL was further associated with the occurrence of hard seeds in soybean cultivars of various origins. The findings of this and previous studies may indicate that qHS1 is involved in the accumulation of β-1,4-glucan derivatives such as xyloglucan and/or β-(1,3(1,4-glucan that reinforce the impermeability of seed coats in soybean.

  13. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea

    Directory of Open Access Journals (Sweden)

    J. S. Choi

    2016-09-01

    Full Text Available This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R] and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003. The meats of PRKAG3 (A 0.024/G 0.976 AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699 AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627 AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792 AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs.

  14. The LPL S447X cSNP is associated with decreased blood pressure and plasma triglycerides, and reduced risk of coronary artery disease

    NARCIS (Netherlands)

    Clee, S. M.; Loubser, O.; Collins, J.; Kastelein, J. J.; Hayden, M. R.

    2001-01-01

    Linkage of the lipoprotein lipase (LPL) gene to blood pressure levels has been reported. The LPL S447X single nucleotide polymorphism (cSNP) has been associated with decreased triglycerides (TG), increased high density lipoprotein cholesterol, and a decreased risk of coronary artery disease (CAD),

  15. Single nucleotide polymorphism analysis of ubiquitin extension protein genes (ubq) of gossypium arboreum and gossypium herbaceum in comparison with arabidopsis thaliana

    International Nuclear Information System (INIS)

    Shaheen, T.; Zafar, Y.; Rahman, M.

    2014-01-01

    Single nucleotide polymorphism analysis is an expedient way to study polymorphisms at genomic level. In the present study we have explored Ubiquitin extension protein gene of G. arboreum (A2) and G. herbaceum (A1) of cotton which is a multiple copy gene. We have found SNPs at 16 positions in 200 bp region within A genome of cotton indicating frequency of SNPs 1/13 bp. Both sequences from cotton have shown maximum similarity with UBQ5 and UBQ6 of Arabidopsis thaliana. Sequence obtained from G. arboreum has shown SNPs at 28 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana while sequence obtained from G. herbaceum has shown SNPs at 31 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana. In conclusion although during pace of evolution ubiquitin extension protein genes of both A genome species have got some mutations from nature but still most of their sequence is similar. Single nucleotide polymorphism study can prove a vital tool to identify gene type in case of Multicopy genes. (author)

  16. Multiple single nucleotide polymorphism analysis and association of specific genotypes in FHIT, SAMD4A, and ANKRD17 in Indian patients with oral cancer.

    Science.gov (United States)

    D'Souza, Wendy; Pradhan, Sultan; Saranath, Dhananjaya

    2017-08-01

    Oral cancer has a high incidence primarily because of tobacco chewing habits. However, a small proportion of habitués develop oral cancer, implying a role for genomic variants in its susceptibility. Thirteen single nucleotide polymorphisms (SNPs) in an Indian cohort comprising patients with oral cancer (n = 500) and healthy controls (n = 500) were genotyped using allelic discrimination real-time polymerase chain reaction (PCR). Prevalence of SNPs rs11130760, rs1957358, rs2306058, rs4883543, rs12637722, rs1457115, rs2353292, rs709821, rs2194861, rs4789378, rs3827538, rs2667552, and rs2886093 was determined in the Indian cohort. A significant association of rs11130760 GG (odds ratio [OR] 1.41; 95% confidence interval [CI] 1.08-1.84) and rs1957358 TT (OR 1.44; 95% CI 1.10-1.90) indicated increased risk; whereas rs1957358 TC (OR 0.67; 95% CI 0.53-0.87) and rs2306058 CT (OR 0.72; 95% CI 0.56-0.93) reflected decreased risk. The SNP rs11130760 wild-type (WT) allele G indicated an increased risk for oral cancer (OR 1.38; 95% CI 1.09-1.73), whereas SNP allele T indicated a decreased risk (OR 0.73; 95% CI 0.58-0.92) for oral cancer. Our study identified SNPs with susceptibility to oral cancer in high-risk populations. © 2017 Wiley Periodicals, Inc.

  17. Exhaustive Genome-Wide Search for SNP-SNP Interactions Across 10 Human Diseases

    Directory of Open Access Journals (Sweden)

    William Murk

    2016-07-01

    Full Text Available The identification of statistical SNP-SNP interactions may help explain the genetic etiology of many human diseases, but exhaustive genome-wide searches for these interactions have been difficult, due to a lack of power in most datasets. We aimed to use data from the Resource for Genetic Epidemiology Research on Adult Health and Aging (GERA study to search for SNP-SNP interactions associated with 10 common diseases. FastEpistasis and BOOST were used to evaluate all pairwise interactions among approximately N = 300,000 single nucleotide polymorphisms (SNPs with minor allele frequency (MAF ≥ 0.15, for the dichotomous outcomes of allergic rhinitis, asthma, cardiac disease, depression, dermatophytosis, type 2 diabetes, dyslipidemia, hemorrhoids, hypertensive disease, and osteoarthritis. A total of N = 45,171 subjects were included after quality control steps were applied. These data were divided into discovery and replication subsets; the discovery subset had > 80% power, under selected models, to detect genome-wide significant interactions (P < 10−12. Interactions were also evaluated for enrichment in particular SNP features, including functionality, prior disease relevancy, and marginal effects. No interaction in any disease was significant in both the discovery and replication subsets. Enrichment analysis suggested that, for some outcomes, interactions involving SNPs with marginal effects were more likely to be nominally replicated, compared to interactions without marginal effects. If SNP-SNP interactions play a role in the etiology of the studied conditions, they likely have weak effect sizes, involve lower-frequency variants, and/or involve complex models of interaction that are not captured well by the methods that were utilized.

  18. A SNP Genotyping Array for Hexaploid Oat

    Directory of Open Access Journals (Sweden)

    Nicholas A. Tinker

    2014-11-01

    Full Text Available Recognizing a need in cultivated hexaploid oat ( L. for a reliable set of reference single nucleotide polymorphisms (SNPs, we have developed a 6000 (6K BeadChip design containing 257 Infinium I and 5486 Infinium II designs corresponding to 5743 SNPs. Of those, 4975 SNPs yielded successful assays after array manufacturing. These SNPs were discovered based on a variety of bioinformatics pipelines in complementary DNA (cDNA and genomic DNA originating from 20 or more diverse oat cultivars. The array was validated in 1100 samples from six recombinant inbred line (RIL mapping populations and sets of diverse oat cultivars and breeding lines, and provided approximately 3500 discernible Mendelian polymorphisms. Here, we present an annotation of these SNPs, including methods of discovery, gene identification and orthology, population-genetic characteristics, and tentative positions on an oat consensus map. We also evaluate a new cluster-based method of calling SNPs. The SNP design sequences are made publicly available, and the full SNP genotyping platform is available for commercial purchase from an independent third party.

  19. A gene-gene interaction between polymorphisms in the OCT2 and MATE1 genes influences the renal clearance of metformin

    DEFF Research Database (Denmark)

    Hougaard Christensen, Mette Marie; Pedersen, Rasmus Steen; Stage, Tore Bjerregaard

    2013-01-01

    The aim of this study was to determine the association between the renal clearance (CL(renal)) of metformin in healthy Caucasian volunteers and the single-nucleotide polymorphism (SNP) c.808G>T (rs316019) in OCT2 as well as the relevance of the gene-gene interactions between this SNP and (a) the ...

  20. Comparison of semi-automated commercial rep-PCR fingerprinting, spoligotyping, 12-locus MIRU-VNTR typing and single nucleotide polymorphism analysis of the embB gene as molecular typing tools for Mycobacterium bovis.

    Science.gov (United States)

    Armas, Federica; Camperio, Cristina; Coltella, Luana; Selvaggini, Serena; Boniotti, Maria Beatrice; Pacciarini, Maria Lodovica; Di Marco Lo Presti, Vincenzo; Marianelli, Cinzia

    2017-08-04

    Highly discriminatory genotyping strategies are essential in molecular epidemiological studies of tuberculosis. In this study we evaluated, for the first time, the efficacy of the repetitive sequence-based PCR (rep-PCR) DiversiLab Mycobacterium typing kit over spoligotyping, 12-locus mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) typing and embB single nucleotide polymorphism (SNP) analysis for Mycobacterium bovis typing. A total of 49 M. bovis animal isolates were used. DNA was extracted and genomic DNA was amplified using the DiversiLab Mycobacterium typing kit. The amplified fragments were separated and detected using a microfluidics chip with Agilent 2100. The resulting rep-PCR-based DNA fingerprints were uploaded to and analysed using web-based DiversiLab software through Pearson's correlation coefficient. Rep-PCR DiversiLab grouped M. bovis isolates into ten different clusters. Most isolates sharing identical spoligotype, MIRU-VNTR profile or embB gene polymorphism were grouped into different rep-PCR clusters. Rep-PCR DiversiLab displayed greater discriminatory power than spoligotyping and embB SNP analysis but a lower resolution power than the 12-locus MIRU-VNTR analysis. MIRU-VNTR confirmed that it is superior to the other PCR-based methods tested here. In combination with spoligotyping and 12-locus MIRU-VNTR analysis, rep-PCR improved the discriminatory power for M. bovis typing.

  1. Association of SSTR2 Polymorphisms and Glucose Homeostasis Phenotypes

    OpenAIRE

    Sutton, Beth S.; Palmer, Nicholette D.; Langefeld, Carl D.; Xue, Bingzhong; Proctor, Alexandria; Ziegler, Julie T.; Haffner, Steven M.; Norris, Jill M.; Bowden, Donald W.

    2009-01-01

    OBJECTIVE This study evaluated the influence of somatostatin receptor type 2 (SSTR2) polymorphisms on measures of glucose homeostasis in the Insulin Resistance Atherosclerosis Family Study (IRASFS). SSTR2 is a G-protein?coupled receptor that, in response to somatostatin, mediates inhibition of insulin, glucagon, and growth hormone release and thus may affect glucose homeostasis. RESEARCH DESIGN AND METHODS Ten single nucleotide polymorphisms (SNPs) spanning the gene were chosen using a SNP de...

  2. Impact of donor and recipient single nucleotide polymorphisms of IL28B rs8099917 in living donor liver transplantation for hepatitis C.

    Directory of Open Access Journals (Sweden)

    Nobuhiro Harada

    Full Text Available Single nucleotide polymorphisms of interleukin-28B (IL28B rs8099917 are reported to be associated with virologic clearance in interferon-and ribavirin -based treatment for hepatitis C virus (HCV-infected patients. We examined virologic response in accordance with IL28B polymorphisms in our living donor liver transplantation series under a preemptive interferon and RBV treatment approach. Adequate DNA samples from both the recipient and donor for the study of single nucleotide polymorphisms of IL28B were available from 96 cases and were the subjects of the present study. Various clinical factors related with virologic response including early virologic response (EVR and sustained virologic response (SVR were examined. Totally 51% presented with EVR and 44% achieved SVR. Presence of the major allele (TT in either the recipient or the donor corresponded to SVR of 53% and 48%. Presence of the minor allele (TG or GG corresponded to SVR of 26% and 32%. Multivariate analysis revealed that genotype of HCV or EVR, but not IL28B polymorphisms in either the recipient or donor, was an independent factor for achieving SVR. When virologic response to treatment was incorporated into analysis, the impact of IL28B polymorphism on virological clearance remained relative to other factors and was not significantly independent.

  3. Single-nucleotide polymorphism in the 5-α-reductase gene (SRD5A2) is associated with increased prevalence of metabolic syndrome in chemotherapy-treated testicular cancer survivors.

    Science.gov (United States)

    Boer, Hink; Westerink, Nico-Derk L; Altena, Renske; Nuver, Janine; Dijck-Brouwer, D A Janneke; van Faassen, Martijn; Klont, Frank; Kema, Ido P; Lefrandt, Joop D; Zwart, Nynke; Boezen, H Marike; Smit, Andries J; Meijer, Coby; Gietema, Jourik A

    2016-02-01

    Chemotherapy-treated testicular cancer survivors are at risk for development of the metabolic syndrome, especially in case of decreased androgen levels. Polymorphisms in the gene encoding steroid 5-α-reductase type II (SRD5A2) are involved in altered androgen metabolism. We investigated whether single-nucleotide polymorphisms (SNPs) rs523349 (V89L) and rs9282858 (A49T) in SRD5A2 are associated with cardiometabolic status in testicular cancer survivors. In 173 chemotherapy-treated testicular cancer survivors, hormone levels and cardiometabolic status were evaluated cross-sectionally (median 5 years [range 3-20] after chemotherapy) and correlated with SNPs in SRD5A2. The metabolic syndrome was more prevalent in survivors who were homozygous or heterozygous variant for SRD5A2 rs523349 compared to wild type (33% versus 19%, P = 0.032). In particular, patients with lower testosterone levels (testicular cancer survivors homozygous or heterozygous variant for SNP rs523349 in SRD5A2. Altered androgen sensitivity appears to be involved in the development of adverse metabolic and vascular changes in testicular cancer survivors and is a target for intervention. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

    Science.gov (United States)

    Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

    2017-02-01

    To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

  5. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  6. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  7. A SNP-Based Molecular Barcode for Characterization of Common Wheat.

    Directory of Open Access Journals (Sweden)

    LiFeng Gao

    Full Text Available Wheat is grown as a staple crop worldwide. It is important to develop an effective genotyping tool for this cereal grain both to identify germplasm diversity and to protect the rights of breeders. Single-nucleotide polymorphism (SNP genotyping provides a means for developing a practical, rapid, inexpensive and high-throughput assay. Here, we investigated SNPs as robust markers of genetic variation for typing wheat cultivars. We identified SNPs from an array of 9000 across a collection of 429 well-known wheat cultivars grown in China, of which 43 SNP markers with high minor allele frequency and variations discriminated the selected wheat varieties and their wild ancestors. This SNP-based barcode will allow for the rapid and precise identification of wheat germplasm resources and newly released varieties and will further assist in the wheat breeding program.

  8. Single Nucleotide Polymorphisms in Regulator-Encoding Genes Have an Additive Effect on Virulence Gene Expression in a Vibrio cholerae Clinical Isolate.

    Science.gov (United States)

    Carignan, Bailey M; Brumfield, Kyle D; Son, Mike S

    2016-01-01

    Vibrio cholerae is the etiological agent of the infectious disease cholera, which is characterized by vomiting and severe watery diarrhea. Recently, V. cholerae clinical isolates have demonstrated increased virulence capabilities, causing more severe symptoms with a much higher rate of disease progression than previously observed. We have identified single nucleotide polymorphisms (SNPs) in four virulence-regulatory genes (hapR, hns, luxO, and vieA) of a hypervirulent V. cholerae clinical isolate, MQ1795. Herein, all SNPs and SNP combinations of interest were introduced into the prototypical El Tor reference strain N16961, and the effects on the production of numerous virulence-related factors, including cholera toxin (CT), the toxin-coregulated pilus (TCP), and ToxT, were analyzed. Our data show that triple-SNP (hapR hns luxO and hns luxO vieA) and quadruple-SNP combinations produced the greatest increases in CT, TCP, and ToxT production. The hns and hns luxO SNP combinations were sufficient for increased TCP and ToxT production. Notably, the hns luxO vieA triple-SNP combination strain produced TCP and ToxT levels similar to those of MQ1795. Certain SNP combinations (hapR and hapR vieA) had the opposite effect on CT, TCP, and ToxT expression. Interestingly, the hns vieA double-SNP combination strain increased TCP production while decreasing CT production. Our findings suggest that SNPs identified in the four regulatory genes, in various combinations, are associated with increased virulence capabilities observed in V. cholerae clinical isolates. These studies provide insight into the evolution of highly virulent strains. IMPORTANCE Cholera, an infectious disease of the small intestine caused by the aquatic bacterium Vibrio cholerae, often results in vomiting and acute watery diarrhea. If left untreated or if the response is too slow, the symptoms can quickly lead to extreme dehydration and ultimately death of the patient. Recent anecdotal evidence of cholera

  9. Compilation of a panel of informative single nucleotide polymorphisms for bovine identification in the Northern Irish cattle population

    Directory of Open Access Journals (Sweden)

    Hartshorne David

    2010-01-01

    Full Text Available Abstract Background Animal identification is pivotal in governmental agricultural policy, enabling the management of subsidy payments, movement of livestock, test scheduling and control of disease. Advances in bovine genomics have made it possible to utilise inherent genetic variability to uniquely identify individual animals by DNA profiling, much as has been achieved with humans over the past 20 years. A DNA profiling test based on bi-allelic single nucleotide polymorphism (SNP markers would offer considerable advantages over current short tandem repeat (STR based industry standard tests, in that it would be easier to analyse and interpret. In this study, a panel of 51 genome-wide SNPs were genotyped across panels of semen DNA from 6 common breeds for the purposes of ascertaining allelic frequency. For SNPs on the same chromosome, the extent of linkage disequilbrium was determined from genotype data by Expectation Maximization (EM algorithm. Minimum probabilities of unique identification were determined for each breed panel. The usefulness of this SNP panel was ascertained by comparison to the current bovine STR Stockmarks II assay. A statistically representative random sampling of bovine animals from across Northern Ireland was assembled for the purposes of determining the population allele frequency for these STR loci and subsequently, the minimal probability of unique identification they conferred in sampled bovine animals from Northern Ireland. Results 6 SNPs exhibiting a minor allele frequency of less than 0.2 in more than 3 of the breed panels were excluded. 2 Further SNPs were found to reside in coding areas of the cattle genome and were excluded from the final panel. The remaining 43 SNPs exhibited genotype frequencies which were in Hardy Weinberg Equilibrium. SNPs on the same chromosome were observed to have no significant linkage disequilibrium/allelic association. Minimal probabilities of uniquely identifying individual animals from

  10. Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction.

    Science.gov (United States)

    Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng

    2012-08-21

    Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.

  11. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    Science.gov (United States)

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  12. CLC-2 single nucleotide polymorphisms (SNPs as potential modifiers of cystic fibrosis disease severity

    Directory of Open Access Journals (Sweden)

    Bleecker Eugene R

    2004-10-01

    Full Text Available Abstract Background Cystic fibrosis (CF lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1 > 70% and Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity.

  13. Single nucleotide polymorphism-based molecular typing of M. leprae from multicase families of leprosy patients and their surroundings to understand the transmission of leprosy.

    Science.gov (United States)

    Turankar, R P; Lavania, M; Chaitanya, V S; Sengupta, U; Darlong, J; Darlong, F; Siva Sai, K S R; Jadhav, R S

    2014-03-01

    The exact mode of transmission of leprosy is not clearly understood; however, many studies have demonstrated active transmission of leprosy around a source case. Families of five active leprosy cases and their household contacts were chosen from a high endemic area in Purulia. Fifty-two soil samples were also collected from different areas of their houses. DNA was extracted from slit-skin smears (SSS) and soil samples and the Mycobacterium leprae-specific RLEP (129 bp) region was amplified using PCR. Molecular typing of M. leprae was performed for all RLEP PCR-positive samples by single nucleotide polymorphism (SNP) typing and confirmation by DNA sequencing. SSS of these five patients and six out of the total 28 contacts were PCR positive for RLEP whereas 17 soil samples out of 52 showed the presence of M. leprae DNA. SNP typing of M. leprae from all RLEP PCR-positive subjects (patients and smear-positive contacts) and 10 soil samples showed the SNP type 1 genotype. M. leprae DNA from the five leprosy patients and the six contacts was further subtyped and the D subtype was noted in all patients and contacts, except for one contact where the C subtype was identified. Typing followed by subtyping of M. leprae clearly revealed that either the contacts were infected by the patients or both patients and contacts had the same source of infection. It also revealed that the type of M. leprae in the soil in the inhabited areas where patients resided was also of the same type as that found in patients. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  14. New generation pharmacogenomic tools: a SNP linkage disequilibrium Map, validated SNP assay resource, and high-throughput instrumentation system for large-scale genetic studies.

    Science.gov (United States)

    De La Vega, Francisco M; Dailey, David; Ziegle, Janet; Williams, Julie; Madden, Dawn; Gilbert, Dennis A

    2002-06-01

    Since public and private efforts announced the first draft of the human genome last year, researchers have reported great numbers of single nucleotide polymorphisms (SNPs). We believe that the availability of well-mapped, quality SNP markers constitutes the gateway to a revolution in genetics and personalized medicine that will lead to better diagnosis and treatment of common complex disorders. A new generation of tools and public SNP resources for pharmacogenomic and genetic studies--specifically for candidate-gene, candidate-region, and whole-genome association studies--will form part of the new scientific landscape. This will only be possible through the greater accessibility of SNP resources and superior high-throughput instrumentation-assay systems that enable affordable, highly productive large-scale genetic studies. We are contributing to this effort by developing a high-quality linkage disequilibrium SNP marker map and an accompanying set of ready-to-use, validated SNP assays across every gene in the human genome. This effort incorporates both the public sequence and SNP data sources, and Celera Genomics' human genome assembly and enormous resource ofphysically mapped SNPs (approximately 4,000,000 unique records). This article discusses our approach and methodology for designing the map, choosing quality SNPs, designing and validating these assays, and obtaining population frequency ofthe polymorphisms. We also discuss an advanced, high-performance SNP assay chemisty--a new generation of the TaqMan probe-based, 5' nuclease assay-and high-throughput instrumentation-software system for large-scale genotyping. We provide the new SNP map and validation information, validated SNP assays and reagents, and instrumentation systems as a novel resource for genetic discoveries.

  15. Genome wide in silico SNP-tumor association analysis

    International Nuclear Information System (INIS)

    Qiu, Ping; Wang, Luquan; Kostich, Mitch; Ding, Wei; Simon, Jason S; Greene, Jonathan R

    2004-01-01

    Carcinogenesis occurs, at least in part, due to the accumulation of mutations in critical genes that control the mechanisms of cell proliferation, differentiation and death. Publicly accessible databases contain millions of expressed sequence tag (EST) and single nucleotide polymorphism (SNP) records, which have the potential to assist in the identification of SNPs overrepresented in tumor tissue. An in silico SNP-tumor association study was performed utilizing tissue library and SNP information available in NCBI's dbEST (release 092002) and dbSNP (build 106). A total of 4865 SNPs were identified which were present at higher allele frequencies in tumor compared to normal tissues. A subset of 327 (6.7%) SNPs induce amino acid changes to the protein coding sequences. This approach identified several SNPs which have been previously associated with carcinogenesis, as well as a number of SNPs that now warrant further investigation This novel in silico approach can assist in prioritization of genes and SNPs in the effort to elucidate the genetic mechanisms underlying the development of cancer

  16. Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

    Science.gov (United States)

    Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

    2018-04-01

    Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

  17. A study of possible associations between single nucleotide polymorphisms in the estrogen receptor 2 gene and female sexual desire.

    Science.gov (United States)

    Gunst, Annika; Jern, Patrick; Westberg, Lars; Johansson, Ada; Salo, Benny; Burri, Andrea; Spector, Tim; Eriksson, Elias; Sandnabba, N Kenneth; Santtila, Pekka

    2015-03-01

    Female sexual desire and arousal problems have been shown to have a heritable component of moderate size. Previous molecular genetic studies on sexual desire have mainly focused on genes associated with neurotransmitters such as dopamine and serotonin. Nevertheless, there is reason to believe that hormones with more specific functions concerning sexuality could have an impact on sexual desire and arousal. The aim of the present study was to investigate the possible effects of 17 single nucleotide polymorphisms (SNPs) located in estrogen receptor genes on female sexual desire and subjective and genital arousal (lubrication). Based on previous research, we hypothesized that ESR1 and ESR2 are relevant genes that contribute to female sexual desire and arousal. The desire, arousal, and lubrication subdomains of the Female Sexual Function Index self-report questionnaire were used. The present study involved 2,448 female twins and their sisters aged 18-49 who had submitted saliva samples for genotyping. The participants were a subset from a large-scale, population-based sample. We found nominally significant main effects on sexual desire for three ESR2 -linked SNPs when controlled for anxiety, suggesting that individuals homozygous for the G allele of the rs1271572 SNP, and the A allele of the rs4986938 and rs928554 SNPs had lower levels of sexual desire. The rs4986938 SNP also had a nominally significant effect on lubrication. No effects for any of the SNPs on subjective arousal could be detected. The number of nominally significant results for SNPs in the ESR2 gene before correcting for multiple testing suggests that further studies on the possible influence of this gene on interindividual variation in female sexual functioning are warranted. In contrast, no support for an involvement of ESR1 was obtained. Our results should be interpreted with caution until replicated in independent, large samples. © 2014 International Society for Sexual Medicine.

  18. Estimating additive and non-additive genetic variances and predicting genetic merits using genome-wide dense single nucleotide polymorphism markers.

    Directory of Open Access Journals (Sweden)

    Guosheng Su

    Full Text Available Non-additive genetic variation is usually ignored when genome-wide markers are used to study the genetic architecture and genomic prediction of complex traits in human, wild life, model organisms or farm animals. However, non-additive genetic effects may have an important contribution to total genetic variation of complex traits. This study presented a genomic BLUP model including additive and non-additive genetic effects, in which additive and non-additive genetic relation matrices were constructed from information of genome-wide dense single nucleotide polymorphism (SNP markers. In addition, this study for the first time proposed a method to construct dominance relationship matrix using SNP markers and demonstrated it in detail. The proposed model was implemented to investigate the amounts of additive genetic, dominance and epistatic variations, and assessed the accuracy and unbiasedness of genomic predictions for daily gain in pigs. In the analysis of daily gain, four linear models were used: 1 a simple additive genetic model (MA, 2 a model including both additive and additive by additive epistatic genetic effects (MAE, 3 a model including both additive and dominance genetic effects (MAD, and 4 a full model including all three genetic components (MAED. Estimates of narrow-sense heritability were 0.397, 0.373, 0.379 and 0.357 for models MA, MAE, MAD and MAED, respectively. Estimated dominance variance and additive by additive epistatic variance accounted for 5.6% and 9.5% of the total phenotypic variance, respectively. Based on model MAED, the estimate of broad-sense heritability was 0.506. Reliabilities of genomic predicted breeding values for the animals without performance records were 28.5%, 28.8%, 29.2% and 29.5% for models MA, MAE, MAD and MAED, respectively. In addition, models including non-additive genetic effects improved unbiasedness of genomic predictions.

  19. Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

    Science.gov (United States)

    Multani, Shaleen; Saranath, Dhananjaya

    2016-11-01

    Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

  20. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  1. Association of the Single Nucleotide Polymorphisms in , , and with Blood Related Traits in Pigs

    Directory of Open Access Journals (Sweden)

    Jae-Bong Lee

    2016-12-01

    Full Text Available The aim of this study was to detect positional candidate genes located within the support interval (SI regions based on the results of red blood cell, mean corpuscular volume (MCV, and mean corpuscular hemoglobin quantitative trait locus (QTL in Sus scrofa chromosome 13, and to verify the correlation between specific single-nucleotide polymorphisms (SNPs located in the exonic region of the positional candidate gene and the three genetic traits. The flanking markers of the three QTL SI regions are SW38 and S0215. Within the QTL SI regions, 44 genes were located, and runt-related transcription factor 1, dual-specificity tyrosine-(Y-phosphorylation regulated kinase 1A (DYRK1A, and potassium inwardly-rectifying channel, subfamily J, member 15 KCNJ15–which are reported to be related to the hematological traits and clinical features of Down syndrome–were selected as positional candidate genes. The ten SNPs located in the exonic region of the three genes were detected by next generation sequencing. A total of 1,232 pigs of an F2 resource population between Landrace and Korean native pigs were genotyped. To investigate the effects of the three genes on each genotype, a mixed-effect model which is the considering family structure model was used to evaluate the associations between the SNPs and three genetic traits in the F2 intercross population. Among them, the MCV level was highly significant (nominal p = 9.8×10−9 in association with the DYRK1A-SNP1 (c.2989 G

  2. Microsatellite and single nucleotide polymorphisms in the β-globin locus control region-hypersensitive Site 2: SPECIFICITY of Tunisian βs chromosomes.

    Science.gov (United States)

    Ben Mustapha, Maha; Moumni, Imen; Zorai, Amine; Douzi, Kaïs; Ghanem, Abderraouf; Abbes, Salem

    2012-01-01

    The diversity of sickle cell disease severity is attributed to several cis acting factors, among them the single nucleotide polymorphisms (SNPs) and (AT) rich region in the β-locus control region (β-LCR). This contains five DNase I hypersensitive sites (HS) located 6 to 22 kb upstream to the ϵ gene. The most important of these is the HS2 (5' β-LCR-HS2), characterized by the presence of three different SNPs and a microsatellite region known to be in association with β(S) chromosomes in various populations. The aim of this study was to present the molecular investigation of the 5' β-LCR-HS2 site in normal and sickle cell disease individuals in order to determine if there is any correlation or specificity between these molecular markers, the β(S) Tunisian chromosomes and phenotypical expression of sickle cell disease. One hundred and twenty-four chromosomes from Tunisian individuals (49 β(S) carriers and 13 normal individuals) were screened by polymerase chain reaction (PCR) and sequencing for the polymorphic short tandem microsatellite repeats (AT)(X)N(12)(AT)(Y) and the three SNPs (rs7119428, rs9736333 and rs60240093) of the 5' β-LCR-HS2. Twelve configurations of the microsatellite motif were found with an ancestral configuration elaborated by ClustalW software. Normal and mutated alleles were observed at the homozygous and heterozygous states for the three SNPs. Correlation between microsatellites and SNPs suggests that mutant SNP alleles were mainly associated, in the homozygous sickle cell disease phenotype, with the (AT)(8)N(12)GT(AT)(7) configuration, whereas, normal SNP alleles were associated with the (AT)(X)N(12)(AT)(11) configurations in normal β(A) chromosomes. The correlation of these various configurations with Hb F expression was also investigated. The principal component analysis (PCA) showed the correlation between the homozygous sickle cell disease phenotype, mutated SNP alleles and the Benin microsatellite configuration (AT)(8)N(12)GT

  3. Real time hybridization studies by resonant waveguide gratings using nanopattern imaging for Single Nucleotide Polymorphism detection

    KAUST Repository

    Bougot-Robin, Kristelle

    2013-12-20

    2D imaging of biochips is particularly interesting for multiplex biosensing. Resonant properties allow label-free detection using the change of refractive index at the chip surface. We demonstrate a new principle of Scanning Of Resonance on Chip by Imaging (SORCI) based on spatial profiles of nanopatterns of resonant waveguide gratings (RWGs) and its embodiment in a fluidic chip for real-time biological studies. This scheme allows multiplexing of the resonance itself by providing nanopattern sensing areas in a bioarray format. Through several chip designs we discuss resonance spatial profiles, dispersion and electric field distribution for optimal light-matter interaction with biological species of different sizes. Fluidic integration is carried out with a black anodized aluminum chamber, advantageous in term of mechanical stability, multiple uses of the chip, temperature control and low optical background. Real-time hybridization experiments are illustrated by SNP (Single Nucleotide Polymorphism) detection in gyrase A of E. coli K12, observed in evolution studies of resistance to the antibiotic ciprofloxacin. We choose a 100 base pairs (bp) DNA target (∼30 kDa) including the codon of interest and demonstrate the high specificity of our technique for probes and targets with close affinity constants. This work validates the safe applicability of our unique combination of RWGs and simple instrumentation for real-time biosensing with sensitivity in buffer solution of ∼10 pg/mm2. Paralleling the success of RWGs sensing for cells sensing, our work opens new avenues for a large number of biological studies. © 2013 Springer Science+Business Media.

  4. Single nucleotide polymorphisms in i-type lysozyme gene and their correlation with vibrio-resistance and growth of clam Meretrix meretrix based on the selected resistance stocks.

    Science.gov (United States)

    Yue, Xin; Wang, Hongxia; Huang, Xiaohong; Wang, Chao; Chai, Xueliang; Wang, Chunde; Liu, Baozhong

    2012-09-01

    I-type lysozyme is considered to play crucial roles in both anti-bacteria and digestion function of the bivalve, which signifies that it is related to both immunity and growth. In this study, based on the principle of case-control association analysis, using the stock materials with different vibrio-resistance profile obtained by selective breeding, single nucleotide polymorphisms (SNPs) in the DNA partial sequence of an i-type lysozyme of Meretrix meretrix (MmeLys) were discovered and examined for their association with vibrio-resistance and growth. Twenty-seven SNPs were detected and fifteen of them were genotyped in clam stocks with different resistance to Vibrio harveyi (09-C and 09-R) and to Vibrio parahaemolyticus (11-S and 11-R). Allele frequency distribution among different stocks was compared. And wet weight of clams with different genotype at each SNP locus was compared. The results indicated that SNP locus 9 was associated with V. harveyi and V. parahaemolyticus resistance and growth of M. meretrix. Loci 12 and 14 were associated with both V. parahaemolyticus-resistance and growth, and also have the potential to be related with V. harveyi-resistance of M. meretrix. Therefore these three SNPs especially locus 9 were the potential markers which may be involved in assisting resistance selective breeding. In addition, this study showed evidence that improvements in clam resistance to vibriosis could be achieved through selective breeding. All results provided encouragement for the continuation of the selective breeding program for vibrio-resistance gain in clam M. meretrix and the application of polymorphisms in MmeLys to the future marker assisted selection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    Science.gov (United States)

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  6. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  7. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona

    2014-01-01

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  8. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  9. Multiple Locus Variable-Number Tandem-Repeat and Single-Nucleotide Polymorphism-Based Brucella Typing Reveals Multiple Lineages in Brucella melitensis Currently Endemic in China

    Directory of Open Access Journals (Sweden)

    Mingjun Sun

    2017-12-01

    Full Text Available Brucellosis is a worldwide zoonotic disease caused by Brucella spp. In China, brucellosis is recognized as a reemerging disease mainly caused by Brucella melitensis specie. To better understand the currently endemic B. melitensis strains in China, three Brucella genotyping methods were applied to 110 B. melitensis strains obtained in past several years. By MLVA genotyping, five MLVA-8 genotypes were identified, among which genotypes 42 (1-5-3-13-2-2-3-2 was recognized as the predominant genotype, while genotype 63 (1-5-3-13-2-3-3-2 and a novel genotype of 1-5-3-13-2-4-3-2 were second frequently observed. MLVA-16 discerned a total of 57 MLVA-16 genotypes among these Brucella strains, with 41 genotypes being firstly detected and the other 16 genotypes being previously reported. By BruMLSA21 typing, six sequence types (STs were identified, among them ST8 is the most frequently seen in China while the other five STs were firstly detected and designated as ST137, ST138, ST139, ST140, and ST141 by international multilocus sequence typing database. Whole-genome sequence (WGS-single-nucleotide polymorphism (SNP-based typing and phylogenetic analysis resolved Chinese B. melitensis strains into five clusters, reflecting the existence of multiple lineages among these Chinese B. melitensis strains. In phylogeny, Chinese lineages are more closely related to strains collected from East Mediterranean and Middle East countries, such as Turkey, Kuwait, and Iraq. In the next few years, MLVA typing will certainly remain an important epidemiological tool for Brucella infection analysis, as it displays a high discriminatory ability and achieves result largely in agreement with WGS-SNP-based typing. However, WGS-SNP-based typing is found to be the most powerful and reliable method in discerning Brucella strains and will be popular used in the future.

  10. Genomic expression and single-nucleotide polymorphism profiling discriminates chromophobe renal cell carcinoma and oncocytoma

    International Nuclear Information System (INIS)

    Tan, Min-Han; Furge, Kyle A; Kort, Eric; Giraud, Sophie; Ferlicot, Sophie; Vielh, Philippe; Amsellem-Ouazana, Delphine; Debré, Bernard; Flam, Thierry; Thiounn, Nicolas; Zerbib, Marc; Wong, Chin Fong; Benoît, Gérard; Droupy, Stéphane; Molinié, Vincent; Vieillefond, Annick; Tan, Puay Hoon; Richard, Stéphane; Teh, Bin Tean; Tan, Hwei Ling; Yang, Ximing J; Ditlev, Jonathon; Matsuda, Daisuke; Khoo, Sok Kean; Sugimura, Jun; Fujioka, Tomoaki

    2010-01-01

    Chromophobe renal cell carcinoma (chRCC) and renal oncocytoma are two distinct but closely related entities with strong morphologic and genetic similarities. While chRCC is a malignant tumor, oncocytoma is usually regarded as a benign entity. The overlapping characteristics are best explained by a common cellular origin, and the biologic differences between chRCC and oncocytoma are therefore of considerable interest in terms of carcinogenesis, diagnosis and clinical management. Previous studies have been relatively limited in terms of examining the differences between oncocytoma and chromophobe RCC. Gene expression profiling using the Affymetrix HGU133Plus2 platform was applied on chRCC (n = 15) and oncocytoma specimens (n = 15). Supervised analysis was applied to identify a discriminatory gene signature, as well as differentially expressed genes. High throughput single-nucleotide polymorphism (SNP) genotyping was performed on independent samples (n = 14) using Affymetrix GeneChip Mapping 100 K arrays to assess correlation between expression and gene copy number. Immunohistochemical validation was performed in an independent set of tumors. A novel 14 probe-set signature was developed to classify the tumors internally with 93% accuracy, and this was successfully validated on an external data-set with 94% accuracy. Pathway analysis highlighted clinically relevant dysregulated pathways of c-erbB2 and mammalian target of rapamycin (mTOR) signaling in chRCC, but no significant differences in p-AKT or extracellular HER2 expression was identified on immunohistochemistry. Loss of chromosome 1p, reflected in both cytogenetic and expression analysis, is common to both entities, implying this may be an early event in histogenesis. Multiple regional areas of cytogenetic alterations and corresponding expression biases differentiating the two entities were identified. Parafibromin, aquaporin 6, and synaptogyrin 3 were novel immunohistochemical markers effectively discriminating

  11. Genomic expression and single-nucleotide polymorphism profiling discriminates chromophobe renal cell carcinoma and oncocytoma

    Directory of Open Access Journals (Sweden)

    Thiounn Nicolas

    2010-05-01

    Full Text Available Abstract Background Chromophobe renal cell carcinoma (chRCC and renal oncocytoma are two distinct but closely related entities with strong morphologic and genetic similarities. While chRCC is a malignant tumor, oncocytoma is usually regarded as a benign entity. The overlapping characteristics are best explained by a common cellular origin, and the biologic differences between chRCC and oncocytoma are therefore of considerable interest in terms of carcinogenesis, diagnosis and clinical management. Previous studies have been relatively limited in terms of examining the differences between oncocytoma and chromophobe RCC. Methods Gene expression profiling using the Affymetrix HGU133Plus2 platform was applied on chRCC (n = 15 and oncocytoma specimens (n = 15. Supervised analysis was applied to identify a discriminatory gene signature, as well as differentially expressed genes. High throughput single-nucleotide polymorphism (SNP genotyping was performed on independent samples (n = 14 using Affymetrix GeneChip Mapping 100 K arrays to assess correlation between expression and gene copy number. Immunohistochemical validation was performed in an independent set of tumors. Results A novel 14 probe-set signature was developed to classify the tumors internally with 93% accuracy, and this was successfully validated on an external data-set with 94% accuracy. Pathway analysis highlighted clinically relevant dysregulated pathways of c-erbB2 and mammalian target of rapamycin (mTOR signaling in chRCC, but no significant differences in p-AKT or extracellular HER2 expression was identified on immunohistochemistry. Loss of chromosome 1p, reflected in both cytogenetic and expression analysis, is common to both entities, implying this may be an early event in histogenesis. Multiple regional areas of cytogenetic alterations and corresponding expression biases differentiating the two entities were identified. Parafibromin, aquaporin 6, and synaptogyrin 3 were novel

  12. Unraveling the genetic architecture of environmental variance of somatic cell score using high-density single nucleotide polymorphism and cow data from experimental farms.

    Science.gov (United States)

    Mulder, H A; Crump, R E; Calus, M P L; Veerkamp, R F

    2013-01-01

    In recent years, it has been shown that not only is the phenotype under genetic control, but also the environmental variance. Very little, however, is known about the genetic architecture of environmental variance. The main objective of this study was to unravel the genetic architecture of the mean and environmental variance of somatic cell score (SCS) by identifying genome-wide associations for mean and environmental variance of SCS in dairy cows and by quantifying the accuracy of genome-wide breeding values. Somatic cell score was used because previous research has shown that the environmental variance of SCS is partly under genetic control and reduction of the variance of SCS by selection is desirable. In this study, we used 37,590 single nucleotide polymorphism (SNP) genotypes and 46,353 test-day records of 1,642 cows at experimental research farms in 4 countries in Europe. We used a genomic relationship matrix in a double hierarchical generalized linear model to estimate genome-wide breeding values and genetic parameters. The estimated mean and environmental variance per cow was used in a Bayesian multi-locus model to identify SNP associated with either the mean or the environmental variance of SCS. Based on the obtained accuracy of genome-wide breeding values, 985 and 541 independent chromosome segments affecting the mean and environmental variance of SCS, respectively, were identified. Using a genomic relationship matrix increased the accuracy of breeding values relative to using a pedigree relationship matrix. In total, 43 SNP were significantly associated with either the mean (22) or the environmental variance of SCS (21). The SNP with the highest Bayes factor was on chromosome 9 (Hapmap31053-BTA-111664) explaining approximately 3% of the genetic variance of the environmental variance of SCS. Other significant SNP explained less than 1% of the genetic variance. It can be concluded that fewer genomic regions affect the environmental variance of SCS than the

  13. Genome-wide survey of single-nucleotide polymorphisms reveals fine-scale population structure and signs of selection in the threatened Caribbean elkhorn coral, Acropora palmata

    Directory of Open Access Journals (Sweden)

    Meghann K. Devlin-Durante

    2017-11-01

    Full Text Available The advent of next-generation sequencing tools has made it possible to conduct fine-scale surveys of population differentiation and genome-wide scans for signatures of selection in non-model organisms. Such surveys are of particular importance in sharply declining coral species, since knowledge of population boundaries and signs of local adaptation can inform restoration and conservation efforts. Here, we use genome-wide surveys of single-nucleotide polymorphisms in the threatened Caribbean elkhorn coral, Acropora palmata, to reveal fine-scale population structure and infer the major barrier to gene flow that separates the eastern and western Caribbean populations between the Bahamas and Puerto Rico. The exact location of this break had been subject to discussion because two previous studies based on microsatellite data had come to differing conclusions. We investigate this contradiction by analyzing an extended set of 11 microsatellite markers including the five previously employed and discovered that one of the original microsatellite loci is apparently under selection. Exclusion of this locus reconciles the results from the SNP and the microsatellite datasets. Scans for outlier loci in the SNP data detected 13 candidate loci under positive selection, however there was no correlation between available environmental parameters and genetic distance. Together, these results suggest that reef restoration efforts should use local sources and utilize existing functional variation among geographic regions in ex situ crossing experiments to improve stress resistance of this species.

  14. Genome-wide survey of single-nucleotide polymorphisms reveals fine-scale population structure and signs of selection in the threatened Caribbean elkhorn coral, Acropora palmata.

    Science.gov (United States)

    Devlin-Durante, Meghann K; Baums, Iliana B

    2017-01-01

    The advent of next-generation sequencing tools has made it possible to conduct fine-scale surveys of population differentiation and genome-wide scans for signatures of selection in non-model organisms. Such surveys are of particular importance in sharply declining coral species, since knowledge of population boundaries and signs of local adaptation can inform restoration and conservation efforts. Here, we use genome-wide surveys of single-nucleotide polymorphisms in the threatened Caribbean elkhorn coral, Acropora palmata , to reveal fine-scale population structure and infer the major barrier to gene flow that separates the eastern and western Caribbean populations between the Bahamas and Puerto Rico. The exact location of this break had been subject to discussion because two previous studies based on microsatellite data had come to differing conclusions. We investigate this contradiction by analyzing an extended set of 11 microsatellite markers including the five previously employed and discovered that one of the original microsatellite loci is apparently under selection. Exclusion of this locus reconciles the results from the SNP and the microsatellite datasets. Scans for outlier loci in the SNP data detected 13 candidate loci under positive selection, however there was no correlation between available environmental parameters and genetic distance. Together, these results suggest that reef restoration efforts should use local sources and utilize existing functional variation among geographic regions in ex situ crossing experiments to improve stress resistance of this species.

  15. Analysis of over 10,000 Cases finds no association between previously reported candidate polymorphisms and ovarian cancer outcome

    DEFF Research Database (Denmark)

    White, Kristin L; Vierkant, Robert A; Fogarty, Zachary C

    2013-01-01

    Ovarian cancer is a leading cause of cancer-related death among women. In an effort to understand contributors to disease outcome, we evaluated single-nucleotide polymorphisms (SNP) previously associated with ovarian cancer recurrence or survival, specifically in angiogenesis, inflammation, mitosis...

  16. Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms.

    Science.gov (United States)

    Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro

    2010-04-27

    To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be

  17. Association analysis of polymorphism in KIAA1717, HUMMLC2B ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) in KIAA1717, HUMMLC2B, DECR1, and FTO genes have been found to be associated with some pork meat quality traits. ... with meat color (CIE L), backfat thickness, drip loss, water-holding capacity, and pH24hr; a SNP in HUMMLC2B was associated with chemical composition ...

  18. A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi

    2010-01-01

    It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca...

  19. DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.

    Directory of Open Access Journals (Sweden)

    Inês Soares

    Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.

  20. Genetic study of two single nucleotide polymorphisms within corresponding microRNAs and susceptibility to tuberculosis in a Chinese Tibetan and Han population.

    Science.gov (United States)

    Li, Dongdong; Li, Dingdong; Wang, Tingting; Song, Xingbo; Qucuo, MeiLang; Yang, Bin; Zhang, Junlong; Wang, Jun; Ying, Binwu; Tao, Chuanmin; Wang, Lanlan

    2011-07-01

    MicroRNAs (miRNA) are thought to play important roles in the pathogenesis of diseases. Single nucleotide polymorphisms (SNPs) within miRNAs can change their characteristics via altering their target selection and/or expression, resulting in functional and/or phenotypic changes. We decided to investigate the genetic association with pulmonary tuberculosis with 2 nucleotide variations within corresponding microRNAs regulating the Toll-like receptor (TLR)-mediating signal pathway. MiRNAs potentially regulating the TLR-mediating signal pathway were predicted via bioinformatics. Finally, 2 SNPs, rs2910164 G>C and rs3746444 T>C within miR-146a and miR-499, were selected as candidates in accordance with some criteria. SNPs were genotyped by polymerase chain reaction-restriction fragment length polymorphism and validated by sequencing to demonstrate their association with susceptibility to pulmonary tuberculosis (PTB) in 337 PTB cases and 738 healthy controls, including 318 Tibetan and 757 Han individuals. Bioinformatics databases were searched to support the association between miRNAs and PTB. There was no association between rs3746444 and PTB risk (p = 0.118) in the Han population, but subjects carrying the C allele exhibited decreased PTB risk (odds ratio [OR] = 0.403 [95% confidence interval (95% CI) 0.278-0.583]). However, there was an association between rs3746444 and PTB in the Tibetan population, and individuals carrying the C allele exhibited increased PTB risk (OR = 1.870 [95% CI 1.218-2.871]). A polymorphism (rs2910164 G>C) indicated an association with PTB risk in both Tibetan (p = 0.031) and Han (p = 0.000) populations. However, the role of the G allele of rs2910164, like the C allele in rs3746444, differed in the Tibetan (OR = 1.509, p tuberculosis with SNPs within the corresponding miRNAs potentially regulates the TLR signal pathway. It is interesting that both the G allele (rs2910164) and the C allele (rs3746444) play different roles in 2 populations

  1. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    Science.gov (United States)

    Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M

    2016-01-01

    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional

  2. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    Directory of Open Access Journals (Sweden)

    Davis Gimode

    Full Text Available Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS technologies to develop both Simple Sequence Repeat (SSR and Single Nucleotide Polymorphism (SNP markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included

  3. [Restriction endonuclease digest - melting curve analysis: a new SNP genotyping and its application in traditional Chinese medicine authentication].

    Science.gov (United States)

    Jiang, Chao; Huang, Lu-Qi; Yuan, Yuan; Chen, Min; Hou, Jing-Yi; Wu, Zhi-Gang; Lin, Shu-Fang

    2014-04-01

    Single nucleotide polymorphisms (SNP) is an important molecular marker in traditional Chinese medicine research, and it is widely used in TCM authentication. The present study created a new genotyping method by combining restriction endonuclease digesting with melting curve analysis, which is a stable, rapid and easy doing SNP genotyping method. The new method analyzed SNP genotyping of two chloroplast SNP which was located in or out of the endonuclease recognition site, the results showed that when attaching a 14 bp GC-clamp (cggcgggagggcgg) to 5' end of the primer and selecting suited endonuclease to digest the amplification products, the melting curve of Lonicera japonica and Atractylodes macrocephala were all of double peaks and the adulterants Shan-yin-hua and A. lancea were of single peaks. The results indicated that the method had good stability and reproducibility for identifying authentic medicines from its adulterants. It is a potential SNP genotyping method and named restriction endonuclease digest - melting curve analysis.

  4. Incorporation of causative quantitative trait nucleotides in single-step GBLUP.

    Science.gov (United States)

    Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy

    2017-07-26

    Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

  5. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  6. Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

    Science.gov (United States)

    Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

    2011-09-01

    Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

  7. Association of β-fibrinogen promoter gene polymorphism (−148C/T), hyperfibrinogenemia and ischemic stroke in young adult patients

    OpenAIRE

    Imran, Imran; Lamsudin, Rusdi; Idjradinata, Ponpon; Achmad, Tri Hanggono; Maskoen, Amelani; Wibowo, Samekto; Harapan, Harapan

    2015-01-01

    Background: Single nucleotide polymorphism (SNP) −148C/T which is located in β-fibrinogen gene (FGB) promoter has correlation with fibrinogen levels; however, the association of SNP −148C/T and ischemic stroke in young adult patients is contradictory. Aim: To determine the association of SNP −148C/T in FGB promoter with plasma fibrinogen levels and ischemic stroke in young adults. Subjects and methods: In this case-control study, SNP −148C/T among 107 ischemic stroke patients and 94 con...

  8. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Pujolar, José Martin; Jacobsen, M.W.; Als, Thomas Damm

    2014-01-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify...... species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American...... eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison...

  9. Single nucleotide polymorphisms at erythropoietin, superoxide dismutase 1, splicing factor, arginine/serin-rich 15 and plasmacytoma variant translocation genes association with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    Maisaa Alwohhaib

    2014-01-01

    Full Text Available A number of genes have been identified in diabetic nephropathy. Association between diabetes-associated nephropathy and polymorphisms in the erythropoietin (EPO gene, variants in the superoxide dismutase 1 (SOD1 gene and plasmacytoma variant translocation 1 (PVT1 gene have been identified. The EPO, SOD1:SFRS15 and PVT1 genes were genotyped using the single nucleotide polymorphism (SNP technique in 38 diabetic nephropathy patients (Group 1 compared with 64 diabetic type 2 subjects without nephropathy (Group 2 at the Mubarak Alkabeer Hospital, Kuwait. The frequency of the risk allele T of the EPO (rs1617640 gene was high in both groups (0.96 in Group 1 and 0.92 in Group 2. Similarly, SNPs of the PVT1 (rs2720709 gene showed a higher frequency of the risk allele G in both groups (0.70 in the Group 1 and 0.68 in Group 2. Although the frequency of the risk allele A was higher than the frequency of the non-risk allele C of the SOD1:SFRS15 gene in both groups, the lowest probability value was observed in those gene SNPs (P = 0.05. We observed that the A allele of the SOD1:SFRS15 gene (rs17880135 was more frequently present in Group 1 (0.75 compared with Group 2 (0.62. Susceptibility to diabetes-associated nephropathy is partially mediated by genetic predisposition, and screening tests may open the gate for new therapeutic approaches.

  10. Interleukin-28B polymorphisms are associated with hepatitis C virus clearance and viral load in a HIV-1-infected cohort

    DEFF Research Database (Denmark)

    Clausen, L N; Weis, N; Astvad, K

    2011-01-01

    Summary. Twenty-five per cent of individuals infected with hepatitis C virus (HCV) are able to clear HCV spontaneously. Differences in host genetics are believed to affect the outcome of HCV infection. We analysed an exonic, a promoter and an intronic single nucleotide polymorphism (SNP) of the i......Summary. Twenty-five per cent of individuals infected with hepatitis C virus (HCV) are able to clear HCV spontaneously. Differences in host genetics are believed to affect the outcome of HCV infection. We analysed an exonic, a promoter and an intronic single nucleotide polymorphism (SNP...... higher median HCV RNA levels than individuals with unfavourable haplotype blocks (P = 0.05). Our findings suggest that IL28B may account for some differences in HCV outcome but that other factors including the viral genotype, host genetics and the host-virus interaction are likely to influence...

  11. Effect of MDM2 SNP309 and p53 codon 72 polymorphisms on lung cancer risk and survival among non-smoking Chinese women in Singapore

    Directory of Open Access Journals (Sweden)

    Sabapathy Kanaga

    2010-03-01

    Full Text Available Abstract Background Single nucleotide polymorphism (SNP 309 resulting in a T or G allele in the promoter of MDM2, the negative regulator of p53, has been suggested to affect cancer predisposition and age of onset, primarily in females. However, findings have been inconsistent in various cancers, and ethnicity appears to be a critical factor influencing the effects of the SNP on cancer risk. An increasing trend has been observed in the prevalence of lung cancers in non-smokers, especially females, though the underlying genetic basis is unclear. Methods We therefore examined the role of the SNPs in the p53 pathway (p53 codon 72 and MDM2 SNP309 on lung cancer risk and prognosis of a life-time non-smoking female Chinese population, in a hospital-based case-control study of 123 cases and 159 age-matched controls, by PCR analysis. Results Our findings reveal that the risk of lung cancer among individuals with the MDM2 SNP309 TT genotype was 2.1 (95% CI 1.01-4.36 relative to the GG genotype, contrary to initial expectations that the GG genotype with elevated MDM2 levels will increase cancer risk. Those who had this genotype in combination with the p53 Pro allele had a risk of 2.5 (95% CI 1.2-5.0. There was however no effect of either polymorphism on age at diagnosis of lung cancer or on overall survival. Conclusions The results thus demonstrate that the MDM2 SNP309 TT rather than the GG genotype is associated with increased risk of lung cancer in this population, suggesting that other mechanisms independent of increased MDM2 levels can influence cancer susceptibility.

  12. Evidence for single nucleotide polymorphisms and their association with bipolar disorder

    Directory of Open Access Journals (Sweden)

    Szczepankiewicz A

    2013-10-01

    Full Text Available Aleksandra Szczepankiewicz1,21Laboratory of Molecular and Cell Biology, 2Department of Psychiatric Genetics, Poznan University of Medical Sciences, Poznan, PolandAbstract: Bipolar disorder (BD is a complex disorder with a number of susceptibility genes and environmental risk factors involved in its pathogenesis. In recent years, huge progress has been made in molecular techniques for genetic studies, which have enabled identification of numerous genomic regions and genetic variants implicated in BD across populations. Despite the abundance of genetic findings, the results have often been inconsistent and not replicated for many candidate genes/single nucleotide polymorphisms (SNPs. Therefore, the aim of the review presented here is to summarize the most important data reported so far in candidate gene and genome-wide association studies. Taking into account the abundance of association data, this review focuses on the most extensively studied genes and polymorphisms reported so far for BD to present the most promising genomic regions/SNPs involved in BD. The review of association data reveals evidence for several genes (SLC6A4/5-HTT [serotonin transporter gene], BDNF [brain-derived neurotrophic factor], DAOA [D-amino acid oxidase activator], DTNBP1 [dysbindin], NRG1 [neuregulin 1], DISC1 [disrupted in schizophrenia 1] to be crucial candidates in BD, whereas numerous genome-wide association studies conducted in BD indicate polymorphisms in two genes (CACNA1C [calcium channel, voltage-dependent, L type, alpha 1C subunit], ANK3 [ankyrin 3] replicated for association with BD in most of these studies. Nevertheless, further studies focusing on interactions between multiple candidate genes/SNPs, as well as systems biology and pathway analyses are necessary to integrate and improve the way we analyze the currently available association data.Keywords: candidate gene, genome-wide association study, SLC6A4, BDNF, DAOA, DTNBP1, NRG1, DISC1

  13. SAQC: SNP Array Quality Control

    Directory of Open Access Journals (Sweden)

    Li Ling-Hui

    2011-04-01

    Full Text Available Abstract Background Genome-wide single-nucleotide polymorphism (SNP arrays containing hundreds of thousands of SNPs from the human genome have proven useful for studying important human genome questions. Data quality of SNP arrays plays a key role in the accuracy and precision of downstream data analyses. However, good indices for assessing data quality of SNP arrays have not yet been developed. Results We developed new quality indices to measure the quality of SNP arrays and/or DNA samples and investigated their statistical properties. The indices quantify a departure of estimated individual-level allele frequencies (AFs from expected frequencies via standardized distances. The proposed quality indices followed lognormal distributions in several large genomic studies that we empirically evaluated. AF reference data and quality index reference data for different SNP array platforms were established based on samples from various reference populations. Furthermore, a confidence interval method based on the underlying empirical distributions of quality indices was developed to identify poor-quality SNP arrays and/or DNA samples. Analyses of authentic biological data and simulated data show that this new method is sensitive and specific for the detection of poor-quality SNP arrays and/or DNA samples. Conclusions This study introduces new quality indices, establishes references for AFs and quality indices, and develops a detection method for poor-quality SNP arrays and/or DNA samples. We have developed a new computer program that utilizes these methods called SNP Array Quality Control (SAQC. SAQC software is written in R and R-GUI and was developed as a user-friendly tool for the visualization and evaluation of data quality of genome-wide SNP arrays. The program is available online (http://www.stat.sinica.edu.tw/hsinchou/genetics/quality/SAQC.htm.

  14. SNIT: SNP identification for strain typing

    Directory of Open Access Journals (Sweden)

    Reifman Jaques

    2011-09-01

    Full Text Available Abstract With ever-increasing numbers of microbial genomes being sequenced, efficient tools are needed to perform strain-level identification of any newly sequenced genome. Here, we present the SNP identification for strain typing (SNIT pipeline, a fast and accurate software system that compares a newly sequenced bacterial genome with other genomes of the same species to identify single nucleotide polymorphisms (SNPs and small insertions/deletions (indels. Based on this information, the pipeline analyzes the polymorphic loci present in all input genomes to identify the genome that has the fewest differences with the newly sequenced genome. Similarly, for each of the other genomes, SNIT identifies the input genome with the fewest differences. Results from five bacterial species show that the SNIT pipeline identifies the correct closest neighbor with 75% to 100% accuracy. The SNIT pipeline is available for download at http://www.bhsai.org/snit.html

  15. Correlations between clinical normal tissue radiosensitivity and single nucleotide polymorphisms in ATM, XRCC1, XRCC3, APEX, SOD2, and TGF-B1

    DEFF Research Database (Denmark)

    Alsner, Jan; Andreassen, Christian Nicolaj; Overgaard, Marie

    in biological pathways suspected to underlie phenotypes of interest. These variants can be either common alterations like single nucleotide polymorphisms, SNPs, or rare variants in potential susceptibility loci like ATM. In parallel, we are using microarray analysis on normal fibroblasts isolated from patients...

  16. Polymorphisms in the P2X7 receptor gene are associated with low lumbar spine bone mineral density and accelerated bone loss in post-menopausal women

    DEFF Research Database (Denmark)

    Gartland, Alison; Skarratt, Kristen K; Hocking, Lynne J

    2012-01-01

    The P2X7 receptor gene (P2RX7) is highly polymorphic with five previously described loss-of-function (LOF) single-nucleotide polymorphisms (SNP; c.151+1G>T, c.946G>A, c.1096C>G, c.1513A>C and c.1729T>A) and one gain-of-function SNP (c.489C>T). The purpose of this study was to determine whether th...... publication, 11 January 2012; doi:10.1038/ejhg.2011.245....

  17. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J; Lu, Xiangyi; Ruden, Douglas M

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w(1118); iso-2; iso-3 strain and the reference y(1); cn(1) bw(1) sp(1) strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5'UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5' and 3' UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory.

  18. Ascertainment biases in SNP chips affect measures of population divergence

    DEFF Research Database (Denmark)

    Albrechtsen, Anders; Nielsen, Finn Cilius; Nielsen, Rasmus

    2010-01-01

    Chip-based high-throughput genotyping has facilitated genome-wide studies of genetic diversity. Many studies have utilized these large data sets to make inferences about the demographic history of human populations using measures of genetic differentiation such as F(ST) or principal component...... on direct sequencing. In addition, we also analyze publicly available genome-wide data. We demonstrate that the ascertainment biases will distort measures of human diversity and possibly change conclusions drawn from these measures in some times unexpected ways. We also show that details of the genotyping...... analyses. However, the single nucleotide polymorphism (SNP) chip data suffer from ascertainment biases caused by the SNP discovery process in which a small number of individuals from selected populations are used as discovery panels. In this study, we investigate the effect of the ascertainment bias...

  19. Transcriptome-wide single nucleotide polymorphisms (SNPs) for abalone (Haliotis midae): validation and application using GoldenGate medium-throughput genotyping assays.

    Science.gov (United States)

    Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay

    2013-09-23

    Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

  20. Impact of a Panel of 88 Single Nucleotide Polymorphisms on the Risk of Breast Cancer in High-Risk Women: Results From Two Randomized Tamoxifen Prevention Trials.

    Science.gov (United States)

    Cuzick, Jack; Brentnall, Adam R; Segal, Corrinne; Byers, Helen; Reuter, Caroline; Detre, Simone; Lopez-Knowles, Elena; Sestak, Ivana; Howell, Anthony; Powles, Trevor J; Newman, William G; Dowsett, Mitchell

    2017-03-01

    Purpose At least 94 common single nucleotide polymorphisms (SNPs) are associated with breast cancer. The extent to which an SNP panel can refine risk in women who receive preventive therapy has not been directly assessed previously. Materials and Methods A risk score on the basis of 88 SNPs (SNP88) was investigated in a nested case-control study of women enrolled in the International Breast Intervention Study (IBIS-I) or the Royal Marsden study. A total of 359 women who developed cancer were matched to 636 controls by age, trial, follow-up time, and treatment arm. Genotyping was done using the OncoArray. Conditional logistic regression and matched concordance indices (mC) were used to measure the performance of SNP88 alone and with other breast cancer risk factors assessed using the Tyrer-Cuzick (TC) model. Results SNP88 was predictive of breast cancer risk overall (interquartile range odds ratio [IQ-OR], 1.37; 95% CI, 1.14 to 1.66; mC, 0.55), but mainly for estrogen receptor-positive disease (IQ-OR, 1.44; 95% CI, 1.16 to 1.79; P for heterogeneity = .10) versus estrogen receptor-negative disease. However, the observed risk of SNP88 was only 46% (95% CI, 19% to 74%) of expected. No significant interaction was observed with treatment arm (placebo IQ-OR, 1.46; 95% CI, 1.13 to 1.87; tamoxifen IQ-OR, 1.25; 95% CI, 0.96 to 1.64; P for heterogeneity = .5). The predictive power was similar to the TC model (IQ-OR, 1.45; 95% CI, 1.21 to 1.73; mC, 0.55), but SNP88 was independent of TC (Spearman rank-order correlation, 0.012; P = .7), and when combined multiplicatively, a substantial improvement was seen (IQ-OR, 1.64; 95% CI, 1.36 to 1.97; mC, 0.60). Conclusion A polygenic risk score may be used to refine risk from the TC or similar models in women who are at an elevated risk of breast cancer and considering preventive therapy. Recalibration may be necessary for accurate risk assessment.

  1. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains

    KAUST Repository

    Coll, Francesc

    2014-09-01

    Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed to classify MTBC strains into distinct lineages and families. Here, we investigate single-nucleotide polymorphisms (SNPs) as robust (stable) markers of genetic variation for phylogenetic analysis. We identify ∼92k SNP across a global collection of 1,601 genomes. The SNP-based phylogeny is consistent with the gold-standard regions of difference (RD) classification system. Of the ∼7k strain-specific SNPs identified, 62 markers are proposed to discriminate known circulating strains. This SNP-based barcode is the first to cover all main lineages, and classifies a greater number of sublineages than current alternatives. It may be used to classify clinical isolates to evaluate tools to control the disease, including therapeutics and vaccines whose effectiveness may vary by strain type. © 2014 Macmillan Publishers Limited.

  2. Dissecting tocopherols content in maize (Zea mays L.), using two segregating populations and high-density single nucleotide polymorphism markers

    Science.gov (United States)

    2012-01-01

    Background Tocopherols, which are vitamin E compounds, play an important role in maintaining human health. Compared with other staple foods, maize grains contain high level of tocopherols. Results Two F2 populations (K22/CI7 and K22/Dan340, referred to as POP-1 and POP-2, respectively), which share a common parent (K22), were developed and genotyped using a GoldenGate assay containing 1,536 single nucleotide polymorphism (SNP) markers. An integrated genetic linkage map was constructed using 619 SNP markers, spanning a total of 1649.03 cM of the maize genome with an average interval of 2.67 cM. Seventeen quantitative trait loci (QTLs) for all the traits were detected in the first map and 13 in the second. In these two maps, QTLs for different traits were localized to the same genomic regions and some were co-located with candidate genes in the tocopherol biosynthesis pathway. Single QTL was responsible for 3.03% to 52.75% of the phenotypic variation and the QTLs in sum explained23.4% to 66.52% of the total phenotypic variation. A major QTL (qc5-1/qd5-1) affecting α-tocopherol (αT) was identified on chromosome 5 between the PZA03161.1 and PZA02068.1 in the POP-2. The QTL region was narrowed down from 18.7 Mb to 5.4 Mb by estimating the recombination using high-density markers of the QTL region. This allowed the identification of the candidate gene VTE4 which encodes γ-tocopherol methyltransferase, an enzyme that transforms γ-tocopherol (γT)to αT. Conclusions These results demonstrate that a few QTLs with major effects and several QTLs with medium to minor effects might contribute to the natural variation of tocopherols in maize grain. The high-density markers will help to fine map and identify the QTLs with major effects even in the preliminary segregating populations. Furthermore, this study provides a simple guide line for the breeders to improve traits that minimize the risk of malnutrition, especially in developing countries. PMID:23122295

  3. Detecting imbalanced expression of SNP alleles by minisequencing on microarrays

    Directory of Open Access Journals (Sweden)

    Dahlgren Andreas

    2004-10-01

    Full Text Available Abstract Background Each of the human genes or transcriptional units is likely to contain single nucleotide polymorphisms that may give rise to sequence variation between individuals and tissues on the level of RNA. Based on recent studies, differential expression of the two alleles of heterozygous coding single nucleotide polymorphisms (SNPs may be frequent for human genes. Methods with high accuracy to be used in a high throughput setting are needed for systematic surveys of expressed sequence variation. In this study we evaluated two formats of multiplexed, microarray based minisequencing for quantitative detection of imbalanced expression of SNP alleles. We used a panel of ten SNPs located in five genes known to be expressed in two endothelial cell lines as our model system. Results The accuracy and sensitivity of quantitative detection of allelic imbalance was assessed for each SNP by constructing regression lines using a dilution series of mixed samples from individuals of different genotype. Accurate quantification of SNP alleles by both assay formats was evidenced for by R2 values > 0.95 for the majority of the regression lines. According to a two sample t-test, we were able to distinguish 1–9% of a minority SNP allele from a homozygous genotype, with larger variation between SNPs than between assay formats. Six of the SNPs, heterozygous in either of the two cell lines, were genotyped in RNA extracted from the endothelial cells. The coefficient of variation between the fluorescent signals from five parallel reactions was similar for cDNA and genomic DNA. The fluorescence signal intensity ratios measured in the cDNA samples were compared to those in genomic DNA to determine the relative expression levels of the two alleles of each SNP. Four of the six SNPs tested displayed a higher than 1.4-fold difference in allelic ratios between cDNA and genomic DNA. The results were verified by allele-specific oligonucleotide hybridisation and

  4. Relationship between single nucleotide polymorphism of chemokine CXCL10 G-210A and the chronicity and severity of HBV infection

    Directory of Open Access Journals (Sweden)

    Li-ming LIU

    2011-01-01

    Full Text Available Objective To investigate the single nucleotide polymorphism(SNP in the promoter of chemokine CXCL10 G-201A,and explore the relationship between the SNP and the chronicity and severity of hepatitis B virus(HBV infection.Methods Blood samples were collected from 792 patients with HBV infection,including 200 with acute hepatitis B(AHB,200 with mild/moderate chronic hepatitis B(CHB-M,192 with severe chronic hepatitis B(CHB-S and 200 with acute liver failure of chronic hepatitis(ACLF,and 300 healthy people were enrolled as normal control(NC.DNA were extracted and subjected to PCR amplification of fragment containing C-1596 site that links with G-201 variation,followed by restriction fragment length polymerase(RFLP analysis.Simultaneously,400 samples were randomly extracted from various groups for direct sequencing of G-201 variation.The consistency of SNP typing results of the two methods was analyzed.Results Variation rates of G-201A were 17.77% for AHB group,25.26% for CHB-M group,26.59% for CHB-S group,21.28% for ACLF group,and 13.82% for NC group.The overall P value obtained from the general χ2 test among the 5 groups was 0.0037.The correlation test(P=0.0015 demonstrated that the variation rate was related to different disease status,and the linear trend test(P=0.0029,Z=-2.9748 indicated an increasing trend of variation rate with the disease progression.Paired comparison showed that the differences in variation rate between CHB-M and NC(P=0.0024,CHB-S and NC(P=0.0007,ACLF and NC(P=0.0428,as well as CHB-S and CHB(P=0.0488 were statistically significant.Direct PCR sequencing showed 98.68% identity with the results from PCR-RFLP.Kappa test(U=58.425,P < 0.05 indicated that the consistency of the two assays met the statistical requirements.Conclusion The G-201A variation in CXCL10 promoter is related to chronicity of HBV infection,and the relations between the variation and the severity of HBV infection remains to be further clarified.

  5. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    2015-01-01

    Full Text Available Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature.

  6. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  7. ERCC1 and XRCC1 but not XPA single nucleotide polymorphisms correlate with response to chemotherapy in endometrial carcinoma

    Directory of Open Access Journals (Sweden)

    Chen L

    2016-11-01

    Full Text Available Liang Chen,1 Mei-Mei Liu,1 Hui Liu,1 Dan Lu,2 Xiao-Dan Zhao,3 Xue-Jing Yang4 1Department of Gynecology and Obstetrics, 2Department of Oncology, 3Department of Clinical Laboratory, The 2nd Affiliated Hospital, Harbin Medical University, 4Nursing Department, Harbin Chest Hospital, Harbin, People’s Republic of China Abstract: Our study aimed to investigate the correlation between single nucleotide polymorphisms of ERCC1/XRCC1/XPA genes and postoperative chemotherapy efficacy and prognosis of endometrial carcinoma. Our study included 108 patients with endometrial carcinoma and 100 healthy participants. ERCC1 rs11615/XRCC1 rs25487/XPA rs1800975 gene polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism. Then the chemotherapy efficacy and toxic effects of the patients were assessed. The genotype and allele frequency of ERCC1 rs11615/XRCC1 rs25487 in the case group were significantly different from that in the control group (all P<0.05. The patients with AA + GA in ERCC1 rs11615 had an increased risk of endometrial carcinoma than those with GG, and the risk of endometrial carcinoma for patients with AA + GA was also higher in comparison with patients with GG genotype in XRCC1 rs25487 (all P<0.05. GG on both ERCC1 rs11615/XRCC1 rs25487 had a higher effective rate of chemotherapy than GA + AA (all P<0.05. ERCC1 rs11615/XRCC1 rs25487 gene polymorphisms were linked with toxic effects in liver, kidney, and nervous system. ERCC1 rs11615/XRCC1 rs25487, muscular invasion, and tumor stage were independent risk factors for the prognosis of endometrial carcinoma (all P<0.05. However, no significant associations were observed between XPA rs1800975 polymorphism and chemotherapy efficacy and prognosis of endometrial carcinoma (all P>0.05. These results indicated that ERCC1 and XRCC1 but not XPA polymorphisms correlate with response to chemotherapy in endometrial carcinoma. Keywords: ERCC1, XRCC1, XPA, single nucleotide

  8. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

    Science.gov (United States)

    Yates, Christopher M; Sternberg, Michael J E

    2013-11-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  9. A retrospective observational study of the relationship between single nucleotide polymorphisms associated with the risk of developing colorectal cancer and survival.

    Directory of Open Access Journals (Sweden)

    Eva J A Morris

    Full Text Available There is variability in clinical outcome for patients with apparently the same stage colorectal cancer (CRC. Single nucleotide polymorphisms (SNPs mapping to chromosomes 1q41, 3q26.2, 6p21, 8q23.3, 8q24.21, 10p14, 11q13, 11q23.1, 12q13.13, 14q22, 14q22.2, 15q13.3, 16q22.1, 18q21.1, 19q13.11, 20p12, 20p12.3, 20q13.33 and Xp22 have robustly been shown to be associated with the risk of developing CRC. Since germline variation can also influence patient outcome the relationship between these SNPs and patient survivorship from CRC was examined.All enrolled into the National Study of Colorectal Cancer Genetics (NSCCG were genotyped for 1q41, 3q26.2, 6p21, 8q23.3, 8q24.21, 10p14, 11q13, 11q23.1, 12q13.13, 14q22, 14q22.2, 15q13.3, 16q22.1, 18q21.1, 19q13.11, 20p12, 20p12.3, 20q13.33 and xp22 SNPs. Linking this information to the National Cancer Data Repository allowed patient genotype to be related to survival.The linked dataset consisted of 4,327 individuals. 14q22.22 genotype defined by the SNP rs4444235 showed a significant association with overall survival. Specifically, the C allele was associated with poorer observed survival (per allele hazard ratio 1.13, 95% confidence interval 1.05-1.22, P = 0.0015.The CRC susceptibility SNP rs4444235 also appears to exert an influence in modulating patient survival and warrants further evaluation as a potential prognostic marker.

  10. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  11. Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes.

    Directory of Open Access Journals (Sweden)

    Claire Chewapreecha

    2014-08-01

    Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.

  12. Assessing SNP-SNP interactions among DNA repair, modification and metabolism related pathway genes in breast cancer susceptibility.

    Directory of Open Access Journals (Sweden)

    Yadav Sapkota

    Full Text Available Genome-wide association studies (GWASs have identified low-penetrance common variants (i.e., single nucleotide polymorphisms, SNPs associated with breast cancer susceptibility. Although GWASs are primarily focused on single-locus effects, gene-gene interactions (i.e., epistasis are also assumed to contribute to the genetic risks for complex diseases including breast cancer. While it has been hypothesized that moderately ranked (P value based weak single-locus effects in GWASs could potentially harbor valuable information for evaluating epistasis, we lack systematic efforts to investigate SNPs showing consistent associations with weak statistical significance across independent discovery and replication stages. The objectives of this study were i to select SNPs showing single-locus effects with weak statistical significance for breast cancer in a GWAS and/or candidate-gene studies; ii to replicate these SNPs in an independent set of breast cancer cases and controls; and iii to explore their potential SNP-SNP interactions contributing to breast cancer susceptibility. A total of 17 SNPs related to DNA repair, modification and metabolism pathway genes were selected since these pathways offer a priori knowledge for potential epistatic interactions and an overall role in breast carcinogenesis. The study design included predominantly Caucasian women (2,795 cases and 4,505 controls from Alberta, Canada. We observed two two-way SNP-SNP interactions (APEX1-rs1130409 and RPAP1-rs2297381; MLH1-rs1799977 and MDM2-rs769412 in logistic regression that conferred elevated risks for breast cancer (P(interaction<7.3 × 10(-3. Logic regression identified an interaction involving four SNPs (MBD2-rs4041245, MLH1-rs1799977, MDM2-rs769412, BRCA2-rs1799943 (P(permutation = 2.4 × 10(-3. SNPs involved in SNP-SNP interactions also showed single-locus effects with weak statistical significance, while BRCA2-rs1799943 showed stronger statistical significance (P

  13. Single nucleotide polymorphisms in the PRDX3 and RPS19 and risk of HPV persistence and cervical precancer/cancer.

    Directory of Open Access Journals (Sweden)

    Mahboobeh Safaeian

    Full Text Available Host genetic factors might affect the risk of progression from infection with carcinogenic human papillomavirus (HPV, the etiologic agent for cervical cancer, to persistent HPV infection, and hence to cervical precancer and cancer.We assessed 18,310 tag single nucleotide polymorphisms (SNPs from 1113 genes in 416 cervical intraepithelial neoplasia 3 (CIN3/cancer cases, 356 women with persistent carcinogenic HPV infection (median persistence of 25 months and 425 randomly selected women (non-cases and non-HPV persistent from the 10,049 women from the Guanacaste, Costa Rica HPV natural history cohort. For gene and SNP associations, we computed age-adjusted odds ratio and p-trend. Three comparisons were made: 1 association with CIN3/cancer (compared CIN3/cancer cases to random controls, 2 association with persistence (compared HPV persistence to random controls, and 3 progression (compared CIN3/cancers with HPV-persistent group. Regions statistically significantly associated with CIN3/cancer included genes for peroxiredoxin 3 PRDX3, and ribosomal protein S19 RPS19. The single most significant SNPs from each gene associated with CIN3/cancer were PRDX3 rs7082598 (P(trend<0.0001, and RPS19 rs2305809 (P(trend=0.0007, respectively. Both SNPs were also associated with progression.These data suggest involvement of two genes, RSP19 and PRDX3, or other SNPs in linkage disequilibrium, with cervical cancer risk. Further investigation showed that they may be involved in both the persistence and progression transition stages. Our results require replication but, if true, suggest a role for ribosomal dysfunction, mitochondrial processes, and/or oxidative stress, or other unknown function of these genes in cervical carcinogenesis.

  14. Tag SNP selection via a genetic algorithm.

    Science.gov (United States)

    Mahdevar, Ghasem; Zahiri, Javad; Sadeghi, Mehdi; Nowzari-Dalini, Abbas; Ahrabian, Hayedeh

    2010-10-01

    Single Nucleotide Polymorphisms (SNPs) provide valuable information on human evolutionary history and may lead us to identify genetic variants responsible for human complex diseases. Unfortunately, molecular haplotyping methods are costly, laborious, and time consuming; therefore, algorithms for constructing full haplotype patterns from small available data through computational methods, Tag SNP selection problem, are convenient and attractive. This problem is proved to be an NP-hard problem, so heuristic methods may be useful. In this paper we present a heuristic method based on genetic algorithm to find reasonable solution within acceptable time. The algorithm was tested on a variety of simulated and experimental data. In comparison with the exact algorithm, based on brute force approach, results show that our method can obtain optimal solutions in almost all cases and runs much faster than exact algorithm when the number of SNP sites is large. Our software is available upon request to the corresponding author.

  15. SNP Discovery and Development of a High-Density Genotyping Array for Sunflower

    Science.gov (United States)

    Bachlava, Eleni; Taylor, Christopher A.; Tang, Shunxue; Bowers, John E.; Mandel, Jennifer R.; Burke, John M.; Knapp, Steven J.

    2012-01-01

    Recent advances in next-generation DNA sequencing technologies have made possible the development of high-throughput SNP genotyping platforms that allow for the simultaneous interrogation of thousands of single-nucleotide polymorphisms (SNPs). Such resources have the potential to facilitate the rapid development of high-density genetic maps, and to enable genome-wide association studies as well as molecular breeding approaches in a variety of taxa. Herein, we describe the development of a SNP genotyping resource for use in sunflower (Helianthus annuus L.). This work involved the development of a reference transcriptome assembly for sunflower, the discovery of thousands of high quality SNPs based on the generation and analysis of ca. 6 Gb of transcriptome re-sequencing data derived from multiple genotypes, the selection of 10,640 SNPs for inclusion in the genotyping array, and the use of the resulting array to screen a diverse panel of sunflower accessions as well as related wild species. The results of this work revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, greater than 95% of successful SNP assays revealed polymorphism, and more than 90% of these assays could be successfully transferred to related wild species. Analysis of the polymorphism data revealed patterns of genetic differentiation that were largely congruent with the evolutionary history of sunflower, though the large number of markers allowed for finer resolution than has previously been possible. PMID:22238659

  16. When whole-genome alignments just won't work: kSNP v2 software for alignment-free SNP discovery and phylogenetics of hundreds of microbial genomes.

    Science.gov (United States)

    Gardner, Shea N; Hall, Barry G

    2013-01-01

    Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four "raw read" genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths.

  17. Single Nucleotide Polymorphisms in Growth Hormone Gene and Their Association with Growth Traits in Siniperca chuatsi (Basilewsky

    Directory of Open Access Journals (Sweden)

    Changxu Tian

    2014-04-01

    Full Text Available Growth hormone (GH has been considered as a candidate gene for growth traits in fish. In this study, polymorphisms of the GH gene were evaluated for associations with growth traits in 282 Siniperca chuatsi individuals. Using directly sequencing, four single nucleotide polymorphisms (SNPs were identified in GH gene, with two mutations in intron 4 (g.4940A>C, g.4948A>T, one mutation in exon 5 (g.5045T>C and one in intron 5 (g.5234T>G. Notably, three of them were significantly associated with growth performance, particularly for g.4940A>C which was highly correlated with all the four growth traits. In conclusion, our results demonstrated that these SNPs in GH gene could influence growth performance of S.chuatsi and could be used for marker-assisted selection (MAS in this species.

  18. Interleukin 1 beta promoter polymorphism is associated with keratoconus in a Japanese population

    OpenAIRE

    Mikami, Takenori; Meguro, Akira; Teshigawara, Takeshi; Takeuchi, Masaki; Uemoto, Riyo; Kawagoe, Tatsukata; Nomura, Eiichi; Asukata, Yuri; Ishioka, Misaki; Iwasaki, Miki; Fukagawa, Kazumi; Konomi, Kenji; Shimazaki, Jun; Nishida, Teruo; Mizuki, Nobuhisa

    2013-01-01

    Purpose Polymorphisms in the interleukin 1 alpha (IL1A) and IL1B gene regions were previously associated with keratoconus in a Korean population. In the present study, we investigated whether the IL1A and IL1B polymorphisms are associated with keratoconus in a Japanese population. Methods A total of 169 Japanese patients with keratoconus and 390 Japanese healthy controls were recruited. We genotyped one IL1A single nucleotide polymorphism (SNP; rs2071376) and two IL1B SNPs (rs1143627 and rs16...

  19. Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent

    Directory of Open Access Journals (Sweden)

    Miao Yu

    2017-01-01

    Full Text Available Purpose. Dental caries is a multifactorial infectious disease. In this study, we investigated whether single nucleotide polymorphisms (SNPs in vitamin D receptor (VDR gene were associated with susceptibility to permanent tooth caries in Chinese adolescents. Method. A total of 200 dental caries patients and 200 healthy controls aged 12 years were genotyped for VDR gene polymorphisms using the PCR-restriction fragment length polymorphism (PCR-RFLP assay. All of them were examined for their oral and dental status with the WHO criteria, and clinical information such as the Decayed Missing Filled Teeth Index (DMFT was evaluated. Genomic DNA was extracted from the buccal epithelial cells. The four polymorphic SNPs (Bsm I, Taq I, Apa I, and Fok I in VDR were assessed for both genotypic and phenotypic susceptibilities. Results. Among the four examined VDR gene polymorphisms, the increased frequency of the CT and CC genotype of the Fok I VDR gene polymorphism was associated with dental caries in 12-year-old adolescent, compared with the controls (X2 = 17.813, p≤0.001. Moreover, Fok I polymorphic allele C frequency was significantly increased in the dental caries cases, compared to the controls (X2 = 14.144, p≤0.001, OR = 1.730, 95% CI = 1.299–2.303. However, the other three VDR gene polymorphisms (Bsm I, Taq I, and Apa I showed no statistically significant differences in the caries groups compared with the controls. Conclusion. VDR-Fok I gene polymorphisms may be associated with susceptibility to permanent tooth caries in Chinese adolescent.

  20. TP53 genetic polymorphisms, interactions with lifestyle factors and lung cancer risk: a case control study in a Chinese population

    OpenAIRE

    Li, Yanli; Chang, Shen-Chih; Niu, Rungui; Liu, Li; Crabtree-Ide, Christina R; Zhao, Baoxing; Shi, Jianping; Han, Xiaoyou; Li, Jiawei; Su, Jia; Cai, Lin; Yu, Shunzhang; Zhang, Zuo-Feng; Mu, Lina

    2013-01-01

    Abstract Background A pathway-based genotyping analysis suggested rs2078486 was a novel TP53 SNP, but very few studies replicate this association. TP53 rs1042522 is the most commonly studied SNP, but very few studies examined its potential interaction with environmental factors in relation to lung cancer risk. This study aims to examine associations between two TP53 single-nucleotide polymorphisms (SNPs) (rs2078486, rs1042522), their potential interac...

  1. SNP Analysis and Whole Exome Sequencing: Their Application in the Analysis of a Consanguineous Pedigree Segregating Ataxia

    Directory of Open Access Journals (Sweden)

    Sarah L. Nickerson

    2015-10-01

    Full Text Available Autosomal recessive cerebellar ataxia encompasses a large and heterogeneous group of neurodegenerative disorders. We employed single nucleotide polymorphism (SNP analysis and whole exome sequencing to investigate a consanguineous Maori pedigree segregating ataxia. We identified a novel mutation in exon 10 of the SACS gene: c.7962T>G p.(Tyr2654*, establishing the diagnosis of autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS. Our findings expand both the genetic and phenotypic spectrum of this rare disorder, and highlight the value of high-density SNP analysis and whole exome sequencing as powerful and cost-effective tools in the diagnosis of genetically heterogeneous disorders such as the hereditary ataxias.

  2. A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo

    Directory of Open Access Journals (Sweden)

    Yi Li

    2017-01-01

    Full Text Available Objective A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. Methods The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. Results A total of 18 (0, 15 (3, 12 (8, 15 (18, 11 (7, and 21 (1 SNPs were detected at the 5% chromosome (genome - wise level for weaning weight (WWT, yearling weight (YWT, carcass weight (CWT, backfat thickness (BFT, longissimus dorsi muscle area (LMA and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29 were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA. Conclusion The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

  3. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  4. The cardiovascular implication of single nucleotide polymorphisms of chromosome 9p21 locus among Arab population

    Directory of Open Access Journals (Sweden)

    Ayman A El-Menyar

    2015-01-01

    Full Text Available Background: Based on several reports including genome-wide association studies, genetic variability has been linked with higher (nearly half susceptibility toward coronary artery disease (CAD. We aimed to evaluate the association of chromosome 9p21 single nucleotide polymorphisms (SNPs: rs2383207, rs10757278, and rs10757274 with the risk and severity of CAD among Arab population. Materials and Methods: A prospective observational case-control study was conducted between 2011 and 2012, in which 236 patients with CAD were recruited from the Heart Hospital in Qatar. Patients were categorized according to their coronary angiographic findings. Also, 152 healthy volunteers were studied to determine if SNPs are associated with risk of CAD. All subjects were genotyped for SNPs (rs2383207, rs2383206, rs10757274 and rs10757278 using allele-specific real-time polymerase chain reaction. Results: Patients with CAD had a mean age of 57 ± 10; of them 77% were males, 54% diabetics, and 25% had family history of CAD. All SNPs were in Hardy-Weinberg equilibrium except rs2383206, with call rate >97%. After adjusting for age, sex and body mass index, the carriers of GG genotype for rs2383207 have increased the risk of having CAD with odds ratio (OR of 1.52 (95% confidence interval [CI] = 1.01-2.961, P = 0.046. Also, rs2383207 contributed to CAD severity with adjusted OR 1.80 (95% CI = 1.04-3.12, P = 0.035 based on the dominant genetic model. The other SNPs (rs10757274 and rs10757278 showed no significant association with the risk of CAD or its severity. Conclusion: Among Arab population in Qatar, only G allele of rs2483207 SNP is significantly associated with risk of CAD and its severity.

  5. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  6. Single nucleotide polymorphisms of ADH1B, ADH1C and ALDH2 genes and esophageal cancer: A population-based case-control study in China

    NARCIS (Netherlands)

    Wu, M.; Chang, S.; Kampman, E.; Kok, F.J.

    2013-01-01

    Alcohol drinking is a major risk factor for esophageal cancer (EC) and the metabolism of ethanol has been suggested to play an important role in esophageal carcinogenesis. Epidemiologic studies, including genomewide association studies (GWAS), have identified single nucleotide polymorphisms (SNPs)

  7. Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

    Science.gov (United States)

    Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

    2011-01-01

    Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

  8. Rapid Genome-wide Single Nucleotide Polymorphism Discovery in Soybean and Rice via Deep Resequencing of Reduced Representation Libraries with the Illumina Genome Analyzer

    Directory of Open Access Journals (Sweden)

    Stéphane Deschamps

    2010-07-01

    Full Text Available Massively parallel sequencing platforms have allowed for the rapid discovery of single nucleotide polymorphisms (SNPs among related genotypes within a species. We describe the creation of reduced representation libraries (RRLs using an initial digestion of nuclear genomic DNA with a methylation-sensitive restriction endonuclease followed by a secondary digestion with the 4bp-restriction endonuclease This strategy allows for the enrichment of hypomethylated genomic DNA, which has been shown to be rich in genic sequences, and the digestion with serves to increase the number of common loci resequenced between individuals. Deep resequencing of these RRLs performed with the Illumina Genome Analyzer led to the identification of 2618 SNPs in rice and 1682 SNPs in soybean for two representative genotypes in each of the species. A subset of these SNPs was validated via Sanger sequencing, exhibiting validation rates of 96.4 and 97.0%, in rice ( and soybean (, respectively. Comparative analysis of the read distribution relative to annotated genes in the reference genome assemblies indicated that the RRL strategy was primarily sampling within genic regions for both species. The massively parallel sequencing of methylation-sensitive RRLs for genome-wide SNP discovery can be applied across a wide range of plant species having sufficient reference genomic sequence.

  9. Polymorphisms in the 3' UTR in the neurocalcin delta gene affect mRNA stability, and confer susceptibility to diabetic nephropathy

    DEFF Research Database (Denmark)

    Kamiyama, Masumi; Kobayashi, Masaaki; Araki, Shin-ichi

    2007-01-01

    Using a large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese type 2 diabetic patients, we have identified a gene encoding neurocalcin delta (NCALD) as a candidate for a susceptibility gene to diabetic nephropathy; the landmark SNP was found in the 3' UT...

  10. A naturally occurring single nucleotide polymorphism in the Salmonella SPI-2 type III effector srfH/sseI controls early extraintestinal dissemination.

    Directory of Open Access Journals (Sweden)

    Joshua M Thornbrough

    Full Text Available CD18 expressing phagocytes associated with the gastro-intestinal (GI epithelium can shuttle Salmonella directly into the bloodstream within a few minutes following microbial ingestion. We have previously demonstrated that Salmonella controls the CD18 pathway to deeper tissue, manipulating the migratory properties of infected cells as an unappreciated component of its pathogenesis. We have observed that one type III effector, SrfH (also called SseI that Salmonella secretes into infected phagocytes manipulates the host protein TRIP6 to stimulate their migration. Paradoxically, SrfH was shown in another study to subvert a different host protein, IQGAP1, in a manner that inhibits the productive motility of such cells, perhaps to avoid interactions with T cells. Here, we resolve the discrepancy. We report that one naturally occurring allele of srfH promotes the migration of infected phagocytes into the bloodstream, while another naturally occurring allele that differs by only a single nucleotide polymorphism (SNP does not. This SNP determines if the protein contains an aspartic acid or a glycine residue at position 103 and may determine if SrfH binds TRIP6. SrfH Gly103 is a rare allele, but is present in the highly invasive strain Salmonella enterica serovar Typhimurium UK-1 (stands for universal killer. It is also present in the genome of the only sequenced strain belonging to the emerging pandemic Salmonella enterica serovar 4, [5],12,i:-, which is frequently associated with septicemia. Finally, we present evidence that suggests that Gifsy-2, the bacteriophage upon which srfH resides, is present in a clinical isolate of the human-specific pathogen, Salmonella enterica serovar Typhi. These observations may have interesting implications for our understanding of Salmonella pathogenesis.

  11. Single nucleotide polymorphisms at interleukin (IL-1β + 3954 and vitamin D receptor (VDR TaqI in chronic periodontitis patients: A pilot study in North Indian population

    Directory of Open Access Journals (Sweden)

    Anika Daing

    2015-01-01

    Full Text Available Background: Increasing evidences support the role of genetic factors in susceptibility to chronic periodontitis. The aim of the present pilot study was to explore the association of two potential single nucleotide polymorphisms (SNPs: Interleukin (IL-1β + 3954 (rs1143634, C > T and vitamin D receptor (VDR TaqI (rs731236, T > C with chronic periodontitis in a North Indian population. Materials and Methods: Twenty-eight chronic periodontitis subjects and 47 periodontally healthy controls were recruited. Individual samples of venous blood were obtained from each subject. Genotyping was done by polymerase chain reaction, followed by restriction fragment length polymorphism (PCR-RFLP. Logistic regression and chi square test were used for genetic association analysis and a P value less than 0.05 taken as statistical significance. Statistical Analysis Used: Chi square test and odds ratio (OR was used. Results: Genotypes and alleles of SNP IL-1β + 3954 did not show a significant association (P > 0.05 with chronic periodontitis. Genotype CC and allele C of VDR TaqI were significantly associated with a higher risk for chronic periodontitis as compared to subjects with TT genotype (CC/TT OR = 4.615; 95% confidence interval [CI]: 1.17 to 18.078 P = 0.028 and allele T (C/T OR = 2.423; 95% CI: 1.179 to 4.980. Conclusion: In North Indian population, genotype CC and allele C of VDR TaqI were associated with risk of chronic periodontitis. No significant correlation was found for IL-1β + 3954 polymorphism and chronic periodontitis.

  12. Inter-individual variation in nucleotide excision repair pathway is modulated by non-synonymous polymorphisms in ERCC4 and MBD4 genes

    Energy Technology Data Exchange (ETDEWEB)

    Allione, Alessandra, E-mail: alessandra.allione@hugef-torino.org [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Guarrera, Simonetta; Russo, Alessia [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Ricceri, Fulvio [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy); Purohit, Rituraj [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Bioinformatics Division, School of Bio Sciences and Technology, Vellore Institute of Technology University, Vellore 632014, Tamil Nadu (India); Pagnani, Andrea; Rosa, Fabio; Polidoro, Silvia; Voglino, Floriana [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Matullo, Giuseppe [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy)

    2013-11-15

    Highlights: • We reported a large inter-individual variability of NER capacity. • ERCC4 rs1800124 and MBD4 rs10342 nsSNP variants were associated with DNA repair capacity. • DNA–protein interaction analyses showed alteration of binding for ERCC4 and MBD4 variants. • A new possible cross-talk between NER and BER pathways has been reported. - Abstract: Inter-individual differences in DNA repair capacity (DRC) may lead to genome instability and, consequently, modulate individual cancer risk. Among the different DNA repair pathways, nucleotide excision repair (NER) is one of the most versatile, as it can eliminate a wide range of helix-distorting DNA lesions caused by ultraviolet light irradiation and chemical mutagens. We performed a genotype–phenotype correlation study in 122 healthy subjects in order to assess if any associations exist between phenotypic profiles of NER and DNA repair gene single nucleotide polymorphisms (SNPs). Individuals were genotyped for 768 SNPs with a custom Illumina Golden Gate Assay, and peripheral blood mononuclear cells (PBMCs) of the same subjects were tested for a NER comet assay to measure DRC after challenging cells by benzo(a)pyrene diolepoxide (BPDE). We observed a large inter-individual variability of NER capacity, with women showing a statistically significant lower DRC (mean ± SD: 6.68 ± 4.76; p = 0.004) than men (mean ± SD: 8.89 ± 5.20). Moreover, DRC was significantly lower in individuals carrying a variant allele for the ERCC4 rs1800124 non-synonymous SNP (nsSNP) (p = 0.006) and significantly higher in subjects with the variant allele of MBD4 rs2005618 SNP (p = 0.008), in linkage disequilibrium (r{sup 2} = 0.908) with rs10342 nsSNP. Traditional in silico docking approaches on protein–DNA and protein–protein interaction showed that Gly875 variant in ERCC4 (rs1800124) decreases the DNA–protein interaction and that Ser273 and Thr273 variants in MBD4 (rs10342) indicate complete loss of protein

  13. Heterogeneous computing architecture for fast detection of SNP-SNP interactions.

    Science.gov (United States)

    Sluga, Davor; Curk, Tomaz; Zupan, Blaz; Lotric, Uros

    2014-06-25

    The extent of data in a typical genome-wide association study (GWAS) poses considerable computational challenges to software tools for gene-gene interaction discovery. Exhaustive evaluation of all interactions among hundreds of thousands to millions of single nucleotide polymorphisms (SNPs) may require weeks or even months of computation. Massively parallel hardware within a modern Graphic Processing Unit (GPU) and Many Integrated Core (MIC) coprocessors can shorten the run time considerably. While the utility of GPU-based implementations in bioinformatics has been well studied, MIC architecture has been introduced only recently and may provide a number of comparative advantages that have yet to be explored and tested. We have developed a heterogeneous, GPU and Intel MIC-accelerated software module for SNP-SNP interaction discovery to replace the previously single-threaded computational core in the interactive web-based data exploration program SNPsyn. We report on differences between these two modern massively parallel architectures and their software environments. Their utility resulted in an order of magnitude shorter execution times when compared to the single-threaded CPU implementation. GPU implementation on a single Nvidia Tesla K20 runs twice as fast as that for the MIC architecture-based Xeon Phi P5110 coprocessor, but also requires considerably more programming effort. General purpose GPUs are a mature platform with large amounts of computing power capable of tackling inherently parallel problems, but can prove demanding for the programmer. On the other hand the new MIC architecture, albeit lacking in performance reduces the programming effort and makes it up with a more general architecture suitable for a wider range of problems.

  14. SNPhylo: a pipeline to construct a phylogenetic tree from huge SNP data.

    Science.gov (United States)

    Lee, Tae-Ho; Guo, Hui; Wang, Xiyin; Kim, Changsoo; Paterson, Andrew H

    2014-02-26

    Phylogenetic trees are widely used for genetic and evolutionary studies in various organisms. Advanced sequencing technology has dramatically enriched data available for constructing phylogenetic trees based on single nucleotide polymorphisms (SNPs). However, massive SNP data makes it difficult to perform reliable analysis, and there has been no ready-to-use pipeline to generate phylogenetic trees from these data. We developed a new pipeline, SNPhylo, to construct phylogenetic trees based on large SNP datasets. The pipeline may enable users to construct a phylogenetic tree from three representative SNP data file formats. In addition, in order to increase reliability of a tree, the pipeline has steps such as removing low quality data and considering linkage disequilibrium. A maximum likelihood method for the inference of phylogeny is also adopted in generation of a tree in our pipeline. Using SNPhylo, users can easily produce a reliable phylogenetic tree from a large SNP data file. Thus, this pipeline can help a researcher focus more on interpretation of the results of analysis of voluminous data sets, rather than manipulations necessary to accomplish the analysis.

  15. Imputation of microsatellite alleles from dense SNP genotypes for parental verification

    Directory of Open Access Journals (Sweden)

    Matthew eMcclure

    2012-08-01

    Full Text Available Microsatellite (MS markers have recently been used for parental verification and are still the international standard despite higher cost, error rate, and turnaround time compared with Single Nucleotide Polymorphisms (SNP-based assays. Despite domestic and international interest from producers and research communities, no viable means currently exist to verify parentage for an individual unless all familial connections were analyzed using the same DNA marker type (MS or SNP. A simple and cost-effective method was devised to impute MS alleles from SNP haplotypes within breeds. For some MS, imputation results may allow inference across breeds. A total of 347 dairy cattle representing 4 dairy breeds (Brown Swiss, Guernsey, Holstein, and Jersey were used to generate reference haplotypes. This approach has been verified (>98% accurate for imputing the International Society of Animal Genetics (ISAG recommended panel of 12 MS for cattle parentage verification across a validation set of 1,307 dairy animals.. Implementation of this method will allow producers and breed associations to transition to SNP-based parentage verification utilizing MS genotypes from historical data on parents where SNP genotypes are missing. This approach may be applicable to additional cattle breeds and other species that wish to migrate from MS- to SNP- based parental verification.

  16. A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Naila Al Mahmuda

    2016-05-01

    Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

  17. Analysis of Single Nucleotide Polymorphism (SNP rs22114085 Associated with Canine Atopic Dermatitis by PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2012-05-01

    Full Text Available Canine atopic dermatitis (cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs22114085 SNP genotypes by PCR-RFLP method. The PCR products were digested with DdeI restriction enzyme. The C allele was distributed in Czech Pointer, Chihuahua, German Wirehaired Pointer with an allele frequency ranging from 0.4545 to 1.00. In the population of Czech Pointer we detected all genotypes CC, CT and TT with frequency in male 0.25, 0.5833 and 0.1667, and in female 0.2728, 0.3636 and 0.3636, subsequently. In German Wirehaired Pointer was detected homozygote genotype CC in male and heterozygote genotype CT in female with frequency 1 and 1. In Chihuahua was observed homozygote genotype CC and heterozygote genotype CT with frequency 0.3333 and 0.6667, subsequently. In Golden retriever and Pincher we detected genotype TT with frequency 1.

  18. Analysis of single nucleotide polymorphism (SNP RS23472497 associated with canine atopic dermatitis by ACRS-PCR method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2014-05-01

    Full Text Available The aim of the paper was to identify of the SNP rs23472497 associated with canine atopic dermatitis (cAD. cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The material involved 60 dogs from 6 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs23472497 SNP genotypes by ACRS-PCR method. The PCR products were digested with NlaIII restriction enzyme. In the population of Czech Pointer and Slovak Wirehaired Pointer we detected all genotypes AA, AG and GG with frequency 0.0732, 0.5122 and 0.4146 for Czech Pointer and 0.1818, 0.5455 and 0.2727 for Slovak Wirehaired Pointer. In Border Collie was observed heterozygote genotype AG and homozygote genotype GG with frequency 0.6667 and 0.3333, subsequently. In German Wirehaired Pointer, Australian Shepherd dog and American Staffordshire terrier we detected only genotype AG with frequency 1. The A allele was distributed with an allele frequency ranging from 0.3293 to 0.5. The G allele was distributed with an allele frequency ranging from 0.5 to 0.6707.

  19. Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function.

    Directory of Open Access Journals (Sweden)

    Dana B Hancock

    Full Text Available Genome-wide association studies have identified numerous genetic loci for spirometic measures of pulmonary function, forced expiratory volume in one second (FEV(1, and its ratio to forced vital capacity (FEV(1/FVC. Given that cigarette smoking adversely affects pulmonary function, we conducted genome-wide joint meta-analyses (JMA of single nucleotide polymorphism (SNP and SNP-by-smoking (ever-smoking or pack-years associations on FEV(1 and FEV(1/FVC across 19 studies (total N = 50,047. We identified three novel loci not previously associated with pulmonary function. SNPs in or near DNER (smallest P(JMA = 5.00×10(-11, HLA-DQB1 and HLA-DQA2 (smallest P(JMA = 4.35×10(-9, and KCNJ2 and SOX9 (smallest P(JMA = 1.28×10(-8 were associated with FEV(1/FVC or FEV(1 in meta-analysis models including SNP main effects, smoking main effects, and SNP-by-smoking (ever-smoking or pack-years interaction. The HLA region has been widely implicated for autoimmune and lung phenotypes, unlike the other novel loci, which have not been widely implicated. We evaluated DNER, KCNJ2, and SOX9 and found them to be expressed in human lung tissue. DNER and SOX9 further showed evidence of differential expression in human airway epithelium in smokers compared to non-smokers. Our findings demonstrated that joint testing of SNP and SNP-by-environment interaction identified novel loci associated with complex traits that are missed when considering only the genetic main effects.

  20. Using Drosophila melanogaster as a model for genotoxic chemical mutational studies with a new program, SnpSift

    Directory of Open Access Journals (Sweden)

    Douglas Mark Ruden

    2012-03-01

    Full Text Available This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms (SNPs, multiple nucleotide polymorphisms (MNPs, insertions and deletions (InDels in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently-isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of PCR-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate premature stop codon mutation in each of the two allelic mutants whereas the other 4 candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically-mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic

  1. Population structure of Atlantic Mackerel inferred from RAD-seq derived SNP markers: effects of sequence clustering parameters and hierarchical SNP selection

    KAUST Repository

    Rodríguez-Ezpeleta, Naiara

    2016-03-03

    Restriction-site associated DNA sequencing (RAD-seq) and related methods are revolutionizing the field of population genomics in non-model organisms as they allow generating an unprecedented number of single nucleotide polymorphisms (SNPs) even when no genomic information is available. Yet, RAD-seq data analyses rely on assumptions on nature and number of nucleotide variants present in a single locus, the choice of which may lead to an under- or overestimated number of SNPs and/or to incorrectly called genotypes. Using the Atlantic mackerel (Scomber scombrus L.) and a close relative, the Atlantic chub mackerel (Scomber colias), as case study, here we explore the sensitivity of population structure inferences to two crucial aspects in RAD-seq data analysis: the maximum number of mismatches allowed to merge reads into a locus and the relatedness of the individuals used for genotype calling and SNP selection. Our study resolves the population structure of the Atlantic mackerel, but, most importantly, provides insights into the effects of alternative RAD-seq data analysis strategies on population structure inferences that are directly applicable to other species.

  2. AHSG tag single nucleotide polymorphisms associate with type 2 diabetes and dyslipidemia: studies of metabolic traits in 7,683 white Danish subjects

    DEFF Research Database (Denmark)

    Andersen, Gitte; Burgdorf, Kristoffer Sølvsten; Sparsø, Thomas

    2008-01-01

    been largely successful. We related seven frequent AHSG tag single nucleotide polymorphisms to a range of metabolic traits, including type 2 diabetes, obesity, and dyslipidemia. RESEARCH DESIGN AND METHODS: The polymorphisms were genotyped in 7,683 white Danish subjects using Taqman allelic...... with dyslipidemia (P = 0.003 and P(corr) = 0.009). Thr248Met (rs4917) tended to associate with lower fasting and post-oral glucose tolerance test serum insulin release (P = 0.02, P(corr) = 0.1 for fasting and P = 0.04, P(corr) = 0.2 for area under the insulin curve) and improved insulin sensitivity estimated...

  3. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

    Science.gov (United States)

    Song, Jaewoo; Xue, Cheng; Preisser, John S; Cramer, Drake W; Houck, Katie L; Liu, Guo; Folsom, Aaron R; Couper, David; Yu, Fuli; Dong, Jing-Fei

    2016-01-01

    VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC) study for the association of single nucleotide polymorphisms (SNPs) in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G) project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  4. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties.

    Science.gov (United States)

    Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.

  5. Compression and fast retrieval of SNP data.

    Science.gov (United States)

    Sambo, Francesco; Di Camillo, Barbara; Toffolo, Gianna; Cobelli, Claudio

    2014-11-01

    The increasing interest in rare genetic variants and epistatic genetic effects on complex phenotypic traits is currently pushing genome-wide association study design towards datasets of increasing size, both in the number of studied subjects and in the number of genotyped single nucleotide polymorphisms (SNPs). This, in turn, is leading to a compelling need for new methods for compression and fast retrieval of SNP data. We present a novel algorithm and file format for compressing and retrieving SNP data, specifically designed for large-scale association studies. Our algorithm is based on two main ideas: (i) compress linkage disequilibrium blocks in terms of differences with a reference SNP and (ii) compress reference SNPs exploiting information on their call rate and minor allele frequency. Tested on two SNP datasets and compared with several state-of-the-art software tools, our compression algorithm is shown to be competitive in terms of compression rate and to outperform all tools in terms of time to load compressed data. Our compression and decompression algorithms are implemented in a C++ library, are released under the GNU General Public License and are freely downloadable from http://www.dei.unipd.it/~sambofra/snpack.html. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2010-01-01

    Full Text Available Myostatin (MSTN is a negative modulator of muscle mass. We characterized the horse (Equus caballus MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type than in light breeds (dolichomorphic type such as Italian Trotter breed. The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.

  7. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    Science.gov (United States)

    Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto

    2010-01-01

    Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds. PMID:20706663

  8. Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.

    Directory of Open Access Journals (Sweden)

    Yasuaki Enokida

    Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.

  9. A STAT6 Intronic Single-Nucleotide Polymorphism is Associated with Clinical Malaria in Ghanaian Children

    Directory of Open Access Journals (Sweden)

    Daniel Amoako-Sakyi

    2016-01-01

    Full Text Available Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974, total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP. Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001, severe malarial anemia (OR = 0.18, P < 0.001, and cerebral malaria (OR = 0.39, P = 0.022. Levels of total IgE significantly differed among malaria phenotypes (P = 0.044 and rs3024974 genotypes (P = 0.037. Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis.

  10. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Directory of Open Access Journals (Sweden)

    Puji Rianti

    2015-10-01

    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  11. Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

    Science.gov (United States)

    Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2010-08-01

    This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

  12. Single nucleotide polymorphisms in ZNF208 are associated with increased risk for HBV in Chinese people.

    Science.gov (United States)

    Li, Hengxin; Chen, Jun; Zhang, RuiZhi; Xu, Ran; Zhang, Zhe; Ren, Le; Yang, Qi; Tian, Yumei; Li, Daxu

    2017-12-22

    Single nucleotide polymorphisms (SNPs) in ZNF208 may be associated with susceptibility to Hepatitis B virus (HBV). In the current study, we analyzed the association between ZNF208 SNPs and risk of HBV in 242 HBV patients and 300 healthy subjects from the Xi'an area of Chinese Han Population. Of the five SNPs examined, rs2188971 (OR: 1.36, 95% CI: 1.04-1.76, P = 0.022), rs8103163 (OR: 1.40, 95% CI: 1.08-1.82, P = 0.010) and rs7248488 (OR: 1.38, 95% CI: 1.07-1.79, P = 0.014) were correlated with HBV susceptibility based on Chi-square tests. After the P -values were adjusted by Bonferroni correction, there only rs8103163 ( P = 0.050) was slightly with increased HBV risk. Additionally, haplotype A rs2188972 T rs2188971 A rs8103163 A rs7248488 (OR = 1.42; 95% C I, 1.10-1.85; P = 0.008) was found to increase susceptibility of suffering from HBV. These findings suggest that ZNF208 polymorphisms may contribute to the development of HBV.

  13. Kynurenine 3-monooxygenase polymorphisms: relevance for kynurenic acid synthesis in patients with schizophrenia and healthy controls

    DEFF Research Database (Denmark)

    Holtze, Maria; Saetre, Peter; Engberg, Göran

    2012-01-01

    on the activity of kynurenine 3-monooxygenase (KMO), the enzyme converting kynurenine to 3-hydroxykynurenine. Methods: We analyzed the association between KMO gene polymorphisms and CSF concentrations of KYNA in patients with schizophrenia and healthy controls. Fifteen single nucleotide polymorphisms (SNPs) were...... selected covering KMO and were analyzed in UNPHASED. Results: We included 17 patients with schizophrenia and 33 controls in our study. We found an association between a KMO SNP (rs1053230), encoding an amino acid change of potential importance for substrate interaction, and CSF concentrations of KYNA....... Limitations: Given the limited sample size, the results are tentative until replication. Conclusion: Our results suggest that the nonsynonymous KMO SNP rs1053230 influences CSF concentrations of KYNA....

  14. Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.

    Science.gov (United States)

    Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed

    2016-10-17

    Preterm birth (PTB), birth at PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

  15. SNP markers retrieval for a non-model species: a practical approach

    Directory of Open Access Journals (Sweden)

    Shahin Arwa

    2012-01-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism markers are rapidly becoming the markers of choice for applications in breeding because of next generation sequencing technology developments. For SNP development by NGS technologies, correct assembly of the huge amounts of sequence data generated is essential. Little is known about assembler's performance, especially when dealing with highly heterogeneous species that show a high genome complexity and what the possible consequences are of differences in assemblies on SNP retrieval. This study tested two assemblers (CAP3 and CLC on 454 data from four lily genotypes and compared results with respect to SNP retrieval. Results CAP3 assembly resulted in higher numbers of contigs, lower numbers of reads per contig, and shorter average read lengths compared to CLC. Blast comparisons showed that CAP3 contigs were highly redundant. Contrastingly, CLC in rare cases combined paralogs in one contig. Redundant and chimeric contigs may lead to erroneous SNPs. Filtering for redundancy can be done by blasting selected SNP markers to the contigs and discarding all the SNP markers that show more than one blast hit. Results on chimeric contigs showed that only four out of 2,421 SNP markers were selected from chimeric contigs. Conclusion In practice, CLC performs better in assembling highly heterogeneous genome sequences compared to CAP3, and consequently SNP retrieval is more efficient. Additionally a simple flow scheme is suggested for SNP marker retrieval that can be valid for all non-model species.

  16. Interest in genomic SNP testing for prostate cancer risk: a pilot survey.

    Science.gov (United States)

    Hall, Michael J; Ruth, Karen J; Chen, David Yt; Gross, Laura M; Giri, Veda N

    2015-01-01

    Advancements in genomic testing have led to the identification of single nucleotide polymorphisms (SNPs) associated with prostate cancer. The clinical utility of SNP tests to evaluate prostate cancer risk is unclear. Studies have not examined predictors of interest in novel genomic SNP tests for prostate cancer risk in a diverse population. Consecutive participants in the Fox Chase Prostate Cancer Risk Assessment Program (PRAP) (n = 40) and unselected men from surgical urology clinics (n = 40) completed a one-time survey. Items examined interest in genomic SNP testing for prostate cancer risk, knowledge, impact of unsolicited findings, and psychosocial factors including health literacy. Knowledge of genomic SNP tests was low in both groups, but interest was higher among PRAP men (p testing in both groups. Multivariable modeling identified several predictors of higher interest in a genomic SNP test including higher perceived risk (p = 0.025), indicating zero reasons for not wanting testing (vs ≥1 reason) (p = 0.013), and higher health literacy (p = 0.016). Knowledge of genomic SNP testing was low in this sample, but higher among high-risk men. High-risk status may increase interest in novel genomic tests, while low literacy may lessen interest.

  17. Role of inflammation gene polymorphisms on pain and response to radiotherapy in multiple myeloma patients with painful bone destructions

    OpenAIRE

    Rudžianskienė, Milda; Inčiūra, Arturas; Gerbutavičius, Rolandas; Dambrauskienė, Rūta; Rudžianskas, Viktoras; Juozaitytė, Elona

    2016-01-01

    Background: Previous researches have demonstrated, that the severity of pain perception and it’s response to analgesia is highly dependent on gene polymorphism encoding for cytokines. We evaluated 12 single nucleotide polymorphisms (SNP) in 6 genes encoding for cytokines in multiple myeloma patients (n = 81) and assessed their influence on pain severity and response to palliative radiotherapy. Methods: Pain intensity was assessed by Visual Analogue Scale. The total dose of opioids was convert...

  18. An updated meta-analysis on the association of MDM2 SNP309 polymorphism with colorectal cancer risk.

    Directory of Open Access Journals (Sweden)

    Xue Qin

    Full Text Available The mouse double minute 2 (MDM2 gene encodes a phosphoprotein that interacts with P53 and negatively regulates its activity. The SNP309 polymorphism (T-G in the promoter of MDM2 gene has been reported to be associated with enhanced MDM2 expression and tumor development. Studies investigating the association between MDM2 SNP309 polymorphism and colorectal cancer (CRC risk reported conflicting results. We performed a meta-analysis of all available studies to explore the association of this polymorphism with CRC risk.All studies published up to July 2013 on the association between MDM2 SNP309 polymorphism and CRC risk were identified by searching electronic databases PubMed, EMBASE, and Chinese Biomedical Literature database (CBM databases. The association between the MDM2 SNP309 polymorphism and CRC risk was assessed by odds ratios (ORs together with their 95% confidence intervals (CIs.A total of 14 case-control studies including 4460 CRC cases and 4828 controls were identified. We did not find a significant association between the MDM2 SNP309 polymorphism and CRC risk in all genetic models in overall population. However, in subgroup analysis by ethnicity, significant associations were found in Asians (TG vs. TT: OR = 1.197, 95% CI = 1.055-1.358, P=0.005; GG+TG vs. TT: OR = 1.246, 95% CI = 1.106-1.404, P=0.000 and Africans. When stratified by HWE in controls, significantly increased risk was also found among the studies consistent with HWE (TG vs. TT: OR = 1.166, 95% CI = 1.037-1.311, P= 0.010. In subgroup analysis according to p53 mutation status, and gender, no any significant association was detected.The present meta-analysis suggests that the MDM2 is a candidate gene for CRC susceptibility. The MDM2 SNP309 polymorphism may be a risk factor for CRC in Asians.

  19. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  20. A low-density SNP array for analyzing differential selection in freshwater and marine populations of threespine stickleback (Gasterosteus aculeatus)

    DEFF Research Database (Denmark)

    Ferchaud, Anne-Laure; Pedersen, Susanne H.; Bekkevold, Dorte

    2014-01-01

    for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. Results......: RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional...... selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. Conclusions: We...

  1. [Association of the tagging single nucleotide polymorphisms in transforming growth factor beta-1 gene with hypertension in the Han nationality population in Xinjiang].

    Science.gov (United States)

    Yang, Jian-feng; Shi, Xiao-peng; Zhao, Dan; Deng, Feng-mei; Zhong, Hua; Wang, Gang; Wang, Zhen-huan; Chen, Xiong-ying; He, Fang

    2010-06-01

    Essential hypertension (EH) was a complex disease resulted from the interaction of cumulative effect of multiple genetic and environment factors. The relationship between the genetic polymorphisms in the transforming growth factor-beta1 (TGF-beta1), the blood levels and EH have been investigated, but the conclusions were different. Therefore, we investigate the relationship between the tagging single nucleotide polymorphisms (tSNPs) (rs1800469, rs2241716, rs11466345, rs2241715, rs4803455) in TGF-beta1 gene, blood levels and EH in the Han nationality population in Xinjiang, to clarity the pattern of linkage disequilibrium (LD) and the feature of the structure of haplotype. Based on the case-control study,we selected 732 (365 EH patients,367 controls) Han Chinese population from the Boertonggu countryside of Shawan region in the Xinjiang Uygur Autonomous Region of China by random cluster sampling. After questionnaire and physical examination, we collected blood samples, and the blood levels of TGF-beta1 were quantified using sandwich ELISA. The polymorphisms of TGF-beta1 gene in the study groups were detected with SNaPshot system. The case-control study in a large group was carried out separately for each of the tSNP and followed up by haplotypes analyses to determine the relation between tSNPs of TGF-beta1 gene and EH in the Han population. (1) The frequencies of alleles A, G of rs11466345 of TGF-beta1 gene in EH group and control group were as follows: 69.7%, 30.3%, 74.4%, 25.6%, respectively. It was demonstrated that the G allele of the rs11466345 polymorphism occurred at a significantly higher frequency in EH patients than in healthy controls (30.3% vs. 25.6%, P 0.05). (2)Except the site of rs11466345, the other tSNPs were in strong LD, and no statistical differences were observed in haplotypes distribution in the followup study between case-control groups (P > 0.05). (3) There were no difference of TGF-beta1 levels between the different genotypes and alleles in

  2. Increased Prevalence of the IL-6 -174C Genetic Polymorphism in Long Distance Swimmers

    OpenAIRE

    Ben-Zaken Sigal; Meckel Yoav; Nemet Dan; Kassem Eias; Eliakim Alon

    2017-01-01

    Abstract The IL-6 -174G/C single nucleotide polymorphism (SNP) functionally affects IL-6 activity, with the G-allele associated with increased IL-6 levels. The C-allele was found to be associated with exercise-induced skeletal muscle damage. The aim of the present study was to examine the association between the IL-6 -174G/C polymorphism and athletic performance among elite swimmers and runners. The study sample included 180 track and field athletes and 80 swimmers. Track and field athletes w...

  3. Development and characterization of a high density SNP genotyping assay for cattle.

    Directory of Open Access Journals (Sweden)

    Lakshmi K Matukumalli

    Full Text Available The success of genome-wide association (GWA studies for the detection of sequence variation affecting complex traits in human has spurred interest in the use of large-scale high-density single nucleotide polymorphism (SNP genotyping for the identification of quantitative trait loci (QTL and for marker-assisted selection in model and agricultural species. A cost-effective and efficient approach for the development of a custom genotyping assay interrogating 54,001 SNP loci to support GWA applications in cattle is described. A novel algorithm for achieving a compressed inter-marker interval distribution proved remarkably successful, with median interval of 37 kb and maximum predicted gap of <350 kb. The assay was tested on a panel of 576 animals from 21 cattle breeds and six outgroup species and revealed that from 39,765 to 46,492 SNP are polymorphic within individual breeds (average minor allele frequency (MAF ranging from 0.24 to 0.27. The assay also identified 79 putative copy number variants in cattle. Utility for GWA was demonstrated by localizing known variation for coat color and the presence/absence of horns to their correct genomic locations. The combination of SNP selection and the novel spacing algorithm allows an efficient approach for the development of high-density genotyping platforms in species having full or even moderate quality draft sequence. Aspects of the approach can be exploited in species which lack an available genome sequence. The BovineSNP50 assay described here is commercially available from Illumina and provides a robust platform for mapping disease genes and QTL in cattle.

  4. FRAS1-related extracellular matrix 3 (FREM3 single-nucleotide polymorphism effects on gene expression, amygdala reactivity and perceptual processing speed

    Directory of Open Access Journals (Sweden)

    Yuliya eNikolova

    2015-09-01

    Full Text Available The A allele of the Fras1-related extracellular matrix protein 3 (FREM3 rs7676614 single nucleotide polymorphism (SNP was linked to major depressive disorder (MDD in an early genome-wide association study (GWAS, and to symptoms of psychomotor retardation in a follow-up investigation. In line with significant overlap between age- and depression-related molecular pathways, parallel work has shown that FREM3 expression in postmortem human brain decreases with age. Here we probe the effect of rs7676614 on amygdala reactivity and perceptual processing speed, both of which are altered in depression and aging. Amygdala reactivity was assessed using a face-matching BOLD fMRI paradigm in 365 Caucasian participants in the Duke Neurogenetics Study (192 women, mean age 19.7±1.2. Perceptual processing speed was indexed by reaction times in the same task and the Trails Making Test (TMT. The effect of rs7676614 on FREM3 mRNA brain expression levels was probed in a postmortem cohort of 169 Caucasian individuals (44 women, mean age 50.8±14.9. The A allele of rs7676614 was associated with blunted amygdala reactivity to faces, slower reaction times in the face-matching condition (p<0.04, as well as marginally slower performance on TMT Part B (p=0.056. In the postmortem cohort, the T allele of rs6537170 (proxy for the rs7676614 A allele, was associated with trend-level reductions in gene expression in Brodmann areas 11 and 47 (p=0.066, reminiscent of patterns characteristic of older age. The low-expressing allele of another FREM3 SNP (rs1391187 was similarly associated with reduced amygdala reactivity and slower TMT Part B speed, in addition to reduced BA47 activity and Extraversion (p<0.05. Together, these results suggest common genetic variation associated with reduced FREM3 expression may confer risk for a subtype of depression characterized by reduced reactivity to environmental stimuli and slower perceptual processing speed, possibly suggestive of

  5. Dynamic variable selection in SNP genotype autocalling from APEX microarray data

    Directory of Open Access Journals (Sweden)

    Zamar Ruben H

    2006-11-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are DNA sequence variations, occurring when a single nucleotide – adenine (A, thymine (T, cytosine (C or guanine (G – is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX. This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Results Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU of St. Paul's Hospital (plus one negative PCR control sample. Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. Conclusion The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our

  6. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

    Science.gov (United States)

    Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

    2015-12-01

    Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three

  7. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman

    2014-12-01

    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  8. Functional and prognostic influence of receptor polymorphisms in the vascular endothelial growth factor system in colorectal cancer

    DEFF Research Database (Denmark)

    Hansen, T; Spindler, K G; Aalund Olsen, Dorte

    2009-01-01

    was significantly higher than the median protein concentration of the CC genotype, p = 0.005. The CC genotype held prognostic information compared to CT and TT genotypes for both SNP's, pinfluence on the VEGFR-2 protein level, and the -604 T/C SNP...... on the gene expression level in CRC patients. The results furthermore indicate a prognostic influence of both SNP's on progression-free survival. No significant financial relationships to disclose.......e15032 Background: The vascular endothelial growth factor (VEGF) system plays a key role in the angiogenic process ensuring a sufficient blood supply to the growth of malignant tumours. The clinical importance of single nucleotide polymorphisms (SNP's) in the VEGF receptors is still unknown...

  9. Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene

    Directory of Open Access Journals (Sweden)

    Qinghua ZHOU

    2010-02-01

    Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.

  10. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  11. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    Science.gov (United States)

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Association of HTRA1 polymorphism and bilaterality in advanced age-related macular degeneration.

    Science.gov (United States)

    Chen, Haoyu; Yang, Zhenglin; Gibbs, Daniel; Yang, Xian; Hau, Vincent; Zhao, Peiquan; Ma, Xiang; Zeng, Jiexi; Luo, Ling; Pearson, Erik; Constantine, Ryan; Kaminoh, Yuuki; Harmon, Jennifer; Tong, Zongzhong; Stratton, Charity A; Cameron, D Joshua; Tang, Shibo; Zhang, Kang

    2008-02-01

    Single nucleotide polymorphism (SNP), rs11200638, in the promoter of HTRA1 has recently been shown to increase the risk for AMD. In order to investigate the association of this HTRA1 polymorphism and the bilaterality of AMD, we genotyped rs11200638 in control, unilateral, and bilateral advanced AMD patients. The A allele for SNP rs11200638 in HTRA1, was significantly more prevalent in bilateral wet AMD and GA patients than in unilateral groups (p=.02 and p=.03, respectively). The homozygote odds ratios of bilateral wet AMD and GA are significantly greater than those seen in unilateral groups (twofold and threefold increase, respectively). This finding is consistent with the role of HTRA1 in AMD pathogenesis and will help aid in the clinical management and prognosis of AMD patients.

  14. Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

    Science.gov (United States)

    Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

    2017-07-01

    To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

  15. [Association between CISH polymorphisms and susceptibility to chronic hepatitis B in Chinese Han population].

    Science.gov (United States)

    Zhang, Xin; Sun, Xuehua; Zhou, Zhenhua; Li, Man; Gao, Yueqiu

    2014-04-01

    To investigate the association between rs414171 single nucleotide polymorphisms (SNP) of cytokine- inducible src homology 2 domain protein (CISH) and the susceptibility to chronic hepatitis B. A total of 233 Chinese Han patients with chronic hepatitis B and 148 age- and sex-matched healthy controls were enrolled in this case-control study. The SNP rs414171 was genotyped by Sequenom MassArray-IPLEX to analyze the relationship between rs414171 and chronic hepatitis B. The distribution of SNP rs414171 allele and genotype frequencies showed no significant difference between the patients and healthy controls (P>0.05). CISH rs414171 is not significantly associated with the susceptibility to chronic hepatitis B in Chinese Han population.

  16. Single Nucleotide Polymorphisms in the Leptin-a Gene and Associations with Growth Traits in the Orange-Spotted Grouper (Epinephelus coioides

    Directory of Open Access Journals (Sweden)

    Haoran Lin

    2013-04-01

    Full Text Available Leptin is a multifunctional protein involved in processes such as body weight regulation, energy expenditure, fat metabolism, food intake, and appetite regulation. Duplicate leptin genes, leptin-a and leptin-b, were previously detected in the orange-spotted grouper. In this study, we cloned the full-length open reading frame (ORF of the leptin-a gene in the orange-spotted grouper, searched for polymorphisms, and performed association analyses between these polymorphisms and seven growth traits. Six polymorphisms, consisting of 2 SNPs in intron 1 (c.182T > G, c.183G > T and 4 SNPs in exon 2 (c.339C > G, c.345C > T, c.447G > A, c.531C > T, were identified and genotyped in 200 individuals. The c.182T > G and c.183G > T polymorphisms showed complete linkage and were analyzed together. Association analyses revealed that the c.182 + 183TG > GT polymorphism was significantly associated with body weight (BWT and body width (BWH, with the AB (TG/GT genotype showing positive effects on growth traits. Additionally, the SNP c.447G > A was significantly associated with BWT, BWH, overall length (OL, trunk width (TW, and head length (HL, with the GA genotype displaying positive effects on growth traits. The c.531C > T SNP showed a close association between the TT genotype and decreased growth. Our results demonstrate that several polymorphisms in the leptin-a gene are associated with growth traits and can be used for marker-assisted selection (MAS in orange-spotted grouper populations.

  17. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

    Directory of Open Access Journals (Sweden)

    Jaewoo Song

    Full Text Available VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC study for the association of single nucleotide polymorphisms (SNPs in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  18. Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

    Science.gov (United States)

    Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

    2013-09-01

    Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  20. SNP-VISTA: An Interactive SNPs Visualization Tool

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Nameeta; Teplitsky, Michael V.; Pennacchio, Len A.; Hugenholtz, Philip; Hamann, Bernd; Dubchak, Inna L.

    2005-07-05

    Recent advances in sequencing technologies promise better diagnostics for many diseases as well as better understanding of evolution of microbial populations. Single Nucleotide Polymorphisms(SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it is possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease and then screen for causative mutations.In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmental samples makes possible more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at http://genome.lbl.gov/vista/snpvista.