WorldWideScience

Sample records for single x-ray diffraction

  1. X-ray diffraction from single GaAs nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Biermanns, Andreas

    2012-11-12

    In recent years, developments in X-ray focussing optics have allowed to produce highly intense, coherent X-ray beams with spot sizes in the range of 100 nm and below. Together with the development of new experimental stations, X-ray diffraction techniques can now be applied to study single nanometer-sized objects. In the present work, X-ray diffraction is applied to study different aspects of the epitaxial growth of GaAs nanowires. Besides conventional diffraction methods, which employ X-ray beams with dimensions of several tens of {mu}m, special emphasis lies on the use of nanodiffraction methods which allow to study single nanowires in their as-grown state without further preparation. In particular, coherent X-ray diffraction is applied to measure simultaneously the 3-dimensional shape and lattice parameters of GaAs nanowires grown by metal-organic vapor phase epitaxy. It is observed that due to a high density of zinc-blende rotational twins within the nanowires, their lattice parameter deviates systematically from the bulk zinc-blende phase. In a second step, the initial stage in the growth of GaAs nanowires on Si (1 1 1) surfaces is studied. This nanowires, obtained by Ga-assisted growth in molecular beam epitaxy, grow predominantly in the cubic zinc-blende structure, but contain inclusions of the hexagonal wurtzite phase close to their bottom interface. Using nanodiffraction methods, the position of the different structural units along the growth axis is determined. Because the GaAs lattice is 4% larger than silicon, these nanowires release their lattice mismatch by the inclusion of dislocations at the interface. Whereas NWs with diameters below 50 nm are free of strain, a rough interface structure in nanowires with diameters above 100 nm prevents a complete plastic relaxation, leading to a residual strain at the interface that decays elastically along the growth direction. Finally, measurements on GaAs-core/InAs-shell nanowire heterostructures are presented

  2. Single-pulse x-ray diffraction using polycapillary optics for in situ dynamic diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Maddox, B. R., E-mail: maddox3@llnl.gov; Akin, M. C., E-mail: akin1@llnl.gov; Teruya, A.; Hunt, D.; Hahn, D.; Cradick, J. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Morgan, D. V. [National Security Technologies LLC, Los Alamos, New Mexico 87544 (United States)

    2016-08-15

    Diagnostic use of single-pulse x-ray diffraction (XRD) at pulsed power facilities can be challenging due to factors such as the high flux and brightness requirements for diffraction and the geometric constraints of experimental platforms. By necessity, the x-ray source is usually positioned very close, within a few inches of the sample. On dynamic compression platforms, this puts the x-ray source in the debris field. We coupled x-ray polycapillary optics to a single-shot needle-and-washer x-ray diode source using a laser-based alignment scheme to obtain high-quality x-ray diffraction using a single 16 ns x-ray pulse with the source >1 m from the sample. The system was tested on a Mo sample in reflection geometry using 17 keV x-rays from a Mo anode. We also identified an anode conditioning effect that increased the x-ray intensity by 180%. Quantitative measurements of the x-ray focal spot produced by the polycapillary yielded a total x-ray flux on the sample of 3.3 ± 0.5 × 10{sup 7} molybdenum Kα photons.

  3. A = Rb, K: Single crystal X-ray diffraction studies

    Indian Academy of Sciences (India)

    Unknown

    X-ray diffraction on structural phase transition. 475. Figure 2. Powder X-ray diffraction pattern of KLHS at 298 and 100 K. 3. Structure determination and refinement. 3.1 Structure of RLHS at 293 K. A crystal of size 0⋅7 × 0⋅3 × 0⋅4 mm was mounted on a BRUKER AXS SMART APEX. CCD9 diffractometer with a crystal to ...

  4. X-ray diffraction from single molecules at the worlds first X-ray free-electron laser source

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Stephan; Kuepper, Jochen; Chapman, Henry; Rolles, Daniel [Center for Free-Electron Laser Science (CFEL), DESY, Hamburg (Germany)

    2011-07-01

    The advent of the first X-ray Free-Electron Laser, the Linac Coherent Light Source (LCLS), opens up a new approach for diffractive imaging of even single molecules that cannot be crystallized into macromolecular crystals of sufficient size necessary for conventional X-ray crystallography. Here, we present the concept, the experimental parametric space that has to be addressed together with first experimental results of X-ray diffractive imaging of single molecules in the gas phase at LCLS. We use a supersonically cooled molecular beam to provide an ensemble of test-molecules, laser-align them, and subsequently probe them with the LCLS in order to get diffraction patterns of single molecules.

  5. Single shot diffraction of picosecond 8.7-keV x-ray pulses

    Directory of Open Access Journals (Sweden)

    F. H. O’Shea

    2012-02-01

    Full Text Available We demonstrate multiphoton, single shot diffraction images of x rays produced by inverse Compton scattering a high-power CO_{2} laser from a relativistic electron beam, creating a pulse of 8.7 keV x rays. The tightly focused, relatively high peak brightness electron beam and high photon density from the 2 J CO_{2} laser yielded 6×10^{7} x-ray photons over the full opening angle in a single shot. Single shot x-ray diffraction is performed by passing the x rays though a vertical slit and on to a flat silicon (111 crystal. 10^{2} diffracted photons were detected. The spectrum of the detected x rays is compared to simulation. The diffraction and detection of 10^{2} x rays is a key step to a more efficient time resolved diagnostic in which the number of observed x rays might reach 10^{4}; enabling a unique, flexible x-ray source as a sub-ps resolution diagnostic for studying the evolution of chemical reactions, lattice deformation and melting, and magnetism.

  6. X-ray diffraction analysis of some single crystals with special properties

    Energy Technology Data Exchange (ETDEWEB)

    Antipin, M.Yu. [Russian Academy of Sciences, Moscow (Russian Federation). Inst. of Organoelement Compounds

    1996-12-31

    New possibilities of the X-ray diffraction method for studies of some single crystals with special physical properties are analyzed. It is demonstrated that wide range temperature diffraction data, special single crystals experiments under strong electric fields, and charge density analysis in crystals might enrich the knowledge on the nature of the crystal properties.

  7. X-ray diffraction

    International Nuclear Information System (INIS)

    Einstein, J.R.; Wei, C.H.

    1982-01-01

    We have been interested in structural elucidation by x-ray diffraction of compounds of biological interest. Understanding exactly how atoms are arranged in three-dimensional arrays as molecules can help explain the relationship between structure and functions. The species investigated may vary in size and shape; our recent studies included such diverse substances as antischistosomal drugs, a complex of cadmium with nucleic acid base, nitrate salts of adenine, and proteins

  8. X-ray diffraction

    International Nuclear Information System (INIS)

    Vries, J.L. de.

    1976-01-01

    The seventh edition of Philips' Review of literature on X-ray diffraction begins with a list of conference proceedings on the subject, organised by the Philips' organisation at regular intervals in various European countries. This is followed by a list of bulletins. The bibliography is divided according to the equipment (cameras, diffractometers, monochromators) and its applications. The applications are subdivided into sections for high/low temperature and pressure, effects due to the equipment, small angle scattering and a part for stress, texture and phase analyses of metals and quantitative analysis of minerals

  9. Single-particle structure determination by correlations of snapshot X-ray diffraction patterns

    Science.gov (United States)

    Starodub, D.; Aquila, A.; Bajt, S.; Barthelmess, M.; Barty, A.; Bostedt, C.; Bozek, J. D.; Coppola, N.; Doak, R. B.; Epp, S. W.; Erk, B.; Foucar, L.; Gumprecht, L.; Hampton, C. Y.; Hartmann, A.; Hartmann, R.; Holl, P.; Kassemeyer, S.; Kimmel, N.; Laksmono, H.; Liang, M.; Loh, N. D.; Lomb, L.; Martin, A. V.; Nass, K.; Reich, C.; Rolles, D.; Rudek, B.; Rudenko, A.; Schulz, J.; Shoeman, R. L.; Sierra, R. G.; Soltau, H.; Steinbrener, J.; Stellato, F.; Stern, S.; Weidenspointner, G.; Frank, M.; Ullrich, J.; Strüder, L.; Schlichting, I.; Chapman, H. N.; Spence, J. C. H.; Bogan, M. J.

    2012-12-01

    Diffractive imaging with free-electron lasers allows structure determination from ensembles of weakly scattering identical nanoparticles. The ultra-short, ultra-bright X-ray pulses provide snapshots of the randomly oriented particles frozen in time, and terminate before the onset of structural damage. As signal strength diminishes for small particles, the synthesis of a three-dimensional diffraction volume requires simultaneous involvement of all data. Here we report the first application of a three-dimensional spatial frequency correlation analysis to carry out this synthesis from noisy single-particle femtosecond X-ray diffraction patterns of nearly identical samples in random and unknown orientations, collected at the Linac Coherent Light Source. Our demonstration uses unsupported test particles created via aerosol self-assembly, and composed of two polystyrene spheres of equal diameter. The correlation analysis avoids the need for orientation determination entirely. This method may be applied to the structural determination of biological macromolecules in solution.

  10. X-ray diffraction studies of NbTe 2 single crystal

    Indian Academy of Sciences (India)

    The composition of the grown crystals was confirmed on the basis of energy dispersive analysis by X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and X-ray density have been carried out for the grown crystals. The particle size ...

  11. X-ray diffraction studies of NbTe2 single crystal

    Indian Academy of Sciences (India)

    Unknown

    X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and ... The layered structure compound, NbTe2, is one of the typical materials which lead to charge .... financial assistance to carry out this work. References. Brown B E 1966 Acta ...

  12. X-ray diffraction computed tomography

    International Nuclear Information System (INIS)

    Harding, G.; Kosanetzky, J.; Neitzel, U.

    1987-01-01

    Coherent scattering of x-ray photons leads to the phenomenon of x-ray diffraction, which is widely used for determining atomic structure in materials science. A technique [x-ray diffraction computed tomography (CT)] is described, analogous to conventional CT, in which the x-ray diffraction properties of a stack of two-dimensional object sections may be imaged. The technique has been investigated using a first generation (single pencil beam) CT scanner to measure small angle coherent scatter, in addition to the customary transmitted radiation. Diffraction data from a standard CT performance phantom obtained with this new technique and with an x-ray diffractometer are compared. The agreement is satisfactory bearing in mind the poor momentum resolution of our apparatus. The dose and sensitivity of x-ray diffraction CT are compared with those of conventional transmission CT. Diffraction patterns of some biological tissues and plastics presented in a companion paper indicate the potential of x-ray diffraction CT for tissue discrimination and material characterization. Finally, possibilities for refinement of the technique by improving the momentum resolution are discussed

  13. X-ray diffraction apparatus

    International Nuclear Information System (INIS)

    Padini, F.R.

    1978-01-01

    The invention provides an x-ray diffraction apparatus permitting the rotation of the divergence sit in conjunction with the rotation of the x-ray irradiated specimen, whereby the dimensions of the x-ray irradiated portion of the specimen remain substantially constant during the rotation of the specimen. In a preferred embodiment, the divergence slit is connected to a structural element linked with a second structural element connected to the specimen such that the divergence slit rotates at a lower angular speed than the specimen

  14. Redetermination of LaZn5 based on single crystal X-ray diffraction data

    Directory of Open Access Journals (Sweden)

    Igor Oshchapovsky

    2012-01-01

    Full Text Available The crystal structure of the already known binary title compound LaZn5 (lanthanum pentazinc (space group P6/mmm, Pearson symbol hP6, CaCu5 structure type has been redetermined from single-crystal X-ray diffraction data. In contrast to previous determinations based on X-ray powder data [Nowotny (1942. Z. Metallkd. 34, 247–253; de Negri et al. (2008. Intermetallics, 16, 168–178], where unit-cell parameters and assignment of the structure type were reported, the present study reveals anisotropic displacement parameters for all atoms. The crystal structure consists of three crytallographically distinct atoms. The La atom (Wyckoff site 1a, site symmetry 6/mmm is surrounded by 18 Zn atoms and two La atoms. The coordination polyhedron around one of the Zn atoms (Wyckoff site 2c, site symmetry -6m2 is an icosahedron made up from three La and nine Zn atoms. The other Zn atom (Wyckoff site 3g, site symmetry mmm is surrounded by four La and eight Zn atoms. Bonding between atoms is explored by means of the TB–LMTO–ASA (tight-binding linear muffin-tin orbital atomic spheres approximation program package. The positive charge density is localized around La atoms, and the negative charge density is around Zn atoms, with weak covalent bonding between the latter.

  15. Diffraction leveraged modulation of X-ray pulses using MEMS-based X-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, Daniel; Shenoy, Gopal; Wang, Jin; Walko, Donald A.; Jung, Il-Woong; Mukhopadhyay, Deepkishore

    2016-08-09

    A method and apparatus are provided for implementing Bragg-diffraction leveraged modulation of X-ray pulses using MicroElectroMechanical systems (MEMS) based diffractive optics. An oscillating crystalline MEMS device generates a controllable time-window for diffraction of the incident X-ray radiation. The Bragg-diffraction leveraged modulation of X-ray pulses includes isolating a particular pulse, spatially separating individual pulses, and spreading a single pulse from an X-ray pulse-train.

  16. Simultaneous X-ray diffraction from multiple single crystals of macromolecules

    DEFF Research Database (Denmark)

    Paithankar, Karthik S.; Sørensen, Henning Osholm; Wright, Jonathan P.

    2011-01-01

    The potential in macromolecular crystallography for using multiple crystals to collect X-ray diffraction data simultaneously from assemblies of up to seven crystals is explored. The basic features of the algorithms used to extract data and their practical implementation are described. The procedure...

  17. Diffractive X-ray Telescopes

    OpenAIRE

    Skinner, Gerald K.

    2010-01-01

    Diffractive X-ray telescopes using zone plates, phase Fresnel lenses, or related optical elements have the potential to provide astronomers with true imaging capability with resolution several orders of magnitude better than available in any other waveband. Lenses that would be relatively easy to fabricate could have an angular resolution of the order of micro-arc-seconds or even better, that would allow, for example, imaging of the distorted space- time in the immediate vicinity of the super...

  18. X-ray diffraction studies on single and mixed confectionery fats using synchrotron radiation

    Energy Technology Data Exchange (ETDEWEB)

    MacMillan, S.C.; Roberts, K.J.; Wells, M.; Polgreen, M.; Smith, I. [Heriot-Watt University, Edinburgh, (United Kingdom). Department of Mechanical and Chemical Engineering, Centre for Molecular and Interface Engineering

    1999-12-01

    Full text: Understanding and refining the molecular-scale processes involved in the manufacture of structured materials such as long-chain hydrocarbon compounds is important in many commercial areas such as the petrochemical, biochemical, food, pharmaceutical and soap industries. In such processes crystallisation is an important separation, purification and preparation technique. Despite this our knowledge of the crystallisation process itself is surprisingly limited. In order to improve the crystallisation of confectionery fats, the crystallisation of it`s main component, cocoa butter fat, must be properly understood. Cocoa butter fat can exhibit up to 6 polymorphic forms of different crystallographic structures with melting points varying from 17.3 deg C to 36.3 deg C. During the production of chocolate it is essential to control the polymorphic form of fats present, in order to produce a final product with the correct physical and rheological properties. Both shear rate and temperature are thought to play a crucial role in this process. The most widely used method for studying polymorphism is X-ray diffraction. Typical X-ray diffraction patterns of fats exhibit two groups of diffraction lines corresponding to the long and short spacings. The long spacings correspond to the planes formed by the methyl end groups and are dependent on the chain length and the angle of tilt of the component fatty acids of the glyceride molecules. The short spacings refer to the cross sectional packing of the hydrocarbon chain and are independent of the chain length. The relationship between crystallisation rate, polymorphic form, shear and the fat composition has for the first time been quantified, which will enable more accurate control of the polymorhic form in chocolate production. This has been achieved by developing an improved in-situ cell for X-ray studies. The X-ray studies are necessary for the examination of on-line studies under well controlled conditions of temperature

  19. X-ray diffraction studies on single and mixed confectionery fats using synchrotron radiation

    International Nuclear Information System (INIS)

    MacMillan, S.C.; Roberts, K.J.; Wells, M.; Polgreen, M.; Smith, I.

    1999-01-01

    Full text: Understanding and refining the molecular-scale processes involved in the manufacture of structured materials such as long-chain hydrocarbon compounds is important in many commercial areas such as the petrochemical, biochemical, food, pharmaceutical and soap industries. In such processes crystallisation is an important separation, purification and preparation technique. Despite this our knowledge of the crystallisation process itself is surprisingly limited. In order to improve the crystallisation of confectionery fats, the crystallisation of it's main component, cocoa butter fat, must be properly understood. Cocoa butter fat can exhibit up to 6 polymorphic forms of different crystallographic structures with melting points varying from 17.3 deg C to 36.3 deg C. During the production of chocolate it is essential to control the polymorphic form of fats present, in order to produce a final product with the correct physical and rheological properties. Both shear rate and temperature are thought to play a crucial role in this process. The most widely used method for studying polymorphism is X-ray diffraction. Typical X-ray diffraction patterns of fats exhibit two groups of diffraction lines corresponding to the long and short spacings. The long spacings correspond to the planes formed by the methyl end groups and are dependent on the chain length and the angle of tilt of the component fatty acids of the glyceride molecules. The short spacings refer to the cross sectional packing of the hydrocarbon chain and are independent of the chain length. The relationship between crystallisation rate, polymorphic form, shear and the fat composition has for the first time been quantified, which will enable more accurate control of the polymorhic form in chocolate production. This has been achieved by developing an improved in-situ cell for X-ray studies. The X-ray studies are necessary for the examination of on-line studies under well controlled conditions of temperature

  20. Note: Application of a pixel-array area detector to simultaneous single crystal x-ray diffraction and x-ray absorption spectroscopy measurements

    International Nuclear Information System (INIS)

    Sun, Cheng-Jun; Brewe, Dale L.; Heald, Steve M.; Zhang, Bangmin; Chen, Jing-Sheng; Chow, G. M.; Venkatesan, T.

    2014-01-01

    X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr 0.67 Sr 0.33 MnO 3 film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam

  1. X-ray diffraction 2 - diffraction principles

    International Nuclear Information System (INIS)

    O'Connor, B.

    1999-01-01

    Full text: The computation of powder diffraction intensities is based on the principle that the powder pattern comprises the summation of the intensity contributions from each of the crystallites (or single crystals) in the material. Therefore, it is of value for powder diffractionists to appreciate the form of the expression for calculating single crystal diffraction pattern intensities. This knowledge is especially important for Rietveld analysis practitioners in terms of the (i) mathematics of the method and (ii) retrieving single crystal structure data from the literature. We consider the integrated intensity from a small single crystal being rotated at velocity ω through the Bragg angle θ for reflection (hkl).... I(hkl) = [l o /ω]. [e 4 /m 2 c 4 ]. [λ 3 δV F(hkl) 2 /υ 2 ].[(1+cos 2 2θ)/2sin2θ] where e, m and c are the usual fundamental constants; λ is the x-ray wavelength, δV is the crystallite volume; F(hkl) is the structure factor; υ is the unit cell volume; and (1+cos 2 θ)/2sin2θ] is the Lorentz-polarisation factor for an unpolarised incident beam. The expression does not include a contribution for extinction. The influence of factors λ, δV, F(hkl) and υ on the intensities should be appreciated by powder diffractionists, especially the structure factor, F(hkl), which is responsible for the fingerprint nature of diffraction patterns, such as the rise and fall of intensity from peak to peak. The structure factor expression represents the summation of the scattered waves from each of the j scattering centres (i e atoms) in the unit cell: F(hkl) Σ f j exp[2πi (h.x j +k.y i +l. z i )] T j . Symbol f is the scattering factor (representing the atom-type scattering efficiency); (x, y, z) are the fractional position coordinates of atom j within the unit cell; and T is the thermal vibration factor for the atom given by: T j = 8π 2 2 > sin 2 θ/λ 2 with 2 > being the mean-square vibration amplitude of the atom (assumed to be isotropic). The

  2. Precession X-ray diffraction chamber

    International Nuclear Information System (INIS)

    Rieder, M.

    1978-01-01

    An X-ray diffraction chamber is described whose design allows the tilting of the goniometric head 90deg along the axis normal to the axis of precession. Images may thus be made in the reverse reflexion region and of reciprocal networks in any arbitrary direction with a single adhesion of the crystal. (H.S.)

  3. Submicron X-ray diffraction

    International Nuclear Information System (INIS)

    MacDowell, Alastair; Celestre, Richard; Tamura, Nobumichi; Spolenak, Ralph; Valek, Bryan; Brown, Walter; Bravman, John; Padmore, Howard; Batterman, Boris; Patel, Jamshed

    2000-01-01

    At the Advanced Light Source in Berkeley the authors have instrumented a beam line that is devoted exclusively to x-ray micro diffraction problems. By micro diffraction they mean those classes of problems in Physics and Materials Science that require x-ray beam sizes in the sub-micron range. The instrument is for instance, capable of probing a sub-micron size volume inside micron sized aluminum metal grains buried under a silicon dioxide insulating layer. The resulting Laue pattern is collected on a large area CCD detector and automatically indexed to yield the grain orientation and deviatoric (distortional) strain tensor of this sub-micron volume. A four-crystal monochromator is then inserted into the beam, which allows monochromatic light to illuminate the same part of the sample. Measurement of diffracted photon energy allows for the determination of d spacings. The combination of white and monochromatic beam measurements allow for the determination of the total strain/stress tensor (6 components) inside each sub-micron sized illuminated volume of the sample

  4. Diffractive X-Ray Telescopes

    International Nuclear Information System (INIS)

    Skinner, G.K.; Skinner, G.K

    2010-01-01

    Diffractive X-ray telescopes using zone plates, phase Fresnel lenses, or related optical elements have the potential to provide astronomers with true imaging capability with resolution several orders of magnitude better than available in any other waveband. Lenses that would be relatively easy to fabricate could have an angular resolution of the order of micro arc seconds or even better, that would allow, for example, imaging of the distorted spacetime in the immediate vicinity of the supermassive black holes in the center of active galaxies What then is precluding their immediate adoption Extremely long focal lengths, very limited bandwidth, and difficulty stabilizing the image are the main problems. The history and status of the development of such lenses is reviewed here and the prospects for managing the challenges that they present are discussed atmospheric absorption

  5. Structure of sodium above 100 GPa by single-crystal x-ray diffraction.

    Science.gov (United States)

    McMahon, M I; Gregoryanz, E; Lundegaard, L F; Loa, I; Guillaume, C; Nelmes, R J; Kleppe, A K; Amboage, M; Wilhelm, H; Jephcoat, A P

    2007-10-30

    At pressures above a megabar (100 GPa), sodium crystallizes in a number of complex crystal structures with unusually low melting temperatures, reaching as low as 300 K at 118 GPa. We have utilized this unique behavior at extreme pressures to grow a single crystal of sodium at 108 GPa, and have investigated the complex crystal structure at this pressure using high-intensity x-rays from the new Diamond synchrotron source, in combination with a pressure cell with wide angular apertures. We confirm that, at 108 GPa, sodium is isostructural with the cI16 phase of lithium, and we have refined the full crystal structure of this phase. The results demonstrate the extension of single-crystal structure refinement beyond 100 GPa and raise the prospect of successfully determining the structures of yet more complex phases reported in sodium and other elements at extreme pressures.

  6. Single-crystal X-ray and neutron powder diffraction investigation of the phase transition in tetrachlorobenzene.

    Science.gov (United States)

    Barnett, Sarah A; Broder, Charlotte K; Shankland, Kenneth; David, William I F; Ibberson, Richard M; Tocher, Derek A

    2006-04-01

    The polymorphic phase transition of 1,2,4,5-tetrachlorobenzene (TCB) has been investigated using neutron powder diffraction and single-crystal X-ray diffraction. The diffraction experiments show a reversible phase change that occurs as a function of temperature with no apparent loss of sample quality on transition between the two phases. Neutron powder diffraction gives detailed information on the molecular structural changes and lattice parameters from 2 K to room temperature. The structure of the low-temperature form has been elucidated for the first time using single-crystal X-ray diffraction. Comparison of the alpha and beta structures show that they are both based on the same sheet motif, with the differences between the two being very subtle, except in terms of crystal symmetry. Detailed analysis of the structures revealed the changes required for inter-conversion. A computational polymorph search showed that these two sheet structures are more thermodynamically stable than alternative herringbone-type structures.

  7. Neutron and X-ray single-crystal diffraction from protein microcrystals via magnetically oriented microcrystal arrays in gels.

    Science.gov (United States)

    Tsukui, Shu; Kimura, Fumiko; Kusaka, Katsuhiro; Baba, Seiki; Mizuno, Nobuhiro; Kimura, Tsunehisa

    2016-07-01

    Protein microcrystals magnetically aligned in D2O hydrogels were subjected to neutron diffraction measurements, and reflections were observed for the first time to a resolution of 3.4 Å from lysozyme microcrystals (∼10 × 10 × 50 µm). This result demonstrated the possibility that magnetically oriented microcrystals consolidated in D2O gels may provide a promising means to obtain single-crystal neutron diffraction from proteins that do not crystallize at the sizes required for neutron diffraction structure determination. In addition, lysozyme microcrystals aligned in H2O hydrogels allowed structure determination at a resolution of 1.76 Å at room temperature by X-ray diffraction. The use of gels has advantages since the microcrystals are measured under hydrated conditions.

  8. On the Use of Wide-Angle Energy-Sensitive Detectors in White-Beam X-Ray Single-Crystal Diffraction

    DEFF Research Database (Denmark)

    Buras, B.; Staun Olsen, J.; Gerward, Leif

    1980-01-01

    The possible applications of multiple-element or large-area semiconductor detectors in single-crystal X-ray diffraction are discussed on the basis of experimental results using Bremsstrahlung as well as synchrotron radiation.......The possible applications of multiple-element or large-area semiconductor detectors in single-crystal X-ray diffraction are discussed on the basis of experimental results using Bremsstrahlung as well as synchrotron radiation....

  9. Glancing angle synchrotron X-ray diffraction

    International Nuclear Information System (INIS)

    Cernik, R.J.

    1996-01-01

    This paper describes in basic detail some of the techniques that can be used to study thin films and surfaces. These are all in the X-ray region and cover reflectivity, diffraction form polycrystalline films, textured films and single crystal films. Other effects such as fluorescence and diffuse scattering are mentioned but not discussed in detail. Two examples of the reflectivity from multilayers and the diffraction from iron oxide films are discussed. The advantages of the synchrotron for these studies is stressed and the experimental geometries that can be employed are described i detail. A brief bibliography is provided at the end to accompany this part of the 1996 Frascati school

  10. Glancing angle synchrotron X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cernik, R.J. [Daresbury Lab., Warrington, WA (United States)

    1996-09-01

    This paper describes in basic detail some of the techniques that can be used to study thin films and surfaces. These are all in the X-ray region and cover reflectivity, diffraction form polycrystalline films, textured films and single crystal films. Other effects such as fluorescence and diffuse scattering are mentioned but not discussed in detail. Two examples of the reflectivity from multilayers and the diffraction from iron oxide films are discussed. The advantages of the synchrotron for these studies is stressed and the experimental geometries that can be employed are described i detail. A brief bibliography is provided at the end to accompany this part of the 1996 Frascati school.

  11. X-ray topography and multiple diffraction

    International Nuclear Information System (INIS)

    Chang, S.-L.

    1983-01-01

    A short summary on X-ray topography, which is based on the dynamical theory of X-ray diffraction, is made. The applications and properties related to the use of the multiple diffraction technique are analized and discussed. (L.C.) [pt

  12. X-ray diffraction on solids under pressure

    International Nuclear Information System (INIS)

    Holzapfel, W.B.

    1984-01-01

    In the first part, various techniques and examples for X-ray diffraction on polycrystalline samples under high pressure will be reviewed with special emphasis on a comparison between angular and energy dispersive techniques. The second part reviews X-ray diffraction techniques for single crystals under pressure and demonstrates on few examples typical applications

  13. About some practical aspects of X-ray diffraction : From single crystal to powders

    Energy Technology Data Exchange (ETDEWEB)

    Giacovazzo, C. [Bari Univ. (Italy). Dip. Geomineralogico

    1996-09-01

    An ideal polycrystalline material or power is an ensemble of a very large number of randomly oriented crystallites. It is shown the effect that this random orientation has on the diffraction of a specimen assumed to contain only one reciprocal lattice node. The most remarkable difference with the single-crystal case is that now must think of scattering vectors not as lying on discrete nodes of reciprocal lattice vectors, the distances from the single-crystal reciprocal lattice nodes to the origin of reciprocal space.

  14. X-Ray Diffractive Optics

    Science.gov (United States)

    Dennis, Brian; Li, Mary; Skinner, Gerald

    2013-01-01

    X-ray optics were fabricated with the capability of imaging solar x-ray sources with better than 0.1 arcsecond angular resolution, over an order of magnitude finer than is currently possible. Such images would provide a new window into the little-understood energy release and particle acceleration regions in solar flares. They constitute one of the most promising ways to probe these regions in the solar atmosphere with the sensitivity and angular resolution needed to better understand the physical processes involved. A circular slit structure with widths as fine as 0.85 micron etched in a silicon wafer 8 microns thick forms a phase zone plate version of a Fresnel lens capable of focusing approx. =.6 keV x-rays. The focal length of the 3-cm diameter lenses is 100 microns, and the angular resolution capability is better than 0.1 arcsecond. Such phase zone plates were fabricated in Goddard fs Detector Development Lab. (DDL) and tested at the Goddard 600-microns x-ray test facility. The test data verified that the desired angular resolution and throughput efficiency were achieved.

  15. Two-dimensional x-ray diffraction

    CERN Document Server

    He, Bob B

    2009-01-01

    Written by one of the pioneers of 2D X-Ray Diffraction, this useful guide covers the fundamentals, experimental methods and applications of two-dimensional x-ray diffraction, including geometry convention, x-ray source and optics, two-dimensional detectors, diffraction data interpretation, and configurations for various applications, such as phase identification, texture, stress, microstructure analysis, crystallinity, thin film analysis and combinatorial screening. Experimental examples in materials research, pharmaceuticals, and forensics are also given. This presents a key resource to resea

  16. The application of X-ray, γ-ray and neutron diffraction to the characterization of single crystal perfection

    International Nuclear Information System (INIS)

    Freund, A.; Schneider, J.R.

    1976-01-01

    The work is divided into the following three chapters: 1) diffraction by perfect and imperfect crystals, 2) experimental apparatus (describing gamma ray, X-ray and neutron diffractometers), 3) application of diffraction methods to the development of neutron monochromators. (WBU) [de

  17. Synthesis and single crystal x-ray diffraction study of a Schiff base derived from 4-acylpyrazolone and 2-aminophenol

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Naresh; Kant, Rajni, E-mail: vivek-gupta2k2@hotmail.com; Gupta, Vivek K., E-mail: vivek-gupta2k2@hotmail.com [Department of Physics and Electronics, University of Jammu, Jammu Tawi - 180006 (India); Jadeja, R. N. [Department of Chemistry, Faculty of Science, The M. S. University of Baroda, Vadodara-390002 (India)

    2014-04-24

    The title compound, (Z)-1-(3-chlorophenyl)-4[1((2hydroxyphenyl)amino)propylidene] -3-methyl-1H-pyrazol-5(4H)-one was synthesized by refluxing compound 1-(m-chlorophenyl)-3-methyl-4-propionyl-5-pyrazolone, with 2-aminophenol in ethanol. The compound crystallizes in the orthorhombic crystal system with space group Pca2{sub 1} having unit cell parameters: a = 26.2993(8), b = 7.0724(2) and c = 18.7170(5)Å. The structure contains two crystallographically independent molecules, A, and, B, in the asymmetric unit cell. The crystal structure was solved by direct method using single crystal X-ray diffraction data collected at room temperature and refined by full-matrix least-squares procedures to a final R- value of 0.049 for 5207 observed reflections.

  18. X-ray diffraction study of stacking faults in a single crystal of 2H SiC

    International Nuclear Information System (INIS)

    Pandey, D.; Krishna, P.

    1977-01-01

    The nature of random stacking faults in a heavily disordered single crystal of 2H SiC has been investigated by studying the broadening of x-ray diffraction maxima. The intensity distribution along the 10.1 reciprocal lattice row was recorded on a four-circle, computer-controlled single crystal diffractometer. The 10.1 reflections with 1 even were found to be considerably broadened showing that the stacking faults present are predominantly intrinsic faults ( both growth and deformation faults). A careful study of the half-width values of different 10.1 reflections revealed that the fault probabilities are large. Exact expressions for the diffracted intensity and the observable diffraction effects were obtained and these were then used to calculate the deformation and growth fault probabilities which were found to be 0.20 and 0.11 respectively. It is suggested that several deformation fault configurations result from a clustering of growth faults. The results obtained are compared with those obtained for 2H ZnS crystals. (author)

  19. Redetermination of the crystal structure of β-zinc molybdate from single-crystal X-ray diffraction data.

    Science.gov (United States)

    Mtioui-Sghaier, Olfa; Mendoza-Meroño, Rafael; Ktari, Lilia; Dammak, Mohamed; García-Granda, Santiago

    2015-07-01

    The crystal structure of the β-polymorph of ZnMoO4 was re-determined on the basis of single-crystal X-ray diffraction data. In comparison with previous powder X-ray diffraction studies [Katikaneani & Arunachalam (2005 ▸). Eur. J. Inorg. Chem. pp. 3080-3087; Cavalcante et al. (2013 ▸). Polyhedron, 54, 13-25], all atoms were refined with anisotropic displacement parameters, leading to a higher precision with respect to bond lengths and angles. β-ZnMoO4 adopts the wolframite structure type and is composed of distorted ZnO6 and MoO6 octa-hedra, both with point group symmetry 2. The distortion of the octa-hedra is reflected by variation of bond lengths and angles from 2.002 (3)-2.274 (4) Å, 80.63 (11)-108.8 (2)° for equatorial and 158.4 (2)- 162.81 (14)° for axial angles (ZnO6), and of 1.769 (3)-2.171 (3) Å, 73.39 (16)-104.7 (2), 150.8 (2)-164.89 (15)° (MoO6), respectively. In the crystal structure, the same type of MO6 octa-hedra share edges to built up zigzag chains extending parallel to [001]. The two types of chains are condensed by common vertices into a framework structure. The crystal structure can alternatively be described as derived from a distorted hexa-gonally closed packed arrangement of the O atoms, with Zn and Mo in half of the octa-hedral voids.

  20. Diffraction of X-ray beams in capillary waveguides

    International Nuclear Information System (INIS)

    Kukhlevsky, S.V.; Flora, F.; Marinai, A.; Nyitray, G.; Ritucci, A.; Palladino, L.; Reale, A.; Tomassetti, G.

    2000-01-01

    Propagation of the soft X-ray radiation generated by a small-diameter incoherent source through the capillary plane waveguide which satisfies the multimode condition is studied using the Fresnel-Kirchhoff diffraction theory. The diffraction is manifested by appearance of the diffraction fringes, dark and light bands, in the far-field zone of the capillary output. Such a behaviour of the X-ray radiation is confirmed by our experimental data. The results give explanation for the interference effect recently observed in many experiments on the grazing reflections of X-rays in single and multiple capillary optics

  1. Diffraction peaks in x-ray spectroscopy: Friend or foe?

    International Nuclear Information System (INIS)

    Tissot, R.G.; Goehner, R.P.

    1992-01-01

    Diffraction peaks can occur as unidentifiable peaks in the energy spectrum of an x-ray spectrometric analysis. Recently, there has been increased interest in oriented polycrystalline films and epitaxial films on single crystal substrates for electronic applications. Since these materials diffract x-rays more efficiently than randomly oriented polycrystalline materials, diffraction peaks are being observed more frequently in x-ray fluorescent spectra. In addition, micro x-ray spectrometric analysis utilizes a small, intense, collimated x-ray beam that can yield well defined diffraction peaks. In some cases these diffraction peaks can occur at the same position as elemental peaks. These diffraction peaks, although a possible problem in qualitative and quantitative elemental analysis, can give very useful information about the crystallographic structure and orientation of the material being analyzed. The observed diffraction peaks are dependent on the geometry of the x-ray spectrometer, the degree of collimation and the distribution of wavelengths (energies) originating from the x-ray tube and striking the sample

  2. Development of a new micro-furnace for "in situ" high-temperature single crystal X-ray diffraction measurements

    Science.gov (United States)

    Alvaro, Matteo; Angel, Ross J.; Marciano, Claudio; Zaffiro, Gabriele; Scandolo, Lorenzo; Mazzucchelli, Mattia L.; Milani, Sula; Rustioni, Greta; Domeneghetti, Chiara M.; Nestola, Fabrizio

    2015-04-01

    Several experimental methods to reliably determine elastic properties of minerals at non-ambient conditions have been developed. In particular, different techniques for generating high-pressure and high-temperature have been successfully adopted for single-crystal and powder X-ray diffraction measurements. High temperature devices for "in-situ" measurements should provide the most controlled isothermal environment as possible across the entire sample. It is intuitive that in general, thermal gradients across the sample increase as the temperature increases. Even if the small isothermal volume required for single-crystal X-ray diffraction experiments makes such phenomena almost negligible, the design of a furnace should also aim to reduce thermal gradients by including a large thermal mass that encloses the sample. However this solution often leads to complex design that results in a restricted access to reciprocal space or attenuation of the incident or diffracted intensity (with consequent reduction of the accuracy and/or precision in lattice parameter determination). Here we present a newly-developed H-shaped Pt-Pt/Rh resistance microfurnace for in-situ high-temperature single-crystal X-ray diffraction measurements. The compact design of the furnace together with the long collimator-sample-detector distance allows us to perform measurements up to 2θ = 70° with no further restrictions on any other angular movement. The microfurnace is equipped with a water cooling system that allows a constant thermal gradient to be maintained that in turn guarantees thermal stability with oscillations smaller than 5°C in the whole range of operating T of room-T to 1200°C. The furnace has been built for use with a conventional 4-circle Eulerian geometry equipped with point detector and automated with the SINGLE software (Angel and Finger 2011) that allows the effects of crystal offsets and diffractometer aberrations to be eliminated from the refined peak positions by the 8

  3. Phase transitions in shock compressed bismuth identified using single photon energy dispersive X-ray diffraction (SPEDX)

    Science.gov (United States)

    Briggs, R.; Suggit, MJ; Gorman, MG; Coleman, A.; Heathcote, R.; Higginbotham, A.; Patel, S.; Wark, JS; McMahon, MI

    2017-10-01

    We present evidence for phase transitions in shock-compressed bismuth using the SPEDX x-ray diffraction technique. Experiments were performed on the Vulcan laser at the Central Laser Facility, RAL, Didcot, UK. We observed diffraction from the (110) bcc peak of Bi-V, and from its calculated lattice parameter the pressure was determined to be approximately 17 GPa. Upon further compression (higher laser intensities), no further diffraction from solid phases was observed. Shock melting of bismuth is thought to occur between 18 and 27 GPa. Diffraction results at lower pressures as a function of delay time are also presented.

  4. Characterization of Metalloproteins and Biomaterials by X-ray Absorption Spectroscopy and X-ray Diffraction

    DEFF Research Database (Denmark)

    Frankær, Christian Grundahl

    by estimation of the water content by thermogravimetric analysis. Bone tissue from dogs treated with strontiummalonate was studied using XAS. A new approach for analysing the X-ray absorption spectra resulted in a compositional model, from which the relative distribution of strontium in the different bone......-ray crystallography and X-ray absorption spectroscopy (XAS) applied to studying different hexameric insulin conformations. (iii) The structures of polymorphs of strontium ranelate and the distribution of strontium in bone tissue. A procedure for fast identification and verification of protein powders using XRPD...... and R6) were solved by single crystal X-ray diffraction (XRD) to 1.40 Å, 1.30 Å and 1.80 Å resolution, respectively. The zinc coordination in each conformation was studied by XAS including both extended X-ray absorption fine structure (EXAFS) spectroscopy and X-ray absorption near edge structure (XANES...

  5. Simple convergent-nozzle aerosol injector for single-particle diffractive imaging with X-ray free-electron lasers

    Directory of Open Access Journals (Sweden)

    R. A. Kirian

    2015-07-01

    Full Text Available A major challenge in high-resolution x-ray free-electron laser-based coherent diffractive imaging is the development of aerosol injectors that can efficiently deliver particles to the peak intensity of the focused X-ray beam. Here, we consider the use of a simple convergent-orifice nozzle for producing tightly focused beams of particles. Through optical imaging we show that 0.5 μm particles can be focused to a full-width at half maximum diameter of 4.2 μm, and we demonstrate the use of such a nozzle for injecting viruses into a micro-focused soft-X-ray FEL beam.

  6. X-ray filter for x-ray powder diffraction

    Science.gov (United States)

    Sinsheimer, John Jay; Conley, Raymond P.; Bouet, Nathalie C. D.; Dooryhee, Eric; Ghose, Sanjit

    2018-01-23

    Technologies are described for apparatus, methods and systems effective for filtering. The filters may comprise a first plate. The first plate may include an x-ray absorbing material and walls defining first slits. The first slits may include arc shaped openings through the first plate. The walls of the first plate may be configured to absorb at least some of first x-rays when the first x-rays are incident on the x-ray absorbing material, and to output second x-rays. The filters may comprise a second plate spaced from the first plate. The second plate may include the x-ray absorbing material and walls defining second slits. The second slits may include arc shaped openings through the second plate. The walls of the second plate may be configured to absorb at least some of second x-rays and to output third x-rays.

  7. X-ray diffraction studies of NbTe2 single crystal

    Indian Academy of Sciences (India)

    Unknown

    Transition metal dichalcogenides; NbTe2 single crystal; EDAX; XRD. 1. Introduction. NbTe2 is a member of transition metal dichalcogenides group, which possesses layered structure. The TMDC group attracted many research workers on account of the inter- esting properties of the compounds of this family (Dimi- gen et al ...

  8. X-ray diffraction study of Nd2CuO4 single crystals at 20 K

    International Nuclear Information System (INIS)

    Makarova, I.P.; Simonov, V.I.; Blomberg, M.K.; Merisalo, M.J.

    1996-01-01

    Single crystals of Nd 2 CuO 4 , a parent compound for the electron-doped high-T c superconductors, have been studied using X-ray diffraction data collected at 20 K. Structure refinements indicated that the specimen was nonstoichiometric, with the approximate formula Nd 1.89 CuO 3.85 . Difference Fourier maps showed significant residual peaks around the Cu and Nd atoms. The residual density around the Cu atom had features characteristic of the valence state +2. Part of the nonspherical effects observed around the Nd atom could be described using the Gram-Charlier series expansion of the Gaussian density function, indicating either static or dynamic displacements of this atom, while part of the residual density was attributed to bonding effects. The bonding of the O(1) atom, located in the plane of the Cu atoms, was found to be different from the bonding of the O(2) atom, situated between the Cu-O(1) layers. (orig.)

  9. High-pressure single-crystal X-ray diffraction of Tl2SeO4

    International Nuclear Information System (INIS)

    Grzechnik, Andrzej; Breczewski, Tomasz; Friese, Karen

    2008-01-01

    The effect of pressure on the crystal structure of thallium selenate (Tl 2 SeO 4 ) (Pmcn, Z=4), containing the Tl + cations with electron lone pairs, has been studied with single-crystal X-ray diffraction in a diamond anvil cell up to 3.64 GPa at room temperature. No phase transition has been observed. The compressibility data are fitted by a Murnaghan equation of state with the zero-pressure bulk modulus B 0 =29(1) GPa and the unit-cell volume at ambient pressure V 0 =529.6(8) A 3 (B'=4.00). Tl 2 SeO 4 is the least compressible in the c direction, while the pressure-induced changes of the a and b lattice parameters are quite similar. These observations can be explained by different pressure effects on the nine- and 11-fold coordination polyhedra around the two non-equivalent Tl atoms. The SeO 4 2- tetrahedra are not rigid units and become more distorted. Their contribution to the compressibility is small. The effect of pressure on the isotypical oxide materials A 2 TO 4 with the β-K 2 SO 4 structure is discussed. It appears that the presence of electron lone pairs on the Tl + cation does not seem to influence the compressibility of Tl 2 SeO 4 . - Graphical abstract: Pressure dependence of normalized lattice parameters and unit-cell volumes in Tl 2 SeO 4 (Pmcn, Z=4). The solid line is the Murnaghan equation of state

  10. Polarisation resonance in X-ray diffraction

    International Nuclear Information System (INIS)

    Goodman, P.; Paterson, D.; Matheson, S.

    1994-01-01

    The study of crystal structures by means of dynamic X-ray diffraction has placed a challenge to theoreticians to revise the X-ray diffraction theory based on Maxwell's equation. In this paper the feasibility of using 'polarisation resonance' as a tool in the determination of absolute configuration for asymmetric structures is investigated. Two (left- and right-handed), σ + and σ- , circular polarization states for 3-beam conditions are considered. Moreover, extending interaction into the 3 rd. dimension (normal to the beam) opens the possibility of absolute configuration determination of asymmetric structures in 3 dimensions. The computational scheme used is shown in terms of scattering diagrams. 7 refs., 1 tab., 6 figs

  11. Basic of X-ray diffraction

    International Nuclear Information System (INIS)

    Giacovazzo, C.

    1996-01-01

    The basic concepts of X-ray diffraction may be more easily understood if it is made preliminary use of a mathematical background. In these pages the authors will first define the delta function and its use for the representation of a lattice. Then the concepts of Fourier transform and convolution are given. At the end of this talk one should realize that a crystal is the convolution of the lattice with a function representing the content of the unit cell

  12. Basic of X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Giacovazzo, C. [Bari Univ. (Italy). Dip. Geomineralogico

    1996-09-01

    The basic concepts of X-ray diffraction may be more easily understood if it is made preliminary use of a mathematical background. In these pages the authors will first define the delta function and its use for the representation of a lattice. Then the concepts of Fourier transform and convolution are given. At the end of this talk one should realize that a crystal is the convolution of the lattice with a function representing the content of the unit cell.

  13. Solvent exchange in a metal-organic framework single crystal monitored by dynamic in situ X-ray diffraction.

    Science.gov (United States)

    Cox, Jordan M; Walton, Ian M; Bateman, Gage; Benson, Cassidy A; Mitchell, Travis; Sylvester, Eric; Chen, Yu Sheng; Benedict, Jason B

    2017-08-01

    Understanding the processes by which porous solid-state materials adsorb and release guest molecules would represent a significant step towards developing rational design principles for functional porous materials. To elucidate the process of liquid exchange in these materials, dynamic in situ X-ray diffraction techniques have been developed which utilize liquid-phase chemical stimuli. Using these time-resolved diffraction techniques, the ethanol solvation process in a flexible metal-organic framework [Co(AIP)(bpy) 0.5 (H 2 O)]·2H 2 O was examined. The measurements provide important insight into the nature of the chemical transformation in this system including the presence of a previously unreported neat ethanol solvate structure.

  14. X-ray diffraction and chemical bonding

    International Nuclear Information System (INIS)

    Bats, J.W.

    1976-01-01

    Chemical bonds are investigated in sulfamic acid (H 3 N-SO 3 ), sodium sulfonlate dihydrate (H 2 NC 6 H 4 SO 3 Na.2H 2 O), 2,5-dimercaptothiadiazole (HS-C 2 N 2 S-SH), sodium cyanide dihydrate (NaCN.2H 2 O), sodium thiocyanate (NaSCN) and ammonium thiocyanate (NH 4 SCN) by X-ray diffraction, and if necessary completed with neutron diffraction. Crystal structures and electron densities are determined together with bond length and angles. Also the effects of thermal motion are discussed

  15. A super-high angular resolution principle for coded-mask X-ray imaging beyond the diffraction limit of a single pinhole

    International Nuclear Information System (INIS)

    Zhang Chen; Zhang Shuangnan

    2009-01-01

    High angular resolution X-ray imaging is always useful in astrophysics and solar physics. In principle, it can be performed by using coded-mask imaging with a very long mask-detector distance. Previously, the diffraction-interference effect was thought to degrade coded-mask imaging performance dramatically at the low energy end with its very long mask-detector distance. The diffraction-interference effect is described with numerical calculations, and the diffraction-interference cross correlation reconstruction method (DICC) is developed in order to overcome the imaging performance degradation. Based on the DICC, a super-high angular resolution principle (SHARP) for coded-mask X-ray imaging is proposed. The feasibility of coded mask imaging beyond the diffraction limit of a single pinhole is demonstrated with simulations. With the specification that the mask element size is 50 x 50 μm 2 and the mask-detector distance is 50 m, the achieved angular resolution is 0.32 arcsec above about 10 keV and 0.36 arcsec at 1.24 keV (λ = 1 nm), where diffraction cannot be neglected. The on-axis source location accuracy is better than 0.02 arcsec. Potential applications for solar observations and wide-field X-ray monitors are also briefly discussed. (invited reviews)

  16. An in-situ X-ray diffraction study on the electrochemical formation of PtZn alloys on Pt(1 1 1) single crystal electrode

    Energy Technology Data Exchange (ETDEWEB)

    Drnec, J., E-mail: drnec@esrf.fr [ESRF, Grenoble (France); Bizzotto, D. [Department of Chemistry, AMPEL, University of British Columbia, Vancouver, BC (Canada); Carlà, F. [ESRF, Grenoble (France); Fiala, R. [Charles University, Faculty of Mathematics and Physics, Prague (Czech Republic); Sode, A. [Ruhr-Universität Bochum, Bochum (Germany); Balmes, O.; Detlefs, B.; Dufrane, T. [ESRF, Grenoble (France); Felici, R., E-mail: felici@esrf.fr [ESRF, Grenoble (France)

    2015-11-01

    Highlights: • PtZn electrochemical alloying is observed on single crystal Pt electrodes. • In-situ X-ray characterization during alloy formation and dissolution is provided. • Structural model of the surface during alloying and dissolution is discussed. • X-ray based techniques can be used in in-operando studies of bimetallic fuel cell catalysts. - Abstract: The electrochemical formation and dissolution of the oxygen reduction reaction (ORR) PtZn catalyst on Pt(1 1 1) surface is followed by in-situ X-ray diffraction (XRD) and X-ray reflectivity (XRR) measurements. When the crystalline Pt surface is polarized to sufficiently negative potential values, with respect to an Ag/AgCl|KCl reference electrode, the electrodeposited zinc atoms diffuse into the bulk and characteristic features are observed in the X-ray patterns. The surface structure and composition during deposition and dissolution is determined from analysis of XRR curves and measurements of crystal truncation rods. Thin Zn-rich surface layer is present during the alloy formation while a Zn-depleted layer forms during dissolution.

  17. GROWTH AND CHARACTERIZATION OF Eu DOPED GaSe SINGLE CRYSTALS BY X-RAY DIFFRACTION AND RAMAN SPECTROSCOPY

    Directory of Open Access Journals (Sweden)

    Dumitru UNTILA

    2017-08-01

    Full Text Available GaSe single crystals doped with Eu (0.025, 0.05, 0.5, 1.0 and 3.0 at% were grown by Bridgman method using Ga, Se and Eu elementary components. The crystalline structure and vibration modes of the GaSe: Eu crystals lattice were studied by X-ray diffraction and Raman spectroscopy. Eu atoms arranged in the van der Waals space of GaSe: Eu crystals form Eu-Se valence bonds and restructure hexagonal lattice of GaSe leading to EuGa2Se4 crystallites formation. Defects generated by EuGa2Se4 crystallites lead to broadening and shifting of single phonon peaks present in Raman spectra towards shorter wavenumbers, and at the same time, activate the longitudinal optical vibrations of EuSe sublattice.Keywords: GaSe, doping, Eu, XRD, Raman. CREȘTEREA ȘI CARACTERIZAREA MONOCRISTALELOR DE GaSe: Eu PRIN DIFRACȚIA RAZELOR X ȘI SPECTROSCOPIA RAMANMonocristalele de GaSe nedopate și dopate cu Eu în cantități de 0.025, 0.05, 0.5, 1.0 și 3.0% at. au fost crescute prin metoda Bridgman din componente elementare Ga, Se și Eu. Structura cristalină și modelele de vibrație a rețelei crista­lelor de GaSe:Eu au fost studiate prin difracția razelor X și spectroscopia Raman. Atomii de Eu localizați în spaţiul van der Waals al cristalelor de GaSe:Eu creează legături de valență Eu-Se și restructurează rețeaua hexagonală a compusului GaSe, conducând la formarea cristalitelor de EuGa2Se4. Defectele generate de cristalitele de EuGa2Se4 duc la lărgirea și deplasarea benzilor monofononice de difuzie Raman spre numere de undă mici și, totodată, activează vibraţiile optice longitudinale ale subreţelei EuSe.Cuvinte-cheie: GaSe, dopare, Eu, XRD, Raman.

  18. Structural characterization of Li1.2 v3o8 insertion electrodes by single-crystal x-ray-diffraction

    CSIR Research Space (South Africa)

    De Picciotto, LA

    1993-08-01

    Full Text Available The crystal structures of Li1.2 V3O8 and a lithiated product Li4.0V3O8 have been determined by single-crystal X-ray diffraction methods. The structure refinement of Li1.2 V308 confirms that of Li1+xV3O8(x almost-equal-to 0) reported by Wadsley thirty...

  19. Equatorial x-ray diffraction from single skinned rabbit psoas fibers at various degrees of activation. Changes in intensities and lattice spacing.

    OpenAIRE

    Brenner, B; Yu, L C

    1985-01-01

    Equatorial x-ray diffraction patterns were obtained from single skinned rabbit psoas fibers during various degrees of activation under isometric conditions at ionic strength 170 mM and 6-9 degrees C. By direct calcium activation, contraction was homogeneous throughout the preparation, and by using a cycling technique (Brenner, 1983) integrity of the fiber was maintained even during prolonged steady activation. The intensity ratio of the two innermost reflections I11/I10, and the normalized in...

  20. Coherent X-ray diffraction studies of mesoscopic materials

    International Nuclear Information System (INIS)

    Shabalin, Anatoly

    2015-12-01

    This thesis is devoted to three separate projects, which can be considered as independent. First, the dynamical scattering effects in the Coherent X-ray Diffractive Imaging (CXDI) method are discussed. Based on the simulation results, a straightforward method for correction for the refraction and absorption artifacts in the Bragg CXDI reconstruction is suggested. The second part summarizes the results of an Coherent X-ray Diffractive Imaging experiment with a single colloidal crystal grain. A remarkable result is that positions of individual particles in the crystal lattice have been resolved in three dimensions. The third project is devoted to X-ray diffraction experimental studies of structural evolution of colloidal crystalline films upon incremental heating. Based on the results of the analysis a model of structural evolution of a colloidal crystal upon heating on nanoscopic and mesoscopic length scales is suggested.

  1. Single crystalline and rare earth substituted La2RuO5 investigated by x-ray diffraction and EXAFS spectroscopy

    Science.gov (United States)

    Riegg, S.; Reller, A.; Ebbinghaus, S. G.

    2012-04-01

    Single crystals of La2RuO5 were obtained from a BaCl2 flux. The structure was determined by single crystal x-ray diffraction and compared to earlier x-ray and neutron powder diffraction results. The local structures of Ru and La/Ln in pure La2RuO5 and the rare earth substituted LaLnxRuO5 (Ln=Pr, Nd, Sm, Gd, Dy) polycrystalline samples were determined from the extended x-ray absorption fine structures (EXAFS) of the K- and LIII-edges of Ru, La, and Ln, respectively. A four shell model was developed to reduce the number of refinable parameters in the fit of the EXAFS spectra. The distribution of the Ln-ions in the layered crystal structure was determined by a comparison of the coordination spheres obtained from the Ln-edges with the unsubstituted La2RuO5. Interatomic distances were compared to the values obtained from the single crystal diffraction and were found to agree very well.

  2. Gas multidetector for neutron and X-ray diffraction studies

    International Nuclear Information System (INIS)

    Allemand, R.

    1975-01-01

    In the context of nuclear imagery research the LETI is studying neutron, X-ray and γ-ray localisation detectors, the fields of application being neutron diffraction, X-ray diffraction and nuclear medicine. This report deals only with gas localisation methods, describing the physical results obtained in neutron and X-ray diffraction [fr

  3. New progress on monolithic X-ray lens in diffraction application

    International Nuclear Information System (INIS)

    Li Yude; He Yejun; Chen Jun; Luo Ping; Wang Dachun; Yan Yiming

    1999-12-01

    The basic physical properties for monolithic X-ray lens are introduced. The X-ray diffraction for macromolecular crystallography using monolithic X-ray lens were investigated. The experimental results show that in the same X-ray source power the diffracted intensity in the condition with X-ray lens was increased about 7 times, and the resolution was improved by 0.2 x 10 -10 -0.6 x 10 -10 m. The signal to noise ratio was also improved, and the time of measurement was reduced. The X-ray diffraction of Au thin films on the Si(100) single crystal substrates were investigated in a X-ray powder diffractometer. The experimental results show that in the same X-ray source power the diffracted intensity in the condition with X-ray lens was increased about 2 times, and the angular resolution of the diffractometer was enhanced

  4. Focal construct geometry for high intensity energy dispersive x-ray diffraction based on x-ray capillary optics

    Energy Technology Data Exchange (ETDEWEB)

    Li, Fangzuo; Liu, Zhiguo; Sun, Tianxi, E-mail: stx@bnu.edu.cn; Jiang, Bowen; Zhu, Yu [The Key Laboratory of Beam Technology and Materials Modification of the Ministry of Education, Beijing Normal University, Beijing 100875 (China); College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China)

    2016-03-14

    We presented a focal construct geometry (FCG) method for high intensity energy dispersive X-ray diffraction by utilizing a home-made ellipsoidal single-bounce capillary (ESBC) and a polycapillary parallel X-ray lens (PPXRL). The ESBC was employed to focus the X-rays from a conventional laboratory source into a small focal spot and to produce an annular X-ray beam in the far-field. Additionally, diffracted polychromatic X-rays were confocally collected by the PPXRL attached to a stationary energy-resolved detector. Our FCG method based on ESBC and PPXRL had achieved relatively high intensity diffraction peaks and effectively narrowed the diffraction peak width which was helpful in improving the potential d-spacing resolution for material phase analysis.

  5. X-ray microimaging by diffractive techniques

    Energy Technology Data Exchange (ETDEWEB)

    Kirz, Janos; Jacobsen, Chris

    2001-07-31

    The report summarizes the development of soft x-ray microscopes at the National Synchrotron Light Source X-1A beamline. We have developed a soft x-ray microscopy beamline (X-1A) at the National Synchrotron Light Source at Brookhaven National Laboratory. This beamline has been upgraded recently to provide two endstations dedicated to microscopy experiments. One endstation hosts a brand new copy of the redesigned room temperature scanning x-ray microscope (STXM), and the other end station hosts a cryo STXM and the original redesigned room temperature microscope, which has been commissioned and has started operation. Cryo STXM and the new microscope use the same new software package, running under the LINUX operating system. The new microscope is showing improved image resolution and extends spectromicroscopy to the nitrogen, oxygen and iron edges. These microscopes are used by us, and by users of the facility, to image hydrated specimens at 50 nm or better spatial resolution and with 0.1-0.5 eV energy resolution. This allows us to carry out chemical state mapping in biological, materials science, and environmental and colloidal science specimens. In the cryo microscope, we are able to do chemical state mapping and tomography of frozen hydrated specimens, and this is of special importance for radiation-sensitive biological specimens. for spectromicroscopic analysis, and methods for obtaining real-space images from the soft x-ray diffraction patterns of non-crystalline specimens. The user program provides opportunities for collaborators and other groups to exploit the techniques available and to develop them further. We have also developed new techniques such as an automated method for acquiring ''stacks'' of images.

  6. Quantitative Imaging of Single, Unstained Viruses with Coherent X Rays

    International Nuclear Information System (INIS)

    Song Changyong; Jiang Huaidong; Mancuso, Adrian; Amirbekian, Bagrat; Miao Jianwei; Peng Li; Sun Ren; Shah, Sanket S.; Zhou, Z. Hong; Ishikawa, Tetsuya

    2008-01-01

    We report the recording and reconstruction of x-ray diffraction patterns from single, unstained viruses, for the first time. By separating the diffraction pattern of the virus particles from that of their surroundings, we performed quantitative and high-contrast imaging of a single virion. The structure of the viral capsid inside a virion was visualized. This work opens the door for quantitative x-ray imaging of a broad range of specimens from protein machineries and viruses to cellular organelles. Moreover, our experiment is directly transferable to the use of x-ray free electron lasers, and represents an experimental milestone towards the x-ray imaging of large protein complexes

  7. X-ray diffraction imaging of material microstructures

    KAUST Repository

    Varga, Laszlo

    2016-10-20

    Various examples are provided for x-ray imaging of the microstructure of materials. In one example, a system for non-destructive material testing includes an x-ray source configured to generate a beam spot on a test item; a grid detector configured to receive x- rays diffracted from the test object; and a computing device configured to determine a microstructure image based at least in part upon a diffraction pattern of the x-rays diffracted from the test object. In another example, a method for determining a microstructure of a material includes illuminating a beam spot on the material with a beam of incident x-rays; detecting, with a grid detector, x-rays diffracted from the material; and determining, by a computing device, a microstructure image based at least in part upon a diffraction pattern of the x-rays diffracted from the material.

  8. Radial composition of single InGaN nanowires: a combined study by EDX, Raman spectroscopy, and X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gomez, M.; Garro, N.; Cantarero, A. [Institut de Ciencia dels Materials, Universitat de Valencia, Paterna (Spain); Segura-Ruiz, J.; Martinez-Criado, G.; Chu, M.H. [European Synchrotron Radiation Facility, Experiments Division, Grenoble (France); Denker, C.; Malindretos, J.; Rizzi, A. [IV. Physikalisches Institut, Georg-August-Universitaet Goettingen (Germany)

    2013-10-15

    The radial alloy distribution of In{sub x} Ga{sub 1-x}N nanowires grown by plasma-assisted molecular beam epitaxy has been investigated by three different techniques with nanometric spatial resolution and capability to study single nanowires. Energy-dispersive X-ray spectroscopy radial line-scans revealed a gradient in the alloy composition of individual nanowires. Resonant Raman scattering and spatially resolved X-ray diffraction showed the existence of three distinctive regions with different alloy composition. The combination of the three techniques provides robust evidence of the spontaneous formation of a core-shell structure with a thin Ga-richer shell wrapping an In-rich core at the bottom part of the nanowires. This composition-modulated nanostructure offers an attractive way to explore new device concepts in fully epitaxial nanowire-based solar cells. (copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  9. Radial composition of single InGaN nanowires: a combined study by EDX, Raman spectroscopy, and X-ray diffraction

    International Nuclear Information System (INIS)

    Gomez-Gomez, M.; Garro, N.; Cantarero, A.; Segura-Ruiz, J.; Martinez-Criado, G.; Chu, M.H.; Denker, C.; Malindretos, J.; Rizzi, A.

    2013-01-01

    The radial alloy distribution of In x Ga 1-x N nanowires grown by plasma-assisted molecular beam epitaxy has been investigated by three different techniques with nanometric spatial resolution and capability to study single nanowires. Energy-dispersive X-ray spectroscopy radial line-scans revealed a gradient in the alloy composition of individual nanowires. Resonant Raman scattering and spatially resolved X-ray diffraction showed the existence of three distinctive regions with different alloy composition. The combination of the three techniques provides robust evidence of the spontaneous formation of a core-shell structure with a thin Ga-richer shell wrapping an In-rich core at the bottom part of the nanowires. This composition-modulated nanostructure offers an attractive way to explore new device concepts in fully epitaxial nanowire-based solar cells. (copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Revisiting the I{\\overline {\\bf 1}} structures of high-temperature Ca-rich plagioclase feldspar - a single-crystal neutron and X-ray diffraction study.

    Science.gov (United States)

    Jin, Shiyun; Wang, Xiaoping; Xu, Huifang

    2018-04-01

    The I{\\overline 1} structures of four natural Ca-rich plagioclase feldspars formed at high temperature were analysed using single-crystal neutron and X-ray diffraction. The neutron time-of-flight Laue diffractometer at the ORNL Spallation Neutron Source (Tennessee, USA) combined with a single-crystal X-ray diffraction instrument were able to reveal some new details about these already intensively studied structures. The split oxygen atoms refined from the neutron diffraction data show the underlying mechanism of Ca-Na ordering and the anisotropic P{\\overline 1} ordering along the c-axis. The compositional ranges covered by the samples studied are quite rare for I{\\overline 1} structures. The incommensurately modulated e2 structure of some plagioclase samples can easily be confused with an I{\\overline 1} structure from the diffraction pattern, which puts some previously published I{\\overline 1} structures into question. An incomplete phase diagram for Ca-rich plagioclase feldspar is proposed to explain the rarity of the I{\\overline 1} structure in this compositional range, and a time-temperature-transformation diagram for the composition ∼An 66 is provided accordingly.

  11. X-ray diffraction of modulated structures

    International Nuclear Information System (INIS)

    Tsujimoto, T.; Hashimoto, K.; Saito, K.

    1977-01-01

    Modulated structures are regarded as a macrolattice, in which each lattice point is a ''unit region of concentration variation'' (abbreviated to ''unit region'') and an average lattice parameter is Qa 0 . The X-ray intensity diffracted from modulated structures, I/sub m(s) is given by I/sub m(s). I/sub d/(s). I/sub u/(s) is the scattering intensity from the ''unit region'' and I/sub u/(s) is that from the imaginary macrolattice in which each lattice point is the unit scattering factor. A region containing one zone-complex has been chosen as the ''unit region'' and the effects of the lattice spacing of the macrolattice and its disturbance on diffraction patterns have been discussed. When zone-complexes are small, I/sub m(s) is dominated by I/sub d/(s) and peaks of I/sub d/(s) are observed as side-bands or additional diffraction lines. The number of additional diffraction lines increases with an increase in Qa 0 and typical side-bands appear at a stage of this process. When the periodicity of the macrolattice is distrubed deeply or Qa 0 is large, I/sub u/(s) is observed directly as diffraction effects. The present theory explains reasonably the asymmetry of side-bands in position, the movement of main diffraction line with aging and the change of side-bands into diffraction lines of metastable phases during aging

  12. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    Powder X-ray diffraction studies were carried out on doped lithium niobate for phase identification. High-resolution X-ray diffraction technique was used to study the crystalline quality through full-width at half-maximum values. The refractive index values are more for doped samples than for pure sample as determined by ...

  13. High resolution in-situ x-ray diffraction of single carbon fibres at high loads and temperatures up to 1800oC

    International Nuclear Information System (INIS)

    Rennhofer, H.; Puchegger, S.; Pabisch, S.; Weinberger, M.; Peterlik, H.; Loidl, D.; Paris, O.

    2008-01-01

    Full text: A specially designed test equipment has been developed to perform in-situ x-ray diffraction experiments of single carbon fibres (HTA 5131, diameter 7 microns) with simultaneously applying high loads and temperatures up to 1800 o C. The test equipment operates in vacuum (pressure -4 mbar) and direct heating with cold grips is used. The structural change of the nm-wide crystallites, in particular with respect to their size, orientation and lattice parameters is followed in dependence on load and temperature. The results are compared to similar experiments on fiber-bundles, which were performed in the laboratory equipment. (author)

  14. Organobase catalyzed 1,4-conjugate addition of 4-hydroxycoumarin on chalcones: Synthesis, NMR and single-crystal X-ray diffraction studies of novel warfarin analogues

    Science.gov (United States)

    Talhi, Oualid; Fernandes, José A.; Pinto, Diana C. G. A.; Almeida Paz, Filipe A.; Silva, Artur M. S.

    2015-08-01

    The synthesis of a new series of warfarin analogues by convenient organobase catalyzed 1,4-conjugate addition of 4-hydroxycoumarin to chalcone derivatives is described. 1H NMR spectroscopy evidenced the presence of a predominant acyclic open-form together with the cyclic hemiketal tautomers of the resulting Michael adducts. The acyclic open-form has been unequivocally proved by single-crystal X-ray diffraction analysis. The use of the B ring ortho-hydroxychalcone synthons in this reaction has led to a diastereoselective synthesis of warfarin bicyclo[3.3.1]nonane ketal derivatives.

  15. Low-temperature single crystal X-ray diffraction and high-pressure Raman studies on [(CH 3) 2NH 2] 2[SbCl 5

    Science.gov (United States)

    Bujak, Maciej; Angel, Ross J.

    2007-11-01

    The structure of bis(dimethylammonium) pentachloroantimonate(III), [(CH 3) 2NH 2] 2[SbCl 5], BDP, was studied at 15 K and ambient pressure by single-crystal X-ray diffraction as well as at ambient temperature and high pressures up to 4.87(5) GPa by Raman spectroscopy. BDP crystallizes in the orthorhombic Pnma space group with a=8.4069(4), b=11.7973(7), c=14.8496(7) Å, and Z=4; R1=0.0381, w R2=0.0764. The structure consists of distorted [SbCl 6] 3- octahedra forming zig-zag [{SbCl 5} n] 2 n- chains that are cross-linked by dimethylammonium [(CH 3) 2NH 2] + cations. The organic and inorganic substructures are bound together by the N-H…Cl hydrogen bonds. The distortions of [SbCl 6] 3- units increase, partly due to the influence of the hydrogen bonds which became stronger, with decreasing temperature. The preliminary room temperature, high-pressure X-ray diffraction experiments suggest that BDP undergoes a first-order phase transition below ca. 0.44(5) GPa that destroys single-crystal samples. The transition is accompanied by changes in the intensities and positions of the Raman lines below 400 cm -1.

  16. 100 years of discovery of X-ray diffraction

    International Nuclear Information System (INIS)

    Zhang Tao

    2012-01-01

    X-ray diffraction was discovered by Max von Laue a hundred years ago. Later, through the work of William H. Bragg and William L. Bragg, an experimental analysis method was developed to solve the structure of molecules at the atomic level. Over the past hundred years, science and technology has been dramatically changed by X-ray diffraction analysis, which has also undergone considerable development. The recent emergence of hard X-ray free electron lasers has provided a new dimension for X-ray diffraction analysis, promising even greater progress in the fields of physics, chemistry and biology. (author)

  17. Temperature dependent resonant X-ray diffraction of single-crystalline Ge2Sb2Te5

    OpenAIRE

    Urban, Philipp; Schneider, Matthias N.; Erra, Loredana; Welzmiller, Simon; Fahrnbauer, Felix; Oeckler, Oliver

    2013-01-01

    The element distribution in the crystal structure of the stable phase of the well-known phase-change material Ge2Sb2Te5 was determined at temperatures up to 471 degrees C using single crystals synthesized by chemical transport reactions. Because of the similar electron count of Sb and Te, the scattering contrast was enhanced by resonant diffraction using synchrotron radiation (beamline ID11, ESRF). A simultaneous refinement on data measured at the K-absorption edges of Sb and Te as well as at...

  18. Purification, crystallization, X-ray diffraction analysis and phasing of an engineered single-chain PvuII restriction endonuclease

    Energy Technology Data Exchange (ETDEWEB)

    Meramveliotaki, Chrysi [Department of Science, Agricultural University of Athens, Athens (Greece); Department of Biology, University of Crete, PO Box 2208, GR-71110 Heraklion, Crete (Greece); Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Department of Agricultural Biotechnology, Agricultural University of Athens, Athens (Greece); Kotsifaki, Dina [Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Androulaki, Maria [Department of Science, Agricultural University of Athens, Athens (Greece); Department of Biology, University of Crete, PO Box 2208, GR-71110 Heraklion, Crete (Greece); Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Department of Agricultural Biotechnology, Agricultural University of Athens, Athens (Greece); Hountas, Athanasios [Department of Science, Agricultural University of Athens, Athens (Greece); Eliopoulos, Elias [Department of Agricultural Biotechnology, Agricultural University of Athens, Athens (Greece); Kokkinidis, Michael, E-mail: kokkinid@imbb.forth.gr [Department of Biology, University of Crete, PO Box 2208, GR-71110 Heraklion, Crete (Greece); Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Department of Science, Agricultural University of Athens, Athens (Greece)

    2007-10-01

    PvuII is the first type II restriction endonuclease to be converted from its wild-type homodimeric form into an enzymatically active single-chain variant. The enzyme was crystallized and phasing was successfully performed by molecular replacement. The restriction endonuclease PvuII from Proteus vulgaris has been converted from its wild-type homodimeric form into the enzymatically active single-chain variant scPvuII by tandemly joining the two subunits through the peptide linker Gly-Ser-Gly-Gly. scPvuII, which is suitable for the development of programmed restriction endonucleases for highly specific DNA cleavage, was purified and crystallized. The crystals diffract to a resolution of 2.35 Å and belong to space group P4{sub 2}, with unit-cell parameters a = b = 101.92, c = 100.28 Å and two molecules per asymmetric unit. Phasing was successfully performed by molecular replacement.

  19. X-ray diffraction contrast tomography (DCT) system, and an X-ray diffraction contrast tomography (DCT) method

    DEFF Research Database (Denmark)

    2012-01-01

    Source: US2012008736A An X-ray diffraction contrast tomography system (DCT) comprising a laboratory X-ray source (2), a staging device (5) rotating a polycrystalline material sample in the direct path of the X-ray beam, a first X-ray detector (6) detecting the direct X-ray beam being transmitted ...... in the polycrystalline sample is determined based on the two-dimensional position of extinction spots and the associated angular position of the sample for a set of extinction spots pertaining to the individual grain....

  20. Thin film characterisation by advanced X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Cappuccio, G.; Terranova, M.L.

    1996-09-01

    The Fifth School on X-ray diffraction from polycrystalline materials was devoted to thin film characterization by advanced X-ray diffraction techniques. Twenty contributions are contained in this volume; all twenty are recorded in the INIS Database. X-ray diffraction is known to be a powerful analytical tool for characterizing materials and understanding their structural features. The aim of these articles is to illustrate the fundamental contribution of modern diffraction techniques (grazing incidence, surface analysis, standing waves, etc.) to the characterization of thin and ultra-thin films, which have become important in many advanced technologies

  1. X-ray Microprobe for Fluorescence and Diffraction Analysis

    International Nuclear Information System (INIS)

    Ice, G.E.

    2005-01-01

    X-ray diffraction (see unit 1.1) and x-ray excited fluorescence analysis are powerful techniques for the nondestructive measurement of crystal structure and chemical composition. X-ray fluorescence analysis is inherently nondestructive with orders of magnitude lower power deposited for the same detectable limit as with fluorescence excited by charged particle probes (Sparks, 1980). X-ray diffraction analysis is sensitive to crystal structure with orders-of-magnitude greater sensitivity to crystallographic strain than electron probes (Rebonato, et al. 1989). When a small-area x-ray microbeam is used as the probe, chemical composition (Z>14), crystal structure, crystalline texture, and crystalline strain distributions can be determined. These distributions can be studied both at the surface of the sample and deep within the sample (Fig. 1). Current state-of-the-art can achieve an ∼1 mm-D x-ray microprobe and an ∼0.1 mm-D x-ray microprobe has been demonstrated (Bilderback, et al., 1994). Despite their great chemical and crystallographic sensitivities, x-ray microprobe techniques have until recently been restricted by inefficient x-ray focusing optics and weak x-ray sources; x-ray microbeam analysis was largely superseded by electron techniques in the 50's. However, interest in x-ray microprobe techniques has now been revived (Howells, et al., 1983; Ice and Sparks, 1984; Chevallier, et al., 1997; Riekel 1992; Thompson, el al., 1992; and Making and Using... 1997) by the development of efficient x-ray focusing optics and ultra-high intensity synchrotron x-ray sources (Buras and Tazzari, 1984; Shenoy, et al., 1988). These advances have increased the achievable microbeam flux by more than 11 orders of magnitude (Fig. 2) (Ice, 1997); the flux in a tunable 1 mm-D beam on a 'so called' 3rd-generation synchrotron source such as the APS can exceed the flux in a fixed-energy mm2 beam on a conventional source. These advances make x-ray microfluorescence and x-ray

  2. The accuracy of the crystal chemical parameters at high-pressure conditions from single-crystal X-ray diffraction in diamond-anvil cell

    DEFF Research Database (Denmark)

    Periotto, Benedetta

    applications also in the materials science as it can provide useful information about the properties and performance of new materials. Over the past decades, the research in this field has been strongly developed due to the advances in computer capabilities and to the technological improvements of X......-ray instruments. At the same time, the high-pressure experiments have benefited by the strong improvements on the high-pressure devices, in particular the diamond-anvil cell (DAC). The aim of this research project is to assess the quality of the data obtained by means of the single-crystal X-ray diffraction...... started with a comparison between two different DACs, in order to define the capabilities of one of the most common types of pressure device, the ETH-type DAC. Application examples of data quality analysis have been conducted on pyroxenes (NaInSi2O6, orthoenstatite MgSiO3 and LiCrSi2O6), which...

  3. Intergrown new zeolite beta polymorphs with interconnected 12-ring channels solved by combining electron crystallography and single-crystal X-ray diffraction

    KAUST Repository

    Yu, Zhengbao

    2012-10-09

    Two new polymorphs of zeolite beta, denoted as SU-78A and SU-78B, were synthesized by employing dicyclohexylammonium hydroxides as organic structure-directing agents. The structure was solved by combining transmission electron microscopy and single-crystal X-ray diffraction. SU-78 is an intergrowth of SU-78A and SU-78B and contains interconnected 12-ring channels in three directions. The two polymorphs are built from the same building layer, similar to that for the zeolite beta family. The layer stacking in SU-78, however, is different from those in zeolite beta polymorph A, B, and C, showing new zeolite framework topologies. SU-78 is thermally stable up to 600 °C. © 2012 American Chemical Society.

  4. Single-crystal X-ray diffraction study of SrGeO3 high-pressure perovskite phase at 100 K

    Science.gov (United States)

    Nakatsuka, Akihiko; Arima, Hiroshi; Ohtaka, Osamu; Fujiwara, Keiko; Yoshiasa, Akira

    2017-10-01

    Single-crystal X-ray diffraction study of SrGeO3 perovskite (cubic; space group Pmɜ¯m) synthesized at 6 GPa and 1223 K was conducted at a low temperature of 100 K. The residual electron density revealed the presence of the bonding electron at the center of the Ge-O bond, in accordance with our previous conclusion that the Ge-O bond is strongly covalent. From comparison with our previous structure-refinement result at 296 K, the mean square displacement (MSD) of the O atom in the direction of the Ge-O bond is suggested to exhibit no significant temperature dependence, in contrast to that in the direction perpendicular to the bond. Thus, the strong covalency of the Ge-O bond can have a large influence on the temperature dependence of thermal vibration of the O atom.

  5. X-ray and neutron diffraction in the study of organic crystalline hydrates.

    OpenAIRE

    Fucke, K.; Steed, J.W.

    2010-01-01

    A review. Diffraction methods are a powerful tool to investigate the crystal structure of organic compounds in general and their hydrates in particular. The laboratory standard technique of single crystal X-ray diffraction gives information about the molecular conformation, packing and hydrogen bonding in the crystal structure, while powder X-ray diffraction on bulk material can trace hydration/dehydration processes and phase transitions under non-ambient conditions. Neutron diffraction is a ...

  6. Preparation of specimens for analysis by: X-ray diffraction and X-ray fluorescence analysis

    International Nuclear Information System (INIS)

    Banos L, L.

    2004-01-01

    Specimen preparation is one of the most important requirements in the analysis of samples by X-ray Diffraction and X-ray Fluorescence. This statement is especially true for samples containing different types of materials. There are many forms of specimen suitable for X-ray analysis and the type of the sample as received will generally determine the method of pretreatment. It is convenient to refer to the material received for analysis as the sample, and that, which is actually analyzed as the specimen. The powder Diffraction method assumes that the particles in the specimen are ideally random orientation and that there are enough crystallites in the specimen to achieve a representative intensity distribution for these crystallites. X ray Fluorescence is essentially a comparative method of analysis, it is vital that all standards and unknowns be presented to the spectrometer in a reproducible and identical manner. (Author) 3 refs., 6 figs

  7. Grazing Incidence X-ray Scattering and Diffraction

    Indian Academy of Sciences (India)

    IAS Admin

    tion. In thia article, various aspects of surface X- ray diffraction and scattering are discussed with illustrations of some typical applications of these techniques. 1. ..... ray reflectivity. Here, X-rays are incident on the sample at very small grazing angles to the surface and below the critical angle, αc. As explained earlier, this ...

  8. High-resolution X-ray diffraction studies of multilayers

    DEFF Research Database (Denmark)

    Christensen, Finn Erland; Hornstrup, Allan; Schnopper, H. W.

    1988-01-01

    High-resolution X-ray diffraction studies of the perfection of state-of-the-art multilayers are presented. Data were obtained using a triple-axis perfect-crystal X-ray diffractometer. Measurements reveal large-scale figure errors in the substrate. A high-resolution triple-axis set up is required...

  9. Hybrid Powder - Single Crystal X-Ray Diffraction Instrument for Planetary Mineralogical Analysis of Unprepared Samples, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a planetary exploration XRD/XRF instrument based on a hybrid diffraction approach that complements powder XRD analysis, similar to that of the...

  10. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    Energy Technology Data Exchange (ETDEWEB)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil; Liu, Zunping; Lang, Keenan; Huang, Xianrong; Wieczorek, Michael; Kasman, Elina; Hammonds, John; Macrander, Albert; Assoufid, Lahsen [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States)

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity and spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.

  11. Fabrication of diffraction X-ray elements

    International Nuclear Information System (INIS)

    Babin, S.V.; Erko, A.I.

    1989-01-01

    The use of focusing elements in the X-ray range shows promise for nondestructive chemical analysis of samples with spatial resolution up to fractions of a μm. This paper considers the problems of fabricating Fresnel zone plates of different types: Amplitude- and phase-transparent zone plates and reflective zone plates formed on a multilayer mirror, as well as microstructures with a specified zone profile. (orig.)

  12. Thin film characterisation by advanced X-ray diffraction techniques

    Energy Technology Data Exchange (ETDEWEB)

    Cappuccio, G.; Terranova, M.L. [eds.] [INFN, Laboratori Nazionali di Frascati, Rome (Italy)

    1996-09-01

    This report described the papers presented at the 5. School on X-ray diffraction from polycrystalline materials held at Frascati (Rome) in 2-5 October 1996. A separate abstract was prepared for each of the papers.

  13. Theory of time-resolved inelastic x-ray diffraction

    DEFF Research Database (Denmark)

    Lorenz, Ulf; Møller, Klaus Braagaard; Henriksen, Niels Engholm

    2010-01-01

    Starting from a general theory of time-resolved x-ray scattering, we derive a convenient expression for the diffraction signal based on a careful analysis of the relevant inelastic scattering processes. We demonstrate that the resulting inelastic limit applies to a wider variety of experimental...... conditions than similar, previously derived formulas, and it directly allows the application of selection rules when interpreting diffraction signals. Furthermore, we present a simple extension to systems simultaneously illuminated by x rays and a laser beam....

  14. Synchrotron x-ray diffraction study of liquid surfaces

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Pershan, P.S.

    1983-01-01

    A spectrometer for X-ray diffraction and refraction studies of horizontal, free surfaces of liquids is described. As an illustration smetic-A layering at the surface of a liquid crystal is presented.......A spectrometer for X-ray diffraction and refraction studies of horizontal, free surfaces of liquids is described. As an illustration smetic-A layering at the surface of a liquid crystal is presented....

  15. X-ray diffraction identification of clay minerals by microcomputer

    International Nuclear Information System (INIS)

    Rodrigues, S.; Imasava, F.J.

    1988-01-01

    The identification of clay minerals by X-ray powder diffraction are done by searching an unknown pattern with a file of standard X-ray diffraction patterns. For this searching done by hand is necessary a long time. This paper shows a program in ''Basic'' language to be utilized in microcomputers for the math of the unknown pattern, using the high velocity of comparison of the microcomputer. A few minutes are used for the match. (author) [pt

  16. Residual stresses analysis by X-ray and neutrons diffraction

    International Nuclear Information System (INIS)

    Lodini, A.; Perrin, M.

    1996-04-01

    This conference is composed of 17 papers grouped in 13 chapters which main themes are: advantages of neutrons and synchrotron radiation for material characterization; residual stress evaluation from micro-deformation measurements in polycrystalline materials; X-ray and neutron diffractometry; residual stress evaluation by X-ray diffraction in extreme surfaces; residual stress diffraction evaluation in monocrystalline nickel base alloys, in polyphasic materials, composite materials, thin films, multilayers and joints; application to thermonuclear reactor components

  17. Aspherical-atom modeling of coordination compounds by single-crystal X-ray diffraction allows the correct metal atom to be identified.

    Science.gov (United States)

    Dittrich, Birger; Wandtke, Claudia M; Meents, Alke; Pröpper, Kevin; Mondal, Kartik Chandra; Samuel, Prinson P; Amin Sk, Nurul; Singh, Amit Pratap; Roesky, Herbert W; Sidhu, Navdeep

    2015-02-02

    Single-crystal X-ray diffraction (XRD) is often considered the gold standard in analytical chemistry, as it allows element identification as well as determination of atom connectivity and the solid-state structure of completely unknown samples. Element assignment is based on the number of electrons of an atom, so that a distinction of neighboring heavier elements in the periodic table by XRD is often difficult. A computationally efficient procedure for aspherical-atom least-squares refinement of conventional diffraction data of organometallic compounds is proposed. The iterative procedure is conceptually similar to Hirshfeld-atom refinement (Acta Crystallogr. Sect. A- 2008, 64, 383-393; IUCrJ. 2014, 1,61-79), but it relies on tabulated invariom scattering factors (Acta Crystallogr. Sect. B- 2013, 69, 91-104) and the Hansen/Coppens multipole model; disordered structures can be handled as well. Five linear-coordinate 3d metal complexes, for which the wrong element is found if standard independent-atom model scattering factors are relied upon, are studied, and it is shown that only aspherical-atom scattering factors allow a reliable assignment. The influence of anomalous dispersion in identifying the correct element is investigated and discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Generation and Stability of the gem-Diol Forms in Imidazole Derivatives Containing Carbonyl Groups. Solid-State NMR and Single-Crystal X-ray Diffraction Studies.

    Science.gov (United States)

    Crespi, Ayelén Florencia; Byrne, Agustín Jesús; Vega, Daniel; Chattah, Ana Karina; Monti, Gustavo Alberto; Lázaro-Martínez, Juan Manuel

    2018-01-18

    The stability of gem-diol forms in imidazolecarboxaldehyde isomers was studied by solid-state nuclear magnetic resonance (ss-NMR) combined with single-crystal X-ray diffraction studies. These methodologies also allowed determining the factors governing the occurrence of such rare functionalization in carbonyl moieties. Results indicated that the position of the carbonyl group is the main factor that governs the generation of geminal diols, having a clear and direct effect on hydration, since, under the same experimental conditions, only 36% of 5-imidazolecarboxaldehydes and 5% of 4-imidazolecarboxaldehydes were hydrated, as compared to 2-imidazolecarboxaldehydes, with which a 100% hydration was achieved. Not only did trifluoroacetic acid favor the addition of water to the carbonyl group but also it allowed obtaining single crystals. Single crystals of the gem-diol and the hemiacetal forms 2-imidazolecarboxaldehyde and N-methyl-2-imidazolecarboxaldehyde, respectively, were isolated and studied through 1 H ss-NMR. Mass spectrometry and solution-state NMR experiments were also performed to study the hydration process.

  19. X-ray diffraction analysis of InAs nanowires

    International Nuclear Information System (INIS)

    Davydok, Anton

    2013-01-01

    Semiconductor nanowires have attracted great interest as building blocks for future electronic and optoelectronic devices. The variability of the growth process opens the opportunity to control and combine the various properties tailoring for specific application. It was shown that the electrical and optical characteristics of the nanowires are strongly connected with their structure. Despite intensive research in this field, the growth process is still not fully understood. In particular, extensive real structure investigations are required. Most of the reports dedicated on the structural researches are based on the results of scanning electron microscopy (SEM) or transmission electron microscopy (TEM). SEM provides an image of the surface with nanostructures and is mainly used to describe the morphology of the sample, but it does not bring information about the internal structure, phase composition and defect structure. At the same time, the internal structure can be examined by TEM down to atomic scale. TEM image of good quality are very expensive due to the efforts in sample preparation and in localisation of a single object. All these aspects make the statistical structural analysis difficult. In the present work, X-ray diffraction analysis has been applied for structural investigation of InAs nanowires grown by different techniques. Using various X-ray diffraction geometries, the nanowire systems were investigated in terms of the lattice parameters, phase composition, strains and displacement fields and stacking defects. In particular, realizing grazing incidence diffraction and controlling the penetration depth of X-ray beam, we characterized sample series grown by Au-assisted metal organic phase epitaxy on GaAs [111]B substrate with different growth time. According to the results of SEM and X-ray investigations, a model of the growth process has been proposed. A more detailed analysis was performed on InAs nanowires grown by molecular beam epitaxy (MBE) on

  20. Characterization of Pb-Free KNbO3- and (Na,BiTiO3-Based Piezoelectric Single-Crystals Using X-ray and Neutron Diffraction

    Directory of Open Access Journals (Sweden)

    Abhijit Pramanick

    2018-01-01

    Full Text Available In view of serious environmental concerns with traditional Pb-based piezoelectrics, the search for new Pb-free alternatives has intensified recently. A thorough investigation of structure-property relationships in Pb-free piezoelectrics is desired in order to design new material compositions with high electromechanical properties that can be operated over a broader range of conditions. Recent availability of high-quality single crystals has not only opened the possibility for achieving multifold enhancements in the electromechanical properties in this new class of materials, but has also provided opportunities to undertake fundamental studies on their structure-property relationships. In the following pages, I review some of the recent X-ray and neutron diffraction studies of Pb-free piezoelectric single crystals, which have provided novel insights into their multiscale stimuli-induced structural mechanisms, including phase transitions, nanoscale structural ordering, lattice instability, and domain re-orientation. Opportunities and challenges for future progress in this area of study are discussed.

  1. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    successfully grown by Czochralski technique in the automatic diameter control facility. As-grown crystal boules were oriented into (0 0 1) direction cut and optically polished for all measurements. Influence of Ti-ion incorporation into LiNbO3 was studied by core level. XPS analysis. Powder X-ray diffraction studies were ...

  2. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    International Nuclear Information System (INIS)

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons

  3. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    Energy Technology Data Exchange (ETDEWEB)

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons.

  4. Accurate Bond Lengths to Hydrogen Atoms from Single?Crystal X?ray Diffraction by Including Estimated Hydrogen ADPs and Comparison to Neutron and QM/MM Benchmarks

    OpenAIRE

    Dittrich, Birger; L?bben, Jens; Mebs, Stefan; Wagner, Armin; Luger, Peter; Flaig, Ralf

    2017-01-01

    Abstract Amino acid structures are an ideal test set for method?development studies in crystallography. High?resolution X?ray diffraction data for eight previously studied genetically encoding amino acids are provided, complemented by a non?standard amino acid. Structures were re?investigated to study a widely applicable treatment that permits accurate X?H bond lengths to hydrogen atoms to be obtained: this treatment combines refinement of positional hydrogen?atom parameters with aspherical s...

  5. Structure and microstructure of Ni-Mn-Ga single crystal exhibiting magnetic shape memory effect analysed by high resolution X-ray diffraction

    Czech Academy of Sciences Publication Activity Database

    Heczko, Oleg; Cejpek, P.; Drahokoupil, Jan; Holý, V.

    2016-01-01

    Roč. 115, Aug (2016), s. 250-258 ISSN 1359-6454 R&D Projects: GA ČR GA13-30397S; GA ČR GA15-00262S Institutional support: RVO:68378271 Keywords : magnetic field-induced strain * magnetic shape memory effect * X-ray diffraction * structure of Ni-Mn-Ga Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.301, year: 2016

  6. Crystal Structure Analysis of the First Discovered Stability-Enhanced Solid State of Tenofovir Disoproxil Free Base Using Single Crystal X-ray Diffraction.

    Science.gov (United States)

    An, Ji-Hun; Kiyonga, Alice Nguvoko; Yoon, Woojin; Ryu, Hyung Chul; Kim, Jae-Sun; Kang, Chaeri; Park, Minho; Yun, Hoseop; Jung, Kiwon

    2017-07-14

    Tenofovir disoproxil (TD), an anti-virus drug, is currently marketed under its most stable form, Form-I of Tenofovir disoproxil fumarate (TDF). However, studies regarding the properties of TD free base crystal as a promising drug as well as its crystal structure have not yet been reported. This assumption was made because TD free base is not directly produced in a solid form during the manufacturing process. TD free base is first obtained in an oil form, and is then synthesized into TDF crystal. In this regard, the present study was conducted to investigate both the potentiality of TD free base to be an active pharmaceutical ingredient (API) and its crystal structure. Here, TD free base solid was produced by means of drowning-out crystallization. Next, single crystal X-ray diffraction (SXD) was employed to determine the crystal structure. Powder X-ray diffraction (PXRD) and a differential scanning calorimetry (DSC) analysis were performed to evaluate the crystal's properties. Furthermore, experiments were carried out at 15%, 35%, 55%, 75%, and 95% relative humidity (RH) for 12 h using a hygroscopic tester to determine and to compare the hygroscopicity and stability of TD free base with TDF crystal. Additionally, experiments were conducted under accelerated (40 °C, RH 75%) and stress storage (60 °C, RH 75%) conditions for 30 days to investigate the changes in purity and the formation of dimer. In this work, we report that TD free base possesses lower hygroscopicity, and thus does not generate dimer impurity from hydrolysis. Primarily, this is attributed to the fact that TD free base is not an easily ionized salt but comprises neutral hydrophobic molecules. According to the structural properties, the improved hygroscopic property of the TD free base crystal was due to the decrease of crystal polarity owing to the intermolecular H-bonds present in TD free base rings. In addition, the solubility investigation study carried out in aqueous solution and at

  7. X-ray diffraction microtomography using synchrotron radiation

    CERN Document Server

    Barroso, R C; Jesus, E F O; Oliveira, L F

    2001-01-01

    The X-ray diffraction computed tomography technique is based on the interference phenomena of the coherent scatter. For low-momentum transfer, it is most probable that the scattering interaction will be coherent. A selective discrimination of a given element in a scanned specimen can be realized by fixing the Bragg angle which produces an interference peak and then, to carry out the computed tomography in the standard mode. The image reconstructed exalts the presence of this element with respect to other ones in a sample. This work reports the feasibility of a non-destructive synchrotron radiation X-ray diffraction imaging technique. This research was performed at the X-ray Diffraction beam line of the National Synchrotron Light Laboratory (LNLS) in Brazil. The coherent scattering properties of different tissue and bone substitute materials were evaluated. Furthermore, diffraction patterns of some polycrystalline solids were studied due to industrial and environmental human exposure to these metals. The obtai...

  8. Redetermination of eveite, Mn2AsO4(OH, based on single-crystal X-ray diffraction data

    Directory of Open Access Journals (Sweden)

    Yongbo W. Yang

    2011-12-01

    Full Text Available The crystal structure of eveite, ideally Mn2(AsO4(OH [dimanganese(II arsenate(V hydroxide], was refined from a single crystal selected from a co-type sample from Långban, Filipstad, Varmland, Sweden. Eveite, dimorphic with sarkinite, is structurally analogous with the important rock-forming mineral andalusite, Al2OSiO4, and belongs to the libethenite group. Its structure consists of chains of edge-sharing distorted [MnO4(OH2] octahedra (..2 symmetry extending parallel to [001]. These chains are cross-linked by isolated AsO4 tetrahedra (..m symmetry through corner-sharing, forming channels in which dimers of edge-sharing [MnO4(OH] trigonal bipyramids (..m symmetry are located. In contrast to the previous refinement from Weissenberg photographic data [Moore & Smyth (1968. Am. Mineral. 53, 1841–1845], all non-H atoms were refined with anisotropic displacement parameters and the H atom was located. The distance of the donor and acceptor O atoms involved in hydrogen bonding is in agreement with Raman spectroscopic data. Examination of the Raman spectra for arsenate minerals in the libethenite group reveals that the position of the peak originating from the O—H stretching vibration shifts to lower wavenumbers from eveite, to adamite, zincolivenite, and olivenite.

  9. High resolution X-ray diffraction studies on unirradiated

    Indian Academy of Sciences (India)

    High-resolution X-ray diffraction technique, employing a three-crystal monochromator–collimator combination is used to study the irradiation induced defects in flux grown Sr-hexaferrite crystals irradiated with 50 MeV Li3+ ion beams at room temperature with a fluence value of 1 × 1014 ions/cm2. The diffraction curves of the ...

  10. Thermal expansion behavior of empressite, AgTe: A structural study by means of in situ high-temperature single-crystal X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Bindi, Luca [Museo di Storia Naturale, sez. di Mineralogia, Universita di Firenze, Via La Pira 4, I-50121 Firenze (Italy)], E-mail: luca.bindi@unifi.it

    2009-04-03

    The crystal structure of empressite, AgTe, a rare silver telluride, has been investigated by in situ X-ray single-crystal diffraction methods within the temperature range 298-463 K. AgTe remains orthorhombic, space group Pmnb (Pnma as standard), and shows only normal thermal expansion over the entire temperature range. The unit-cell parameters show a gradual increase with the increase of temperature. Slight adjustments in the geometry of Ag-tetrahedra and in the crystal-chemical environment of tellurium atoms occur in a continuous way without abrupt structural changes. The coefficients of thermal expansion along various axes are: {alpha}{sub a} = 1.5 x 10{sup -5} K{sup -1}, {alpha}{sub b} = 3.0 x 10{sup -5} K{sup -1}, {alpha}{sub c} = 2.2 x 10{sup -5} K{sup -1}, and the bulk thermal expansion coefficient {alpha}{sub V} is 5.4 x 10{sup -5} K{sup -1} for the temperature range 298-463 K.

  11. On the preparation of as-produced and purified single-walled carbon nanotube samples for standardized X-ray diffraction characterization

    International Nuclear Information System (INIS)

    Allaf, Rula M.; Rivero, Iris V.; Spearman, Shayla S.; Hope-Weeks, Louisa J.

    2011-01-01

    The aim of this research was to specify proper sample conditioning for acquiring representative X-ray diffraction (XRD) profiles for single-walled carbon nanotube (SWCNT) samples. In doing so, a specimen preparation method for quantitative XRD characterization of as-produced and purified arc-discharge SWCNT samples has been identified. Series of powder XRD profiles were collected at different temperatures, states, and points of time to establish appropriate conditions for acquiring XRD profiles without inducing much change to the specimen. It was concluded that heating in the 300-450 deg. C range for 20 minutes, preferably vacuum-assisted, and then sealing the sample is an appropriate XRD specimen preparation technique for purified arc-discharge SWCNT samples, while raw samples do not require preconditioning for characterization. - Graphical Abstract: A sample preparation method for XRD characterization of as-produced and purified arc-discharge SWCNT samples is identified. The preparation technique seeks to acquire representative XRD profiles without inducing changes to the samples. Purified samples required 20 minutes of heating at (300-450)deg. C, while raw samples did not require preconditioning for characterization. Highlights: → Purification routines may induce adsorption onto the SWCNT samples. → Heating a SWCNT sample may result in material loss, desorption, and SWCNTs closing. → Raw arc-discharge samples do not require preparation for XRD characterization. → Heating is appropriate specimen preparation for purified and heat-treated samples. → XRD data fitting is required for structural analysis of SWCNT bundles.

  12. Variable-temperature single-crystal X-ray diffraction study of tetragonal and cubic perovskite-type barium titanate phases.

    Science.gov (United States)

    Nakatani, Tomotaka; Yoshiasa, Akira; Nakatsuka, Akihiko; Hiratoko, Tatsuya; Mashimo, Tsutomu; Okube, Maki; Sasaki, Satoshi

    2016-02-01

    A variable-temperature single-crystal X-ray diffraction study of a synthetic BaTiO3 perovskite has been performed over the temperature range 298-778 K. A transition from a tetragonal (P4mm) to a cubic (Pm3m) phase has been revealed near 413 K. In the non-centrosymmetric P4mm symmetry group, both Ti and O atoms are displaced along the c-axis in opposite directions with regard to the Ba position fixed at the origin, so that Ti(4+) and Ba(2+) cations occupy off-center positions in the TiO6 and BaO12 polyhedra, respectively. Smooth temperature-dependent changes of the atomic coordinates become discontinuous with the phase transition. Our observations imply that the cations remain off-center even in the high-temperature cubic phase. The temperature dependence of the mean-square displacements of Ti in the cubic phase includes a significant static component which means that Ti atoms are statistically distributed in the off-center positions.

  13. Structure refinement of the δ1p phase in the Fe-Zn system by single-crystal X-ray diffraction combined with scanning transmission electron microscopy.

    Science.gov (United States)

    Okamoto, Norihiko L; Tanaka, Katsushi; Yasuhara, Akira; Inui, Haruyuki

    2014-04-01

    The structure of the δ1p phase in the iron-zinc system has been refined by single-crystal synchrotron X-ray diffraction combined with scanning transmission electron microscopy. The large hexagonal unit cell of the δ1p phase with the space group of P63/mmc comprises more or less regular (normal) Zn12 icosahedra, disordered Zn12 icosahedra, Zn16 icosioctahedra and dangling Zn atoms that do not constitute any polyhedra. The unit cell contains 52 Fe and 504 Zn atoms so that the compound is expressed with the chemical formula of Fe13Zn126. All Fe atoms exclusively occupy the centre of normal and disordered icosahedra. Iron-centred normal icosahedra are linked to one another by face- and vertex-sharing forming two types of basal slabs, which are bridged with each other by face-sharing with icosioctahedra, whereas disordered icosahedra with positional disorder at their vertex sites are isolated from other polyhedra. The bonding features in the δ1p phase are discussed in comparison with those in the Γ and ζ phases in the iron-zinc system.

  14. Combined single-crystal X-ray and neutron diffraction analysis of the structure of the (Zr6CI18H5)3- poly-anion

    International Nuclear Information System (INIS)

    Cotton, F.A.; Chen, L.; Schultz, A.J.

    1996-01-01

    The octahedral hexa zirconium compound (Ph 4 P) 3 [Zr 6 Cl 18 H 5 ] has been structurally characterized by a combined analysis of single-crystal X-ray and time-of-flight (TOF) neutron diffraction data. The space group is tetragonal, I4 1 /a, Z = 8, with lattice constants at 123 K of a = 32.957(8), c 15.001(3) Angstrom, V = 16,294(6) Angstrom 3 . Difference Fourier maps based on the neutron data exhibited negative troughs on the triangular faces of the hexa zirconium octahedron which were introduced into the structure as hydrogen atoms. Refinement of the atomic positional and occupancy parameters for the hydrogen atoms resulted in about 0.7 H atoms on each triangular face for a total of 5.47(15) hydrogen atoms atoms per hexa zirconium cluster, in good accord with the 1 H NMR measurement (5.0) and the theoretical expectation of 5. The Zr - (μ 3 H) distances range from 1.8 to 2.1 Angstrom. (authors)

  15. Acemetacin cocrystal structures by powder X-ray diffraction

    Directory of Open Access Journals (Sweden)

    Geetha Bolla

    2017-05-01

    Full Text Available Cocrystals of acemetacin drug (ACM with nicotinamide (NAM, p-aminobenzoic acid (PABA, valerolactam (VLM and 2-pyridone (2HP were prepared by melt crystallization and their X-ray crystal structures determined by high-resolution powder X-ray diffraction. The powerful technique of structure determination from powder data (SDPD provided details of molecular packing and hydrogen bonding in pharmaceutical cocrystals of acemetacin. ACM–NAM occurs in anhydrate and hydrate forms, whereas the other structures crystallized in a single crystalline form. The carboxylic acid group of ACM forms theacid–amide dimer three-point synthon R32(9R22(8R32(9 with three different syn amides (VLM, 2HP and caprolactam. The conformations of the ACM molecule observed in the crystal structures differ mainly in the mutual orientation of chlorobenzene fragment and the neighboring methyl group, being anti (type I or syn (type II. ACM hydrate, ACM—NAM, ACM–NAM-hydrate and the piperazine salt of ACM exhibit the type I conformation, whereas ACM polymorphs and other cocrystals adopt the ACM type II conformation. Hydrogen-bond interactions in all the crystal structures were quantified by calculating their molecular electrostatic potential (MEP surfaces. Hirshfeld surface analysis of the cocrystal surfaces shows that about 50% of the contribution is due to a combination of strong and weak O...H, N...H, Cl...H and C...H interactions. The physicochemical properties of these cocrystals are under study.

  16. X-ray diffraction study of directionally grown perylene crystallites

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Lemke, H. T.; Hammershøj, P.

    2008-01-01

    Using grazing incidence X-ray diffraction, perylene crystallites grown on thin highly oriented poly(tetrafluoroethylene) (PTFE) films on silicon substrates have been investigated. All the perylene crystallites are found to orient with the ab plane of the monoclinic unit cell parallel to the subst......Using grazing incidence X-ray diffraction, perylene crystallites grown on thin highly oriented poly(tetrafluoroethylene) (PTFE) films on silicon substrates have been investigated. All the perylene crystallites are found to orient with the ab plane of the monoclinic unit cell parallel...

  17. X-ray and Neutron Diffraction in the Study of Organic Crystalline Hydrates

    Directory of Open Access Journals (Sweden)

    Katharina Fucke

    2010-07-01

    Full Text Available A review. Diffraction methods are a powerful tool to investigate the crystal structure of organic compounds in general and their hydrates in particular. The laboratory standard technique of single crystal X-ray diffraction gives information about the molecular conformation, packing and hydrogen bonding in the crystal structure, while powder X-ray diffraction on bulk material can trace hydration/dehydration processes and phase transitions under non-ambient conditions. Neutron diffraction is a valuable complementary technique to X-ray diffraction and gives highly accurate hydrogen atom positions due to the interaction of the radiation with the atomic nuclei. Although not yet often applied to organic hydrates, neutron single crystal and neutron powder diffraction give precise structural data on hydrogen bonding networks which will help explain why hydrates form in the first place.

  18. Analytic theory of soft x-ray diffraction by lamellar multilayer gratings

    NARCIS (Netherlands)

    Kozhevnikov, I.V.; van der Meer, R.; Bastiaens, Hubertus M.J.; Boller, Klaus J.; Bijkerk, Frederik

    2011-01-01

    An analytic theory describing soft x-ray diffraction by Lamellar Multilayer Gratings (LMG) has been developed. The theory is derived from a coupled waves approach for LMGs operating in the single-order regime, where an incident plane wave can only excite a single diffraction order. The results from

  19. X-Ray diffraction Investigation of Electrochemically Deposited Copper

    DEFF Research Database (Denmark)

    Pantleon, Karen; Jensen, Jens Dahl; Somers, Marcel A.J.

    2004-01-01

    by the determination of X-ray diffraction (XRD) pole figures and the calculation of the orientation distribution functions. XRD results are discussed in relation to the morphologies of the electrodeposits as investigated with light optical microscopy and correlated with the process parameters during electrodeposition....

  20. Oxygen precipitation studied by x-ray diffraction techniques

    Czech Academy of Sciences Publication Activity Database

    Meduňa, M.; Caha, O.; Růžička, J.; Bernatová, S.; Svoboda, Milan; Buršík, Jiří

    178 -179, - (2011), s. 325-330 ISSN 1012-0394 R&D Projects: GA ČR(CZ) GA202/09/1013 Institutional research plan: CEZ:AV0Z20410507 Keywords : Czochralski silicon * oxygen precipitates * x-ray Laue diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism

  1. Fusion bonding of Si wafers investigated by x ray diffraction

    DEFF Research Database (Denmark)

    Weichel, Steen; Grey, Francois; Rasmussen, Kurt

    2000-01-01

    The interface structure of bonded Si(001) wafers with twist angle 6.5 degrees is studied as a function of annealing temperature. An ordered structure is observed in x-ray diffraction by monitoring a satellite reflection due to the periodic modulation near the interface, which results from...

  2. Diffractive-refractive optics: X-ray collimator

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Oberta, Peter

    2008-01-01

    Roč. 79, č. 7 (2008), 073105/1-073105/4 ISSN 0034-6748 R&D Projects: GA AV ČR IAA100100716 Institutional research plan: CEZ:AV0Z10100522 Keywords : x-ray collimator * diffractive-refractive optics Subject RIV: BH - Optics , Masers, Lasers Impact factor: 1.738, year: 2008

  3. X-ray diffraction of iron containing samples

    NARCIS (Netherlands)

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2017-01-01

    X-ray diffraction (XRD) is a commonly used technology to identify crystalline phases. However, care must be taken with the combination of XRD configuration and sample. Copper (most commonly used radiation source) is a poor match with iron containing materials due to induced fluorescence. Magnetite

  4. X-Ray Diffraction of Iron Containing Samples

    NARCIS (Netherlands)

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2018-01-01

    In X-ray diffraction, a good combination of configuration and sample is essential. Copper radiation for iron containing materials leads to a high background. Although this has been recognized, many researchers still use this combination. To clearly show the unsuitability of copper radiation for iron

  5. Differential scanning calorimetric and powder X-ray diffraction ...

    Indian Academy of Sciences (India)

    The thermotropic phase transitions and supramolecular structure of NAAEs were investigated by differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD). Results obtained from DSC studies indicate that the transition temperatures (t), enthalpies ( t) and entropies ( t) exhibit odd-even alternation ...

  6. Ultra-small angle X-ray diffraction from muscle

    Energy Technology Data Exchange (ETDEWEB)

    Nave, C.; Diakun, G.P.; Bordas, J.

    1986-05-15

    An ultra-small angle X-ray scattering instrument is described. It uses two channel cut crystals, one to monochromatise and collimate the beam and the other to analyse the scattered radiation. It has been used to collect diffraction data from muscle, in which the physiological unit cell, the sarcomere, has a repeat of 2000 nm or more.

  7. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Unknown

    Powder data is especially useful to deduce accurate cell parameters. Rietveld's refinement procedure1,2 has revolutionized the application of powder X-ray diffraction by resulting in a large number of structures being refined in the last decade. If a suitable starting model is available, it has become routine to refine structures ...

  8. Evaluation of In-Vacuum Imaging Plate Detector for X-Ray Diffraction Microscopy

    International Nuclear Information System (INIS)

    Nishino, Yoshinori; Takahashi, Yukio; Yamamoto, Masaki; Ishikawa, Tetsuya

    2007-01-01

    We performed evaluation tests of a newly developed in-vacuum imaging plate (IP) detector for x-ray diffraction microscopy. IP detectors have advantages over direct x-ray detection charge-coupled device (CCD) detectors, which have been commonly used in x-ray diffraction microscopy experiments, in the capabilities for a high photon count and for a wide area. The detector system contains two IPs to make measurement efficient by recording data with the one while reading or erasing the other. We compared speckled diffraction patterns of single particles taken with the IP and a direct x-ray detection CCD. The IP was inferior to the CCD in spatial resolution and in signal-to-noise ratio at a low photon count

  9. Simulating X-ray diffraction of textured films

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Bunk, Oliver; Andreasen, Jens Wenzel

    2008-01-01

    Computationally efficient simulations of grazing-incidence X-ray diffraction (GIXD) are discussed, with particular attention given to textured thin polycrystalline films on supporting substrates. A computer program has been developed for simulating scattering from thin films exhibiting varying...... from the totally substrate-reflected beam ( two-beam approximation) and refraction effects are also included in the program, together with the geometrical intensity corrections associated with GIXD measurements. To achieve 'user friendliness' for scientists less familiar with diffraction...

  10. Diffraction enhanced X-ray imaging of mammals crystalline lens

    Energy Technology Data Exchange (ETDEWEB)

    Antunes, A. [Departamento de Fisica Aplicada, USP, CP 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: antunes@if.usp.br; Hoennicke, M.G. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Curitiba (Brazil); Safatle, A.M.V. [Faculdade de Medicina Veterinaria e Zootecnia, USP, 05508-900 Sao Paulo, SP (Brazil); Cusatis, C. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Curitiba (Brazil); Moraes Barros, P.S. [Faculdade de Medicina Veterinaria e Zootecnia, USP, 05508-900 Sao Paulo, SP (Brazil); Morelhao, S.L. [Departamento de Fisica Aplicada, USP, CP 66318, 05315-970 Sao Paulo, SP (Brazil)

    2005-08-15

    Crystalline lenses are transparent biological materials where the organization of the lens fibers can also be affected by changes at molecular level, and therefore the structure and morphology of the tissue can be correlated to the loss of transparency of the lens. In this work, internal structure of mammal lenses regarding the long-range ordering of the fibers are investigated by diffraction enhanced X-ray imaging (DEI) radiography. Moreover, DEI and absorption X-ray synchrotron radiographs for healthy and cataractous crystalline lenses are compared. Significant differences in healthy and cataractous crystalline lenses are observed.

  11. Diffraction enhanced X-ray imaging of mammals crystalline lens

    International Nuclear Information System (INIS)

    Antunes, A.; Hoennicke, M.G.; Safatle, A.M.V.; Cusatis, C.; Moraes Barros, P.S.; Morelhao, S.L.

    2005-01-01

    Crystalline lenses are transparent biological materials where the organization of the lens fibers can also be affected by changes at molecular level, and therefore the structure and morphology of the tissue can be correlated to the loss of transparency of the lens. In this work, internal structure of mammal lenses regarding the long-range ordering of the fibers are investigated by diffraction enhanced X-ray imaging (DEI) radiography. Moreover, DEI and absorption X-ray synchrotron radiographs for healthy and cataractous crystalline lenses are compared. Significant differences in healthy and cataractous crystalline lenses are observed

  12. Raman spectroscopy and X-ray diffraction studies on celestite

    International Nuclear Information System (INIS)

    Chen Yenhua; Yu Shucheng; Huang, Eugene; Lee, P.-L.

    2010-01-01

    High-pressure Raman spectroscopy and X-ray diffraction studies of celestite (SrSO 4 ) were carried out in a diamond anvil cell at room temperature. Variation in the Raman vibrational frequency and change of lattice parameters with pressure indicate that a transformation occurs in celestite. This transformation caused an adjustment in the Sr-O polyhedra that affected the stretching-force constant of SO 4 . Moreover, compressibilities along the crystallographic axes decreased in the order a to c to b. From the compression data, the bulk modulus of the celestite was 87 GPa. Both X-ray and Raman data show that the transition in celestite is reversible.

  13. MSL Chemistry and Mineralogy X-Ray Diffraction X-Ray Fluorescence (CheMin) Instrument

    Science.gov (United States)

    Zimmerman, Wayne; Blake, Dave; Harris, William; Morookian, John Michael; Randall, Dave; Reder, Leonard J.; Sarrazin, Phillipe

    2013-01-01

    This paper provides an overview of the Mars Science Laboratory (MSL) Chemistry and Mineralogy Xray Diffraction (XRD), X-ray Fluorescence (XRF) (CheMin) Instrument, an element of the landed Curiosity rover payload, which landed on Mars in August of 2012. The scientific goal of the MSL mission is to explore and quantitatively assess regions in Gale Crater as a potential habitat for life - past or present. The CheMin instrument will receive Martian rock and soil samples from the MSL Sample Acquisition/Sample Processing and Handling (SA/SPaH) system, and process it utilizing X-Ray spectroscopy methods to determine mineral composition. The Chemin instrument will analyze Martian soil and rocks to enable scientists to investigate geophysical processes occurring on Mars. The CheMin science objectives and proposed surface operations are described along with the CheMin hardware with an emphasis on the system engineering challenges associated with developing such a complex instrument.

  14. Determination of organic crystal structures by X ray powder diffraction

    CERN Document Server

    McBride, L

    2000-01-01

    The crystal structure of Ibuprofen has been solved from synchrotron X-ray powder diffraction data using a genetic algorithm (GA). The performance of the GA is improved by incorporating prior chemical information in the form of hard limits on the values that can be taken by the flexible torsion angles within the molecule. Powder X-ray diffraction data were collected for the anti-convulsant compounds remacemide, remacemide nitrate and remacemide acetate at 130 K on BM 16 at the X-ray European Synchrotron Radiation Facility (ESRF) at Grenoble. High quality crystal structures were obtained using data collected to a resolution of typically 1.5 A. The structure determinations were performed using a simulated annealing (SA) method and constrained Rietveld refinements for the structures converged to chi sup 2 values of 1.64, 1.84 and 1.76 for the free base, nitrate and acetate respectively. The previously unknown crystal structure of the drug famotidine Form B has been solved using X-ray powder diffraction data colle...

  15. Solvent exchange in a metal–organic framework single crystal monitored by dynamic in situ X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cox, Jordan M.; Walton, Ian M.; Bateman, Gage; Benson, Cassidy A.; Mitchell, Travis; Sylvester, Eric; Chen, Yu-Sheng; Benedict, Jason B. (UC); (Buffalo)

    2017-07-25

    Understanding the processes by which porous solid-state materials adsorb and release guest molecules would represent a significant step towards developing rational design principles for functional porous materials. To elucidate the process of liquid exchange in these materials, dynamicin situX-ray diffraction techniques have been developed which utilize liquid-phase chemical stimuli. Using these time-resolved diffraction techniques, the ethanol solvation process in a flexible metal–organic framework [Co(AIP)(bpy)0.5(H2O)]·2H2O was examined. The measurements provide important insight into the nature of the chemical transformation in this system including the presence of a previously unreported neat ethanol solvate structure.

  16. Instrument and method for X-ray diffraction, fluorescence, and crystal texture analysis without sample preparation

    Science.gov (United States)

    Gendreau, Keith (Inventor); Martins, Jose Vanderlei (Inventor); Arzoumanian, Zaven (Inventor)

    2010-01-01

    An X-ray diffraction and X-ray fluorescence instrument for analyzing samples having no sample preparation includes a X-ray source configured to output a collimated X-ray beam comprising a continuum spectrum of X-rays to a predetermined coordinate and a photon-counting X-ray imaging spectrometer disposed to receive X-rays output from an unprepared sample disposed at the predetermined coordinate upon exposure of the unprepared sample to the collimated X-ray beam. The X-ray source and the photon-counting X-ray imaging spectrometer are arranged in a reflection geometry relative to the predetermined coordinate.

  17. An autonomous CZT module for X-ray diffraction imaging

    International Nuclear Information System (INIS)

    Montemont, G.; Monnet, O.; Stanchina, S.; Verger, L.; Kosciesza, D.; Schlomka, J.P.

    2013-01-01

    We present the development of a CZT-based detection module dedicated to X-ray diffraction imaging. This kind of application requires a good energy and spatial resolution in order to resolve Bragg peaks. In a first part, we present the detector configuration used and dimensioning constraints. As the input energy range is comprised between 20 and 150 keV, we use 5 mm thick high resistivity CZT crystals. The 660 mm 2 detection area is segmented on both sides into 192 anodes and 12 cathodes. Signals from both sides are read jointly in order to perform multi parametric event corrections (depth of interaction, charge sharing, induction sharing). In order to be integrated easily inside an X-ray imaging system, the system has been conceived to be completely autonomous: it is powered by a single 12 V supply and is interfaced with the external system by Ethernet for communication and RS485 for synchronization. In a second part, we describe the system readout architecture and then the implementation of the data processing. An FPGA circuit embeds a digital processing chain that carries out readout ASIC interfacing and advanced multi parametric data corrections. Gain, offset but also depth of interaction and charge sharing are corrected on the flow. Incoming events from different channels are clustered together by comparing their location and time of occurrence. The FPGA also embeds a processor running an operating system that controls the system, carries out all calibrations, automated tests and acquisitions. Eventually, we show the results obtained and demonstrate the relative influence of depth of interaction and charge sharing. Homogeneity of detector behavior is also discussed and the reproducibility of the performance between modules is presented. The average energy resolution at 25 C is 2.4 % FWHM at 122 keV and 3.8 % FWHM at 60 keV and the average efficiency is 73 %. (authors)

  18. Multiple x-ray diffraction simulation and applications

    International Nuclear Information System (INIS)

    Costa, C.A.B.S. da.

    1989-09-01

    A computer program (MULTX) was implemented for simulation X-ray multiple diffraction diagrams in Renninger geometries. The program uses the X-ray multiple diffraction theory for imperfect crystals. The iterative calculation of the intensities is based on the Taylor series general term, and the primary beam power expansion is given as function of the beam x penetration in the crystal surface. This development allows to consider the simultaneous interaction of the beams involved in the multiple diffraction phenomenon. The simulated diagrams are calculated point-to-point and the tests for the Si and GaAs presented good reproduction of the experimental diagrams for different primary reflections. (L.C.J.A.)

  19. Monitoring protein precipitates by in-house X-ray powder diffraction

    OpenAIRE

    Ståhl, Kenny; Frankær, Christian Grundahl; Petersen, Jakob; Harris, Pernille

    2013-01-01

    Powder diffraction from protein powders using in-house diffractometers is an effective tool for identification and monitoring of protein crystal forms and artifacts. As an alternative to conventional powder diffractometers a single crystal diffractometer equipped with an X-ray micro-source can be used to collect powder patterns from 1 l samples. Using a small-angle X-ray scattering (SAXS) camera it is possible to collect data within minutes. A streamlined program has been developed for the ca...

  20. Extinction correction in white X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Tomiyoshi, S.; Yamada, M.; Watanabe, H.

    1980-01-01

    Extinction effects in white-beam X-ray and neutron diffraction are considered. In white-beam diffraction, a small deviation of the wavelength from the Bragg condition Δlambda is a variable which represents the line profile of the diffraction peaks, so that by using the new parameter Δlambda the theory is converted to one in white-beam diffraction. It is shown that for a convex crystal, primary extinction agrees with the results calculated already for monochromatic diffraction. The same relation is shown to hold in secondary extinction. It is concluded that extinction theory derived for monochromatic diffraction is applicable without any modification in white-beam diffraction. (Auth.)

  1. Locating and Visualizing Crystals for X-Ray Diffraction Experiments.

    Science.gov (United States)

    Becker, Michael; Kissick, David J; Ogata, Craig M

    2017-01-01

    Macromolecular crystallography has advanced from using macroscopic crystals, which might be >1 mm on a side, to crystals that are essentially invisible to the naked eye, or even under a standard laboratory microscope. As crystallography requires recognizing crystals when they are produced, and then placing them in an X-ray, electron, or neutron beam, this provides challenges, particularly in the case of advanced X-ray sources, where beams have very small cross sections and crystals may be vanishingly small. Methods for visualizing crystals are reviewed here, and examples of different types of cases are presented, including: standard crystals, crystals grown in mesophase, in situ crystallography, and crystals grown for X-ray Free Electron Laser or Micro Electron Diffraction experiments. As most techniques have limitations, it is desirable to have a range of complementary techniques available to identify and locate crystals. Ideally, a given technique should not cause sample damage, but sometimes it is necessary to use techniques where damage can only be minimized. For extreme circumstances, the act of probing location may be coincident with collecting X-ray diffraction data. Future challenges and directions are also discussed.

  2. Diffraction anomalous fine structure using X-ray anomalous dispersion

    International Nuclear Information System (INIS)

    Soejima, Yuji; Kuwajima, Shuichiro

    1998-01-01

    A use of X-ray anomalous dispersion effects for structure investigation has recently been developed by using synchrotron radiation. One of the interesting method is the observation of anomalous fine structure which arise on diffraction intensity in energy region of incident X-ray at and higher than absorption edge. The phenomenon is so called Diffraction Anomalous Fine Structure (DAFS). DAFS originates in the same physical process an that of EXAFS: namely photoelectric effect at the corresponding atom and the interaction of photoelectron waves between the atom and neighboring atoms. In contrast with EXAFS, the method is available for only the crystalline materials, but shows effective advantages of the structure investigations by a use of diffraction: one is the site selectivity and the other is space selectivity. In the present study, demonstrations of a use of X-ray anomalous dispersion effect for the superstructure determination will be given for the case of PbZrO 3 , then recent trial investigations of DAFS in particular on the superlattice reflections will be introduced. In addition, we discuss about Forbidden Reflection near Edge Diffraction (FRED) which is more recently investigated as a new method of the structure analysis. (author)

  3. High Pressure X-ray Diffraction Studies on Barium.

    Science.gov (United States)

    Barnett, J D; Bennion, R B; Hall, H T

    1963-08-09

    Simultaneous x-ray diffraction and electrical resistance measurements on barium establish, with certainty, that Bridgman's 78-kb resistance transition is identical with his 59-kb volumetransition. During this transition, the bodycentered cubic structure changes to hexagonalclose packed. Lattice parameters for the latter structure at 62 kb (volume scale) are: a = 3.90 A, c = 6.15 A, and c/a = 1.58. Compression (AV/Vo) at 62 kb is 0.359 + 0.005 compared to 0.345 previously reported by Bridgman. Below the transition, at 49 kb, compression is 0.300 +/- 0.005 compared to Bridgman's 0.288. Bridgman's 17-kb volume transition was not detected by x-ray diffraction.

  4. Measurements of transient electron density distributions by femtosecond X-ray diffraction

    International Nuclear Information System (INIS)

    Freyer, Benjamin

    2013-01-01

    This thesis concerns measurements of transient charge density maps by femtosecond X-ray diffraction. Different X-ray diffraction methods will be considered, particularly with regard to their application in femtosecond X-ray diffraction. The rotation method is commonly used in stationary X-ray diffraction. In the work in hand an X-ray diffraction experiment is demonstrated, which combines the method with ultrafast X-ray pulses. This experiment is the first implementation which makes use of the rotation method to map transient intensities of a multitude of Bragg reflections. As a prototype material Bismuth is used, which previously was studied frequently by femtosecond X-ray diffraction by measuring Bragg reflections successively. The experimental results of the present work are compared with the literature data. In the second part a powder-diffraction experiment will be presented, which is used to study the dynamics of the electron-density distribution on ultrafast time scales. The experiment investigates a transition metal complex after photoexcitation of the metal to ligand charge transfer state. Besides expected results, i. e. the change of the bond length between the metal and the ligand and the transfer of electronic charge from the metal to the ligand, a strong contribution of the anion to the charge transfer was found. Furthermore, the charge transfer has predominantly a cooperative character. That is, the excitation of a single complex causes an alteration of the charge density of several neighboring units. The results show that more than 30 transition-metal complexes and 60 anions contribute to the charge transfer. This collective response is a consequence of the strong coulomb interactions of the densely packed ions.

  5. Single-Crystal X-Ray Diffraction of Orthoenstatite to 48 GPa: New High-Pressure Phases with 4-, 5-, and 6-Coordinated Silicon

    Science.gov (United States)

    Finkelstein, G. J.; Dera, P. K.; Duffy, T. S.

    2013-12-01

    Orthopyroxene (opx, (Mg,Fe)SiO3) is one of the major phases in Earth's upper mantle, comprising ~20% of the region by volume. At high pressures and temperatures, this phase undergoes several well-characterized phase transitions. Its behavior at low temperature is less well known, but may be important for cold subducting slabs (1, 2). Previous studies (3, 4) reported that MgSiO3 orthoenstatite persists up to ~12 GPa, and a phase transition above this pressure was recently discovered by Zhang et al. (5). This structure, which we call β-opx (designated HPCEN2 in previous studies), is related to one predicted by theory (6), and has P21/c monoclinic symmetry. It retains an opx topology despite its lower symmetry, distinguishing it from a true clinopyroxene. We conducted single-crystal X-ray diffraction experiments in a diamond anvil cell at GSECARS and HPCAT at the APS. Mg0.91Fe0.09SiO3 orthopyroxene was compressed in a neon pressure medium with a gold pressure standard. In addition to the orthopyroxene to β-opx transition, we observe two further phase changes at ~28 GPa and ~38 GPa. The transitions result in volume reductions of ~2.5% and ~3.9%, respectively. The Si layers in both new structures are intermediate between the opx structure and that of the ilmenite-structured akimotoite polymorph. Akimotoite consists of edge-sharing MgO6 and SiO6 octahedra arranged in alternating honeycomb sheets. A theoretical study suggested clinoenstatite could transform directly to akimotoite at low temperatures through a shear-based mechanism (7). Here, we observe that the path toward akimotoite-like Si layers is stepwise. In the new MgSiO3 structures, the initial chains of SiO4 tetrahedra are partially converted to the characteristic 6-coordinated honeycomb layers. This results in some 5-coordinated Si sites in both structures. Due to the increased coordination number, we are calling the new structures α- and β-post-orthopyroxene (α-popx and β-popx). The Mg layers, however, do

  6. Diffractive-refractive optics: X-ray splitter

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír

    2010-01-01

    Roč. 17, č. 1 (2010), s. 129-131 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412; GA AV ČR IAA100100716 Institutional research plan: CEZ:AV0Z10100522 Keywords : x-ray splitter * diffractive-refractive optics Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.335, year: 2010

  7. X-Ray Diffraction of Iron Containing Samples

    OpenAIRE

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2018-01-01

    In X-ray diffraction, a good combination of configuration and sample is essential. Copper radiation for iron containing materials leads to a high background. Although this has been recognized, many researchers still use this combination. To clearly show the unsuitability of copper radiation for iron oxides, magnetite, goethite, maghemite, and hematite were analysed in different configurations using copper or cobalt radiation. Results show effects of fluorescence repressing measures and differ...

  8. Nanofabrication of Diffractive Soft X-ray Optics

    OpenAIRE

    Lindblom, Magnus

    2009-01-01

    This thesis summarizes the present status of the nanofabrication of diffractive optics, i.e. zone plates, and test objects for soft x-ray microscopy at KTH. The emphasis is on new and improved fabrication processes for nickel and germanium zone plates. A new concept in which nickel and germanium are combined in a zone plate is also presented. The main techniques used in the fabrication are electron beam lithography for the patterning, followed by plasma etching and electroplating for the stru...

  9. Coherent X-ray diffraction from collagenous soft tissues

    Energy Technology Data Exchange (ETDEWEB)

    Berenguer de la Cuesta, Felisa; Wenger, Marco P.E.; Bean, Richard J.; Bozec, Laurent; Horton, Michael A.; Robinson, Ian K.; (UCL)

    2009-09-11

    Coherent X-ray diffraction has been applied in the imaging of inorganic materials with great success. However, its application to biological specimens has been limited to some notable exceptions, due to the induced radiation damage and the extended nature of biological samples, the last limiting the application of most part of the phasing algorithms. X-ray ptychography, still under development, is a good candidate to overcome such difficulties and become a powerful imaging method for biology. We describe herein the feasibility of applying ptychography to the imaging of biological specimens, in particular collagen rich samples. We report here speckles in diffraction patterns from soft animal tissue, obtained with an optimized small angle X-ray setup that exploits the natural coherence of the beam. By phasing these patterns, dark field images of collagen within tendon, skin, bone, or cornea will eventually be obtained with a resolution of 60-70 nm. We present simulations of the contrast mechanism in collagen based on atomic force microscope images of the samples. Simulations confirmed the 'speckled' nature of the obtained diffraction patterns. Once inverted, the patterns will show the disposition and orientation of the fibers within the tissue, by enhancing the phase contrast between protein and no protein regions of the sample. Our work affords the application of the most innovative coherent X-ray diffraction tools to the study of biological specimens, and this approach will have a significant impact in biology and medicine because it overcomes many of the limits of current microscopy techniques.

  10. Accurate Bond Lengths to Hydrogen Atoms from Single-Crystal X-ray Diffraction by Including Estimated Hydrogen ADPs and Comparison to Neutron and QM/MM Benchmarks.

    Science.gov (United States)

    Dittrich, Birger; Lübben, Jens; Mebs, Stefan; Wagner, Armin; Luger, Peter; Flaig, Ralf

    2017-04-03

    Amino acid structures are an ideal test set for method-development studies in crystallography. High-resolution X-ray diffraction data for eight previously studied genetically encoding amino acids are provided, complemented by a non-standard amino acid. Structures were re-investigated to study a widely applicable treatment that permits accurate X-H bond lengths to hydrogen atoms to be obtained: this treatment combines refinement of positional hydrogen-atom parameters with aspherical scattering factors with constrained "TLS+INV" estimated hydrogen anisotropic displacement parameters (H-ADPs). Tabulated invariom scattering factors allow rapid modeling without further computations, and unconstrained Hirshfeld atom refinement provides a computationally demanding alternative when database entries are missing. Both should incorporate estimated H-ADPs, as free refinement frequently leads to over-parameterization and non-positive definite H-ADPs irrespective of the aspherical scattering model used. Using estimated H-ADPs, both methods yield accurate and precise X-H distances in best quantitative agreement with neutron diffraction data (available for five of the test-set molecules). This work thus solves the last remaining problem to obtain such results more frequently. Density functional theoretical QM/MM computations are able to play the role of an alternative benchmark to neutron diffraction. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Structural Characterization of Doped GaSb Single Crystals by X-ray Topography

    Energy Technology Data Exchange (ETDEWEB)

    Honnicke, M.G.; Mazzaro, I.; Manica, J.; Benine, E.; M da Costa, E.; Dedavid, B. A.; Cusatis, C.; Huang, X. R.

    2009-09-13

    We characterized GaSb single crystals containing different dopants (Al, Cd and Te), grown by the Czochralski method, by x-ray topography and high angular resolution x-ray diffraction. Lang topography revealed dislocations parallel and perpendicular to the crystal's surface. Double-crystal GaSb 333 x-ray topography shows dislocations and vertical stripes than can be associated with circular growth bands. We compared our high-angular resolution x-ray diffraction measurements (rocking curves) with the findings predicted by the dynamical theory of x-ray diffraction. These measurements show that our GaSb single crystals have a relative variation in the lattice parameter ({Delta}d/d) on the order of 10{sup -5}. This means that they can be used as electronic devices (detectors, for example) and as x-ray monochromators.

  12. Federated repositories of X-ray diffraction images.

    Science.gov (United States)

    Androulakis, Steve; Schmidberger, Jason; Bate, Mark A; DeGori, Ross; Beitz, Anthony; Keong, Cyrus; Cameron, Bob; McGowan, Sheena; Porter, Corrine J; Harrison, Andrew; Hunter, Jane; Martin, Jennifer L; Kobe, Bostjan; Dobson, Renwick C J; Parker, Michael W; Whisstock, James C; Gray, Joan; Treloar, Andrew; Groenewegen, David; Dickson, Neil; Buckle, Ashley M

    2008-07-01

    There is a pressing need for the archiving and curation of raw X-ray diffraction data. This information is critical for validation, methods development and improvement of archived structures. However, the relatively large size of these data sets has presented challenges for storage in a single worldwide repository such as the Protein Data Bank archive. This problem can be avoided by using a federated approach, where each institution utilizes its institutional repository for storage, with a discovery service overlaid. Institutional repositories are relatively stable and adequately funded, ensuring persistence. Here, a simple repository solution is described, utilizing Fedora open-source database software and data-annotation and deposition tools that can be deployed at any site cheaply and easily. Data sets and associated metadata from federated repositories are given a unique and persistent handle, providing a simple mechanism for search and retrieval via web interfaces. In addition to ensuring that valuable data is not lost, the provision of raw data has several uses for the crystallographic community. Most importantly, structure determination can only be truly repeated or verified when the raw data are available. Moreover, the availability of raw data is extremely useful for the development of improved methods of image analysis and data processing.

  13. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    Energy Technology Data Exchange (ETDEWEB)

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi, E-mail: nakasako@phys.keio.ac.jp [Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); RIKEN SPring-8 Center, 1-1-1 Kohto, Sayo, Sayo-gun, Hyogo 679-5148 (Japan)

    2014-03-15

    The software suite SITENNO is developed for processing diffraction data collected in coherent X-ray diffraction imaging experiments of non-crystalline particles using an X-ray free-electron laser. Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles.

  14. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    International Nuclear Information System (INIS)

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi

    2014-01-01

    The software suite SITENNO is developed for processing diffraction data collected in coherent X-ray diffraction imaging experiments of non-crystalline particles using an X-ray free-electron laser. Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles

  15. High resolution double-sided diffractive optics for hard X-ray microscopy.

    Science.gov (United States)

    Mohacsi, Istvan; Vartiainen, Ismo; Guizar-Sicairos, Manuel; Karvinen, Petri; Guzenko, Vitaliy A; Müller, Elisabeth; Färm, Elina; Ritala, Mikko; Kewish, Cameron M; Somogyi, Andrea; David, Christian

    2015-01-26

    The fabrication of high aspect ratio metallic nanostructures is crucial for the production of efficient diffractive X-ray optics in the hard X-ray range. We present a novel method to increase their structure height via the double-sided patterning of the support membrane. In transmission, the two Fresnel zone plates on the two sides of the substrate will act as a single zone plate with added structure height. The presented double-sided zone plates with 30 nm smallest zone width offer up to 9.9% focusing efficiency at 9 keV, that results in a factor of two improvement over their previously demonstrated single-sided counterparts. The increase in efficiency paves the way to speed up X-ray microscopy measurements and allows the more efficient utilization of the flux in full-field X-ray microscopy.

  16. X-ray diffraction at Bragg angles around π/2

    International Nuclear Information System (INIS)

    Mayolo, C.M.G. de.

    1991-01-01

    X-ray diffraction at Bragg angles around π/2 is studied from the theoretical and experimental points of view. The proposed corrections to the dynamical theory in the θ β ≅ π/2 cases, has been reviewed showing the equivalence between two formalisms leading to a corrected expression for the dependence of the angular parameter y with the angle of incidence. An expression for y valid in the conventional and θ β ≅ π/2 cases has been obtained. A general expression for Bragg law and for energy resolution after a Bragg diffraction was also deduced. (author)

  17. X-ray diffraction, neutron diffraction and analysis of molecular structures

    International Nuclear Information System (INIS)

    Fontecilla-Camps, J.C.

    1997-01-01

    The only method that is capable to show the atomic structure of most of macromolecules is the X ray diffraction; neutron diffraction is mostly used for the localization of hydrogen atoms, too light to be detected by X ray diffraction. With the growing number of known structures, the molecular crystallographic study may combine the molecular replacement technique and the co-crystallization method, or use the new Laue method, and leads to the functional and topological analysis of biological molecular structures

  18. Nano structured materials studied by coherent X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Gulden, Johannes

    2013-03-15

    Structure determination with X-rays in crystallography is a rapidly evolving field. Crystallographic methods for structure determination are based on the assumptions about the crystallinity of the sample. It is vital to understand the structure of possible defects in the crystal, because they can influence the structure determination. All conventional methods to characterize defects require a modelling through simulated data. No direct methods exist to image the core of defects in crystals. Here a new method is proposed, which will enable to visualize the individual scatterers around and at defects in crystals. The method is based on coherent X-ray scattering. X-rays are perfectly suited since they can penetrate thick samples and buried structures can be investigated Recent developments increased the coherent flux of X-Ray sources such as synchrotrons by orders of magnitude. As a result, the use of the coherent properties of X-rays is emerging as a new aspect of X-ray science. New upcoming and operating X-ray laser sources will accelerate this trend. One new method which has the capacity to recover structural information from the coherently scattered photons is Coherent X-ray Diffraction Imaging (CXDI). The main focus of this thesis is the investigation of the structure and the dynamics of colloidal crystals. Colloidal crystals can be used as a model for atomic crystals in order to understand the growth and defect structure. Despite the large interest in these structures, many details are still unknown.Therefore, it is vital to develop new approaches to measure the core of defects in colloidal crystals. After an introduction into the basics of the field of coherent X-ray scattering, this thesis introduces a novel method, Small Angle Bragg Coherent Diffractive Imaging, (SAB-CDI). This new measurement technique which besides the relevance to colloidal crystals can be applied to a large variety of nano structured materials. To verify the experimental possibilities the

  19. Nano structured materials studied by coherent X-ray diffraction

    International Nuclear Information System (INIS)

    Gulden, Johannes

    2013-03-01

    Structure determination with X-rays in crystallography is a rapidly evolving field. Crystallographic methods for structure determination are based on the assumptions about the crystallinity of the sample. It is vital to understand the structure of possible defects in the crystal, because they can influence the structure determination. All conventional methods to characterize defects require a modelling through simulated data. No direct methods exist to image the core of defects in crystals. Here a new method is proposed, which will enable to visualize the individual scatterers around and at defects in crystals. The method is based on coherent X-ray scattering. X-rays are perfectly suited since they can penetrate thick samples and buried structures can be investigated Recent developments increased the coherent flux of X-Ray sources such as synchrotrons by orders of magnitude. As a result, the use of the coherent properties of X-rays is emerging as a new aspect of X-ray science. New upcoming and operating X-ray laser sources will accelerate this trend. One new method which has the capacity to recover structural information from the coherently scattered photons is Coherent X-ray Diffraction Imaging (CXDI). The main focus of this thesis is the investigation of the structure and the dynamics of colloidal crystals. Colloidal crystals can be used as a model for atomic crystals in order to understand the growth and defect structure. Despite the large interest in these structures, many details are still unknown.Therefore, it is vital to develop new approaches to measure the core of defects in colloidal crystals. After an introduction into the basics of the field of coherent X-ray scattering, this thesis introduces a novel method, Small Angle Bragg Coherent Diffractive Imaging, (SAB-CDI). This new measurement technique which besides the relevance to colloidal crystals can be applied to a large variety of nano structured materials. To verify the experimental possibilities the

  20. Design and fabrication of micro X-ray diffraction system

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yang Soon; Han, Sun Ho; Kim, Jong Goo; Jee, Kwang Yong

    2006-10-15

    It has been observed that microstructure changes occur at the pellet periphery(rim) of the fuel at very high burn-up. Despite its narrow range (below some hundreds microns in depth), this peripheral region(rim) determines the behaviour of nuclear fuel. To determine lattice parameter with XRD at intervals as small as 30-50 {mu} m in radial direction of irradiated fuel samples, a micro X-ray diffraction system was designed and fabricated. This report describes the micro X-ray diffraction system consisted of an X-ray microbeam alignment system and a sample micro translation system, its characterization, and its performance test through the analysis for the micro region of some specimens. This system will be set in a radiation shielded glove box, and then used for analysis of lattice parameter change and the phase change at intervals as small as 30-50 {mu} m in radial direction of the rim of an irradiated fuel sample and a fuel cladding.

  1. Classifying and assembling two-dimensional X-ray laser diffraction patterns of a single particle to reconstruct the three-dimensional diffraction intensity function: resolution limit due to the quantum noise

    International Nuclear Information System (INIS)

    Tokuhisa, Atsushi; Taka, Junichiro; Kono, Hidetoshi; Go, Nobuhiro

    2012-01-01

    A new algorithm is developed for reconstructing the high-resolution three-dimensional diffraction intensity function of a globular biological macromolecule from many quantum-noise-limited two-dimensional X-ray laser diffraction patterns, each for an unknown orientation. The structural resolution is expressed as a function of the incident X-ray intensity and quantities characterizing the target molecule. A new two-step algorithm is developed for reconstructing the three-dimensional diffraction intensity of a globular biological macromolecule from many experimentally measured quantum-noise-limited two-dimensional X-ray laser diffraction patterns, each for an unknown orientation. The first step is classification of the two-dimensional patterns into groups according to the similarity of direction of the incident X-rays with respect to the molecule and an averaging within each group to reduce the noise. The second step is detection of common intersecting circles between the signal-enhanced two-dimensional patterns to identify their mutual location in the three-dimensional wavenumber space. The newly developed algorithm enables one to detect a signal for classification in noisy experimental photon-count data with as low as ∼0.1 photons per effective pixel. The wavenumber of such a limiting pixel determines the attainable structural resolution. From this fact, the resolution limit due to the quantum noise attainable by this new method of analysis as well as two important experimental parameters, the number of two-dimensional patterns to be measured (the load for the detector) and the number of pairs of two-dimensional patterns to be analysed (the load for the computer), are derived as a function of the incident X-ray intensity and quantities characterizing the target molecule

  2. Serial femtosecond X-ray diffraction of enveloped virus microcrystals

    Directory of Open Access Journals (Sweden)

    Robert M. Lawrence

    2015-07-01

    Full Text Available Serial femtosecond crystallography (SFX using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ∼700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ∼40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is an important step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.

  3. Growth of ω inclusions in Ti alloys: An X-ray diffraction study

    International Nuclear Information System (INIS)

    Šmilauerová, J.; Harcuba, P.; Pospíšil, J.; Matěj, Z.; Holý, V.

    2013-01-01

    We investigated the size and crystal structure of nanometer-sized ω inclusions in single crystals of β-Ti alloys by X-ray diffraction pole-figure measurements and reciprocal space mapping. We studied the topotactical relation of the β and ω crystal lattices, and from the positions and shapes of the diffraction maxima of the ω lattice determined the mean size of the ω inclusions and the misfit of the inclusion lattice with respect to the host lattice, as well as their changes during ageing. The lattice of the ω inclusions exhibits a large positive misfit already before ageing and the misfit is subsequently reduced during the ageing process. Using the theories of elasticity and X-ray scattering we simulated diffuse X-ray scattering around the β diffraction maxima and demonstrated that the diffuse scattering is caused mainly by local elastic strains in the β host phase around the ω inclusions

  4. Identifications studies of Lauha Bhasma by X-ray diffraction and X-ray fluorescence.

    Science.gov (United States)

    Bhargava, S C; Reddy, K R C; Sastry, G V S

    2012-01-01

    Procedures for preparation of Lauha Bhasma are described in ancient texts of Ayurveda. These procedures also begin with different source material for iron such as Teekshna Lauha and Kanta Lauha etc. In the present study, we have selected different source materials viz. magnetite iron ore for Kanta Lauha and pure (Armco grade) iron turnings for Teekshna Lauha. The standard procedures of preparation of Lauha Bhasma are carried out in identical conditions for these two raw materials. The final product from the Puta are characterized by using X-ray diffraction and X-ray fluorescence spectroscopy to understanding the crystallographic form or forms of iron oxides and their composition at the end of each Puta. The iron content at the end of repeated Putas (18 for Kanta Lauha and 20 for Teekshna Lauha) have shown a decrease in case of Teekshna Lauha since the starting material is pure iron while it showed only marginal decreases in the case of Kanta Lauha because the Fe(3)O(4) of magnetite is undergoing oxidation to Fe(2)O(3). The trace elements remain within the Bhasma in the form of various oxides of Si, Al, Ca, etc.

  5. Surface analysis of dental amalgams by X-ray photoelectron spectroscopy and X-ray diffraction.

    Science.gov (United States)

    Uo, Motohiro; Berglund, Anders; Cardenas, Juan; Pohl, Lars; Watari, Fumio; Bergman, Maud; Sjöberg, Staffan

    2003-11-01

    It is important to characterize the surface of dental amalgam in order to understand the process of mercury release from amalgam restorations in the oral cavity. The mercury evaporation occurs not only from the newly made restoration but also from the set material. The surfaces of four different types of amalgams, which had been well set, were analyzed with X-ray photoelectron spectroscopy (XPS) and X-ray diffraction (XRD) and the relationship between surface compositions and mercury release was studied. Fresh amalgam surfaces as well as aged surfaces, which were stored for 30 days in air, were investigated using XPS and the chemical states of amalgam components and oxygen were studied. The aged surfaces were also characterized with XRD and grazing angle XRD. With increased oxidation, the surface contents of tin and oxygen were increased in all amalgams. In contrast, the surface contents of copper and mercury were decreased. An increase of zinc or indium content were observed in zinc or indium containing amalgams, respectively. A surface layer enriched with indium and oxygen was clearly detected by XPS but not with grazing angle XRD. The thickness of the enriched surface layer is estimated to be in the order of few nanometer, which is approximately equal to the analysis depth of XPS. In addition, the presence of metallic elements, like tin and zinc, that readily form a stable oxide layer at the surface suppress the release of mercury.

  6. High-pressure single-crystal synchrotron X-ray diffraction of kainite (KMg(SO4) Cl 3H2O)

    Science.gov (United States)

    Nazzareni, S.; Comodi, P.; Hanfland, M.

    2018-03-01

    Kainite (KMg(SO4) Cl 3H2O) is a "mixed-salt" sulfate from the group of evaporitic minerals more soluble than Ca-sulfate hydrate and NaCl. The compressibility and structural modifications of monoclinic (sp. gr. C2/m) kainite up to a pressure of 14 GPa were studied by high-pressure single-crystal synchrotron X-ray diffraction. Kainite remains stable over the investigated pressure range and no phase transition was recognised. The bulk modulus is K 0 = 31.6 (1) GPa, with K' fixed to 4, as obtained by fitting the P-volume data with a second-order Birch-Murnaghan EoS (BM2); instead of using a BM3 EoS, we obtained K 0 = 32.2(5) GPa, K' =3.8 (1). The linear moduli calculated for the lattice parameters fitting the data with a BM3 EoS are for a-axis M 0a = 117(4) GPa, Mpa = 11(1), for b-axis M 0b = 113(2) GPa, Mpc = 8.6(5), and c-axis M 0c = 68.2(3) GPa, Mpc = 14(1). Structure refinements showed a strong compression of the K polyhedra and in particular K(1) and K(3) polyhedra have similar polyhedral bulk moduli: K 0K(1) = 20.8(7) GPa, K'=4.8(3); K 0K(2) = 29(1) GPa, K'=8.1(6); K 0K(3) = 26(1) GPa, K'=4.2(4). The most compressible bond distances are K(1)-Cl(2) with a shortening of about 13%, K(1)-Cl(1) with a shortening of about 10%, K(3)-Ow(6) and K(3)-O8(B) both with a shortening of 9%. S-tetrahedra are almost incompressible and Mg-octahedra bulk moduli are K 0Mg(2) = 102(4) GPa, and K 0Mg(4) = 72(1) GPa, K 0Mg(1) = 41(4) GPa K'= 8.9(1.7), and K 0Mg(3) = 65(5) GPa K'= 10(2). The strain tensor analysis indicates that the most compressible direction of the kainite monoclinic structure is oriented 29.7(2)° from the c-axis in the (0 1 0) plane. The shortening of the K(1)-K(2) distance (from 4.219(4) Å at ambient P to 3.521(7) Å at 11.9 GPa) and the different compressibilities of the octahedra/tetrahedra may explain why the stiffer direction of kainite is in the a-c plane approximatively along the direction where K(1)-K(2) and Mg(4)-Mg(3)-Mg(4) polyhedra align. This may

  7. X-ray diffraction imaging of biological cells

    CERN Document Server

    Nakasako, Masayoshi

    2018-01-01

    In this book, the author describes the development of the experimental diffraction setup and structural analysis of non-crystalline particles from material science and biology. Recent advances in X-ray free electron laser (XFEL)-coherent X-ray diffraction imaging (CXDI) experiments allow for the structural analysis of non-crystalline particles to a resolution of 7 nm, and to a resolution of 20 nm for biological materials. Now XFEL-CXDI marks the dawn of a new era in structural analys of non-crystalline particles with dimensions larger than 100 nm, which was quite impossible in the 20th century. To conduct CXDI experiments in both synchrotron and XFEL facilities, the author has developed apparatuses, named KOTOBUKI-1 and TAKASAGO-6 for cryogenic diffraction experiments on frozen-hydrated non-crystalline particles at around 66 K. At the synchrotron facility, cryogenic diffraction experiments dramatically reduce radiation damage of specimen particles and allow tomography CXDI experiments. In addition, in XFEL ex...

  8. Rapid structure determination of the hydrogen-containing compound Cs2C2O4.H2O by joint single-crystal X-ray and powder neutron diffraction.

    Science.gov (United States)

    Weller, Mark T; Henry, Paul F; Light, Mark E

    2007-06-01

    The structure determination of caesium oxalate monohydrate using single-crystal X-ray diffraction, powder neutron diffraction data and a combination of both has been undertaken. Results show that even for hydrogen-containing materials data collected rapidly on a high-flux neutron diffractometer improve the refinement such that accurate positional and thermal displacement parameters can be extracted for all atom types. This contrasts with structural models extracted from either data set alone that demonstrate the inherent limitations of the individual diffraction methods. The rapidity with which useful neutron diffraction data has been collected from hydrogen-containing compounds, 10 min in this study, indicates that the technique should be widely applicable allowing the facile and accurate extraction of hydrogen positions for many compounds.

  9. Experimental Charge Density in an Oxidized Trinuclear Iron Complex using 15 K Synchrotron and 100 K Conventional Single-Crystal X-ray Diffraction

    International Nuclear Information System (INIS)

    Overgaard, J.; Larsen, F.; Timco, G.; Iversen, B.

    2009-01-01

    The experimental electron density distribution in a crystal consisting of the simplest conceivable trinuclear carboxylate-bridged iron-μ3-oxo dianion with two α-picolinium cations has been determined using both synchrotron (15 K) and conventional (100 K) X-ray diffraction data. The constituent trinuclear oxo-centered molecule consists of six 2-bridging formate groups between the iron pairs, while the axial ligand for all iron atoms is another formate group. The compound {(Fe3O(HCOO)6(HCOO)3)2-·H2O·2(α-CH3NC5H5)+}, ( 1) crystallizes in the monoclinic space group P21/m with charge assisted hydrogen bonds linking the α-picolinium cations to the trinuclear groups. The chemical bonding in the weakly asymmetric Fe3O-core of 1 has been examined through the use of the quantum theory of atoms in molecules, and in combination with experimental d-orbital populations, a significant electron sharing is observed between the Fe atoms and the central oxygen. The central oxygen exhibits clear sp2 hybridization, and the iron atoms have valence shell charge concentrations in all metal-ligand bond directions. The relative bond strengths are evaluated based upon the charge density distribution and found to be in accordance with the geometrical results. Integrated group charges follow expectations from formal chemical valences.

  10. Software system for X-ray diffraction quantitative phase analysis

    International Nuclear Information System (INIS)

    Fuentes, L.; Herrera, V.; Rubio, E.

    1989-01-01

    A system of experimental methods and computer programs for X-ray diffraction analysis is presented. The most important cases occurring in practice are considered. Program MARIA for spectral analysis is described. The external standard method for powder analysis is presented. Program STANDEXT calculates the sample absorption coefficient, the concentrations and standard deviations by a least squares method. For the case of partly identified samples, the internal standard method is developed. All measured peak are considered in the calculations. Program STANDINT solves the concentrations of the identified phases, their errors and the sample's absorption coefficient. A modification is introduced in the so-called direct method for massive sample analysis. The effect of texture is characterized by model representation of the inverse pole figure associated to the sample diffracting surface. Program DIREC is proposed for titting texture-modulated theoretical diffraction patterns to experimental ones, thus calculating phase concentrations and corresponding errors. Examples are given in some applications

  11. Modern trends in x-ray powder diffraction

    International Nuclear Information System (INIS)

    Goebel, H.E.; Snyder, R.L.

    1985-01-01

    The revival of interest in X-ray powder diffraction, being quoted as a metamorphosis from the 'ugly duckling' to a 'beautiful swan', can be attributed to a number of modern developments in instrumentation and evaluation software. They result in faster data collection, improved accuracy and resolution, and better detectability of minor phases. The ease of data evaluation on small computers coupled direct to the instrument allows convenient execution of previously tedious and time-consuming off-line tasks like qualitative and quantitative analysis, characterization of microcrystalline properties, indexing, and lattice-constant refinements, as well as structure refinements or even exploration of new crystal structures. Powder diffraction has also progressed from an isolated analytical laboratory method to an in situ technique for analysing solid-state reactions or for the on-stream control of industrial processes. The paper surveys these developments and their real and potential applications, and tries to emphasize new trends that are regarded as important steps for the further progress of X-ray powder diffraction

  12. Automation of a Guinier camera for X-ray diffraction

    International Nuclear Information System (INIS)

    Duijn, J.H.

    1988-01-01

    The automation of a Guinier X-ray diffraction camera is discussed. The photographic plate in the conventional setup has been replaced by a curved proportional counter (CPC) which has an electronic readout system. As a result the recording time has been reduced from a few hours to a few minutes. The construction and optimum dimensions of the CPC are discussed and the most essential parts of the readout electronics are highlighted. A linewidth of 200 μm FWHM and an accuracy of 30 μm are achieved. 45 refs.; 53 figs.; 4 tabs

  13. Ultrafast X-Ray Diffraction of Heterogeneous Solid Hydrogen

    Energy Technology Data Exchange (ETDEWEB)

    Levitan, Abraham [Olin College of Engineering, Needham, MA (United States)

    2015-08-19

    Angularly resolved x-ray diffraction at 5.5 keV establishes the structure of a 5 µm diameter solid hydrogen jet, providing a foundation for analysis of hydrogen in a warm dense matter state. The jet was composed of approximately 65 % ± 5% HCP and 35 % ± 5% FCC by volume with an average crystallite size on the order of hundreds of nanometers. Broadening in the angularly resolved spectrum provided strong evidence for anisotropic strain up to approximately 3 % in the HCP lattice. Finally, we found no evidence for orientational ordering of the crystal domains.

  14. Oxides neutron and synchrotron X-ray diffraction studies

    CERN Document Server

    Sosnowska, I M

    1999-01-01

    We review some results from several areas of oxide science in which neutron scattering and X-ray synchrotron scattering exercise a complementary role to high-resolution transmission electron microscopy. The very high-resolution time-of-flight neutron diffraction technique and its role in studies of the magnetic structure of oxides is especially reviewed. The selected topics of structural studies for the chosen oxides are: crystal and magnetic structure of the so-called cellular random systems, magnetic structure and phase transitions in ferrites and the behaviour of water in non-stoichiometric protonic conductors and in the opal silica-water system. (40 refs).

  15. X-ray diffraction analysis device with electronic photon counter

    International Nuclear Information System (INIS)

    Fillit, R.Y.; Bruyas, H.; Patay, F.

    1985-01-01

    The means provided to control the movements around the three axes are composed of step-by-step motors related to exits control logic which is connected to the calculation and monitored by a clock. The clock monitors also the calculator so as that the calculator controls, together with the programmable clock and control logic, the coordination of the whole rotation movements, along the three rotation axes, their velocity, their duration and the acquisition of the measured intensities of the diffracted X-ray beam [fr

  16. Synchrotron X-ray diffraction using triple-axis spectrometry

    International Nuclear Information System (INIS)

    Als-Nielsen, J.

    1980-12-01

    High resolution X-ray diffraction studies of (i) monolayers of the noble gases Kr and Ar physiosorbed on graphite (ii) smectic A fluctuations in the nematic and the smectic A phases of liquid crystals are described. The apparatus used is a triple axis spectrometer situated at the storage ring DORIS at Hasylab, DESY, Hamburg. A monochromatic, well collimated beam is extracted from the synchrotron radiation spectrum by Bragg reflection from perfect Si or Ge crystals. The direction of the beam scattered from the sample is determined by Bragg reflection from a perfect Si or Ge crystal. High intensities even with resolution extending beyond the wavelength of visible light can be obtained. (Auth.)

  17. Powder X-ray diffraction study af alkali alanates

    DEFF Research Database (Denmark)

    Cao, Thao; Mosegaard Arnbjerg, Lene; Jensen, Torben René

    Powder X-ray diffraction study of alkali alanates Thao Cao, Lene Arnbjerg, Torben R. Jensen. Center for Materials Crystallography (CMC), Center for Energy Materials (CEM), iNANO and Department of Chemistry, Aarhus University, DK-8000, Denmark. Abstract: To meet the energy demand in the future...... for mobile applications, new materials with high gravimetric and volumetric storage capacity of hydrogen have to be developed. Alkali alanates are promising for hydrogen storage materials. Sodium alanate stores hydrogen reversibly at moderate conditions when catalysed with, e.g. titanium, whereas potassium...

  18. Electron density study of urea using TDS-corrected X-ray diffraction data: quantitative comparison of experimental theoretical results

    NARCIS (Netherlands)

    Zavodnik, Valery; Stash, Adam; Tsirelson, Vladimir; Feil, D.; de Vries, R.Y.; Feil, Dirk

    1999-01-01

    The electron-density distribution in urea, CO(NH2)2, was studied by high-precision single-crystal X-ray diffraction analysis at 148 (1) K. An experimental correction for TDS was applied to the X-ray intensities. Rmerge(F2) = 0.015. The displacement parameters agree quite well with results from

  19. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.

    1992-01-01

    The term open-quote Variable-Metricclose quotes (V-M) when applied to diffraction crystals refers to a crystal in which the spacing between crystalline planes varies with the position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes. The variation in the crystalline spacing of a V-M crystal can be produced by introducing a thermal gradient in the crystal. This approach works well when the over-all percentage change in the lattice spacing is small (less than 0.1 %). For V-M crystals where the over-all change in spacing is the order of 0.1 percent or larger, it is more practical to produce the change in crystal spacing by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. One of the simplest applications of this type of crystal diffraction optics is to use V-M crystals to increase the number of photon per unit bandwidth in a diffracted x-ray beam. Typical enhancement factors of 3 to 20 are possible with wiggler sources. For near perfect silicon crystals the rocking curve for (111) planes is typically 8.5 arc seconds at 8 keV and 2.6 arc seconds at 20 keV. If one changes the crystalline spacing to match the change in the incident angle of the beam on the crystalline planes, then the full surface of the diffraction crystal will diffract the same wavelength x-ray. The increase in flux per unit bandwidth in the diffracted beam is 6 to 1 and 20 to 1 for the 8 keV and 20 keV x-rays, respectively, for the NSLS example. In most of the experiments the changes in crystalline spacings were generated with thermal gradients. One set of experiments used a V-M crystal grown with a variable percentage of germanium and silicon. This crystal had a 0.1 percent change in crystal spacing in 1 mm of distance in the crystal

  20. Graphical method for analyzing wide-angle x-ray diffraction

    Science.gov (United States)

    Chen, XiaoHui; Xue, Tao; Liu, DongBing; Yang, QingGuo; Luo, BinQiang; Li, Mu; Li, XiaoYa; Li, Jun

    2018-01-01

    Wide-angle X-ray diffraction on large-scale laser facility is a well-established experimental method, which is used to study the shock response of single crystal materials by recording X-rays diffracted from numerous lattice planes. We present a three-dimensional graphical method for extracting physical understanding from the raw diffraction data in shocked experiments. This method advances beyond the previous iterative process by turning abstract diffraction theories in shock physics into mathematic issues, providing three-dimensional visualization and quick extraction of data characteristics. The capability and versatility of the method are exhibited by identifying lattice planes for single crystal samples with different orientations and quantitatively measuring the lattice compression and rotation under dynamic loading.

  1. Controlled molecules for X-ray diffraction experiments at free-electron lasers

    International Nuclear Information System (INIS)

    Stern, Stephan

    2013-12-01

    performed on a gas-phase ensemble of the prototypical molecule 2,5-diiodobenzonitrile (C 7 H 3 I 2 N, DIBN) at the X-ray free-electron laser LCLS. The target molecules were laser-aligned along a common axis in the laboratory frame by a Nd:YAG laser. Reaching a strong degree of molecular alignment, was an important step in this experiment. Therefore, a significant part of the work was dedicated to gaining control of the molecular degrees of freedom. In order to reach a high degree of alignment, the target molecules were prepared in low rotational quantum states by means of efficient cooling in a supersonic expansion from a pulsed valve followed by spatial quantum-state selection in an electrostatic deflector. Utilization of the deflector significantly improved alignment of the DIBN molecules. Further applications of the deection technique such as, e.g., the spatial separation of several species of molecular complexes/clusters are presented in this thesis as well. The quantum-state selected and strongly laser-aligned samples were probed by the X-ray pulses of LCLS and the obtained diffraction patterns show a significant difference when comparing diffraction from aligned and isotropically-distributed DIBN which agrees well with theory. The results represent an important step in the effort of pushing diffractive imaging of non-crystalline samples at XFELs towards the single-molecule limit. Concepts and experimental requirements for future experiments of this kind are discussed, involving, e.g., the step towards imaging of laser-aligned large (bio)macromolecules or imaging of ultrafast fragmentation dynamics in femtosecond pump-probe experiments at XFELs.

  2. Controlled molecules for X-ray diffraction experiments at free-electron lasers

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Stephan

    2013-12-15

    performed on a gas-phase ensemble of the prototypical molecule 2,5-diiodobenzonitrile (C{sub 7}H{sub 3}I{sub 2}N, DIBN) at the X-ray free-electron laser LCLS. The target molecules were laser-aligned along a common axis in the laboratory frame by a Nd:YAG laser. Reaching a strong degree of molecular alignment, was an important step in this experiment. Therefore, a significant part of the work was dedicated to gaining control of the molecular degrees of freedom. In order to reach a high degree of alignment, the target molecules were prepared in low rotational quantum states by means of efficient cooling in a supersonic expansion from a pulsed valve followed by spatial quantum-state selection in an electrostatic deflector. Utilization of the deflector significantly improved alignment of the DIBN molecules. Further applications of the deection technique such as, e.g., the spatial separation of several species of molecular complexes/clusters are presented in this thesis as well. The quantum-state selected and strongly laser-aligned samples were probed by the X-ray pulses of LCLS and the obtained diffraction patterns show a significant difference when comparing diffraction from aligned and isotropically-distributed DIBN which agrees well with theory. The results represent an important step in the effort of pushing diffractive imaging of non-crystalline samples at XFELs towards the single-molecule limit. Concepts and experimental requirements for future experiments of this kind are discussed, involving, e.g., the step towards imaging of laser-aligned large (bio)macromolecules or imaging of ultrafast fragmentation dynamics in femtosecond pump-probe experiments at XFELs.

  3. Qualitative analysis of powder x-ray diffraction data

    International Nuclear Information System (INIS)

    Raftery, T.

    1999-01-01

    based methods of considering significant lines such as with the Hanawalt, Fink and alphabetical index; computer based search-match based on FOM and the more recent graphically based full pattern methods of phase identification. No single approach is foolproof. a range of techniques is recommended if a high level of success is required. Copyright (1999) Australian X-ray Analytical Association Inc

  4. Characterization of Brazilian asphalt using X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Edson R.; Pinto, Nivia G.V.; Almeida, Ana P.G.; Braz, Delson; Lopes, Ricardo T. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Lab. de Instrumentacao Nuclear], E-mail: ecardoso@lin.ufrj.br; Barroso, Regina C. [Universidade do Estado do Rio de Janeiro (UERJ), Rio de Janeiro, RJ (Brazil). Inst. de Fisica], E-mail: cely@uerj.br; Motta, Laura M.G. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Lab. de Geotecnia], E-mail: laura@coc.ufrj.br

    2007-07-01

    Asphalt is a sticky, black and highly viscous liquid or semi-solid that is presented in most crude petroleum and in some natural deposits. The X ray diffraction can give valuable information over the characteristics of a material. Thus, the X-ray diffraction (XRD) method was employed to investigate parameters that characterize and differentiate asphalt groups (Boscan, CAP20, CAP40, CAP50/60, CAP50/70 and CAP85/100). The scattering measurements were carried out in {theta}-2{theta} reflection geometry using a powder diffractometer Shimadzu XRD-6000 at the Nuclear Instrumentation Laboratory, Brazil. Scans were typically done from 8 deg to 28 deg every 0.05. The parameters analyzed were: FWHM, peak area, peak center, peak height, left half width and right half width. Thus, in this study, scattering profiles from different asphalt groups were carefully measured in order to establish characteristic signatures of these materials. The results indicate that by using three parameters (peak centroid, peak area and peak intensity) it is possible to characterize and differentiate the asphalt. (author)

  5. X-ray Diffraction Study of Arsenopyrite at High Pressure

    Energy Technology Data Exchange (ETDEWEB)

    D Fan; M Ma; W Zhou; S Wei; Z Chen; H Xie

    2011-12-31

    The high-pressure X-ray diffraction study of a natural arsenopyrite was investigated up to 28.2 GPa using in situ angle-dispersive X-ray diffraction and a diamond anvil cell at National Synchrotron Light Source, Brookhaven National Laboratory. The 16:3:1 methanol-ethanol-water mixture was used as a pressure-transmitting medium. Pressures were measured using the ruby-fluorescence method. No phase change has been observed up to 28.2 GPa. The isothermal equation of state (EOS) was determined. The values of K{sub 0}, and K'{sub 0} refined with a third-order Birch-Murnaghan EOS are K{sub 0} = 123(9) GPa, and K'{sub 0} = 5.2(8). Furthermore, we confirm that the linear compressibilities ({beta}) along a, b and c directions of arsenopyrite is elastically isotropic ({beta}{sub a} = 6.82 x 10{sup -4}, {beta}{sub b} = 6.17 x 10{sup -4} and {beta}{sub c} = 6.57 x 10{sup -4} GPa{sup -1}).

  6. Quantification of rutile in anatase by X-ray diffraction

    International Nuclear Information System (INIS)

    Chavez R, A.

    2001-01-01

    Nowadays the discovering of new and better materials required in all areas of the industry has been lead to the human being to introduce him to this small and great world. The crystalline materials, have properties markedly directional. When it is necessary to realize a quantitative analysis to these materials the task is not easy. The main objective of this work is the research of a real problem, its solution and perfecting of a technique involving the theoretical and experimental principles which allow the quantification of crystalline phases. The chapter 1 treats about the study of crystalline state during the last century, by means of the X-ray diffraction technique. The chapter 2 studies the nature and production of X-rays, the chapter 3 expounds the principles of the diffraction technique which to carry out when it is satisfied the Bragg law studying the powder diffraction method and its applications. In the chapter 4 it is explained how the intensities of the beams diffracted are determined by the atoms positions inside of the elemental cell of the crystal. The properties of the crystalline samples of anatase and rutile are described in the chapter 5. The results of this last analysis are the information which will be processed by means of the auxiliary software: Diffrac AT, Axum and Peakfit as well as the TAFOR and CUANTI software describing this part with more detail in the chapters 6 and 7 where it is mentioned step by step the function of each software until to reach the quantification of crystalline phases, objective of this work. Finally, in the chapter 8 there are a results analysis and conclusions. The contribution of this work is for those learned institutions of limited resources which can tackle in this way the characterization of materials. (Author)

  7. Classifying and assembling two-dimensional X-ray laser diffraction patterns of a single particle to reconstruct the three-dimensional diffraction intensity function: resolution limit due to the quantum noise.

    Science.gov (United States)

    Tokuhisa, Atsushi; Taka, Junichiro; Kono, Hidetoshi; Go, Nobuhiro

    2012-05-01

    A new two-step algorithm is developed for reconstructing the three-dimensional diffraction intensity of a globular biological macromolecule from many experimentally measured quantum-noise-limited two-dimensional X-ray laser diffraction patterns, each for an unknown orientation. The first step is classification of the two-dimensional patterns into groups according to the similarity of direction of the incident X-rays with respect to the molecule and an averaging within each group to reduce the noise. The second step is detection of common intersecting circles between the signal-enhanced two-dimensional patterns to identify their mutual location in the three-dimensional wavenumber space. The newly developed algorithm enables one to detect a signal for classification in noisy experimental photon-count data with as low as ~0.1 photons per effective pixel. The wavenumber of such a limiting pixel determines the attainable structural resolution. From this fact, the resolution limit due to the quantum noise attainable by this new method of analysis as well as two important experimental parameters, the number of two-dimensional patterns to be measured (the load for the detector) and the number of pairs of two-dimensional patterns to be analysed (the load for the computer), are derived as a function of the incident X-ray intensity and quantities characterizing the target molecule. © 2012 International Union of Crystallography

  8. X-Ray Diffraction and Fluorescence Instrument for Mineralogical Analysis at the Lunar Surface, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a compact and lightweight X-Ray Diffraction (XRD) / X-Ray Fluorescence (XRF) instrument for analysis of mineralogical composition of regolith,...

  9. X-Ray Diffraction and Fluorescence Instrument for Mineralogical Analysis at the Lunar Surface, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop LUNA, a compact and lightweight X-Ray Diffraction (XRD) / X-Ray Fluorescence (XRF) instrument for mineralogical analysis of regolith, rock...

  10. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.; Fernandez, P.B.

    1992-01-01

    A variable-metric (VM) crystal is one in which the spacing between the crystalline planes changes with position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes of interest and can be produced by either introducing a thermal gradient in the crystal or by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. A series of experiments were performed in the laboratory to demonstrate the principle of the variable-metric crystal and its potential use in synchrotron beam lines. One of the most useful applications of the VM crystal is to increase the number of photons per unit bandwidth in a diffracted beam without losing any of the overall intensity. In a normal synchrotron beam line that uses a two-crystal monochromator, the bandwidth of the diffracted photon beam is determined by the vertical opening angle of the beam which is typically 0.10--0.30 mrad or 20--60 arcsec. When the VM crystal approach is applied, the bandwidth of the beam can be made as narrow as the rocking curve of the diffracting crystal, which is typically 0.005--0.050 mrad or 1--10 arcsec. Thus a very large increase of photons per unit bandwidth (or per unit energy) can be achieved through the use of VM crystals. When the VM principle is used with bent crystals, new kinds of x-ray optical elements can be generated that can focus and defocus x-ray beams much like simple lenses where the focal length of the lens can be changed to match its application. Thus both large magnifications and large demagnifications can be achieved as well as parallel beams with narrow bandwidths

  11. Advances in thin film diffraction instrumentation by X-ray optics

    International Nuclear Information System (INIS)

    Haase, A.

    1996-01-01

    The structural characterisation of thin films requires a parallel X-ray beam of high intensity. Parallel beam geometry is commonly used in high resolution and single crystal experiments, but also in the field of X-ray diffraction for polycrystalline material (e.g. in phase, texture and stress analysis). For grazing incidence diffraction (GID), the use of small slits on the primary side and of long soller slits with a flat monochromator on the secondary side is standard. New optical elements have been introduced with polychromatic or monochromatic radiation. By means of different applications the results are compared with those of classical beam optics. X-ray fiber optics utilize total external reflection of X-rays on smooth surfaces. Effects of monochromatization are presented. In many fields of application, fiber optics may replace conventional collimators. The use of primary and secondary channel cut crystals can also produce a high parallel monochromatic X-ray beam. A parabolically bent graded multilayer produces a monochromatic parallel beam of high intensity. Compared with classical Bragg-Brentano (focussing) geometry, excellent results have been obtained, especially for samples with an irregular shape. In combination with a channel cut monochromator there is a substantial gain in intensity leading to an increase of the dynamic intensity range of rocking curves

  12. Advances in thin film diffraction instrumentation by X-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Haase, A. [Rich. Seifert and Co., Analytical X-ray Systems, Ahrensburg (Germany)

    1996-09-01

    The structural characterisation of thin films requires a parallel X-ray beam of high intensity. Parallel beam geometry is commonly used in high resolution and single crystal experiments, but also in the field of X-ray diffraction for polycrystalline material (e.g. in phase, texture and stress analysis). For grazing incidence diffraction (GID), the use of small slits on the primary side and of long soller slits with a flat monochromator on the secondary side is standard. New optical elements have been introduced with polychromatic or monochromatic radiation. By means of different applications the results are compared with those of classical beam optics. X-ray fiber optics utilize total external reflection of X-rays on smooth surfaces. Effects of monochromatization are presented. In many fields of application, fiber optics may replace conventional collimators. The use of primary and secondary channel cut crystals can also produce a high parallel monochromatic X-ray beam. A parabolically bent graded multilayer produces a monochromatic parallel beam of high intensity. Compared with classical Bragg-Brentano (focussing) geometry, excellent results have been obtained, especially for samples with an irregular shape. In combination with a channel cut monochromator there is a substantial gain in intensity leading to an increase of the dynamic intensity range of rocking curves.

  13. The first X-ray diffraction measurements on Mars

    Directory of Open Access Journals (Sweden)

    David Bish

    2014-11-01

    Full Text Available The Mars Science Laboratory landed in Gale crater on Mars in August 2012, and the Curiosity rover then began field studies on its drive toward Mount Sharp, a central peak made of ancient sediments. CheMin is one of ten instruments on or inside the rover, all designed to provide detailed information on the rocks, soils and atmosphere in this region. CheMin is a miniaturized X-ray diffraction/X-ray fluorescence (XRD/XRF instrument that uses transmission geometry with an energy-discriminating CCD detector. CheMin uses onboard standards for XRD and XRF calibration, and beryl:quartz mixtures constitute the primary XRD standards. Four samples have been analysed by CheMin, namely a soil sample, two samples drilled from mudstones and a sample drilled from a sandstone. Rietveld and full-pattern analysis of the XRD data reveal a complex mineralogy, with contributions from parent igneous rocks, amorphous components and several minerals relating to aqueous alteration. In particular, the mudstone samples all contain one or more phyllosilicates consistent with alteration in liquid water. In addition to quantitative mineralogy, Rietveld refinements also provide unit-cell parameters for the major phases, which can be used to infer the chemical compositions of individual minerals and, by difference, the composition of the amorphous component.

  14. [Diffraction gratings used in x-ray spectroscopy]: Final report

    International Nuclear Information System (INIS)

    Smith, H.I.

    1988-01-01

    This subcontract was initiated in order to facilitate the development at MIT of technologies for fabricating the very fine diffraction grating required in x-ray spectroscopy at Lawrence Livermore Laboratory (LLL). These gratings are generally gold transmission gratings with spatial periods of 200 nm or less. The major focus of our efforts was to develop a means of fabricating gratings of 100 nm period. We explored two approaches: e-beam fabrication of x-ray lithography masks, and achromatic holographic lithography. This work was pursued by Erik Anderson as a major component of his Ph.D. thesis. Erik was successful in both the e-beam and holographic approaches. However, the e-beam method proved to be highly impractical: exposure times of about 115 days would be required to cover an area of 1 cm 2 . The achromatic holography, on the other hand, should be capable of exposing areas well in excess of 1 cm 2 in times under 1 hour. Moreover, 100 nm-period gratings produced by achromatic holography are coherent over their entire area whereas gratings produced by e-beam lithography are coherent only over areas /approximately/100 μm. The remainder of this report consists of portions excerpted from Erik Anderson's thesis. These contain all the details of our work on 100 nm period gratings. 26 refs., 17 figs

  15. Ultrafast coherent diffractive imaging of nanoparticles using X-ray free-electron laser radiation

    International Nuclear Information System (INIS)

    Kassemeyer, Stephan

    2014-01-01

    Coherent diffractive imaging with X-ray free-electron lasers (X-FEL) promises high-resolution structure determination of single microscopic particles without the need for crystallization. The diffraction signal of small samples can be very weak, a difficulty that can not be countered by merely increasing the number of photons because the sample would be damaged by a high absorbed radiation dose. Traditional X-ray crystallography avoids this problem by bringing many sample particles into a periodic arrangement, which amplifies the individual signals while distributing the absorbed dose. Depending on the sample, however, crystallization can be very difficult or even impossible. This thesis presents algorithms for a new imaging approach using X-FEL radiation that works with single, non-crystalline sample particles. X-FELs can deliver X-rays with a peak brilliance many orders of magnitude higher than conventional X-ray sources, compensating for their weak interaction cross sections. At the same time, FELs can produce ultra-short pulses down to a few femtoseconds. In this way it is possible to perform ultra-fast imaging, essentially ''freezing'' the atomic positions in time and terminating the imaging process before the sample is destroyed by the absorbed radiation. This thesis primarily focuses on the three-dimensional reconstruction of single (and not necessarily crystalline) particles using coherent diffractive imaging at X-FELs: in order to extract three-dimensional information from scattering data, two-dimensional diffraction patterns from many different viewing angles must be combined. Therefore, the diffraction signal of many identical sample copies in random orientations is measured. The main result of this work is a globally optimal algorithm that can recover the sample orientations solely based on the diffraction signal, enabling three-dimensional imaging for arbitrary samples. The problem of finding three-dimensional orientations is

  16. X-ray diffraction patterns of thermally-reduced graphenes

    International Nuclear Information System (INIS)

    Ju, Hae-Mi; Choi, Sung-Ho; Huh, Seung-Hun

    2010-01-01

    Thermally-reduced graphenes (GPs) from graphene oxides (GOs) in the range of 200 - 800 .deg. C have been investigated by using X-ray diffraction (XRD). The temperature-dependent evolutions of the (002) peaks show that exfoliation of GO sheets occurs, along with wrinkling, at ∼200 .deg. C and that high-quality GPs are produced at ∼ 600 .deg. C (GP 600 ). These phenomena are explained by the vaporization of intercalated water molecules and the effective removal of the oxide groups of GO by thermal annealing, respectively. GP 600 exhibited a clean and sharp (002) peak corresponding to an interlayer distance of 3.392 A, which is close to that of conventional graphene (∼3.4 A). The structure of GP 600 is further discussed.

  17. Powder X-ray diffraction laboratory, Reston, Virginia

    Science.gov (United States)

    Piatak, Nadine M.; Dulong, Frank T.; Jackson, John C.; Folger, Helen W.

    2014-01-01

    The powder x-ray diffraction (XRD) laboratory is managed jointly by the Eastern Mineral and Environmental Resources and Eastern Energy Resources Science Centers. Laboratory scientists collaborate on a wide variety of research problems involving other U.S. Geological Survey (USGS) science centers and government agencies, universities, and industry. Capabilities include identification and quantification of crystalline and amorphous phases, and crystallographic and atomic structure analysis for a wide variety of sample media. Customized laboratory procedures and analyses commonly are used to characterize non-routine samples including, but not limited to, organic and inorganic components in petroleum source rocks, ore and mine waste, clay minerals, and glassy phases. Procedures can be adapted to meet a variety of research objectives.

  18. Quantitative biological imaging by ptychographic X-ray diffraction microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Giewekemeyer, Klaus; Kalbfleisch, Sebastian; Beerlink, Andre; Salditt, Tim [Institut fuer Roentgenphysik, Georg-August-Universitaet Goettingen (Germany); Thibault, Pierre; Dierolf, Martin; Pfeiffer, Franz [Department Physik (E17), Technische Universitaet Muenchen, Garching (Germany); Kewish, Cameron M. [Paul Scherrer Institut, Villigen PSI (Switzerland)

    2010-07-01

    Mesoscopic structures with specific functions are abundant in many cellular systems and have been well characterized by electron microscopy in the past. However, the quantitative study of the three-dimensional structure and density of subcellular components remains a difficult problem. In this contribution we show how these limitations could be overcome in the future by the application of recently introduced and now rapidly evolving coherent X-ray imaging techniques for quantitative biological imaging on the nanoscale. More specifically, we report on a recent scanning (ptychographic) diffraction experiment on unstained and unsliced freeze-dried cells of the bacterium Deinococcus radiourans using only a pinhole as beam defining optical element. As a result quantitative density projections well below optical resolution have been achieved.

  19. Innovative in Situ Ball Mill for X-ray Diffraction.

    Science.gov (United States)

    Ban, Voraksmy; Sadikin, Yolanda; Lange, Michael; Tumanov, Nikolay; Filinchuk, Yaroslav; Černý, Radovan; Casati, Nicola

    2017-12-19

    The renewed interest of mechanochemistry as an ecofriendly synthetic route has inspired original methodologies to probe reactions, with the aim to rationalize unknown mechanisms. Recently, Friščić et al. ( Nat. Chem. 2013 , 5 , 66 - 73 , DOI: 10.1038/nchem.1505 ) monitored the progress of milling reactions by synchrotron X-ray powder diffraction (XRPD). For the first time, it was possible to acquire directly information during a mechanochemical process. This new methodology is still in its early stages, and its development will definitively transform the fundamental understanding of mechanochemistry. A new type of in situ ball mill setup has been developed at the Materials Science beamline (Swiss Light Source, Paul Scherrer Institute, Switzerland). Its particular geometry, described here in detail, results in XRPD data displaying significantly lower background and much sharper Bragg peaks, which in turn allow more sophisticated analysis of mechanochemical processes, extending the limits of the technique.

  20. X-ray diffraction study of choline chloride's β form

    International Nuclear Information System (INIS)

    Petrouleas, V.; Lemmon, R.M.; Christensen, A.

    1978-01-01

    The organic salt choline chloride exists in two crystalline polymorphs. One (the α form) is extraordinarily sensitive to ionizing radiation, the other (the β form) is not. The present report describes an x-ray diffraction study of the β form. The structure has been found to be highly disordered face centered cubic. A reasonable least-square refinement of the intensity data has been achieved in the centrosymmetric space group Fm3 or Fm3m by use of a molecular model with restrained bond lengths. The results show that in the β form the electronic density due to the choline cation is closely spaced around the N, so that hydrogen bonding to the chloride is unlikely. Comparison with infrared and NMR data indicates that the disordering is dynamic and can be ascribed to rotations of the choline ion around crystallographic symmetry axes. Possible connections of these results with the radiation stability of the β form are discussed

  1. Analysis of the corium phases by X-ray diffraction

    International Nuclear Information System (INIS)

    Trillon, G.

    2004-01-01

    In the framework of the severe accidents R and D studies led by CEA, the better knowledge of the corium behaviour, corium coming from the melting of a nuclear reactor, are fundamental stakes in order to master this kind of accident. Among the available physical properties of the corium, the nature of the final crystalline compounds which have been made during the, cooling gives information about its solidification and its stabilisation. X-Rays Diffraction is the reference method used in order to characterize the corium coming from the different facilities of the European platform PLINIUS of CEA-Cadarache. This work presents the scientific approach that has been followed in order to obtain information both qualitative and quantitative on corium, using X-Rays Diffraction. For instance, a specific method for identifying U 1-x Zr x O 2 solid solutions has been developed, and the validity of quantitative analysis of corium crystalline phases using the Rietveld method (with an internal standard), has been tested. This last method has also permitted semi-quantitative measurements of amorphous phases within corium. For these studies, analysis of prototypical corium has been conducted on samples coming from the experiences led on the different facilities of the PLINIUS platform. These analysis allowed for the first time to obtain quantitative data of the corium crystalline phases in order to validate thermodynamic databases and has been used to estimate the thereto-physical properties of the corium. New information on crystalline phases of corium has also been found, especially for the UO 2 -ZrO 2 pseudo binary system. (author)

  2. Phosphor Scanner For Imaging X-Ray Diffraction

    Science.gov (United States)

    Carter, Daniel C.; Hecht, Diana L.; Witherow, William K.

    1992-01-01

    Improved optoelectronic scanning apparatus generates digitized image of x-ray image recorded in phosphor. Scanning fiber-optic probe supplies laser light stimulating luminescence in areas of phosphor exposed to x rays. Luminescence passes through probe and fiber to integrating sphere and photomultiplier. Sensitivity and resolution exceed previously available scanners. Intended for use in x-ray crystallography, medical radiography, and molecular biology.

  3. Nanostructured diffractive optical devices for soft X-ray microscopes

    CERN Document Server

    Hambach, D; Schneider, G

    2001-01-01

    The new transmission X-ray microscope (TXM) installed at the BESSY II electron storage ring uses an off-axis transmission zone plate (OTZ) as diffractive and focusing element of the condenser-monochromator setup. A high resolution micro-zone plate (MZP) forms a magnified image on a CCD-detector. Both, the OTZ with an active area of up to 24 mm sup 2 and the MZP with zone widths as small as 25 nm are generated by a process including electron beam lithography (EBL), dry etching and subsequent electroplating of nickel on top of silicon membrane substrates with about 100-150 nm thickness. The combination of a larger zone width and the usage of nickel zone structures allows to increase the diffraction efficiency of the condenser element at least by a factor of 3 compared to the earlier used KZP7 condenser zone plate in the TXM at BESSY I. Groove diffraction efficiencies of 21.6% and 14.7% were measured for MZP objectives with 40 and 25 nm outermost zone width, respectively.

  4. Fundamentals of powder x-ray diffraction practice

    International Nuclear Information System (INIS)

    Raftery, T.

    2002-01-01

    Full text: The goal of powder Xray diffraction is to gain information about a specimen or sample. Key aspects of this goal are 1. the sample selection, preparation and presentation; 2. the data collection process and conditions; 3. the interaction between these and the interpretation of the data. The 'ideal' powder (or polycrystalline) xray diffraction sample is fine grained, randomly orientated, homogenous and representative. There exists standard sample selection and preparation techniques for powders - sometimes however, the required information must be gained by alternate sample selection and preparation techniques. While there are few variables in the data collection process, there are some significant ones such as matching diffractometer resolution and intensity to the data collection goal whether that is phase identity, quantitative analysis or structure refinement, etc. There are also options of optical arrangement (Bragg-Brintano versus parallel beam versus Debye-Scherrer). One important aspect of the collection process is the assessment of the data quality. Powder xray diffraction has many applications from the straight-forward confirmation of phase identity and purity to structural analysis. Some of these applications will be considered and the interaction between the goal of the application and aspects of sample selection. Copyright (2002) Australian X-ray Analytical Association Inc

  5. Ultrafast time-resolved X-ray diffraction using an optimized laser-plasma based X-ray source

    International Nuclear Information System (INIS)

    Lu, Wei

    2013-01-01

    Femtosecond X-ray pulses are invaluable tools to investigate the structural dynamics triggered by a femtosecond laser pulse. These ultrashort X-ray pulses can be provided by lab-sized laser-produced plasma X-ray sources. This thesis is dedicated to optimizing the X-ray emission from the X-ray source at the University of Duisburg-Essen and using this source to investigate ultrafast structural dynamics in laser excited materials. For these purposes, detailed investigations on how the laser intensities, target thicknesses, angles of incidence and different pre-pulse/pre-plasma conditions affecting the emission of Kα-photons from Cu and Ti targets were performed. The outcomes from these studies are applied to optimize the X-ray production of the existing X-ray source for time resolved X-ray diffraction (TRXD) experiments. In the mean time, in order to improve the measurement sensitivity/accuracy, and automatize and speed up the experimental procedures, several other improvements have been implemented in the experimental setup for TRXD experiments. These improvements of the setup are essential to achieve the results of the three TRXD experiments discussed in this thesis. In the first experiment, Debye-Waller effect in a thin laser-excited Au film was observed. The drop of measured diffraction signal with a decay time constant of 4.3±1 ps was measured for high excitation fluences. This result is in good agreement with previous experimental results as well as the Two-Temperature Model (TTM) calculations at high fluences. The second experiment extends the studies of coherent optical phonons in laser-excited Bi to a higher excitation fluence range that has not been investigated previously. Large amplitude coherent atomic motion and a complete softening of the A1g phonon mode were observed. These observations represents conclusive experimental evidence that the Peierls distortion, which defines the equilibrium structure of Bi, vanishes and the material is transformed into

  6. Neutron and X-ray diffraction from modulated structures

    International Nuclear Information System (INIS)

    Harris, P.

    1994-07-01

    This thesis describes X-ray and neutron scattering experiments performed on two examples of modulated structures. After an introduction to the subject of modulated structures, the thesis is divided in three parts. A single crystal elastic neutron scattering experiment between 4.2 and 115 Κ has been performed and four-circle X-ray data have been collected at 8 Κ for the monoclinic low-temperature phase of the layered perovskite PAMC. The results from the neutron scattering experiment indicate that magnetoelastic effects influence the ordering of the crystal. The X-ray experiments have made it possible to determine the crystal structure in the low-temperature phase. The superspace group is P2 1 /b(β-30)Os, with β = 1/3. A small-angle neutron scattering experiment has been performed on the magnetic structure of manganese silicide. When a magnetic field is applied, the modulation vectors turn towards the field direction, showing domain growth and diverging peak widths as they approach the field direction. Phase 'A' is established to have the modulation vectors directed perpendicular to the field direction. Cooling in zero field shows increasing peak widths at low temperatures, indicating a lock-in transition below the lowest reached temperature. To be able to analyse the data of the magnetic order in MnSi, and analytical calculation of the three dimensional resolution function for a small-angle neutron scattering spectrometer has been performed. The calculation is done by application of a combination of phase space analysis and Gaussian approximations for the neutron distribution as well as for the transmission functions of the different apertures. A finite mosaic spread of the crystal and finite correlation widths of the Bragg reflections have been included in the cross section. (au) (3 tabs., 48 ills., 100 refs.)

  7. Moessbauer spectroscopy and X-ray diffraction study of 304 L stainless steel thin films

    International Nuclear Information System (INIS)

    Boubeker, B.; Eymery, J.P.; Goudeau, P.; Sayouty, E.H.

    1994-01-01

    304 L stainless steel films (SS) were elaborated using an ion-beam sputtering technique. The target material was a sheet of commercial grade 304 L SS. The starting material was first analysed by both conversion electron Moessbauer spectroscopy (CEMS) and X-ray diffraction. The nonmagnetic state and f.c.c. structure of this material were confirmed. The films were deposited on various substrates with thicknesses in the 175-800 nm range. The films are found to have both b.c.c. structure and ferromagnetic character. X-ray diffraction technique was also used in order to determine the residual stresses developed during the deposition process. The second stage of the work is devoted to the evolution of the film structure as a function of annealing treatments. So isochronal and isothermal kinetics at temperatures higher than 913 K have allowed to follow the alpha --> gamma phase transformation using X-ray diffraction and CEMS technique.The X-ray diffractograms reveal the existence of both b.c.c. and f.c.c. phases. Similar results can be deduced from Moessbauer spectra due to the single line coming from the non-magnetic phase and the sextet coming from the ferromagnetic phase. In addition the CEMS spectra reveal that the ferromagnetic component is split into two parts which indicates the existence of two iron sites. 1 fig., 4 refs.(author)

  8. A laboratory based system for Laue micro x-ray diffraction

    Science.gov (United States)

    Lynch, P. A.; Stevenson, A. W.; Liang, D.; Parry, D.; Wilkins, S.; Tamura, N.

    2007-02-01

    A laboratory diffraction system capable of illuminating individual grains in a polycrystalline matrix is described. Using a microfocus x-ray source equipped with a tungsten anode and prefigured monocapillary optic, a micro-x-ray diffraction system with a 10 μm beam was developed. The beam profile generated by the ellipsoidal capillary was determined using the "knife edge" approach. Measurement of the capillary performance, indicated a beam divergence of 14 mrad and a useable energy bandpass from 5.5 to 19 keV. Utilizing the polychromatic nature of the incident x-ray beam and application of the Laue indexing software package X-Ray Micro-Diffraction Analysis Software, the orientation and deviatoric strain of single grains in a polycrystalline material can be studied. To highlight the system potential the grain orientation and strain distribution of individual grains in a polycrystalline magnesium alloy (Mg 0.2 wt % Nd) was mapped before and after tensile loading. A basal (0002) orientation was identified in the as-rolled annealed alloy; after tensile loading some grains were observed to undergo an orientation change of 30° with respect to (0002). The applied uniaxial load was measured as an increase in the deviatoric tensile strain parallel to the load axis.

  9. Spectral X-Ray Diffraction using a 6 Megapixel Photon Counting Array Detector.

    Science.gov (United States)

    Muir, Ryan D; Pogranichniy, Nicholas R; Muir, J Lewis; Sullivan, Shane Z; Battaile, Kevin P; Mulichak, Anne M; Toth, Scott J; Keefe, Lisa J; Simpson, Garth J

    2015-03-12

    Pixel-array array detectors allow single-photon counting to be performed on a massively parallel scale, with several million counting circuits and detectors in the array. Because the number of photoelectrons produced at the detector surface depends on the photon energy, these detectors offer the possibility of spectral imaging. In this work, a statistical model of the instrument response is used to calibrate the detector on a per-pixel basis. In turn, the calibrated sensor was used to perform separation of dual-energy diffraction measurements into two monochromatic images. Targeting applications include multi-wavelength diffraction to aid in protein structure determination and X-ray diffraction imaging.

  10. X-ray diffraction using the time structure of the SRS

    International Nuclear Information System (INIS)

    Tanner, B.K.

    1983-01-01

    The subject is discussed under the headings: introduction (advances in the techniques of X-ray topography; comparison with transmission electron microscopy); stroboscopic X-ray topography; stroboscopic X-ray topography of travelling surface acoustic waves; possible general diffraction experiments. (U.K.)

  11. IL 12: Femtosecond x-ray powder diffraction

    International Nuclear Information System (INIS)

    Woerner, M.; Zamponi, F.; Rothhardt, P.; Ansari, Z.; Dreyer, J.; Freyer, B.; Premont-Schwarz, M.; Elsaesser, T.

    2010-01-01

    A chemical reaction generates new compounds out of one or more initial species. On a molecular level, the spatial arrangement of electrons and nuclei changes. While the structure of the initial and the product molecules can be measured routinely, the transient structures and molecular motions during a reaction have remained unknown in most cases. This knowledge, however, is a key element for the exact understanding of the reaction. The ultimate dream is a 'reaction microscope' which allows for an in situ imaging of the molecules during a reaction. We report on the first femtosecond x-ray powder diffraction experiment in which we directly map the transient electronic charge density in the unit cell of a crystalline solid with 30 pico-meter spatial and 100 femtosecond temporal resolution. X-ray diffraction from polycrystalline powder samples, the Debye Scherrer diffraction technique, is a standard method for determining equilibrium structures. The intensity of the Debye Scherrer rings is determined by the respective x-ray structure factor which represents the Fourier transform of the spatial electron density. In our experiments, the transient intensity and angular positions of up to 20 Debye Scherrer reactions from a polycrystalline powder are measured and unravel for the first time a concerted electron and proton transfer in hydrogen-bonded ionic (NH 4 ) 2 SO 4 crystals. Photoexcitation of ammonium sulfate induces a sub-100 fs electron transfer from the sulfate groups into a highly conned electron channel along the z-axis of the unit cell. The latter geometry is stabilized by transferring protons from the adjacent ammonium groups into the channel. Time-dependent charge density maps derived from the diffraction data display a periodic modulation of the channels charge density by low-frequency lattice motions with a concerted electron and proton motion between the channel and the initial proton binding site. A deeper insight into the underlying microscopic

  12. Identification of inversion domains in KTiOPO{sub 4}via resonant X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Fabrizi, Federica, E-mail: federica.fabrizi@diamond.ac.uk [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom); Thomas, Pamela A. [Department of Physics, University of Warwick, Coventry, CV4 7AL (United Kingdom); Nisbet, Gareth; Collins, Stephen P. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom)

    2015-05-14

    The identification and high-resolution mapping of the absolute crystallographic structure in multi-domain ferroelectric KTiOPO{sub 4} is achieved through a novel synchrotron X-ray diffraction method. On a single Bragg reflection, the intensity ratio in resonant diffraction below and above the Ti absorption K edge demonstrates a domain contrast up to a factor of ∼270, thus implementing a non-contact, non-destructive imaging technique with micrometre spatial resolution, applicable to samples of arbitrarily large dimensions. A novel method is presented for the identification of the absolute crystallographic structure in multi-domain polar materials such as ferroelectric KTiOPO{sub 4}. Resonant (or ‘anomalous’) X-ray diffraction spectra collected across the absorption K edge of Ti (4.966 keV) on a single Bragg reflection demonstrate a huge intensity ratio above and below the edge, providing a polar domain contrast of ∼270. This allows one to map the spatial domain distribution in a periodically inverted sample, with a resolution of ∼1 µm achieved with a microfocused beam. This non-contact, non-destructive technique is well suited for samples of large dimensions (in contrast with traditional resonant X-ray methods based on diffraction from Friedel pairs), and its potential is particularly relevant in the context of physical phenomena connected with an absence of inversion symmetry, which require characterization of the underlying absolute atomic structure (such as in the case of magnetoelectric coupling and multiferroics)

  13. Correct interpretation of diffraction properties of quartz crystals for X-ray optics applications

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xian-Rong; Gog, Thomas; Kim, Jungho; Kasman, Elina; Said, Ayman H.; Casa, Diego M.; Wieczorek, Michael; Hönnicke, Marcelo G.; Assoufid, Lahsen

    2018-02-01

    Quartz has hundreds of strong Bragg reflections that may offer a great number of choices for making fixed-angle X-ray analyzers and polarizers at virtually any hard X-ray energies with selectable resolution. However, quartz crystals, unlike silicon and germanium, are chiral and may thus appear in two different forms of handedness that are mirror images. Furthermore, because of the threefold rotational symmetry along thecaxis, the {h1h2h3L} and {h2h1h3L} Bragg reflections may have quite different Darwin bandwidth, reflectivity and angular acceptance, although they have the same Bragg angle. The design of X-ray optics from quartz crystals therefore requires unambiguous determination of the orientation, handedness and polarity of the crystals. The Laue method and single-axis diffraction technique can provide such information, but the variety of conventions used in the literature to describe quartz structures has caused widespread confusion. The current studies give detailed guidelines for design and fabrication of quartz X-ray optics, with special emphasis on the correct interpretation of Laue patterns in terms of the crystallography and diffraction properties of quartz. Meanwhile, the quartz crystals examined were confirmed by X-ray topography to have acceptably low densities of dislocations and other defects, which is the foundation for developing high-resolution quartz-based X-ray optics.

  14. High-Resolution Detector For X-Ray Diffraction

    Science.gov (United States)

    Carter, Daniel C.; Withrow, William K.; Pusey, Marc L.; Yost, Vaughn H.

    1988-01-01

    Proposed x-ray-sensitive imaging detector offers superior spatial resolution, counting-rate capacity, and dynamic range. Instrument based on laser-stimulated luminescence and reusable x-ray-sensitive film. Detector scans x-ray film line by line. Extracts latent image in film and simultaneously erases film for reuse. Used primarily for protein crystallography. Principle adapted to imaging detectors for electron microscopy and fluorescence spectroscopy and general use in astronomy, engineering, and medicine.

  15. Two digital X-ray imaging systems for applications in X-ray diffraction

    International Nuclear Information System (INIS)

    Bateman, J.E.; Connolly, J.F.; Stephenson, R.; Flesher, A.C.; Bryant, C.J.; Lincoln, A.D.; Tucker, P.A.; Swanton, S.W.

    1986-08-01

    Two digital X-ray imaging systems developed at the Rutherford Appleton Laboratory are described:- the Mark I and the Mark II. Both use a bidimensionally sensitive Multiwire proportional counter as the basic X-ray image transducer coupled to a digital microcomputer system. The Mark I system provides the advantages of high speed, high sensitivity digital imaging directly into the computer with the potential for software control of the sample orientation and environment. The Mark II system adds the novel features of signal averaging and multi-frame exposures. (author)

  16. The CCP14 project: software for x-ray diffraction analysts

    International Nuclear Information System (INIS)

    Cranswick, L.

    2002-01-01

    Full text: The primary role of the UK EPSRC funded Collaborative Computational Project No 14 for Single Crystal and Powder Diffraction (CCP14) is to provide freely available crystallographic software to academics and students. While the CCP14 routinely concentrates on crystallographic applications (crystal structure solution and structure refinement), there is still a variety of software useful and freely available to X-ray analysts. As it is routinely important for X-ray analysts to keep up to date with effective new methods and time saving improvements, this presentation will concentrate on techniques relevant to most X-ray analysts - from data conversion to unit cell refinement to quantitative analysis and some structure refinement tools. Emphasis will also be put on the fact that crystallographic and powder diffraction programs are best not used as a black box. While point and click software tools are available, it can be very important to understand the theory behind what they are doing. Mentioned software can be downloaded via the CCP14 website in the UK (www.ccp14.ac.uk/mirror/), with full regional mirrors in the USA, Canada and Australia. Copyright (2002) Australian X-ray Analytical Association Inc

  17. Diffraction measurements of residual macrostress and microstress using x-rays, synchrotron and neutrons

    International Nuclear Information System (INIS)

    Tanaka, Keisuke; Akiniwa, Yoshiaki

    2004-01-01

    The present paper reviews some recent developments of the measurements of the macrostress and microstress by diffraction using X-rays, synchrotron and neutrons especially in Japan. These three methods are based on the same principle of the diffraction of crystals, and have different advantages. The conventional X-rays detect the stress very near the surface, while the neutron diffraction takes the stress in the interior of the materials. High-energy X-rays from synchrotron sources have the penetration depth in between and are suitable for the measurement of subsurface stresses. After describing the developments of the fundamentals of the methods, the paper covers the recent applications of the diffraction methods to the residual stress analysis in textured thin films, the nondestructive determination of the subsurface distribution of residual stress in shot-peened materials, local stress measurements near the crack tip, the stress measurements of single crystals, macrostress and microstress measurements in composites, and the determination of the internal distribution of the residual stress in welded joints. (author)

  18. Applications of the Warren-Averbach method of X-ray diffraction line profile analysis

    International Nuclear Information System (INIS)

    Ichikawa, Rodrigo Uchida

    2013-01-01

    The objective of this work was to develop and implement a methodology of X-ray Line Profile Analysis (XLPA) for the study and determination of the mean crystallite sizes and microstrains in materials. A computer program was developed to speed up the treatment of diffraction peaks and perform the deconvolution utilizing the Stokes method to correct the instrumental contribution in the X-ray diffraction measurements. The XLPA methods used were the Scherrer, Williamson-Hall and Single-Line methods, which can be called real space methods, and the Fourier space method of Warren-Averbach. Furthermore, considering a mathematical modelling it was possible to calculate the crystallite size distribution, considering the log-normal distribution and spherical crystallites. It was possible to demonstrate the proposed theory can provide reliable results evaluating a dispersion parameter. The methodologies described above were applied in two distinct materials: in the alloy Zircaloy-4 and in ZnO. (author)

  19. Spectral feature variations in x-ray diffraction imaging systems

    Science.gov (United States)

    Wolter, Scott D.; Greenberg, Joel A.

    2016-05-01

    Materials with different atomic or molecular structures give rise to unique scatter spectra when measured by X-ray diffraction. The details of these spectra, though, can vary based on both intrinsic (e.g., degree of crystallinity or doping) and extrinsic (e.g., pressure or temperature) conditions. While this sensitivity is useful for detailed characterizations of the material properties, these dependences make it difficult to perform more general classification tasks, such as explosives threat detection in aviation security. A number of challenges, therefore, currently exist for reliable substance detection including the similarity in spectral features among some categories of materials combined with spectral feature variations from materials processing and environmental factors. These factors complicate the creation of a material dictionary and the implementation of conventional classification and detection algorithms. Herein, we report on two prominent factors that lead to variations in spectral features: crystalline texture and temperature variations. Spectral feature comparisons between materials categories will be described for solid metallic sheet, aqueous liquids, polymer sheet, and metallic, organic, and inorganic powder specimens. While liquids are largely immune to texture effects, they are susceptible to temperature changes that can modify their density or produce phase changes. We will describe in situ temperature-dependent measurement of aqueous-based commercial goods in the temperature range of -20°C to 35°C.

  20. X-Ray Powder Diffraction with Guinier - Haegg Focusing Cameras

    International Nuclear Information System (INIS)

    Brown, Allan

    1970-12-01

    The Guinier - Haegg focusing camera is discussed with reference to its use as an instrument for rapid phase analysis. An actual camera and the alignment procedure employed in its setting up are described. The results obtained with the instrument are compared with those obtained with Debye - Scherrer cameras and powder diffractometers. Exposure times of 15 - 30 minutes with compounds of simple structure are roughly one-sixth of those required for Debye - Scherrer patterns. Coupled with the lower background resulting from the use of a monochromatic X-ray beam, the shorter exposure time gives a ten-fold increase in sensitivity for the detection of minor phases as compared with the Debye - Scherrer camera. Attention is paid to the precautions taken to obtain reliable Bragg angles from Guinier - Haegg film measurements, with particular reference to calibration procedures. The evaluation of unit cell parameters from Guinier - Haegg data is discussed together with the application of tests for the presence of angle-dependent systematic errors. It is concluded that with proper calibration procedures and least squares treatment of the data, accuracies of the order of 0.005% are attainable. A compilation of diffraction data for a number of compounds examined in the Active Central Laboratory at Studsvik is presented to exemplify the scope of this type of powder camera

  1. X-ray conductivity of ZnSe single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Degoda, V. Ya., E-mail: degoda@univ.kiev.ua; Podust, G. P. [Taras Shevchenko Kyiv National University, Physics Department (Ukraine)

    2016-05-15

    The experimental I–V and current–illuminance characteristics of the X-ray conductivity and X-ray luminescence of zinc-selenide single crystals feature a nonlinear shape. The performed theoretical analysis of the kinetics of the X-ray conductivity shows that even with the presence of shallow and deep traps for free charge carriers in a semiconductor sample, the integral characteristics of the X-ray conductivity (the current–illuminance and I–V dependences) should be linear. It is possible to assume that the nonlinearity experimentally obtained in the I–V and current–illuminance characteristics can be caused by features of the generation of free charge carriers upon X-ray irradiation, i.e., the generation of hundreds of thousands of free charge carriers of opposite sign in a local region with a diameter of <1 μm and Coulomb interaction between the free charge carriers of opposite signs.

  2. X-Ray Diffraction and the Discovery of the Structure of DNA

    Science.gov (United States)

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  3. Modelling the X-ray powder diffraction of nitrogen-expanded austenite using the Debye formula

    DEFF Research Database (Denmark)

    Oddershede, Jette; Christiansen, Thomas; Ståhl, Kenny

    2008-01-01

    Stress-free and homogeneous samples of nitrogen-expanded austenite, a defect-rich f.c.c. structure with a high interstitial nitrogen occupancy (between 0.36 and 0.61), have been studied using X-ray powder diffraction and Debye simulations. The simulations confirm the presence of deformation...... to be indistinguishable to X-ray powder diffraction....

  4. Multiflash X ray with Image Detanglement for Single Image Isolation

    Science.gov (United States)

    2017-08-31

    conceived and developed to capture multiple flash X-rays on a single film or phosphor screen and digitally detangle the resulting image into separate images...capability was conceived and developed to capture multiple flash X-rays on a single film or phosphor screen and digitally detangle the resulting image...digital radiograph (ORAD); and 2) an appropriate averaging of the value of the pixels within the exposed region-of-interest on the ORAD needs to be

  5. On the theory of time-resolved x-ray diffraction

    DEFF Research Database (Denmark)

    Henriksen, Niels Engholm; Møller, Klaus Braagaard

    2008-01-01

    We derive the basic theoretical formulation for X-ray diffraction with pulsed fields, using a fully quantized description of light and matter. Relevant time scales are discussed for coherent as well as incoherent X-ray pulses, and we provide expressions to be used for calculation of the experimen......We derive the basic theoretical formulation for X-ray diffraction with pulsed fields, using a fully quantized description of light and matter. Relevant time scales are discussed for coherent as well as incoherent X-ray pulses, and we provide expressions to be used for calculation...... of the experimental diffraction signal for both types of X-ray sources. We present a simple analysis of time-resolved X-ray scattering for direct bond breaking in diatomic molecules. This essentially analytical approach highlights the relation between the signal and the time-dependent quantum distribution...

  6. Source assemblage types for cratonic diamonds from X-ray synchrotron diffraction

    Science.gov (United States)

    Nestola, F.; Alvaro, M.; Casati, M. N.; Wilhelm, H.; Kleppe, A. K.; Jephcoat, A. P.; Domeneghetti, M. C.; Harris, J. W.

    2016-11-01

    Three single crystals of clinopyroxene trapped within three different gem-quality diamonds from the Udachnaya kimberlite (Siberia, Russia) were analysed in situ by single-crystal synchrotron X-ray diffraction in order to obtain information on their chemical composition and infer source assemblage type. A non-destructive approach was used with high-energy (≈ 60 keV; λ ≈ 0.206 Å) at I15, the extreme-conditions beamline at Diamond Light Source. A dedicated protocol was used to center the mineral inclusions located deep inside the diamonds in the X-ray beam. Our results reveal that two of the inclusions can be associated with peridotitic paragenesis whereas the third is eclogitic. This study also demonstrates that this non-destructive experimental approach is extremely efficient in evaluating the origin of minerals trapped in their diamond hosts.

  7. X-ray dosimetry of TlGaSe2 single crystals

    International Nuclear Information System (INIS)

    Kerimova, E.M.; Mustafaeva, S.N.; Mamedbeili, S.D.; Jabarov, J.N.; Iskenderova, P.M.; Kazimov, S.B.

    2002-01-01

    TlGaSe 2 compound belongs to group of layered semiconductors of A 3 B 3 C 2 6 -type. Photoelectric and optical properties of TlGaSe 2 single crystals were investigated in detail. Influence of gamma-, electron and neutron radiation on photoelectric properties of TlGaSe 2 single crystals is investigated too. The present work deals with experimental results relative to X-ray dosimetric characteristics of TlGaSe 2 crystals at 300 K. X-ray conductivity and X-ray dosimetric characteristic measurements are carried out in low load resistance regime. The source of X-ray radiation is the installation of X-ray diffraction analysis (URS-55a) with the BCV-2(Cu). Intensity of X-ray radiation (E) is regulated by measurement with current variation in tube at each given value of X-ray radiation dose E (R/min) are measured by crystal dosimeter DRGZ-02. X-ray conductivity coefficients K σ characterising X-ray sensitivity of investigated crystals are determined as the relative change of conductivity under X-ray radiation a per dose. There have been determined values of characteristic coefficients of TlGaSe 2 single crystal X-ray conductivity at different values of accelerating voltage (V a ) on the tube and corresponding doses of X-ray radiation. Analysis of obtained data showed that X-ray conductivity coefficients K σ in studied crystals are regularly decreased (from 0.276 to 0.033) as with the rise of dose (E=0.75-78.0 R/min) as with the increase of values of V a on X-ray tube (V a =254-50 keV). One of the possible reasons of observed regularities is that X-ray conductivity in investigated crystals, especially at comparatively low V a is due predominantly to radiation of thin layer of crystal. In this case with the rise of radiation intensity there have been started to prevail the mechanism of surface quadratic recombination which leads to observed decrease of X-ray conductivity. With the rise of accelerating potential 'effective hardness' is increased, as a result of which there

  8. High-energy X-ray diffraction of disordered materials in high-energy X-ray diffraction beamline BL04B2 at SPring-8

    International Nuclear Information System (INIS)

    Kohara, Shinji; Suzuya, Kentaro

    2001-01-01

    The high-energy (E≥30 keV) X-ray diffraction with the latest generation synchrotron sources as well as the introduction of advanced insertion devices has created new approaches to the quantitative study of the structure of non-crystalline materials because of several improvements: higher resolution in real space due to a wide range of Q, smaller correction terms (especially for absorption correction), reduction of truncation errors, the feasibility of running under extreme environments, including low- and high-temperatures, and of obtaining a direct comparison between X-ray and neutron diffraction data. Recently, this technique has been combined with neutron diffraction with a pulsed source to provide more detailed and reliable structural information not previously available. This article reviews and summarizes a horizontal two-axis diffractometer for non-crystalline materials, installed at the high-energy X-ray diffraction beamline BL04B2 of SPring-8, and recent results obtained from the high-energy X-ray diffraction on several oxide glasses: SiO 2 and GeO 2 . In particular, it addresses the structural models of oxide glasses obtained by the reverse Monte Carlo (RMC) modelling technique using both the high-energy X-ray and neutron diffraction data. (author)

  9. Dynamic X-ray Diffraction to study the shock-induced α - ɛ Phase Transition in Iron

    Science.gov (United States)

    Branch, Brittany; Jensen, Brian

    2017-06-01

    Iron undergoes a well-known polymorphic phase transformation from a ferromagnetic body-centered cubic (α-phase) ground state to a non-magnetic hexagonal-closed pack (ɛ-phase) crystal structure at pressures exceeding 13 GPa. With the coupling of dynamic loading platforms and advanced light sources we were able to study the α- ɛ phase transition of iron using dynamic X-ray diffraction (XRD) now available at the Advanced Photon Source (APS). Specifically, front-surface plate impact experiments were performed using single and two-stage gun systems coupled to the X-ray beam line at the new Dynamic Compression Sector (DCS) at the APS. X-ray diffraction data obtained from multiple 80 picosecond width x-ray bunches were obtained for impact stresses that spanned the a-e region of the phase diagram. The experimental methods, results, and preliminary analysis will be presented. LA-UR - 17-21401.

  10. Can isolated single black holes produce X-ray novae?

    Science.gov (United States)

    Matsumoto, Tatsuya; Teraki, Yuto; Ioka, Kunihito

    2018-03-01

    Almost all black holes (BHs) and BH candidates in our Galaxy have been discovered as soft X-ray transients, so-called X-ray novae. X-ray novae are usually considered to arise from binary systems. Here, we propose that X-ray novae are also caused by isolated single BHs. We calculate the distribution of the accretion rate from interstellar matter to isolated BHs, and find that BHs in molecular clouds satisfy the condition of the hydrogen-ionization disc instability, which results in X-ray novae. The estimated event rate is consistent with the observed one. We also check an X-ray novae catalogue (Corral-Santana et al.) and find that 16/59 ˜ 0.27 of the observed X-ray novae are potentially powered by isolated BHs. The possible candidates include IGR J17454-2919, XTE J1908-094, and SAX J1711.6-3808. Near-infrared photometric and spectroscopic follow-ups can exclude companion stars for a BH census in our Galaxy.

  11. Two digital X-ray imaging systems for applications in X-ray diffraction

    International Nuclear Information System (INIS)

    Bateman, J.E.; Connolly, J.F.; Stephenson, R.; Flesher, A.C.; Tucker, P.A.; Swanton, S.W.

    1987-01-01

    Two digital X-ray imaging systems developed at the Rutherford Appleton Laboratory are described: the Mark I and the Mark II. Both use a bidimensionally sensitive multiwire proportional counter (MWPC) as the basic X-ray image transducer coupled, in the case of the Mark I to a Digital LSI 11-23 microcomputer system via CAMAC, and in the case of the Mark II to a Digital LSI 11-73 microcomputer system via custom-built data acquisition hardware mounted directly on the Q-bus of the microcomputer. The Mark I system provides the advantages of high speed, high sensitivity digital imaging directly into the computer with the potential for software control of the sample orientation and environment. The Mark II system adds the novel features of signal averaging and multiframe exposures. The dedicated digital memories have a resolution of 512x512 pixels of 16 bits, matching well to the spatial resolution of the xenon-filled MWPC (0.5 mm fwhm over an aperture of 200 mm x 200 mm). A 512x512x4 bit video graphics system displays the images in grey scales or colour. (orig.)

  12. X-ray and neutron diffraction studies of superionic conductors: protonic compounds

    International Nuclear Information System (INIS)

    Tranqui, D.; Anne, M.

    1982-01-01

    Rapid reviews of X-ray and neutron diffraction theories and instrumentations are presented. It is shown that X-ray diffraction is a very powerful tool to determine three dimensional crystal structures. However localization of light atoms by X-ray is somewhat uncertain in compounds containing heavy atoms. In neutron diffraction the irregular but limited variation of scattering lengths of all elements within the periodic table render it possible to localize almost all atoms, especially hydrogen atoms in solids. Some recent and successful studies of protonic compounds and other by X-ray and neutron diffraction are cited. These examples demonstrate that the combined X-ray and neutron techniques should be used to obtain not only geometrical features of rigid framework in superionic conductor materials but also in an indirect way the dynamic properties of mobile ions. (author)

  13. Measurements of transient electron density distributions by femtosecond X-ray diffraction; Messungen transienter Elektronendichteverteilungen durch Femtosekunden-Roentgenbeugung

    Energy Technology Data Exchange (ETDEWEB)

    Freyer, Benjamin

    2013-05-02

    This thesis concerns measurements of transient charge density maps by femtosecond X-ray diffraction. Different X-ray diffraction methods will be considered, particularly with regard to their application in femtosecond X-ray diffraction. The rotation method is commonly used in stationary X-ray diffraction. In the work in hand an X-ray diffraction experiment is demonstrated, which combines the method with ultrafast X-ray pulses. This experiment is the first implementation which makes use of the rotation method to map transient intensities of a multitude of Bragg reflections. As a prototype material Bismuth is used, which previously was studied frequently by femtosecond X-ray diffraction by measuring Bragg reflections successively. The experimental results of the present work are compared with the literature data. In the second part a powder-diffraction experiment will be presented, which is used to study the dynamics of the electron-density distribution on ultrafast time scales. The experiment investigates a transition metal complex after photoexcitation of the metal to ligand charge transfer state. Besides expected results, i. e. the change of the bond length between the metal and the ligand and the transfer of electronic charge from the metal to the ligand, a strong contribution of the anion to the charge transfer was found. Furthermore, the charge transfer has predominantly a cooperative character. That is, the excitation of a single complex causes an alteration of the charge density of several neighboring units. The results show that more than 30 transition-metal complexes and 60 anions contribute to the charge transfer. This collective response is a consequence of the strong coulomb interactions of the densely packed ions.

  14. RASOR: an advanced instrument for soft x-ray reflectivity and diffraction.

    Science.gov (United States)

    Beale, T A W; Hase, T P A; Iida, T; Endo, K; Steadman, P; Marshall, A R; Dhesi, S S; van der Laan, G; Hatton, P D

    2010-07-01

    We report the design and construction of a novel soft x-ray diffractometer installed at Diamond Light Source. The beamline endstation RASOR is constructed for general users and designed primarily for the study of single crystal diffraction and thin film reflectivity. The instrument is comprised of a limited three circle (theta, 2theta, and chi) diffractometer with an additional removable rotation (phi) stage. It is equipped with a liquid helium cryostat, and post-scatter polarization analysis. Motorized motions are provided for the precise positioning of the sample onto the diffractometer center of rotation, and for positioning the center of rotation onto the x-ray beam. The functions of the instrument have been tested at Diamond Light Source, and initial test measurements are provided, demonstrating the potential of the instrument.

  15. Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

    Science.gov (United States)

    Leal, Ricardo M F; Callow, Shirley; Callow, Phil; Blakeley, Matthew P; Cardin, Christine J; Denny, William A; Teixeira, Susana C M; Mitchell, Edward P; Forsyth, V Trevor

    2010-11-01

    Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

  16. A conical-type X-ray guide tube for diffraction experiments with small crystals

    International Nuclear Information System (INIS)

    Nozaki, Hiroshi; Nakazawa, Hiromoto

    1986-01-01

    The divergence and intensity distribution of X-rays transported through a conical-type X-ray guide tube (XGT) were measured. Diverging X-rays from a point source were condensed by use of the conical-type XGT. The parallelism of X-rays through the XGT was better than that encountered for a cylindrical-type XGT proposed previously. The intensity of the X-ray beam around the central axis of the conical-type XGT was exceedingly high in comparison with that measured without the tube and almost uniform over a cross-sectional area 60 μm in diameter. The high intensity provides the possibility of performing diffraction experiments with crystals as small as 20 μm in diameter with a conventional X-ray diffraction system. (orig.)

  17. Neutron diffraction study of sodium hydrogen selenate Na3H5(SeO4)4. Comparison with the X-ray diffraction data

    International Nuclear Information System (INIS)

    Troyanov, S.I.; Zakharov, M.A.; Reehuis, M.; Kemnitz, E.

    2002-01-01

    The neutron diffraction study of Na 3 H 5 (SeO 4 ) 4 single crystals at 298 and 85 K has confirmed the positions of nonhydrogen atoms obtained in the X-ray diffraction study. Contrary to the X-ray diffraction data, the neutron diffraction data indicate that all the three independent protons are ordered and participate in two asymmetric and one symmetric hydrogen bonds, with the O···O distances being 2.68, 2.61, and 2.48 A. The system of hydrogen bonds is built by complicated chains

  18. Synchrotron Powder X-ray Diffraction Study of the Structure and Dehydration Behavior of Sepiolite

    Science.gov (United States)

    Post, J. E.; Bish, D. L.; Heaney, P. J.

    2006-05-01

    Sepiolite is a hydrous Mg-silicate clay mineral with fibrous morphology that typically occurs as fine-grained, poorly crystalline masses. It occurs in a wide variety of geological environments and has been mined for centuries because of its many uses, e.g. in the pharmaceutical, fertilizer, and pesticide industries. Its versatile functionality derives from the large surface area and microporosity that are characteristic of the material. In recent years, sepiolite has received considerable attention with regard to the adsorption of organics, for use as a support for catalysts, as a molecular sieve, and as an inorganic membrane for ultrafiltration. Because of its fine-grained and poorly crystalline nature, it has not been possible to study sepiolite's crystal structure using single-crystal X-ray diffraction methods, and consequently many details of the structure are still not well known. In this study, Rietveld refinements using synchrotron powder X-ray diffraction data were used to investigate the crystal structure and dehydration behavior of sepiolite from Durango, Mexico. The room- temperature (RT) sepiolite structure in air compares well with previous models but reveals an additional zeolitic water site. The RT structure under vacuum retained only ~1/8 of the zeolitic water and the volume decreased 1.3%. Real-time, temperature-resolved synchrotron powder X-ray diffraction data and Rietveld refinements were used to investigate the behavior of the sepiolite structure from 300 to 925 K. Rietveld refinements revealed that most of the zeolitic water is lost by ~390 K, accompanied by a decrease in the a and c unit-cell parameters. Above ~600 K the sepiolite structure folds as one-half of the crystallographically bound water is lost. Rietveld refinements of the "anhydrous" sepiolite structure reveal that, in general, unit-cell parameters a, b, â and volume steadily decrease with increasing temperature; there is an obvious change in slope at ~820 K suggesting a phase

  19. Measurement of thickness of thin films by the X-ray diffraction method

    International Nuclear Information System (INIS)

    Srinivasan, C.; Balasingh, C.; Singh, A.K.

    1979-07-01

    X-ray diffraction method can be used to measure the thickness of thin films (coatings). The principle and the experimental details of the x-ray diffraction methods are described. The intensities of the diffracted beams are derived assuming a random orientation of the crystallites in the diffracting medium. Consequently, the expressions are not valid when the sample has preferred orientation. To check the performance of the method, thicknesses of nickel deposits on mild steel plates were determined by the x-ray diffraction method and the results compared with those obtained by the weighing method and metallographic examination. The weighing method which gives an accuracy of +- 0.1 micron is taken as the standard. The x-ray diffraction methods and the metallographic examinations give values within +- 1 micron of the value obtained by the weighing method. (author)

  20. Physical methods for studying minerals and solid materials: X-ray, electron and neutron diffraction; scanning and transmission electron microscopy; X-ray, electron and ion spectrometry

    International Nuclear Information System (INIS)

    Eberhart, J.-P.

    1976-01-01

    The following topics are discussed: theoretical aspects of radiation-matter interactions; production and measurement of radiations (X rays, electrons, neutrons); applications of radiation interactions to the study of crystalline materials. The following techniques are presented: X-ray and neutron diffraction, electron microscopy, electron diffraction, X-ray fluorescence analysis, electron probe microanalysis, surface analysis by electron emission spectrometry (ESCA and Auger electrons), scanning electron microscopy, secondary ion emission analysis [fr

  1. X-ray micro diffraction study on mesostructured silica thin films

    CERN Document Server

    Noma, T; Miyata, H; Iida, A

    2001-01-01

    The local structure of highly ordered mesostructured silica films was investigated by using a synchrotron X-ray microbeam and a CCD X-ray detector. Two-dimensional X-ray diffraction patterns clearly showed the detailed arrangement of the mesostructures, in which the hexagonal mesochannels aligned uniaxially in the mesostructured silica films formed on a silica glass substrate with a rubbing-treated thin polyimide coating. The alignment direction was shown to be perpendicular to the rubbing direction. The grazing incidence condition revealed the structural anisotropy of the mesostructures, while normal incidence X-ray diffraction data indicated the in-plane structural uniformity of the films. Extra spots were observed in the diffraction patterns. This suggested that the X-ray beam reflected at the boundary of the mesostructured silica film and the substrate.

  2. Structural Investigations of Nanowires Using X-Ray Diffraction

    DEFF Research Database (Denmark)

    Stankevic, Tomas

    Advancements in growth of the nanowire-based devices opened another dimension of possible structures and material combinations, which nd their applications in a wide variety of elds, including everyday life. Characterization of such devices brings its own challenges and here we show that X-rays oer...

  3. (X-ray diffraction experiments with condenser matter)

    Energy Technology Data Exchange (ETDEWEB)

    Coppens, P.

    1990-01-01

    This report discusses research on the following topics: high-{Tc} superconductors; The response of crystal to an applied electric field; quasicrystals; surface structure and kinetics of surface layer formation; EXAFS studies of superconductors and heterostructures; effect of iron on the crystal structure of perovskite; x-ray detector development; and SAXS experiments. (LSP)

  4. Electronic structure of nanoscale Cu/Pt alloys: A combined X-ray diffraction and X-ray absorption investigations

    International Nuclear Information System (INIS)

    Chen Xing; Chu Wangsheng; Cai Quan; Xia Dingguo; Wu Zhonghua; Wu Ziyu

    2006-01-01

    PVP-protected Cu/Pt clusters were prepared by glycol/water reduction method and characterized with transmission electron microscopy (TEM), X-ray diffraction (XRD) and absorption spectra. TEM and XRD analysis show that the Cu/Pt clusters with different molar ratio have fcc structure with particle size of about 4 nm, while the lattice parameters in these clusters reduce with increasing Cu concentration. From the X-ray absorption near edge structure (XANES) at Cu-K edge and Pt-L 2,3 edge, we demonstrate that the d-electronic states of Cu and Pt are affected by the local environment as a function of Cu/Pt molar ratio. With increasing Cu concentration, Pt loses a fraction of 5d electrons and the hybridization between p- and d-states at Cu sites is enhanced

  5. Electronic structure of nanoscale Cu/Pt alloys: A combined X-ray diffraction and X-ray absorption investigations

    Energy Technology Data Exchange (ETDEWEB)

    Chen Xing [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Graduate School of the Chinese Academy of Sciences, 100864 Beijing (China); Chu Wangsheng [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); University of Science and Technology of China, Hefei, 230036 (China); Cai Quan [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Graduate School of the Chinese Academy of Sciences, 100864 Beijing (China); Xia Dingguo [College of Environmental and Energy Engineering, Beijing University of Technology, 100022 Beijing (China); Wu Zhonghua [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Wu Ziyu [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China) and National Center for Nanoscience and Technology (China)]. E-mail: wuzy@ihep.ac.cn

    2006-11-15

    PVP-protected Cu/Pt clusters were prepared by glycol/water reduction method and characterized with transmission electron microscopy (TEM), X-ray diffraction (XRD) and absorption spectra. TEM and XRD analysis show that the Cu/Pt clusters with different molar ratio have fcc structure with particle size of about 4 nm, while the lattice parameters in these clusters reduce with increasing Cu concentration. From the X-ray absorption near edge structure (XANES) at Cu-K edge and Pt-L{sub 2,3} edge, we demonstrate that the d-electronic states of Cu and Pt are affected by the local environment as a function of Cu/Pt molar ratio. With increasing Cu concentration, Pt loses a fraction of 5d electrons and the hybridization between p- and d-states at Cu sites is enhanced.

  6. X-ray Diffraction Crystal Calibration and Characterization

    International Nuclear Information System (INIS)

    Haugh, Michael J.; Stewart, Richard; Kugland, Nathan

    2009-01-01

    National Security Technologies X-ray Laboratory is comprised of a multi-anode Manson type source and a Henke type source that incorporates a dual goniometer and XYZ translation stage. The first goniometer is used to isolate a particular spectral band. The Manson operates up to 10 kV and the Henke up to 20 kV. The Henke rotation stages and translation stages are automated. Procedures have been developed to characterize and calibrate various NIF diagnostics and their components. The diagnostics include X-ray cameras, gated imagers, streak cameras, and other X-ray imaging systems. Components that have been analyzed include filters, filter arrays, grazing incidence mirrors, and various crystals, both flat and curved. Recent efforts on the Henke system are aimed at characterizing and calibrating imaging crystals and curved crystals used as the major component of an X-ray spectrometer. The presentation will concentrate on these results. The work has been done at energies ranging from 3 keV to 16 keV. The major goal was to evaluate the performance quality of the crystal for its intended application. For the imaging crystals we measured the laser beam reflection offset from the X-ray beam and the reflectivity curves. For the curved spectrometer crystal, which was a natural crystal, resolving power was critical. It was first necessary to find sources of crystals that had sufficiently narrow reflectivity curves. It was then necessary to determine which crystals retained their resolving power after being thinned and glued to a curved substrate

  7. Interaction between lipid monolayers and poloxamer 188: An X-ray reflectivity and diffraction study

    DEFF Research Database (Denmark)

    Wu, G.H.; Majewski, J.; Ege, C.

    2005-01-01

    The mechanism by which poloxamer 188 (P188) seals a damaged cell membrane is examined using the lipid monolayer as a model system. X-ray reflectivity and grazing-incidence x-ray diffraction results show that at low nominal lipid density, P188, by physically occupying the available area and phase ...

  8. Microprocessor-based system for automatic X-ray diffraction and fluorescence

    International Nuclear Information System (INIS)

    Souza, A.M. de; Carmo, L.C.S. do; Pereira, V.J.E.; Soares, E.A.

    1984-01-01

    A data acquisition and processing device appropriate for X-ray analysis and goniometer control was built. The Z-80 based system as well as the whole architeture is described. The advantages and new possibilities of the automated instrument as compared to the traditional ones are listed. The X-ray diffraction and fluorescence techniques can take advantage of the automation. (Author) [pt

  9. Modern X-ray diffraction. X-ray diffractometry for materials scientists, physicists, and chemicists. 2. rev. and enl. ed.; Moderne Roentgenbeugung. Roentgendiffraktometrie fuer Materialwissenschaftler, Physiker und Chemiker

    Energy Technology Data Exchange (ETDEWEB)

    Spiess, Lothar; Teichert, Gerd; Schwarzer, Robert; Behnken, Herfried; Genzel, Christoph

    2009-07-01

    This book offers a comprehensive survey over the applications of X-ray diffractions in fields like materials technique, metallurgy, electrotechniques, mechanical engineering, as well as micro- and nanotechniques. The necessary baic knowledges of X-ray diffraction are mediated foundedly and illustratively. Thereby new techniques and evaluation procedures are presented as well as well known methods.

  10. Calculated efficiencies of three-material low stress coatings for diffractive x-ray transmission optics

    International Nuclear Information System (INIS)

    Kubec, Adam; Braun, Stefan; Gawlitza, Peter; Menzel, Maik; Leson, Andreas

    2016-01-01

    Diffractive X-ray optical elements made by thin film coating techniques such as multilayer Laue lenses (MLL) and multilayer zone plates (MZP) are promising approaches to achieve resolutions in hard X-ray microscopy applications of less than 10 nm. The challenge is to make a lens with a large numerical aperture on the one hand and a decent working distance on the other hand. One of the limiting factors with the coated structures is the internal stress in the films, which can lead to significant bending of the substrate and various types of unwanted diffraction effects. Several approaches have been discussed to overcome this challenge. One of these is a three-material combination such as Mo/MoSi 2 /Si, where four single layers per period are deposited. Mo and Si represent the absorber and spacer in this case while MoSi 2 forms a diffusion barrier; in addition the thicknesses of absorber and spacer are chosen to minimize residual stress of the overall coating. Here the diffraction efficiency as well as the profile of the beam in the focal plane are discussed in order to find a tradeoff between lowest residual stress and best diffraction properties.

  11. Calculated efficiencies of three-material low stress coatings for diffractive x-ray transmission optics

    Energy Technology Data Exchange (ETDEWEB)

    Kubec, Adam, E-mail: adam.kubec@iws.fraunhofer.de; Braun, Stefan; Gawlitza, Peter; Menzel, Maik; Leson, Andreas [Fraunhofer IWS Dresden, Winterbergstr. 28, 01277 Dresden (Germany)

    2016-07-27

    Diffractive X-ray optical elements made by thin film coating techniques such as multilayer Laue lenses (MLL) and multilayer zone plates (MZP) are promising approaches to achieve resolutions in hard X-ray microscopy applications of less than 10 nm. The challenge is to make a lens with a large numerical aperture on the one hand and a decent working distance on the other hand. One of the limiting factors with the coated structures is the internal stress in the films, which can lead to significant bending of the substrate and various types of unwanted diffraction effects. Several approaches have been discussed to overcome this challenge. One of these is a three-material combination such as Mo/MoSi{sub 2}/Si, where four single layers per period are deposited. Mo and Si represent the absorber and spacer in this case while MoSi{sub 2} forms a diffusion barrier; in addition the thicknesses of absorber and spacer are chosen to minimize residual stress of the overall coating. Here the diffraction efficiency as well as the profile of the beam in the focal plane are discussed in order to find a tradeoff between lowest residual stress and best diffraction properties.

  12. High-energy X-ray diffraction studies of disordered materials

    International Nuclear Information System (INIS)

    Kohara, Shinji; Suzuya, Kentaro

    2003-01-01

    With the arrival of the latest generation of synchrotron sources and the introduction of advanced insertion devices (wigglers and undulators), the high-energy (E≥50 keV) X-ray diffraction technique has become feasible, leading to new approaches in the quantitative study of the structure of disordered materials. High-energy X-ray diffraction has several advantages: higher resolution in real space due to a wide range of scattering vector Q, smaller correction terms (especially the absorption correction), reduction of truncation errors, the feasibility of running under extreme environments, including high-temperatures and high-pressures, and the ability to make direct comparisons between X-ray and neutron diffraction data. Recently, high-energy X-ray diffraction data have been combined with neutron diffraction data from a pulsed source to provide more detailed and reliable structural information than that hitherto available

  13. X-ray Excited Optical Fluorescence and Diffraction Imaging of Reactivity and Crystallinity in a Zeolite Crystal : Crystallography and Molecular Spectroscopy in One

    NARCIS (Netherlands)

    Ristanovic, Zoran; Hofmann, Jan P; Richard, Marie-Ingrid; Jiang, Tao; Chahine, Gilbert A; Schülli, Tobias U; Meirer, Florian; Weckhuysen, Bert M

    2016-01-01

    Structure-activity relationships in heterogeneous catalysis are challenging to be measured on a single-particle level. For the first time, one X-ray beam is used to determine the crystallographic structure and reactivity of a single zeolite crystal. The method generates μm-resolved X-ray diffraction

  14. Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

    International Nuclear Information System (INIS)

    Gromova, T. Yu.; Demidyuk, I. V.; Kostrov, S. V.; Sosfenov, N. I.; Melik-Adamyan, V. R.; Kuranova, I. P.

    2008-01-01

    A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

  15. Reflectivity and diffraction of X rays applied to organic thin films

    International Nuclear Information System (INIS)

    Rieutord, Francois

    1987-01-01

    This research thesis reports the study of organic thin films by using X-ray-based technologies, and more particularly X-ray reflectivity. After some recalls on X ray diffraction, and on the fabrication of Langmuir-Blodgett films, the author shows how, by combining three X-ray-based techniques, it is possible to study a volume structure of a thin film. He describes the technique of measurement by X- ray reflexivity, its experimental implementation, and methods for result interpretation. In the next part, the author reports the study of peculiar interference effects which are noticed in reflexivity on Langmuir-Blodgett films, and then describes the nature of these films by correlating results of X ray reflexivity with direct observations performed by electronic microscopy on replica [fr

  16. Real-time x-ray diffraction measurements of shocked polycrystalline tin and aluminum

    Science.gov (United States)

    Morgan, Dane V.; Macy, Don; Stevens, Gerald

    2008-11-01

    A new, fast, single-pulse x-ray diffraction (XRD) diagnostic for determining phase transitions in shocked polycrystalline materials has been developed. The diagnostic consists of a 37-stage Marx bank high-voltage pulse generator coupled to a needle-and-washer electron beam diode via coaxial cable, producing line and bremsstrahlung x-ray emission in a 35 ns pulse. The characteristic Kα lines from the selected anodes of silver and molybdenum are used to produce the diffraction patterns, with thin foil filters employed to remove the characteristic Kβ line emission. The x-ray beam passes through a pinhole collimator and is incident on the sample with an approximately 3×6 mm2 spot and 1° full width half maximum angular divergence in a Bragg-reflecting geometry. For the experiments described in this report, the angle between the incident beam and the sample surface was 8.5°. A Debye-Scherrer diffraction image was produced on a phosphor located 76 mm from the polycrystalline sample surface. The phosphor image was coupled to a charge-coupled device camera through a coherent fiber-optic bundle. Dynamic single-pulse XRD experiments were conducted with thin foil samples of tin, shock loaded with a 1 mm vitreous carbon back window. Detasheet high explosive with a 2-mm-thick aluminum buffer was used to shock the sample. Analysis of the dynamic shock-loaded tin XRD images revealed a phase transformation of the tin beta phase into an amorphous or liquid state. Identical experiments with shock-loaded aluminum indicated compression of the face-centered-cubic aluminum lattice with no phase transformation.

  17. X-ray diffraction microstructural analysis of bimodal size distribution MgO nano powder

    International Nuclear Information System (INIS)

    Suminar Pratapa; Budi Hartono

    2009-01-01

    Investigation on the characteristics of x-ray diffraction data for MgO powdered mixture of nano and sub-nano particles has been carried out to reveal the crystallite-size-related microstructural information. The MgO powders were prepared by co-precipitation method followed by heat treatment at 500 degree Celsius and 1200 degree Celsius for 1 hour, being the difference in the temperature was to obtain two powders with distinct crystallite size and size-distribution. The powders were then blended in air to give the presumably bimodal-size- distribution MgO nano powder. High-quality laboratory X-ray diffraction data for the powders were collected and then analysed using Rietveld-based MAUD software using the lognormal size distribution. Results show that the single-mode powders exhibit spherical crystallite size (R) of 20(1) nm and 160(1) nm for the 500 degree Celsius and 1200 degree Celsius data respectively with the nano metric powder displays narrower crystallite size distribution character, indicated by lognormal dispersion parameter of 0.21 as compared to 0.01 for the sub-nano metric powder. The mixture exhibits relatively more asymmetric peak broadening. Analysing the x-ray diffraction data for the latter specimen using single phase approach give unrealistic results. Introducing two phase models for the double-phase mixture to accommodate the bimodal-size-distribution characteristics give R = 100(6) and σ = 0.62 for the nano metric phase and R = 170(5) and σ= 0.12 for the σ sub-nano metric phase. (author)

  18. Characterization of single-crystal sapphire substrates by X-ray methods and atomic force microscopy

    International Nuclear Information System (INIS)

    Prokhorov, I. A.; Zakharov, B. G.; Asadchikov, V. E.; Butashin, A. V.; Roshchin, B. S.; Tolstikhina, A. L.; Zanaveskin, M. L.; Grishchenko, Yu. V.; Muslimov, A. E.; Yakimchuk, I. V.; Volkov, Yu. O.; Kanevskii, V. M.; Tikhonov, E. O.

    2011-01-01

    The possibility of characterizing a number of practically important parameters of sapphire substrates by X-ray methods is substantiated. These parameters include wafer bending, traces of an incompletely removed damaged layer that formed as a result of mechanical treatment (scratches and marks), surface roughness, damaged layer thickness, and the specific features of the substrate real structure. The features of the real structure of single-crystal sapphire substrates were investigated by nondestructive methods of double-crystal X-ray diffraction and plane-wave X-ray topography. The surface relief of the substrates was investigated by atomic force microscopy and X-ray scattering. The use of supplementing analytical methods yields the most complete information about the structural inhomogeneities and state of crystal surface, which is extremely important for optimizing the technology of substrate preparation for epitaxy.

  19. Impact of sub-pixelation within CdZnTe detectors for x-ray diffraction imaging systems

    Science.gov (United States)

    Tabary, J.; Paulus, C.; Montémont, G.; Verger, L.

    2017-05-01

    X-ray diffraction is known to be an effective technique for illicit materials detection in baggage screening, as it can reveal molecular structural information of any solid substances but also of liquids, aerosols and gels. Some X-ray diffraction systems using 2D pixelated spectrometric detectors, such as CdZnTe detectors, are then able to perform 3D baggage scanning in time compatible with bag throughput constraints of airports. However, X-ray diffraction systems designed for baggage screening generally suffer from poor photon count statistics and bad spatial resolution, because of the tight collimations and the small scattering angle. To improve these factors, techniques of sub-pixelation can be implemented in CdZnTe detectors. Indeed, sub-pixelation enables to open the collimation without angular resolution degradation and also to segment the inspected volume in several sub-volumes, inducing a better spatial resolution in the X-ray beam direction. In this paper, we present some experiments demonstrating the interest of sub-pixelation within CdZnTe detectors for X-ray diffraction imaging systems. In particular, an experimental demonstration is presented with a 2D XRD image of a realistic baggage performed with only one single pixel from our own CdZnTe based imager.

  20. Pressure-induced phase transitions in organic molecular crystals: a combination of x-ray single-crystal and powder diffraction, raman and IR-spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Boldyreva, E V; Goryainov, S V; Seryotkin, Y V; Kolesnik, E N; Shakhtshneider, T P; Ivashevskaya, S N; Drebushchak, T N [Research and Education Center ' Molecular Design and Ecologically Safe Technologies' , REC-008, Novosibirsk State University (Russian Federation); Sowa, H [Goettingen University (Germany); Ahsbahs, H; Chernyshev, V V [Marburg University (Germany); Dmitriev, V P [Swiss-Norwegian Beamline ESRF, Grenoble (France)], E-mail: boldyrev@nsu.ru

    2008-07-15

    The contribution summarizes the results of recent studies of phase transitions induced by high pressure in a number of molecular organic crystals, such as polymorphs of paracetamol, chlorpropamide, polymorphs of glycine, L- and DL-serine, {beta}-alanine. The main attention is paid to the following topics: (1) Reversible / irreversible transformations; (2) Different behavior of single crystals / powders; (3) The role of pressure-transmitting liquid; (4) The role of the kinetic factors: phase transitions on decompression, or after a long storage at a selected pressure; (5) Isosymmetric phase transitions; (6) The role of the changes in the hydrogen bond networks / intramolecular conformational changes in the phase transitions; (7) Superstructures / nanostructures formed as a result of pressure-induced phase transitions.

  1. High-k Gate Dielectric Films Studied by Extremely Asymmetric X-ray Diffraction and X-ray Photoelectron Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Yuki [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Akimoto, Koichi [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Yoshida, Hironori [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Emoto, Takashi [Toyota National College of Technology, Toyota, Aichi 471-8525 (Japan); Kobayashi, Daisuke [Institute of Space and Astronautical Science, Sagamihara, Kanagawa 229-8510 (Japan); Hirose, Kazuyuki [Institute of Space and Astronautical Science, Sagamihara, Kanagawa 229-8510 (Japan)

    2007-10-15

    We studied HfAlO{sub x}(N)/SiO{sub 2}/Si films which were fabricated by the layer-by-layer deposition and annealing (LL-D and A) method with different annealing conditions. In this time, in-situ annealing was performed at various temperatures in an NH{sub 3} ambient. In addition, post-deposition annealing (PDA) was performed for some samples. For each sample, the interfacial lattice strain was evaluated using extremely asymmetric X-ray diffraction and the local dielectric constant near the Al atoms was measured by X-ray photoelectron spectroscopy (XPS). Observation of the strain field was done by measuring the X-ray rocking curve of the Si 113 reflection of the Si (001) substrate under grazing incidence conditions. It was found that in the case of the samples without PDA, for higher in-situ annealing temperatures compressive strain is introduced and the local dielectric constant becomes lower. For the samples with PDA, the differences of the lattice strain and the local dielectric constant are small for different in-situ annealing temperatures.

  2. Characterization of Polycrystalline Materials Using Synchrotron X-ray Imaging and Diffraction Techniques

    DEFF Research Database (Denmark)

    Ludwig, Wolfgang; King, A.; Herbig, M.

    2010-01-01

    propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X-ray......The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using...... diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure...

  3. Powder Handling Device for X-ray Diffraction Analysis with Minimal Sample Preparation, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This project consists of developing a Vibrating Sample Holder (VSH) for planetary X-Ray Diffraction (XRD) instruments. The principle of this novel sample handling...

  4. Powder Handling Device for X-ray Diffraction Analysis with Minimal Sample Preparation, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — This project consists in developing a Vibrating Powder Handling System for planetary X-Ray Diffraction instruments. The principle of this novel sample handling...

  5. State-of-the-art and problems of X-ray diffraction analysis of biomacromolecules

    International Nuclear Information System (INIS)

    Andreeva, N. S.

    2006-01-01

    The state-of-the-art of X-ray diffraction studies of biomacromolecules is briefly characterized, and the challenge imposed by science is discussed. These studies are characterized by a wide scope and extensive use. This field of science is of great interest and is developed in many countries. The main purpose is to solve practical problems in medicine consisting in the design of drugs against various diseases. X-ray diffraction analysis of enzymes brought the pharmaceutical industry to a new level, thus allowing the rational design of drugs against formerly untreatable diseases. Modern X-ray diffraction studies of biomacromolecules laid the basis for a new science called structural biology. This method allows one to solve fundamental problems of physical chemistry for a new state of matter existing in living systems. Here, science poses numerous problems in analysis of X-ray diffraction data on biological macromolecules. Many of theses problems are in their infancy

  6. Characterization of Polycrystalline Materials Using Synchrotron X-ray Imaging and Diffraction Techniques

    DEFF Research Database (Denmark)

    Ludwig, Wolfgang; King, A.; Herbig, M.

    2010-01-01

    The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using...... propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X......-ray diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure...

  7. Method for improve x-ray diffraction determinations of residual stress in nickel-base alloys

    Science.gov (United States)

    Berman, Robert M.; Cohen, Isadore

    1990-01-01

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys which comprises covering part of a predetermined area of the surface of a nickel-base alloy with a dispersion, exposing the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample.

  8. Method for improving x-ray diffraction determinations of residual stress in nickel-base alloys

    Science.gov (United States)

    Berman, R.M.; Cohen, I.

    1988-04-26

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys is discussed. Part of a predetermined area of the surface of a nickel-base alloy is covered with a dispersion. This exposes the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose, since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample. 2 figs.

  9. In situ x-ray diffraction and in situ x-ray absorption spectroscopy for investigation of intercalation batteries

    International Nuclear Information System (INIS)

    Levy-Clement, C.; Mondoloni, C.; Godart, C.; Cortes, R.

    1991-01-01

    This paper presents applications of in situ X-ray diffraction and absorption techniques to the study of H + /MnO 2 alkaline batteries. The two complementary in situ techniques are described. Investigation of the electrochemical insertion and deinsertion of H + has been made through its influence on the evolution of the crystallographic structure of γ-MnO 2 , while investigation of the transfer of e - has been undertaken through the variation of the oxidation state of the manganese during the discharging and charging process of a battery. New insights in the understanding of the mechanisms of proton insertion and charge transfer into γ-MnO 2 are discussed

  10. Structural characterization of thin-film cadmium stearate by X-ray diffraction technique

    International Nuclear Information System (INIS)

    Mohamad Deraman; Mohd Ali Sufi; Kok Kuan Ying; Muhamad Mat Salleh; Chew Tat Tian

    1990-01-01

    X-ray diffraction measurement were carried out on thin films of cadmium stearate using an X-ray diffractometer at Unit Tenaga Nuklear. Structure characteristic obtained from the measured diffraction pattern are compared with that of thin films of manganese stearate reported earlier by Pomerantz et. al. Some of the structural similarities (such as inter-planar spacing) and differences (such as the absence of subsidiary peak between Bragg peaks) are found and discussed

  11. Synchrotron radiation X-ray powder diffraction techniques applied in hydrogen storage materials - A review

    OpenAIRE

    Honghui Cheng; Chen Lu; Jingjing Liu; Yongke Yan; Xingbo Han; Huiming Jin; Yu Wang; Yi Liu; Changle Wu

    2017-01-01

    Synchrotron radiation is an advanced collimated light source with high intensity. It has particular advantages in structural characterization of materials on the atomic or molecular scale. Synchrotron radiation X-ray powder diffraction (SR-XRPD) has been successfully exploited to various areas of hydrogen storage materials. In the paper, we will give a brief introduction on hydrogen storage materials, X-ray powder diffraction (XRPD), and synchrotron radiation light source. The applications of...

  12. Synthesis and Single Crystal X-Ray Crystallographic Analysis of 2 ...

    African Journals Online (AJOL)

    dihydropyrimidin-1-ium) tetrachlorocobaltate(II) [H2pymo]2[CoCl4]. The compound was re-crystallized in diethyl ether to obtain a suitable single crystal for X-ray diffraction analysis which revealed a molecule crystallizes in the orthorhombic ...

  13. Combination of Raman, infrared, and X-ray energy-dispersion spectroscopies and X-ray d diffraction to study a fossilization process

    Energy Technology Data Exchange (ETDEWEB)

    Sousa Filho, Francisco Eduardo de [Departamento de Fisica, Universidade Regional do Cariri, Crato, CE (Brazil); Joao Herminio da Silva [Universidade Federal do Ceara, Cariri, Juazeiro do Norte, CE (Brazil); Saraiva, Antonio Alamo Feitosa; Brito, Deyvid Dennys S. [Departamento de Ciencias Biologicas, Universidade Regional do Cariri, Crato, CE (Brazil); Viana, Bartolomeu Cruz [Departamento de Fisica, Universidade Federal do Piaui, Teresina, PI, (Brazil); Abagaro, Bruno Tavares de Oliveira; Freire, Paulo de Tarso Cavalcante, E-mail: tarso@fisica.ufc.br [Departamento de Fisica, Universidade Federal do Ceara, Fortaleza, CE (Brazil)

    2011-12-15

    X-ray diffraction was combined with X-ray energy-dispersion, Fourier-transform infrared, and Raman spectroscopies to study the fossilization of a Cretaceous specimen of the plant Brachyphyllum castilhoi, a fossil from the Ipubi Formation, in the Araripe Sedimentary Basin, Northeastern Brazil. Among the possible fossilization processes, which could involve pyrite, silicon oxide, calcium oxide, or other minerals, we were able to single out pyritization as the central mechanism producing the fossil, more than 100 million years ago. In addition to expanding the knowledge of the Ipubi Formation, this study shows that, when combined with other experimental techniques, Raman spectroscopy is a valuable tool at the paleontologist's disposal. (author)

  14. Characterization of nanowires by coherent X-ray diffractive imaging and ptychography

    International Nuclear Information System (INIS)

    Dzhigaev, Dmitry

    2017-03-01

    Imaging techniques are of paramount importance for our understanding of the universe. From galaxies and stars explored by huge telescopes down to micro and nanostructures studied by microscopes, imaging systems provide invaluable scientific information. When an object under investigation has a size of about 100 nanometers, X-rays become a perfect probe for non-destructive imaging. The manufacturing process of image forming lenses for X-rays becomes much more complicated comparing to optical ones. Therefore, ''lensless'' techniques which rely on the coherent properties of radiation were developed. With third generation of synchrotron sources highly coherent and intense X-ray beams became widely accessible. They are used in new imaging methods such as coherent X-ray diffractive imaging (CXDI) and X-ray ptychography. Modern nanotechnology opens a wide spectrum of possible applications in different branches of physics, chemistry, biology and engineering. At the nanoscale, matter has different physical and chemical properties compared to the macroscale bulk material. The continuing trend of miniaturization of functional components in semiconductor industry brings new challenges both in growth and characterization methods. This Thesis is focused on application of coherent diffractive imaging methods to reveal the structure of single semiconductor nanowires (NWs). They have been attracting significant attention for a couple of decades due to their efficient strain relaxation properties. And since the strain plays a significant role in NW performance the projects carried out in this work are oriented on Bragg CXDI approaches. Three distinct projects were carried out during my research activity at DESY research center of the Helmholtz Association. Experimental work was performed at P06 and P10 beamlines at PETRA III synchrotron. The first part of this Thesis extends the application of the three-dimensional (3D) Bragg CXDI to strain field mapping in a

  15. Characterization of nanowires by coherent X-ray diffractive imaging and ptychography

    Energy Technology Data Exchange (ETDEWEB)

    Dzhigaev, Dmitry

    2017-03-15

    Imaging techniques are of paramount importance for our understanding of the universe. From galaxies and stars explored by huge telescopes down to micro and nanostructures studied by microscopes, imaging systems provide invaluable scientific information. When an object under investigation has a size of about 100 nanometers, X-rays become a perfect probe for non-destructive imaging. The manufacturing process of image forming lenses for X-rays becomes much more complicated comparing to optical ones. Therefore, ''lensless'' techniques which rely on the coherent properties of radiation were developed. With third generation of synchrotron sources highly coherent and intense X-ray beams became widely accessible. They are used in new imaging methods such as coherent X-ray diffractive imaging (CXDI) and X-ray ptychography. Modern nanotechnology opens a wide spectrum of possible applications in different branches of physics, chemistry, biology and engineering. At the nanoscale, matter has different physical and chemical properties compared to the macroscale bulk material. The continuing trend of miniaturization of functional components in semiconductor industry brings new challenges both in growth and characterization methods. This Thesis is focused on application of coherent diffractive imaging methods to reveal the structure of single semiconductor nanowires (NWs). They have been attracting significant attention for a couple of decades due to their efficient strain relaxation properties. And since the strain plays a significant role in NW performance the projects carried out in this work are oriented on Bragg CXDI approaches. Three distinct projects were carried out during my research activity at DESY research center of the Helmholtz Association. Experimental work was performed at P06 and P10 beamlines at PETRA III synchrotron. The first part of this Thesis extends the application of the three-dimensional (3D) Bragg CXDI to strain field mapping in a

  16. X-ray diffraction applied to powder studies

    International Nuclear Information System (INIS)

    Assaf, Josiane

    1982-01-01

    the thesis starts with general definitions of x-ray: their nature, sources and production mechanism. it describesdifferent methods such as Debye-scherrer, absorption coefficient method, diffractometer method...The use of pattern-fitting techniques for the characterization of the microstructure is discussed through applications to nanocrystalline materials. Remarkable results achieved in the solution of crystal structures are presented, as well as the impact in solid-state chemistry of powder crystallography, particularly for elucidating the crystal chemistry of families of compounds for which only powders are available

  17. Progress in X-ray synchrotron diffraction studies of muscle contraction. Ch. 19

    International Nuclear Information System (INIS)

    Wakabayashi, Katsuzo

    1991-01-01

    This chapter provides a review of applications of synchrotron radiation (SR) to X-ray diffraction studies on the dynamic aspects of muscle contraction and is, at the same time, a progress report on the technical developments specifically related to muscle research. The introduction of SR as an intense X-ray source and the development of high ability detectors have led to enormous improvement in the quality of data from time-resolved X-ray diffraction studies of muscle contraction. The X-ray diffraction pattern taken during contraction shows that the force generation of a muscle proceeds upon interaction of the incommensurate structures of the thin and thick filaments. In this framework a distinct intensity change of the weaker reflections from the thin filaments was detected. However, there was still no strong evidence of direct physical attachment of myosin heads to actin during contraction. (author). 170 refs.; 52 figs.; 3 tabs

  18. Background removal in X-ray fiber diffraction patterns

    International Nuclear Information System (INIS)

    Millane, R.P.; Arnott, S.

    1985-01-01

    Background can be a major source of error in measurement of diffracted intensities in fiber diffraction patterns. Errors can be large when poorly oriented less-crystalline specimens give diffraction patterns with little uncontaminated background. A method for estimating and removing a general global background in such cases is described and illustrated with an example. (orig.)

  19. Determination of precise X-ray diffraction angles by fast Fourier transform

    International Nuclear Information System (INIS)

    Tokita, S.; Kojima, T.

    1987-01-01

    A new analytical method is presented for the separation of two or more closely overlapping X-ray diffraction lines using the narrowly distributed Gaussian function and one-dimensional fast Fourier transform pair. To test the method, the diffraction lines associated with characteristic Kα 1 and Kα 2 rays are measured by an X-ray diffractometer using a Brazilian quartz powder as a standard sample. It is found that the observed diffraction lines can be completely separated into Kα 1 and Kα 2 lines and that the accuracy of those diffraction angles is better than 2x10 -4 . (orig.)

  20. Monitoring protein precipitates by in-house X-ray powder diffraction

    DEFF Research Database (Denmark)

    Ståhl, Kenny; Frankær, Christian Grundahl; Petersen, Jakob

    2013-01-01

    Powder diffraction from protein powders using in-house diffractometers is an effective tool for identification and monitoring of protein crystal forms and artifacts. As an alternative to conventional powder diffractometers a single crystal diffractometer equipped with an X-ray micro-source can...... of such calculated powder patterns from insulin and lysozyme have been included in the powder diffraction database and successfully used for search-match identification. However, the fit could be much improved if peak asymmetry and multiple bulk-solvent corrections were included. When including a large number...... of protein data sets in the database some problems can be foreseen due to the large number of overlapping peaks in the low-angle region, and small differences in unit cell parameters between pdb-data and powder data. It is suggested that protein entries are supplied with more searchable keywords as protein...

  1. Neutron and X-ray diffraction measurements on micro- and nano-sized precipitates embedded in a Ni-based superalloy and after their extraction from the alloy

    International Nuclear Information System (INIS)

    Gilles, R.; Mukherji, D.; Hoelzel, M.; Strunz, P.; Toebbens, D.M.; Barbier, B.

    2006-01-01

    Neutron and X-ray diffraction are eminently suitable techniques to determine lattice misfit in nickel-based superalloys. Due to the different measuring techniques and sensitivities of the probes, sometimes one method is preferable to the other. This paper demonstrates how the use of neutrons allows a better determination of the misfit value in a bulk single-crystal tungsten-rich nickel superalloy with oriented precipitates than the use of X-rays, although the resolution in neutron diffraction is generally inferior to that in X-ray diffraction. It also yields more accurate results when the precipitates are at the nanoscale. The neutron measurements were carried out using a special technique to detect a larger number of reflections in single-crystal samples than observed in standard diffraction geometry. A comparison of the measurements by neutron and X-ray diffraction of precipitates separated from the bulk is also included in the investigation

  2. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    LiNbO3) nonlinear optical single crystal. P KUMAR1,3, S MOORTHY BABU1,∗, S PERERO2,3,. RAJAMANICCAM L SAI4, I BHAUMIK5, S GANESAMOORTHY5 and A K KARNAL5. 1Crystal Growth Centre, Anna University, Chennai 600 025, India.

  3. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    Congruent LiNbO3 single crystals with Ti ion dopants (2 and 5 mol%) were successfully grown by Czochralski technique in the automatic diameter control facility. As-grown crystal boules were oriented into (0 0 1) direction cut and optically polished for all measurements. Influence of Ti-ion incorporation into LiNbO3 was ...

  4. Determination of austenite vs. α-ferrite in steel by neutron and X-ray diffraction

    International Nuclear Information System (INIS)

    Als-Nielsen, J.; Clausen, K.

    1984-06-01

    Neutron and X-ray diffraction studies for determining the relative content of fcc (austenite) and bcc (α-ferrite) phases in steel samples are reported. In addition to determine the relative content of phases the diffraction method also provides information about the strain fields in the sample by the concomitant broadening of diffraction peaks. Neutron diffraction has the advantage that large sample volumes (several cc) are probed, and the effect of texture can thus be eliminated. X-ray diffraction patterns can be registered in a short time thus allowing kinetic studies of phase changes during heat treatment or mechanical treatment. In addition it is possible to probe different surface thickness by utilizing different X-ray wavelengths. Measurements of this type can be carried out on a commercial contract basis in the Solid State Physics Division at Risoe National Laboratory. (author)

  5. X-ray and neutron diffraction studies of crystallinity in hydroxyapatite coatings.

    Science.gov (United States)

    Girardin, E; Millet, P; Lodini, A

    2000-02-01

    To standardize industrial implant production and make comparisons between different experimental results, we have to be able to quantify the crystallinity of hydroxyapatite. Methods of measuring crystallinity ratio were developed for various HA samples before and after plasma spraying. The first series of methods uses X-ray diffraction. The advantage of these methods is that X-ray diffraction equipment is used widely in science and industry. In the second series, a neutron diffraction method is developed and the results recorded are similar to those obtained by the modified X-ray diffraction methods. The advantage of neutron diffraction is the ability to obtain measurements deep inside a component. It is a nondestructive method, owing to the very low absorption of neutrons in most materials. Copyright 2000 John Wiley & Sons, Inc.

  6. The trickle before the torrent-diffraction data from X-ray lasers.

    Science.gov (United States)

    Maia, Filipe R N C; Hajdu, Janos

    2016-08-01

    Today Scientific Data launched a collection of publications describing data from X-ray free-electron lasers under the theme 'Structural Biology Applications of X-ray Lasers'. The papers cover data on nanocrystals, single virus particles, isolated cell organelles, and living cells. All data are deposited with the Coherent X-ray Imaging Data Bank (CXIDB) and available to the scientific community to develop ideas, tools and procedures to meet challenges with the expected torrents of data from new X-ray lasers, capable of producing billion exposures per day.

  7. Crystallization and preliminary X-ray diffraction analysis of recombinant hepatitis E virus-like particle

    International Nuclear Information System (INIS)

    Wang, Che-Yen; Miyazaki, Naoyuki; Yamashita, Tetsuo; Higashiura, Akifumi; Nakagawa, Atsushi; Li, Tian-Cheng; Takeda, Naokazu; Xing, Li; Hjalmarsson, Erik; Friberg, Claes; Liou, Der-Ming; Sung, Yen-Jen; Tsukihara, Tomitake; Matsuura, Yoshiharu; Miyamura, Tatsuo; Cheng, R. Holland

    2008-01-01

    A recombinant virus-like particle that is a potential oral hepatitis E vaccine was crystallized. Diffraction data were collected to 8.3 Å resolution and the X-ray structure was phased with the aid of a low-resolution density map determined using cryo-electron microscopy data. Hepatitis E virus (HEV) accounts for the majority of enterically transmitted hepatitis infections worldwide. Currently, there is no specific treatment for or vaccine against HEV. The major structural protein is derived from open reading frame (ORF) 2 of the viral genome. A potential oral vaccine is provided by the virus-like particles formed by a protein construct of partial ORF3 protein (residue 70–123) fused to the N-terminus of the ORF2 protein (residues 112–608). Single crystals obtained by the hanging-drop vapour-diffusion method at 293 K diffract X-rays to 8.3 Å resolution. The crystals belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 337, b = 343, c = 346 Å, α = β = γ = 90°, and contain one particle per asymmetric unit

  8. In-line holography and coherent diffractive imaging with x-ray waveguides

    International Nuclear Information System (INIS)

    De Caro, L.; Giannini, C.; Guagliardi, A.; Pelliccia, D.; Mocuta, C.; Metzger, T. H.; Cedola, A.; Burkeeva, I.; Lagomarsino, S.

    2008-01-01

    A Fresnel coherent diffraction imaging experiment with hard x rays is here presented, using two planar crossed waveguides as optical elements, leading to a virtual pointlike source. The coherent wave field obtained with this setup is used to illuminate a micrometric single object having the shape of a butterfly. A digital two-dimensional in-line holographic reconstruction of the unknown object at low resolution (200 nm) has been obtained directly via fast Fourier transform (FFT) of the raw data. The object and its twin image are well separated because suitable geometrical conditions are satisfied. A good estimate of the incident wave field phase has been extracted directly from the FFT of the raw data. A partial object reconstruction with 50 nm spatial resolution was achieved by fast iterative phase retrieval, the major limitation for a full reconstruction being the nonideal structure of the guided beam. The method offers a route for fast and reliable phase retrieval in x-ray coherent diffraction

  9. Solving a superstructure from two-wavelength x-ray powder diffraction data - a simulation

    Science.gov (United States)

    Chen, Jian-Rong; Gu, Yuan-Xin; Fan, Hai-Fu

    2003-03-01

    Two different kinds of phase ambiguities are intrinsic in two-wavelength x-ray powder diffraction from acentric crystal structures having pseudo-translation symmetry. In a test calculation we have solved the problem for the first time by two different phasing procedures developed originally in single-crystal structure analysis. They are the direct method of breaking enantiomorphous phase ambiguity in protein crystallography and that of breaking translational phase ambiguity for superstructures. An artificial structure was used in the test, which is based on atomic coordinates of the known structure, SHAS (C5H6O5N3K), with the atom K replaced by Rb. The arrangement of Rb atoms possesses a subperiodicity of t = (a + b + c)/2. Two-wavelength synchrotron x-ray powder diffraction data were simulated with lambda1=0.0816nm and lambda2=0.1319nm. Overlapped reflections were uniformly decomposed at the beginning and redecomposed afterward when the partial-structure information became available. The enantiomorphous phase ambiguity was resolved only for reflections with h + k + l even. Phases of reflections with h + k + l odd were derived by the direct method of solving superstructures. A fragment was then obtained, which led to the complete structure in five cycles of Fourier iteration.

  10. Capture and X-ray diffraction studies of protein microcrystals in a microfluidic trap array

    Energy Technology Data Exchange (ETDEWEB)

    Lyubimov, Artem Y. [Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Murray, Thomas D. [University of California, Berkeley, CA 94720 (United States); Johns Hopkins University School of Medicine, Baltimore, MD 21205 (United States); Koehl, Antoine [Stanford University, Stanford, CA 94305 (United States); Araci, Ismail Emre [Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Uervirojnangkoorn, Monarin; Zeldin, Oliver B. [Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Cohen, Aina E.; Soltis, S. Michael; Baxter, Elizabeth L. [SLAC National Accelerator Laboratory, Stanford, CA 94305 (United States); Brewster, Aaron S.; Sauter, Nicholas K. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Brunger, Axel T., E-mail: brunger@stanford.edu [Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Stanford University, Stanford, CA 94305 (United States); Berger, James M., E-mail: brunger@stanford.edu [Johns Hopkins University School of Medicine, Baltimore, MD 21205 (United States); Stanford University, Stanford, CA 94305 (United States)

    2015-04-01

    A microfluidic platform has been developed for the capture and X-ray analysis of protein microcrystals, affording a means to improve the efficiency of XFEL and synchrotron experiments. X-ray free-electron lasers (XFELs) promise to enable the collection of interpretable diffraction data from samples that are refractory to data collection at synchrotron sources. At present, however, more efficient sample-delivery methods that minimize the consumption of microcrystalline material are needed to allow the application of XFEL sources to a wide range of challenging structural targets of biological importance. Here, a microfluidic chip is presented in which microcrystals can be captured at fixed, addressable points in a trap array from a small volume (<10 µl) of a pre-existing slurry grown off-chip. The device can be mounted on a standard goniostat for conducting diffraction experiments at room temperature without the need for flash-cooling. Proof-of-principle tests with a model system (hen egg-white lysozyme) demonstrated the high efficiency of the microfluidic approach for crystal harvesting, permitting the collection of sufficient data from only 265 single-crystal still images to permit determination and refinement of the structure of the protein. This work shows that microfluidic capture devices can be readily used to facilitate data collection from protein microcrystals grown in traditional laboratory formats, enabling analysis when cryopreservation is problematic or when only small numbers of crystals are available. Such microfluidic capture devices may also be useful for data collection at synchrotron sources.

  11. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  12. High Pressure X-Ray Diffraction Studies on Nanocrystalline Materials

    Science.gov (United States)

    Palosz, B.; Stelmakh, S.; Grzanka, E.; Gierlotka, S.; Pielaszek, R.; Bismayer, U.; Werner, S.; Palosz, W.

    2003-01-01

    Application of in situ high pressure powder diffraction technique for examination of specific structural properties of nanocrystals based on the experimental data of SiC nanocrystalline powders of 2 to 30 nrn diameter in diameter is presented. Limitations and capabilities of the experimental techniques themselves and methods of diffraction data elaboration applied to nanocrystals with very small dimensions (nanoparticles of different grain size.

  13. Structure solution from powder neutron and x-ray diffraction data: getting the best of both worlds

    International Nuclear Information System (INIS)

    Hunter, B.A.

    2000-01-01

    Full text: Powder diffraction methods have traditionally been used in three main areas: phase identification and quantification, lattice parameter determination and structure refinement. Until recently structure solution has been the almost exclusive domain of single crystal diffraction methods, predominantly using x-rays. The increasing use of synchrotron and neutron sources, and the unrelenting advances in computing hardware and software means that powder methods are challenging single crystal methods as a practical method for structure solution, especially when single crystal method can not be applied. It is known that structural refinements from a known starting structure using combined X-ray and neutron data sets are capable of providing highly accurate structures. Likewise, using combined x-ray and neutron powder diffraction data in the structure solution process should also be a powerful technique, although to date no one is pursuing this methodology. This paper present examples of solutions to the problem. Namely we are using high resolution powder X-ray and neutron methods to solve the structures of molecular materials and minerals, then refining the structures using both sets of data. In this way we exploit the advantages of both methods while minimising the disadvantages. We present our solution for a small amino acid structure, a metalorganic and a mineral structure

  14. Comparative study of macrotexture analysis using X-ray diffraction and electron backscattered diffraction techniques

    International Nuclear Information System (INIS)

    Serna, Marilene Morelli

    2002-01-01

    The macrotexture is one of the main characteristics in metallic materials, which the physical properties depend on the crystallographic direction. The analysis of the macrotexture to middles of the decade of 80 was just accomplished by the techniques of Xray diffraction and neutrons diffraction. The possibility of the analysis of the macrotexture using, the technique of electron backscattering diffraction in the scanning electronic microscope, that allowed to correlate the measure of the orientation with its location in the micro structure, was a very welcome tool in the area of engineering of materials. In this work it was studied the theoretical aspects of the two techniques and it was used of both techniques for the analysis of the macrotexture of aluminum sheets 1050 and 3003 with intensity, measured through the texture index 'J', from 2.00 to 5.00. The results obtained by the two techniques were shown reasonably similar, being considered that the statistics of the data obtained by the technique of electron backscatter diffraction is much inferior to the obtained by the X-ray diffraction. (author)

  15. Microbeam high-resolution diffraction and x-ray standing wave methods applied to semiconductor structures

    International Nuclear Information System (INIS)

    Kazimirov, A; Bilderback, D H; Huang, R; Sirenko, A; Ougazzaden, A

    2004-01-01

    A new approach to conditioning x-ray microbeams for high angular resolution x-ray diffraction and scattering techniques is introduced. We combined focusing optics (one-bounce imaging capillary) and post-focusing collimating optics (miniature Si(004) channel-cut crystal) to generate an x-ray microbeam with a size of 10 μm and ultimate angular resolution of 14 μrad. The microbeam was used to analyse the strain in sub-micron thick InGaAsP epitaxial layers grown on an InP(100) substrate by the selective area growth technique in narrow openings between the oxide stripes. For the structures for which the diffraction peaks from the substrate and the film overlap, the x-ray standing wave technique was applied for precise measurements of the strain with a Δd/d resolution of better than 10 -4 . (rapid communication)

  16. Protein crystal structure from non-oriented, single-axis sparse X-ray data

    Directory of Open Access Journals (Sweden)

    Jennifer L. Wierman

    2016-01-01

    Full Text Available X-ray free-electron lasers (XFELs have inspired the development of serial femtosecond crystallography (SFX as a method to solve the structure of proteins. SFX datasets are collected from a sequence of protein microcrystals injected across ultrashort X-ray pulses. The idea behind SFX is that diffraction from the intense, ultrashort X-ray pulses leaves the crystal before the crystal is obliterated by the effects of the X-ray pulse. The success of SFX at XFELs has catalyzed interest in analogous experiments at synchrotron-radiation (SR sources, where data are collected from many small crystals and the ultrashort pulses are replaced by exposure times that are kept short enough to avoid significant crystal damage. The diffraction signal from each short exposure is so `sparse' in recorded photons that the process of recording the crystal intensity is itself a reconstruction problem. Using the EMC algorithm, a successful reconstruction is demonstrated here in a sparsity regime where there are no Bragg peaks that conventionally would serve to determine the orientation of the crystal in each exposure. In this proof-of-principle experiment, a hen egg-white lysozyme (HEWL crystal rotating about a single axis was illuminated by an X-ray beam from an X-ray generator to simulate the diffraction patterns of microcrystals from synchrotron radiation. Millions of these sparse frames, typically containing only ∼200 photons per frame, were recorded using a fast-framing detector. It is shown that reconstruction of three-dimensional diffraction intensity is possible using the EMC algorithm, even with these extremely sparse frames and without knowledge of the rotation angle. Further, the reconstructed intensity can be phased and refined to solve the protein structure using traditional crystallographic software. This suggests that synchrotron-based serial crystallography of micrometre-sized crystals can be practical with the aid of the EMC algorithm even in cases

  17. X-ray microanalysis of single and cultured cells

    International Nuclear Information System (INIS)

    Wroblewski, J.; Roomans, G.M.

    1984-01-01

    X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background

  18. Ultrafast Structural Dynamics in InSb Probed by Time-Resolved X-Ray Diffraction

    International Nuclear Information System (INIS)

    Chin, A.H.; Shank, C.V.; Chin, A.H.; Schoenlein, R.W.; Shank, C.V.; Glover, T.E.; Leemans, W.P.; Balling, P.

    1999-01-01

    Ultrafast structural dynamics in laser-perturbed InSb are studied using time-resolved x-ray diffraction with a novel femtosecond x-ray source. We report the first observation of a delay in the onset of lattice expansion, which we attribute to energy relaxation processes and lattice strain propagation. In addition, we observe direct indications of ultrafast disordering on a subpicosecond time scale. copyright 1999 The American Physical Society

  19. Information extracting and processing with diffraction enhanced imaging of X-ray

    International Nuclear Information System (INIS)

    Chen Bo; Chinese Academy of Science, Beijing; Chen Chunchong; Jiang Fan; Chen Jie; Ming Hai; Shu Hang; Zhu Peiping; Wang Junyue; Yuan Qingxi; Wu Ziyu

    2006-01-01

    X-ray imaging at high energies has been used for many years in many fields. Conventional X-ray imaging is based on the different absorption within a sample. It is difficult to distinguish different tissues of a biological sample because of their small difference in absorption. The authors use the diffraction enhanced imaging (DEI) method. The authors took images of absorption, extinction, scattering and refractivity. In the end, the authors presented pictures of high resolution with all these information combined. (authors)

  20. Nano-fabrication of diffractive optics for soft X-ray and atom beam focusing

    International Nuclear Information System (INIS)

    Rehbein, S.

    2002-01-01

    Nano-structuring processes are described for manufacturing diffractive optics for the condenser-monochromator set-up of the transmission X-ray microscope (TXM) and for the scanning transmission X-ray microscope (STXM) at the BESSY II electron storage ring in Berlin. Furthermore, a process for manufacturing free-standing nickel zone plates for helium atom beam focusing experiments is presented. (author)

  1. Model experiment of in vivo synchrotron X-ray diffraction of human kidney stones

    Energy Technology Data Exchange (ETDEWEB)

    Ancharov, A.I. [Institute of Solid State Chemistry and Mechanochemistry SB RAS, Novosibirsk (Russian Federation)]. E-mail: ancharov@mail.ru; Potapov, S.S. [Institute of Mineralogy UB RAS, Miass (Russian Federation); Moiseenko, T.N. [The State Regional Clinical Hospital, Novosibirsk (Russian Federation); Feofilov, I.V. [The State Regional Clinical Hospital, Novosibirsk (Russian Federation); Nizovskii, A.I. [Boreskov Institute of Catalysis SB RAS, Novosibirsk (Russian Federation)

    2007-05-21

    The diffraction of synchrotron radiation (SR) was used to explore the phase composition of kidney stones placed into a specific object phantom, which imitated the human body. As an imitation of the patient breath, the kidney stone was moved vertically and rotated to an angle of 15{sup o} during the recording of the X-ray pattern. It was shown that rotation and displacement did not distort the X-ray pattern.

  2. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Mikulík, P.; Oberta, Peter

    2011-01-01

    Roč. 18, č. 2 (2011), s. 299-301 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412 Institutional research plan: CEZ:AV0Z10100522 Keywords : diffractive-refractive optics * x-ray synchrotron radiation monochromator * x-ray crystal monochromator * harmonics separation Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.726, year: 2011

  3. X-ray diffraction from intact tau aggregates in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Landahl, Eric C.; Antipova, Olga; Bongaarts, Angela; Barrea, Raul; Berry, Robert; Binder, Lester I.; Irving, Thomas; Orgel, Joseph; Vana, Laurel; Rice, Sarah E. (DePaul); (IIT); (NWU)

    2011-09-15

    We describe an instrument to record X-ray diffraction patterns from diseased regions of human brain tissue by combining an in-line visible light fluorescence microscope with an X-ray diffraction microprobe. We use thiazine red fluorescence to specifically label and detect the filamentous tau protein pathology associated with Pick's disease, as several laboratories have done previously. We demonstrate that thiazine red-enhanced regions within the tissue show periodic structure in X-ray diffraction, which is not observed in healthy tissue. One observed periodicity (4.2 {angstrom}) is characteristic of cross-beta sheet structure, consistent with previous results from powder diffraction studies performed on purified, dried tau protein.

  4. X-ray diffraction from intact tau aggregates in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Landahl, Eric C. [DePaul University, Department of Physics, 2219 N. Kenmore Ave., IL 60614, Chicago (United States); Antipova, Olga [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Bongaarts, Angela [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Barrea, Raul [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Berry, Robert; Binder, Lester I. [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Irving, Thomas; Orgel, Joseph [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Vana, Laurel [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Rice, Sarah E., E-mail: s-rice@northwestern.edu [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States)

    2011-09-01

    We describe an instrument to record X-ray diffraction patterns from diseased regions of human brain tissue by combining an in-line visible light fluorescence microscope with an X-ray diffraction microprobe. We use thiazine red fluorescence to specifically label and detect the filamentous tau protein pathology associated with Pick's disease, as several laboratories have done previously. We demonstrate that thiazine red-enhanced regions within the tissue show periodic structure in X-ray diffraction, which is not observed in healthy tissue. One observed periodicity (4.2 A) is characteristic of cross-beta sheet structure, consistent with previous results from powder diffraction studies performed on purified, dried tau protein.

  5. Materials identification using a small-scale pixellated x-ray diffraction system

    Science.gov (United States)

    O'Flynn, D.; Crews, C.; Drakos, I.; Christodoulou, C.; Wilson, M. D.; Veale, M. C.; Seller, P.; Speller, R. D.

    2016-05-01

    A transmission x-ray diffraction system has been developed using a pixellated, energy-resolving detector (HEXITEC) and a small-scale, mains operated x-ray source (Amptek Mini-X). HEXITEC enables diffraction to be measured without the requirement of incident spectrum filtration, or collimation of the scatter from the sample, preserving a large proportion of the useful signal compared with other diffraction techniques. Due to this efficiency, sufficient molecular information for material identification can be obtained within 5 s despite the relatively low x-ray source power. Diffraction data are presented from caffeine, hexamine, paracetamol, plastic explosives and narcotics. The capability to determine molecular information from aspirin tablets inside their packaging is demonstrated. Material selectivity and the potential for a sample classification model is shown with principal component analysis, through which each different material can be clearly resolved.

  6. Chemistry of Metal-organic Frameworks Monitored by Advanced X-ray Diffraction and Scattering Techniques.

    Science.gov (United States)

    Mazaj, Matjaž; Kaučič, Venčeslav; Zabukovec Logar, Nataša

    2016-01-01

    The research on metal-organic frameworks (MOFs) experienced rapid progress in recent years due to their structure diversity and wide range of application opportunities. Continuous progress of X-ray and neutron diffraction methods enables more and more detailed insight into MOF's structural features and significantly contributes to the understanding of their chemistry. Improved instrumentation and data processing in high-resolution X-ray diffraction methods enables the determination of new complex MOF crystal structures in powdered form. By the use of neutron diffraction techniques, a lot of knowledge about the interaction of guest molecules with crystalline framework has been gained in the past few years. Moreover, in-situ time-resolved studies by various diffraction and scattering techniques provided comprehensive information about crystallization kinetics, crystal growth mechanism and structural dynamics triggered by external physical or chemical stimuli. The review emphasizes most relevant advanced structural studies of MOFs based on powder X-ray and neutron scattering.

  7. Serial femtosecond X-ray diffraction of 30S ribosomal subunit microcrystals in liquid suspension at ambient temperature using an X-ray free-electron laser

    International Nuclear Information System (INIS)

    Demirci, Hasan; Sierra, Raymond G.; Laksmono, Hartawan; Shoeman, Robert L.; Botha, Sabine; Barends, Thomas R. M.; Nass, Karol; Schlichting, Ilme; Doak, R. Bruce; Gati, Cornelius; Williams, Garth J.; Boutet, Sébastien; Messerschmidt, Marc; Jogl, Gerwald; Dahlberg, Albert E.; Gregory, Steven T.; Bogan, Michael J.

    2013-01-01

    Serial femtosecond X-ray (SFX) diffraction extending beyond 6 Å resolution using T. thermophilus 30S ribosomal subunit crystals is reported. High-resolution ribosome structures determined by X-ray crystallography have provided important insights into the mechanism of translation. Such studies have thus far relied on large ribosome crystals kept at cryogenic temperatures to reduce radiation damage. Here, the application of serial femtosecond X-ray crystallography (SFX) using an X-ray free-electron laser (XFEL) to obtain diffraction data from ribosome microcrystals in liquid suspension at ambient temperature is described. 30S ribosomal subunit microcrystals diffracted to beyond 6 Å resolution, demonstrating the feasibility of using SFX for ribosome structural studies. The ability to collect diffraction data at near-physiological temperatures promises to provide fundamental insights into the structural dynamics of the ribosome and its functional complexes

  8. High resolution X-ray diffraction studies on unirradiated and ...

    Indian Academy of Sciences (India)

    ray diffraction techniques are widely used as non- destructive direct methods for analysing defects and dislo- cations in nearly perfect crystals (Lang 1958, 1970; Kato. 1992; Bowen and Tanner 1998). Crystallography has become an integral part ...

  9. Mechanical characterisation of surface layers by x-ray diffraction -application to tribology

    International Nuclear Information System (INIS)

    Farrahi, G.H.

    1996-01-01

    The results presented in this paper show that X-ray diffraction can be employed for the characterisation of surface layer damage through residual stresses and work hardening by some tribological actions such as fretting and dry sliding. X-ray diffraction technique can also be employed for a rapid and non-destructive measurement of hardness of hardened steel. The diffraction profile analysis can offer a good indication about the materials characteristics and the microstructural evolution caused by heat treatment or by mechanical loading

  10. Characterization of Gas-Solid Reactions using In Situ Powder X-ray Diffraction

    DEFF Research Database (Denmark)

    Møller, Kasper Trans; Hansen, Bjarne Rosenlund Søndertoft; Dippel, Ann-Christin

    2014-01-01

    X-ray diffraction is a superior technique for structural characterization of crystalline matter. Here we review the use of in situ powder X-ray diffraction (PXD) mainly for real-time studies of solid/gas reactions, data analysis and the extraction of valuable knowledge of structural, chemical...... by diffraction techniques, e.g. crystallite size. The aim of this review is to provide new inspiration for utilization of in situ PXD for characterization of a wide range of properties beyond the scope of crystal structure solution....

  11. Quantitative determination of phases of X-ray reflections from three-beam diffractions. Pt. 2

    International Nuclear Information System (INIS)

    Tang Mautsu; Chang Shihlin

    1988-01-01

    The method proposed by Chang and Tang of quantitative determination of X-ray reflection phases from multiple diffraction profiles is applied to nearly perfect crystals of gallium arsenide. The detailed intensity-profile-analysis procedures are given. Multiple diffraction profiles obtained with a conventional X-ray source and synchrotron radiation are subjected to this analysis. It is found that, for this particular diffraction example, errors as small as 15 0 in phase determination are achieved. Errors due to the theoretical approximation, peak position measurement and scaling factor are also discussed. (orig.)

  12. Phase analysis of micro-alloyed steels using X-ray diffraction measurements

    International Nuclear Information System (INIS)

    Tobisch, J.; Kleinstueck, K.; Schatt, W.; Riehle, M.; Technische Univ., Dresden

    1977-01-01

    The applicability of neutron diffraction and X-ray diffraction to phase analyses of micro-alloyed steels is tested. The results show that the resolution of neutron reflexes was too low for quantitative statements. X-ray diffraction measurements of the reflex intensity permit quantitative analyses of the phase TiN, TiC, and Ti 4 C 2 S 2 in micro-alloyed steels without and after heat treatment. The values of the quantitative determination of these phases ranged from about 0.03 to 0.4 per cent by weight

  13. Synchrotron X-ray and neutron diffraction studies in solid-state chemistry

    International Nuclear Information System (INIS)

    Cheetham, A.K.; Wilkinson, A.P.

    1992-01-01

    Since the scatterers are different - X-rays are scattered by the electrons of an atom, neutrons by the nuclei - the questions addressed by the two diffraction experiments have been complementary. For example, neighboring elements of the periodic table could be distinguished formerly only by neutron diffraction. Now, however, this is also partly possible with high-energy synchrotron radiation. This review describes recent applications of X-ray and neutron diffraction methods in solid-state chemistry and how the maximal information can be extracted by a combination of techniques. (orig.)

  14. Neutron and x-ray diffraction studies of liquids and glasses

    International Nuclear Information System (INIS)

    Fischer, Henry E; Barnes, Adrian C; Salmon, Philip S

    2006-01-01

    The techniques of neutron diffraction and x-ray diffraction, as applied to structural studies of liquids and glasses, are reviewed. Emphasis is placed on the explanation and discussion of the experimental techniques and data analysis methods, as illustrated by the results of representative experiments. The disordered, isotropic nature of the structure of liquids and glasses leads to special considerations and certain difficulties when neutron and x-ray diffraction techniques are applied, especially when used in combination on the same system. Recent progress in experimental technique, as well as in data analysis and computer simulation, has motivated the writing of this review

  15. Optomechanical design of a high-precision detector robot arm system for x-ray nano-diffraction with x-ray nanoprobe

    Science.gov (United States)

    Shu, D.; Kalbfleisch, S.; Kearney, S.; Anton, J.; Chu, Y. S.

    2014-03-01

    Collaboration between Argonne National Laboratory and Brookhaven National Laboratory has created a design for the high-precision detector robot arm system that will be used in the x-ray nano-diffraction experimental station at the Hard X-ray Nanoprobe (HXN) beamline for the NSLS-II project. The robot arm system is designed for positioning and manipulating an x-ray detector in three-dimensional space for nano-diffraction data acquisition with the HXN x-ray microscope. It consists of the following major component groups: a granite base with air-bearing support, a 2-D horizontal base stage, a vertical axis goniometer, a 2-D vertical plane robot arm, a 3-D fast scanning stages group, and a 2-D x-ray pixel detector. The design specifications and unique optomechanical structure of this novel high-precision detector robot arm system will be presented in this paper.

  16. Combined experimental powder X-ray diffraction and DFT data to obtain the lowest energy molecular conformation of friedelin

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Djalma Menezes de; Mussel, Wagner da Nova; Duarte, Lucienir Pains; Silva, Gracia Divina de Fatima; Duarte, Helio Anderson; Gomes, Elionai Cassiana de Lima [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Quimica; Guimaraes, Luciana [Universidade Federal de Sao Joao Del-Rei (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Vieira Filho, Sidney A., E-mail: bibo@ef.ufop.br [Universidade Federal de Ouro Preto (UFOP), MG (Brazil). Dept. de Farmacia

    2012-07-01

    Friedelin molecular conformers were obtained by Density Functional Theory (DFT) and by ab initio structure determination from powder X-ray diffraction. Their conformers with the five rings in chair-chair-chair-boat-boat, and with all rings in chair, are energy degenerated in gas-phase according to DFT results. The powder diffraction data reveals that rings A, B and C of friedelin are in chair, and rings D and E in boat-boat, conformation. The high correlation values among powder diffraction data, DFT and reported single crystal data indicate that the use of conventional X-ray diffractometer can be applied in routine laboratory analysis in the absence of a single-crystal diffractometer. (author)

  17. Energy-dispersive X-ray diffraction beamline at Indus-2 synchrotron ...

    Indian Academy of Sciences (India)

    Abstract. An energy-dispersive X-ray diffraction beamline has been designed, developed and commissioned at BL-11 bending magnet port of the Indian synchrotron source, Indus-2. The performance of this beamline has been benchmarked by measuring diffraction patterns from var- ious elemental metals and standard ...

  18. Energy-dispersive X-ray diffraction beamline at Indus-2 synchrotron ...

    Indian Academy of Sciences (India)

    An energy-dispersive X-ray diffraction beamline has been designed, developed and commissioned at BL-11 bending magnet port of the Indian synchrotron source, Indus-2. The performance of this beamline has been benchmarked by measuring diffraction patterns from various elemental metals and standard inorganic ...

  19. New structural studies of liquid crystal by reflectivity and resonant X-ray diffraction

    International Nuclear Information System (INIS)

    Fernandes, P.

    2007-04-01

    This memory presents three structural studies of smectic Liquid Crystals by reflectivity and resonant diffraction of X-rays. It is divided in five chapters. In the first a short introduction to Liquid Crystals is given. In particular, the smectic phases that are the object of this study are presented. The second chapter is consecrated to the X-ray experimental techniques that were used in this work. The three last chapters present the works on which this thesis can be divided. Chapter three demonstrates on free-standing films of MHPOBC (historic liquid crystal that possesses the antiferroelectric sub-phases) the possibility to extend the technique of resonant X-ray diffraction to liquid crystals without resonant element. In the fourth chapter the structure of the B 2 liquid crystal phase of bent-core molecules (or banana molecules) is elucidated by using resonant X-ray diffraction combined with polarization analysis of the diffracted beam. A model of the polarization of the resonant beam diffracted by four different structures proposed for the B 2 phase is developed in this chapter. In the fifth chapter a smectic binary mixture presenting a very original critical point of phase separation is studied by X-ray reflectivity and optical microscopy. A concentration gradient in the direction perpendicular to the plane of the film seems to be induced by the free-standing film geometry. The results of a simplified model of the system are compatible with this interpretation

  20. X-ray diffraction and X-ray K absorption near edge studies of copper (II) complexes with amino acids

    Science.gov (United States)

    Sharma, P. K.; Mishra, Ashutosh; Malviya, Varsha; Kame, Rashmi; Malviya, P. K.

    2017-05-01

    Synthesis of copper (II) complexes [CuL1L2X].nH2O, where n=1, 2,3 (X=Cl,Br,NO3) (L1is 2,2’-bipyridine and L2 is L-tyrosine) by the chemical root method. The XRD data for the samples have been recorded. EXAFS spectra have also been recorded at the K-edge of Cu using the dispersive beam line BL-8 at 2.5 Gev Indus-2 Synchrotron radiation source at RRCAT, Indore, India. XRD and EXAFS data have been analysed using the computer software. X-ray diffraction studies of all complexes indicate their crystalline nature. Lattice parameter, bond length, particle size have been determined from XRD data.

  1. High Pressure X-Ray Diffraction Studies of Nanocrystalline Materials

    Science.gov (United States)

    Palosz, B.; Stel'makh, S.; Grzanka, E.; Gierlotka, S.; Palosz, W.

    2004-01-01

    Experimental evidence obtained for a variety of nanocrystalline materials suggest that the crystallographic structure of a very small size particle deviates from that in the bulk crystals. In this paper we show the effect of the surface of nanocrystals on their structure by the analysis of generation and distribution of macro- and micro-strains at high pressures and their dependence on the grain size in nanocrystalline powders of Sic. We studied the structure of Sic nanocrystals by in-situ high-pressure powder diffraction technique using synchrotron and neutron sources and hydrostatic or isostatic pressure conditions. The diffraction measurements were done in HASYLAB at DESY using a Diamond Anvil Cell (DAC) in the energy dispersive geometry in the diffraction vector range up to 3.5 - 4/A and under pressures up to 50 GPa at room temperature. In-situ high pressure neutron diffraction measurements were done at LANSCE in Los Alamos National Laboratory using the HIPD and HIPPO diffractometers with the Paris-Edinburgh and TAP-98 cells, respectively, in the diffraction vector range up to 26 Examination of the response of the material to external stresses requires nonstandard methodology of the materials characterization and description. Although every diffraction pattern contains a complete information on macro- and micro-strains, a high pressure experiment can reveal only those factors which contribute to the characteristic diffraction patterns of the crystalline phases present in the sample. The elastic properties of powders with the grain size from several nm to micrometers were examined using three methodologies: (l), the analysis of positions and widths of individual Bragg reflections (used for calculating macro- and micro-strains generated during densification) [I], (2). the analysis of the dependence of the experimental apparent lattice parameter, alp, on the diffraction vector Q [2], and (3), the atomic Pair Distribution Function (PDF) technique [3]. The results

  2. Structure of drug-target proteins determined by both X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Kuroki, Ryota

    2009-01-01

    Crystallography enables us to obtain accurate atomic positions within proteins. High resolution X-ray crystallography provides information for most of the atoms comprising a protein, with the exception of hydrogens. Neutron diffraction data can provide information of the location of hydrogen atoms to the structural information determined by X-ray crystallography. Here, we show the recent of the structural determination of drug-target proteins, porcine pancreatic elastase (PPE) and human immuno-deficiency virus type-1 protease (HIV-PR) by both X-ray and neutron diffraction. The structure of porcine pancreatic elastase with its potent inhibitor (FR13080) was determined to 0.94A resolution by X-ray diffraction and 1.75 A resolution by neutron diffraction. It was found that there are two characteristic hydrogen bonding interactions in which hydrogen atoms were confirmed. One is located between a catalytic aspartate and histidine, another is involved in the inhibitor recognition site. The structure of HIV-PR with its potent inhibitor (KNI-272) was also determined to 0.93 A resolution by X-ray diffraction and 2.3 A resolution by neutron diffraction. The ionization state of the catalytic residues were clarified to show that Asp125 is protonated and Asp25 is deprotonated. The ionization state and the location of hydrogen atoms of the catalytic residue in HIV-PR were firstly determined by neutron diffraction. Furthermore, collaborative use of both X-ray and neutron to identify the location of ambiguous hydrogen atoms will be shown. (author)

  3. Long-Wavelength X-Ray Diffraction and Its Applications in Macromolecular Crystallography.

    Science.gov (United States)

    Weiss, Manfred S

    2017-01-01

    For many years, diffraction experiments in macromolecular crystallography at X-ray wavelengths longer than that of Cu-K α (1.54 Å) have been largely underappreciated. Effects caused by increased X-ray absorption result in the fact that these experiments are more difficult than the standard diffraction experiments at short wavelengths. However, due to the also increased anomalous scattering of many biologically relevant atoms, important additional structural information can be obtained. This information, in turn, can be used for phase determination, for substructure identification, in molecular replacement approaches, as well as in structure refinement. This chapter reviews the possibilities and the difficulties associated with such experiments, and it provides a short description of two macromolecular crystallography synchrotron beam lines dedicated to long-wavelength X-ray diffraction experiments.

  4. Influence of neutron irradiation on the microstructure of nuclear graphite: An X-ray diffraction study

    Science.gov (United States)

    Zhou, Z.; Bouwman, W. G.; Schut, H.; van Staveren, T. O.; Heijna, M. C. R.; Pappas, C.

    2017-04-01

    Neutron irradiation effects on the microstructure of nuclear graphite have been investigated by X-ray diffraction on virgin and low doses (∼ 1.3 and ∼ 2.2 dpa), high temperature (750° C) irradiated samples. The diffraction patterns were interpreted using a model, which takes into account the turbostratic disorder. Besides the lattice constants, the model introduces two distinct coherent lengths in the c-axis and the basal plane, that characterise the volumes from which X-rays are scattered coherently. The methodology used in this work allows to quantify the effect of irradiation damage on the microstructure of nuclear graphite seen by X-ray diffraction. The results show that the changes of the deduced structural parameters are in agreement with previous observations from electron microscopy, but not directly related to macroscopic changes.

  5. Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

    Science.gov (United States)

    Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

    2016-09-01

    We present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional data cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. We demonstrate this ‘big data’ approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.

  6. Determination of the strain hardening rate of metals and alloys by X ray diffraction

    International Nuclear Information System (INIS)

    Cadalbert, Robert

    1977-01-01

    This report for engineering graduation is based on the study of X ray diffraction line profile which varies with the plastic strain rate of the metal. After some generalities of strain hardening (consequence of a plastic deformation on the structure of a polycrystalline metal, means to study a strain hardened structure, use of X ray diffraction to analyse the strain hardened crystalline structure), the author reports the strain hardening rate measurement by using X ray diffraction. Several aspects are addressed: principles, experimental technique, apparatus, automation and programming of the measurement cycle, method sensitivity and precision. In the next part, the author reports applications: measurement of the strain hardening rate in different materials (tubes with hexagonal profile, cylindrical tubes in austenitic steel), and study of the evolution of strain hardening with temperature [fr

  7. Purification, crystallization and preliminary X-ray diffraction analysis of the effector protein PevD1 from Verticillium dahliae

    International Nuclear Information System (INIS)

    Han, Lei; Liu, Zheng; Liu, Xinqi; Qiu, Dewen

    2012-01-01

    The overexpression, purification, crystallization and preliminary X-ray diffraction analysis of protein elicitor PevD1 from Verticillium dahliae are reported. The effector protein PevD1 from the pathogenic fungus Verticillium dahliae was purified and crystallized using the hanging-drop vapour-diffusion method. Native crystals appeared in a solution consisting of 4.0 M sodium formate. A native data set was collected at 1.9 Å resolution at 100 K using an in-house X-ray source. Because of the absence of useful methinione in the protein sequence, derivative crystals that contained iodine were obtained by soaking in 1.25 M potassium iodide, and a data set that contained anomalous signal was collected using the same X-ray facility at a wavelength of 1.54 Å. The single-wavelength anomalous dispersion method was used to successfully solve the structure based on the anomalous signal generated from iodine

  8. Single crystal X-ray structure of the artists’ pigment zinc yellow

    DEFF Research Database (Denmark)

    Simonsen, Kim Pilkjær; Christiansen, Marie Bitsch; Vinum, Morten Gotthold

    2017-01-01

    been unknown. In this work, zinc yellow was synthesised by precipitation from an aqueous solution of zinc nitrate and potassium chromate under both neutral and basic conditions, and the products were compared with the pigment used in industrial paints. Analyses by Raman microscopy (MRS), scanning...... electron microscopy-energy dispersive X-ray spectroscopy (SEM-EDS), attenuated total reflectance-Fourier transform infrared spectroscopy (ATR-FTIR), and powder X-ray diffraction (PXRD), showed that the synthesised products and the industrial pigment were identical. Single-crystal X-ray crystallography......The artists’ pigment zinc yellow is in general described as a complex potassium zinc chromate with the empirical formula 4ZnCrO4·K2O·3H2O. Even though the pigment has been in use since the second half of the 19th century also in large-scale industrial applications, the exact structure had hitherto...

  9. Assessment of the out-plane and in-plane ordering of high quality ZnO nanorods by X-ray multiple diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Martínez-Tomás, M.C., E-mail: Carmen.Martinez-tomas@uv.es [Departamento de Física Aplicada y Electromagnetismo, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot (Spain); Montenegro, D.N.; Agouram, S. [Departamento de Física Aplicada y Electromagnetismo, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot (Spain); Sallet, V. [Groupe d' Etude de la Matière Condensée (GEMAC), CNRS-Université de Versailles St-Quentin, 45 avenue des Etats-Unis, 78035 Versailles Cedex (France); Muñoz-Sanjosé, V. [Departamento de Física Aplicada y Electromagnetismo, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot (Spain)

    2013-08-31

    ZnO nanorods grown on buffered and non buffered sapphire substrates have been investigated by X-ray multiple diffraction using Renninger scans of the ZnO(0001) and ZnO(0003) forbidden reflections. In this technique the diffracted X-ray beam is simultaneously diffracted by several sets of planes, providing information on the broadening in different directions, as well as from nanorods, and from the layer on which they grow. The intensities and angular widths of peaks obtained by azimuthal and omega scans have been analyzed, making a direct comparison with conventional measurements of the full width at half-maximum of symmetric and asymmetric reflections. The analysis leads to establish that the peaks of the Renninger scan are highly sensitive to structural characteristics, providing information related with both the out-plane and in-plane ordering of nanostructured samples with a single scan. - Highlights: ► Structural characteristics of ZnO nanorods have been analyzed by X-ray multiple diffraction. ► X-ray multiple diffraction can provide mosaic structure characteristics from a single scan. ► Peaks of Renninger scan result to be very sensitive to structural characteristics. ► X-ray multiple diffraction can be an alternative analysis method to X-ray diffraction.

  10. An experimental system for high temperature X-ray diffraction studies with in situ mechanical loading

    Science.gov (United States)

    Oswald, Benjamin B.; Schuren, Jay C.; Pagan, Darren C.; Miller, Matthew P.

    2013-03-01

    An experimental system with in situ thermomechanical loading has been developed to enable high energy synchrotron x-ray diffraction studies of crystalline materials. The system applies and maintains loads of up to 2250 N in uniaxial tension or compression at a frequency of up to 100 Hz. The furnace heats the specimen uniformly up to a maximum temperature of 1200 °C in a variety of atmospheres (oxidizing, inert, reducing) that, combined with in situ mechanical loading, can be used to mimic processing and operating conditions of engineering components. The loaded specimen is reoriented with respect to the incident beam of x-rays using two rotational axes to increase the number of crystal orientations interrogated. The system was used at the Cornell High Energy Synchrotron Source to conduct experiments on single crystal silicon and polycrystalline Low Solvus High Refractory nickel-based superalloy. The data from these experiments provide new insights into how stresses evolve at the crystal scale during thermomechanical loading and complement the development of high-fidelity material models.

  11. An experimental system for high temperature X-ray diffraction studies with in situ mechanical loading

    International Nuclear Information System (INIS)

    Oswald, Benjamin B.; Pagan, Darren C.; Miller, Matthew P.; Schuren, Jay C.

    2013-01-01

    An experimental system with in situ thermomechanical loading has been developed to enable high energy synchrotron x-ray diffraction studies of crystalline materials. The system applies and maintains loads of up to 2250 N in uniaxial tension or compression at a frequency of up to 100 Hz. The furnace heats the specimen uniformly up to a maximum temperature of 1200 °C in a variety of atmospheres (oxidizing, inert, reducing) that, combined with in situ mechanical loading, can be used to mimic processing and operating conditions of engineering components. The loaded specimen is reoriented with respect to the incident beam of x-rays using two rotational axes to increase the number of crystal orientations interrogated. The system was used at the Cornell High Energy Synchrotron Source to conduct experiments on single crystal silicon and polycrystalline Low Solvus High Refractory nickel-based superalloy. The data from these experiments provide new insights into how stresses evolve at the crystal scale during thermomechanical loading and complement the development of high-fidelity material models.

  12. An experimental system for high temperature X-ray diffraction studies with in situ mechanical loading

    Energy Technology Data Exchange (ETDEWEB)

    Oswald, Benjamin B.; Pagan, Darren C.; Miller, Matthew P. [Sibley School of Mechanical and Aerospace Engineering, Cornell University, Ithaca, New York 14853 (United States); Schuren, Jay C. [Materials and Manufacturing Directorate, Air Force Research Laboratory, Wright-Patterson Air Force Base, Ohio 45433 (United States)

    2013-03-15

    An experimental system with in situ thermomechanical loading has been developed to enable high energy synchrotron x-ray diffraction studies of crystalline materials. The system applies and maintains loads of up to 2250 N in uniaxial tension or compression at a frequency of up to 100 Hz. The furnace heats the specimen uniformly up to a maximum temperature of 1200 Degree-Sign C in a variety of atmospheres (oxidizing, inert, reducing) that, combined with in situ mechanical loading, can be used to mimic processing and operating conditions of engineering components. The loaded specimen is reoriented with respect to the incident beam of x-rays using two rotational axes to increase the number of crystal orientations interrogated. The system was used at the Cornell High Energy Synchrotron Source to conduct experiments on single crystal silicon and polycrystalline Low Solvus High Refractory nickel-based superalloy. The data from these experiments provide new insights into how stresses evolve at the crystal scale during thermomechanical loading and complement the development of high-fidelity material models.

  13. Impurity precipitation in atomized particles evidenced by nano x-ray diffraction computed tomography

    Science.gov (United States)

    Bonnin, Anne; Wright, Jonathan P.; Tucoulou, Rémi; Palancher, Hervé

    2014-08-01

    Performances and physical properties of high technology materials are influenced or even determined by their initial microstructure and by the behavior of impurity phases. Characterizing these impurities and their relations with the surrounding matrix is therefore of primary importance but it unfortunately often requires a destructive approach, with the risk of misinterpreting the observations. The improvement we have done in high resolution X-ray diffraction computed tomography combined with the use of an X-ray nanoprobe allows non-destructive crystallographic description of materials with microscopic heterogeneous microstructure (with a grain size between 10 nm and 10 μm). In this study, the grain localization in a 2D slice of a 20 μm solidified atomized γU-Mo particle is shown and a minority U(C,O) phase (1 wt. %) with sub-micrometer sized grains was characterized inside. Evidence is presented showing that the onset of U(C,O) grain crystallization can be described by a precipitation mechanism since one single U-Mo grain has direct orientation relationship with more than one surrounding U(C,O) grains.

  14. Direct observation of ultrafast atomic motion using time-resolved X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Shymanovich, U.

    2007-11-13

    This thesis is dedicated to the study of the atomic motion in laser irradiated solids on a picosecond to subpicosecond time-scale using the time-resolved X-ray diffraction technique. In the second chapter, the laser system, the laser-plasma based X-ray source and the experimental setup for optical pump / X-ray probe measurements were presented. Chapter 3 is devoted to the characterization and comparison of different types of X-ray optics. Chapter 4 presented the time-resolved X-ray diffraction experiments performed for this thesis. The first two sections of this chapter discuss the measurements of initially unexpected strain-induced transient changes of the integrated reflectivity of the X-ray probe beam. The elimination of the strain-induced transient changes of the integrated reflectivity represented an important prerequisite to perform the study of lattice heating in Germanium after femtosecond optical excitation by measuring the transient Debye-Waller effect. The third section describes the investigations of acoustic waves upon ultrafast optical excitation and discusses the two different pressure contributions driving them: the thermal and the electronic ones. (orig.)

  15. Electronic properties of crystalline materials observed in X-ray diffraction

    Science.gov (United States)

    Lovesey, S. W.; Balcar, E.; Knight, K. S.; Fernández Rodríguez, J.

    2005-05-01

    The few electrons in valence states of a material participate in many of its physical properties, including both structural and transport properties. In the diffraction of X-rays, or neutrons, valence electrons can lead to weak Bragg reflections that are extremely sensitive signatures of their charge and magnetic degrees of freedom. In this regard, diffraction instruments supplied with X-rays from a synchrotron source are particularly useful because the brightness, tuneability and polarization of the X-rays are all helpful in making valuable observations. The data obtained from Bragg diffraction can be analyzed on the basis of an atomic model, which has the virtue that it can be used as a common platform for the analysis of X-ray and neutron diffraction and, in addition, the analysis of observations made with X-ray absorption, NMR, EPR, muon and Mössbauer spectroscopies. We present the salient features for the calculation of structure factors based on an atomic model and applied to the analysis of Bragg diffraction by non-magnetic and magnetic materials, with an emphasis on resonant X-ray Bragg diffraction. The presentation contains a new treatment of parity-odd events found in the mixed electric dipole-electric quadrupole channel of scattering. In addition we discuss the complementary observation of dichroic signals, including natural circular and magnetochiral dichroism. The survey of available analytical tools is complemented by a series of worked examples demonstrating the application of the formalism to different materials with different crystal structures and resonant ions: dysprosium borocarbide ( DyB2C2), vanadium sesquioxide (V2O3), gadolinium tetraboride ( GdB4), chromium sesquioxide ( Cr2O3), haematite and perovskite-type manganites.

  16. Electronic properties of crystalline materials observed in X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Lovesey, S.W. [Diamond Light Source Ltd., ISIS Facility, RAL, Oxfordshire OX11 0QX (United Kingdom) and RIKEN Harima Institute, SPring-8, Hyogo 679-5148 (Japan)]. E-mail: s.w.lovesey@rl.ac.uk; Balcar, E. [Vienna University of Technology, Atominstitut, Stadionallee 2, A1020, Vienna (Austria); Knight, K.S. [Diamond Light Source Ltd., ISIS Facility, RAL, Oxfordshire OX11 0QX (United Kingdom); Department of Mineralogy, Natural History Museum, London SW7 5BD (United Kingdom); Fernandez Rodriguez, J. [Departamento de Fisica, Universidad de Oviedo, E-33007 Oviedo (Spain)

    2005-05-01

    The few electrons in valence states of a material participate in many of its physical properties, including both structural and transport properties. In the diffraction of X-rays, or neutrons, valence electrons can lead to weak Bragg reflections that are extremely sensitive signatures of their charge and magnetic degrees of freedom. In this regard, diffraction instruments supplied with X-rays from a synchrotron source are particularly useful because the brightness, tuneability and polarization of the X-rays are all helpful in making valuable observations. The data obtained from Bragg diffraction can be analyzed on the basis of an atomic model, which has the virtue that it can be used as a common platform for the analysis of X-ray and neutron diffraction and, in addition, the analysis of observations made with X-ray absorption, NMR, EPR, muon and Mossbauer spectroscopies. We present the salient features for the calculation of structure factors based on an atomic model and applied to the analysis of Bragg diffraction by non-magnetic and magnetic materials, with an emphasis on resonant X-ray Bragg diffraction. The presentation contains a new treatment of parity-odd events found in the mixed electric dipole-electric quadrupole channel of scattering. In addition we discuss the complementary observation of dichroic signals, including natural circular and magnetochiral dichroism. The survey of available analytical tools is complemented by a series of worked examples demonstrating the application of the formalism to different materials with different crystal structures and resonant ions: dysprosium borocarbide (DyB{sub 2}C{sub 2}), vanadium sesquioxide (V{sub 2}O{sub 3}), gadolinium tetraboride (GdB{sub 4}), chromium sesquioxide (Cr{sub 2}O{sub 3}), haematite and perovskite-type manganites.

  17. Local layer structure of smectic liquid crystals by X-ray micro-diffraction

    CERN Document Server

    Takanishi, Y

    2003-01-01

    The local layer structure of smectic liquid crystal has been measured using time-resolved synchrotron X-ray micro-diffraction. Typical layer disorders observed in surface stabilized (anti-) ferroelectric liquid crystals, i.e. a stripe texture, a needed-like defect and a zigzag defect, are directly analyzed. The detailed analysis slows that the surface anchoring force due to the interaction between the liquid crystal molecule and the alignment thin film plays an important role to realize both the static and dynamic local layer structures. The layer structure of the circular domain observed in the liquid crystal of bent-shaped molecules found to depend on the applied electric field though the optical micrograph shows little difference. The frustrated, double and single layer structures of the bent-shaped molecule liquid crystal are determined depending on the terminal alkyl chain length. (author)

  18. Strategies for Time-resolved X-ray Diffraction of Phase Transitions with Laser Compression

    Science.gov (United States)

    Benedetti, Laura Robin; Eggert, J. H.; Bradley, D. K.; Bell, P. M.; Kilkenny, J. D.; Palmer, N.; Petre, R. B.; Rygg, J. R.; Sorce, C.; Collins, G. W.; Boehly, T. R.

    2017-10-01

    As part of a program to document kinetics of phase transitions under laser-driven dynamic compression, we are designing a platform to make multiple x-ray diffraction measurements during a single laser experiment. Our plans include experimental development at Omega-EP and eventual implementation at NIF. We will present our strategy for designing a robust platform that can effectively document a wide variety of phase transformations by utilizing both streaked and multiple-frame imaging detectors. Preliminary designs utilize a novel CMOS detector designed by Sandia National Lab. Our initial experiments include scoping studies that will focus on photometrics and shielding requirements in the high EMP environment close to the target. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. Lawrence Livermore National Security, LLC, LLNL-ABS-734470.

  19. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chen Bo; Berenguer, Felisa; Bean, Richard J; Robinson, Ian K; Zhang Fucai; Rodenburg, John M; Kewish, Cameron M; Vila-Comamala, Joan; Chu, Yong S

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens. (paper)

  20. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chu, Y.S.; Chen, B.; Zhang, F.; Berenguer, F.; Bean, R.; Kewish, C.; Vila-Comamala, J.; Rodenburg, J.; Robinson, I.

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens.

  1. Determination of densities from chemical composition and X-Ray diffraction

    International Nuclear Information System (INIS)

    Azevedo, A.L.T. de

    1980-01-01

    X-ray diffraction method applied to retained austenite measurements gives volume per cent results, whereas the same kind of measurement made by Moessbauer Effect gives iron percentages. To compare both results one needs to convert the volume % to weight % or vice-versa. This necessitates, among other things, in determining the densities of the α and #betta# phases in the steel being studied. A method for calculating the densities, based on the application of the definition of density to just one unit cell, using X-ray diffraction and chemical results, are described. (Author) [pt

  2. Transmission diffraction-tomography system using a high-energy X-ray tube.

    Science.gov (United States)

    Garrity, D J; Jenneson, P M; Crook, R; Vincent, S M

    2010-01-01

    A high-energy bench-top energy dispersive X-ray diffraction (EDXRD) system for 3-dimensional mapping of the crystalline structure and phase transformations in steel is described, for which preliminary data and system development are presented here. The use of precision tungsten slit screens with up to 225 keV X-rays allows for diffraction through samples of 304 L austenitic stainless steel of thickness 3-10 mm, while sample positioning is carried out with a precision goniometer and translation stage system. Copyright 2009 Elsevier Ltd. All rights reserved.

  3. A Furnace for Diffraction Studies using Synchrotron X-Ray Radiation

    DEFF Research Database (Denmark)

    Buras, B.; Lebech, Bente; Kofoed, W.

    1984-01-01

    A furnace for diffraction studies using synchrotron X-ray radiation is described. The furnace can be operated between ambient temperature and 1 800 °C with a temperature stability better than 5 °C for temperatures above 300 °C. Kapton windows allow almost 360° access for the X-ray beam in the hor...... in the horizontal scattering plane and the furnace may be used in both conventional monochromatic beam angle-dispersive and white-beam energy-dispersive diffraction experiments. Details of the furnace windows, heating element, thermometry and sample mount are given....

  4. X-ray diffraction studies of chitosan acetate-based polymer electrolytes

    International Nuclear Information System (INIS)

    Osman, Z.; Ibrahim, Z.A.; Abdul Kariem Arof

    2002-01-01

    Chitosan is the product when partially deacetylated chitin dissolves in dilute acetic acid. This paper presents the x-ray diffraction patterns of chitosan acetate, plasticised chitosan acetate and plasticised-salted chitosan acetate films. The results show that the chitosan acetate based polymer electrolyte films are not completely amorphous but it is partially crystalline. X-ray diffraction study also confirms the occurrence of the complexation between chitosan and the salt and the interaction between salt and plasticizer. The salt-chitosan interaction is clearly justified by infrared spectroscopy. (Author)

  5. Modification of the x-ray diffraction efficiency of lithium fluoride crystals by surface treatment

    International Nuclear Information System (INIS)

    Sellick, B.O.

    1976-01-01

    Convex-curved crystals of lithium fluoride demonstrate good dispersion and efficiency when used in reflection for x-ray spectral analysis. The crystals are stable and reasonably unaffected by harsh environments. In addition, they are mechanically strong, easily cleavable or machinable, and plastically deformable with heat. In the present study, flat crystal wafers were left either clear as cleaved or were subjected to surface treatment by sandblasting or lapping. Some wafers were then bent in a press mold to obtain convex-curved crystals of differing radii. The diffraction efficiency data presented show how surface treatment affects the efficiency of these various crystals when used as x-ray diffracting agents

  6. Planar irregularities of texture and stress field in Ti detected by X-ray diffraction technique

    Science.gov (United States)

    Tarkowski, L.; Bonarski, J.; Alexandrov, I.

    2010-02-01

    Regardless of the origin of structure irregularities of materials, the recognition of their spatial distribution in a sample or constructing elements is a great research problem. One of the most effective and non-destructive tools used for this purpose is the X-ray diffraction technique, assisted by an appropriate experimental method and data processing. The work presents the results of investigations of planar distribution of crystallographic texture and stress irregularities manifested by changes of diffraction effects registered by the X-ray technique. As an example, the introduced method is tested on a titanium rod after severe plastic deformation process.

  7. Crystallization and preliminary X-ray diffraction study of porcine carboxypeptidase B

    Energy Technology Data Exchange (ETDEWEB)

    Akparov, V. Kh., E-mail: valery@akparov.ru [Scientific Center of Russian Federation Research Institute for Genetics and Selection of Industrial Microorganisms (Russian Federation); Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Kuranova, I. P., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-05-15

    Crystals of porcine pancreatic carboxypeptidase B have been grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction study showed that the crystals belong to sp. gr. P4{sub 1}2{sub 1}2 and have the following unit-cell parameters: a = b = 79.58 Å, c = 100.51 Å; α = β = γ = 90.00°. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one of the grown crystals at the SPring 8 synchrotron facility to 0.98 Å resolution.

  8. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    Science.gov (United States)

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  9. Dewetting of Au Films Studied by Coherent X-ray Diffraction (CXD)

    Science.gov (United States)

    Williams, G. J.; Pfeifer, M. A.; Robinson, I. K.

    2002-03-01

    Long-term heating of Au thin films evaporated on quartz or silica substrates causes dewetting. Eventually, single crystals of Au are formed with a size and spacing determined by the initial deposit thickness. When a finite perfect crystal is illuminated by a coherent X-ray beam, the diffracted intensity near a Bragg peak is the square modulus of the Fourier Transform of the diffracting crystal. The advantage of the coherent technique in this situation lies in its ability to recover the shape of the resulting crystal, allowing measurement not only of the size and spatial distribution of the dewetted film, but also of the contact angle and the strain within the 3D crystal. The quantity measured in such a CXD experiment is the intensity; the phase of the diffracted beam may be recovered using an iterative algorithm, thereby allowing the reconstruction of crystal shape. We present here the successful inversion of a CXD pattern in three dimensions from a micron-sized Au single crystal prepared in this way.

  10. Diffraction crystals for sagittally focusing x-rays

    Science.gov (United States)

    Ice, G.E.; Sparks, C.J. Jr.

    1982-06-07

    The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

  11. X-ray grazing incidence diffraction from multilayers

    Energy Technology Data Exchange (ETDEWEB)

    Tixier, S.; Boeni, P.; Swygenhoven, H. van; Horisberger, M. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-09-01

    Grazing incidence scattering geometries using synchrotron radiation have been applied in order to characterise the roughness profiles and the structural coherence of multilayers. The lateral correlation length of the roughness profiles was evaluated using diffuse reflectivity in the `out of plane` geometry. This type of measurement is the only diffuse reflectivity technique allowing large lateral momentum transfer. It is typically suitable for correlation lengths smaller than 1000 A. The lateral structural coherence length of Ni{sub 3}Al/Ni multilayers as a function of the layer thickness was obtained by grazing incidence diffraction (GID). 3 figs., 1 ref.

  12. X-ray diffraction and imaging with a coherent beam: application to X-ray optical elements and to crystals exhibiting phase inhomogeneities

    International Nuclear Information System (INIS)

    Masiello, F.

    2011-05-01

    The exceptional properties of synchrotron light sources have been exploited in very different disciplines, from archaeology to chemistry, from material science to biology, from medicine to physics. Among these properties it is important to mention the high brilliance, continuum spectrum, high degree of polarization, time structure, small source size and divergence of the beam, the last resulting in a high transversal coherence of the produced radiation. This high transversal coherence of the synchrotron sources has permitted the development of new techniques, e.g. phase contrast imaging, X-ray photon correlation spectroscopy and coherent X-ray diffraction imaging (CXDI). This thesis work will consist essentially of three parts. In the first part it will be presented the work done as a member of the X-ray Optics Group of ESRF in the characterization of high quality diamond crystals foreseen as X-ray optical elements. The characterization has been done using different complementary X-ray techniques, such as high resolution diffraction, topography, grazing incidence diffraction, reflectivity and measurements of the coherence preservation using the Talbot effect. In the second part, I will show the result obtained in the study of the temperature behaviours of the domain in periodically poled ferroelectrics crystals. This type of measurements, based on Bragg-Fresnel diffraction, are possible only thanks to the high degree of coherence of the beam. In the third part, I will present the results obtained in the characterization of diamonds foreseen for applications other than X-ray optical elements. (author)

  13. Simultaneous X-ray diffraction and phase-contrast imaging for investigating material deformation mechanisms during high-rate loading

    Energy Technology Data Exchange (ETDEWEB)

    Hudspeth, M. [Purdue University, West Lafayette, IN 47907 (United States); Sun, T. [Argonne National Laboratory, Argonne, IL 60439 (United States); Parab, N.; Guo, Z. [Purdue University, West Lafayette, IN 47907 (United States); Fezzaa, K. [Argonne National Laboratory, Argonne, IL 60439 (United States); Luo, S. [The Peac Institute of Multiscale Sciences, Chengdu, Sichuan 610207, People’s Republic of (China); Chen, W., E-mail: wchen@purdue.edu [Purdue University, West Lafayette, IN 47907 (United States)

    2015-01-01

    A simultaneous X-ray imaging and diffraction technique has been developed for studying dynamic material behaviors during high-rate tensile loading provided by a miniature Kolsky bar. Using a high-speed camera and an intensified charge-coupled device (ICCD), a simultaneous X-ray imaging and diffraction technique has been developed for studying dynamic material behaviors during high-rate tensile loading. A Kolsky tension bar has been used to pull samples at 1000 s{sup −1} and 5000 s{sup −1} strain-rates for super-elastic equiatomic NiTi and 1100-O series aluminium, respectively. By altering the ICCD gating time, temporal resolutions of 100 ps and 3.37 µs have been achieved in capturing the diffraction patterns of interest, thus equating to single-pulse and 22-pulse X-ray exposure. Furthermore, the sample through-thickness deformation process has been simultaneously imaged via phase-contrast imaging. It is also shown that adequate signal-to-noise ratios are achieved for the detected white-beam diffraction patterns, thereby allowing sufficient information to perform quantitative data analysis diffraction via in-house software (WBXRD-GUI). Of current interest is the ability to evaluate crystal d-spacing, texture evolution and material phase transitions, all of which will be established from experiments performed at the aforementioned elevated strain-rates.

  14. Polymorphous transformation in the crystal structure of [Mg(H.sub.2./sub.O).sub.6./sub. Br.sub.2./sub.][(C.sub.7./sub.H.sub.14./sub.N.sub.4./sub.).sub.2./sub.] . 4 (H.sub.2./sub.O) studied by powder and single crystal X-ray diffraction

    Czech Academy of Sciences Publication Activity Database

    Rivera, A.; Rohlíček, Jan; Sadat-Bernal, J.; Ríos-Motta, J.; Dušek, Michal

    2014-01-01

    Roč. 229, č. 4 (2014), s. 319-327 ISSN 0044-2968 Grant - others:AV ČR(CZ) Praemium Academiae Institutional support: RVO:68378271 Keywords : polymorphism * powder X-ray * single crystal diffraction * 1,3,6,8-tetraazatricyclo[4.3.1.13,ˑ 8]undecane * phase transformation * crystal structure analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.310, year: 2014

  15. The structure of liquid semiconductors, superionic conductors and glasses by neutron scattering, X-ray diffraction and extended X-ray absorption fine structure

    International Nuclear Information System (INIS)

    Buchanan, P.

    2001-09-01

    A study of the applicability of modern X-ray and neutron scattering techniques to the study of the structure of liquid semiconductors and glasses has been made. The results demonstrate how neutron scattering with isotopic substitution (NDIS), anomalous X-ray scattering and Extended X-ray Absorption Fine Structure (EXAFS) can be successfully used to elucidate the structure of materials that cannot be studied by NDIS alone. The local coordination structure of Ag 2 Se in its room temperature, superionic and liquid phases has been determined using the EXAFS technique. This EXAFS data have been combined with previously available neutron diffraction data to provide a refinement of the structure obtained through neutron diffraction alone. The structure of GeO 2 has been determined to the full partial structure factor level using a combination of anomalous X-ray scattering and neutron diffraction measurements. The data are in good agreement with previously obtained results. The partial structure factors of P 40 Se 60 and P 50 Se 50 have been determined to the first order difference level using the anomalous X-ray diffraction technique. The structure of liquid Ga 2 Te 3 has been determined to the partial structure factor level using combined neutron diffraction with isotopic substitution (NDIS) and anomalous X-ray diffraction. The structure of liquid FeSe 2 has been determined to the first order difference level using the NDIS technique alone. The structure of liquid FeTe 2 was determined at the total structure factor level using neutron diffraction in order to estimate the effect of chalcogenide ion size on the structure. The results demonstrate the feasibility of the additional structural determination techniques for disordered materials made possible through the development of third generation X-ray synchrotron sources. (author)

  16. Observation of parametric X-ray radiation in an anomalous diffraction region

    Energy Technology Data Exchange (ETDEWEB)

    Alexeyev, V.I., E-mail: vial@x4u.lebedev.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Eliseyev, A.N., E-mail: elisseev@pluton.lpi.troitsk.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Irribarra, E., E-mail: esteban.irribarra@epn.edu.ec [Escuela Politécnica Nacional, Ladrón de Guevara E11-253, Quito (Ecuador); Kishin, I.A., E-mail: ivan.kishin@mail.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Kubankin, A.S., E-mail: kubankin@bsu.edu.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Nazhmudinov, R.M., E-mail: fizeg@bk.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation)

    2016-08-19

    A new possibility to expand the energy region of diffraction processes based on the interaction of relativistic charged particles with crystalline structures is presented. Diffracted photons related to parametric X-ray radiation produced by relativistic electrons are detected below the low energy threshold for the X-ray diffraction mechanism in crystalline structures for the first time. The measurements were performed during the interaction of 7 MeV electrons with a textured polycrystalline tungsten foil and a highly oriented pyrolytic graphite crystal. The experiment results are in good agreement with a developed model based on the PXR kinematical theory. The developed experimental approach can be applied to separate the contributions of real and virtual photons to the total diffracted radiation generated during the interaction of relativistic charged particles with crystalline targets. - Highlights: • Parametric X-ray radiation below the low energy threshold for diffraction of free X-rays. • Experimental separation of the contributions from different radiation mechanisms. • PXR from relativistic electrons in mosaic crystals and textured polycrystlas.

  17. Femtosecond X-ray diffraction from two-dimensional protein crystals

    Directory of Open Access Journals (Sweden)

    Matthias Frank

    2014-03-01

    Full Text Available X-ray diffraction patterns from two-dimensional (2-D protein crystals obtained using femtosecond X-ray pulses from an X-ray free-electron laser (XFEL are presented. To date, it has not been possible to acquire transmission X-ray diffraction patterns from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permit a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy approach at the Linac Coherent Light Source, Bragg diffraction was acquired to better than 8.5 Å resolution for two different 2-D protein crystal samples each less than 10 nm thick and maintained at room temperature. These proof-of-principle results show promise for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.

  18. Coded diffraction system in X-ray crystallography using a boolean phase coded aperture approximation

    Science.gov (United States)

    Pinilla, Samuel; Poveda, Juan; Arguello, Henry

    2018-03-01

    Phase retrieval is a problem present in many applications such as optics, astronomical imaging, computational biology and X-ray crystallography. Recent work has shown that the phase can be better recovered when the acquisition architecture includes a coded aperture, which modulates the signal before diffraction, such that the underlying signal is recovered from coded diffraction patterns. Moreover, this type of modulation effect, before the diffraction operation, can be obtained using a phase coded aperture, just after the sample under study. However, a practical implementation of a phase coded aperture in an X-ray application is not feasible, because it is computationally modeled as a matrix with complex entries which requires changing the phase of the diffracted beams. In fact, changing the phase implies finding a material that allows to deviate the direction of an X-ray beam, which can considerably increase the implementation costs. Hence, this paper describes a low cost coded X-ray diffraction system based on block-unblock coded apertures that enables phase reconstruction. The proposed system approximates the phase coded aperture with a block-unblock coded aperture by using the detour-phase method. Moreover, the SAXS/WAXS X-ray crystallography software was used to simulate the diffraction patterns of a real crystal structure called Rhombic Dodecahedron. Additionally, several simulations were carried out to analyze the performance of block-unblock approximations in recovering the phase, using the simulated diffraction patterns. Furthermore, the quality of the reconstructions was measured in terms of the Peak Signal to Noise Ratio (PSNR). Results show that the performance of the block-unblock phase coded apertures approximation decreases at most 12.5% compared with the phase coded apertures. Moreover, the quality of the reconstructions using the boolean approximations is up to 2.5 dB of PSNR less with respect to the phase coded aperture reconstructions.

  19. Characterisation of microfocused beam for synchrotron powder diffraction using a new X-ray camera

    International Nuclear Information System (INIS)

    Thomas, C; Potter, J; Tang, C C; Lennie, A R

    2012-01-01

    The powder diffraction beamline I11, Diamond Light Source, is being continually upgraded as requirements of the user community evolve. Intensities of X-rays from the I11 in-vacuum electron undulator in the 3 GeV synchrotron fall off at higher energies. By focusing higher energy X-rays, we can overcome flux limitations, and open up new diffraction experiments. Here, we describe characterisation of microfocusing using compound refractive lenses (CRL). For a relatively modest outlay, we have developed an experimental setup and a novel X-ray camera with good sensitivity and a resolution specification suitable for characterising these focusing optics. We show that vertical oscillations in the focused beam compromise resolution of the source imaged by the CRL. Nevertheless, we have measured CRL focusing properties, and demonstrate the use of energy scanning to determine lens alignment. Real benefits of the intensity gain are illustrated.

  20. Soft x-ray resonant magnetic powder diffraction on PrNiO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Staub, U [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); GarcIa-Fernandez, M [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); Mulders, A M [Department of Applied Physics, Curtin University of Technology, GPO Box U1987, Perth WA 6845 (Australia); Bodenthin, Y [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); MartInez-Lope, M J [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, E-28049 Madrid (Spain); Alonso, J A [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, E-28049 Madrid (Spain)

    2007-03-07

    We report on the first soft x-ray resonant powder diffraction experiments performed at the Ni L{sub 2,3} edges of PrNiO{sub 3}. The temperature, polarization and energy dependence of the (1/2 0 1/2) reflection indicates a magnetic origin for the signal. This experiment demonstrates that x-ray resonant magnetic powder diffraction can be relatively easily performed in the soft x-ray regime due to the very large enhancement factors at the absorption edges. Such experiments allow us to extract important information on the electronic states of the d shell. Similar results can be anticipated from orbital reflections measured in a powder. (fast track communication)

  1. In situ laser heating and radial synchrotron X-ray diffraction ina diamond anvil cell

    Energy Technology Data Exchange (ETDEWEB)

    Kunz, Martin; Caldwell, Wendel A.; Miyagi, Lowell; Wenk,Hans-Rudolf

    2007-06-29

    We report a first combination of diamond anvil cell radialx-ray diffraction with in situ laser heating. The laser-heating setup ofALS beamline 12.2.2 was modified to allow one-sided heating of a samplein a diamond anvil cell with an 80 W yttrium lithium fluoride laser whileprobing the sample with radial x-ray diffraction. The diamond anvil cellis placed with its compressional axis vertical, and perpendicular to thebeam. The laser beam is focused onto the sample from the top while thesample is probed with hard x-rays through an x-ray transparentboron-epoxy gasket. The temperature response of preferred orientation of(Fe,Mg)O is probed as a test experiment. Recrystallization was observedabove 1500 K, accompanied by a decrease in stress.

  2. Cryogenic x-ray diffraction microscopy utilizing high-pressure cryopreservation

    Science.gov (United States)

    Lima, Enju; Chushkin, Yuriy; van der Linden, Peter; Kim, Chae Un; Zontone, Federico; Carpentier, Philippe; Gruner, Sol M.; Pernot, Petra

    2014-10-01

    We present cryo x-ray diffraction microscopy of high-pressure-cryofixed bacteria and report high-convergence imaging with multiple image reconstructions. Hydrated D. radiodurans cells were cryofixed at 200 MPa pressure into ˜10-μm-thick water layers and their unstained, hydrated cellular environments were imaged by phasing diffraction patterns, reaching sub-30-nm resolutions with hard x-rays. Comparisons were made with conventional ambient-pressure-cryofixed samples, with respect to both coherent small-angle x-ray scattering and the image reconstruction. The results show a correlation between the level of background ice signal and phasing convergence, suggesting that phasing difficulties with frozen-hydrated specimens may be caused by high-background ice scattering.

  3. Energy-scanning X-ray diffraction of synthetic multilayer structure

    International Nuclear Information System (INIS)

    Malaurent, J.C.; Duval, H.; Fert, A.

    1987-01-01

    An energy-scanning X-ray diffraction technique is used to study a synthetic periodic multilayer structure with two amorphous components. The source was the Bremsstrahlung from the X-ray tube, and the detector was a silicon-lithium diode. Experimental results obtained for a multilayer PdSi/MgCu with large period show a deviation from the classical Bragg's law. The deviation is produced by the variation of the refractive index of the multilayer with the wavelength of the incident X-ray. The period d was determined to within 1%. A measure of the refraction index enabled an estimate to be made of the width of each layer. It was also possible to estimate the fluctuation of the period along the multilayer from the full widths of the diffracted Bragg peaks at maximum intensities. The limits of the method are discussed. (orig.)

  4. Hydrothermal formation of tobermorite studied by in situ X-ray diffraction under autoclave condition.

    Science.gov (United States)

    Kikuma, Jun; Tsunashima, Masamichi; Ishikawa, Tetsuji; Matsuno, Shin-ya; Ogawa, Akihiro; Matsui, Kunio; Sato, Masugu

    2009-09-01

    Hydrothermal formation of tobermorite from a pre-cured cake has been investigated by transmission X-ray diffraction (XRD) using high-energy X-rays from a synchrotron radiation source in combination with a newly designed autoclave cell. The autoclave cell has a large and thin beryllium window for wide-angle X-ray diffraction; nevertheless, it withstands a steam pressure of more than 1.2 MPa, which enables in situ XRD measurements in a temperature range of 373 to 463 K under a saturated steam pressure. Formation and/or decomposition of several components has been successfully observed during 7.5 h of reaction time. From the intensity changes of the intermediate materials, namely non-crystalline C-S-H and hydroxylellestadite, two pathways for tobermorite formation have been confirmed. Thus, the newly developed autoclave cell can be used for the analyses of reaction mechanisms under specific atmospheres and temperatures.

  5. Crystallization kinetics of amorphous griseofulvin by pattern fitting procedure using X-ray diffraction data.

    Science.gov (United States)

    Yamamura, Shigeo; Takahira, Rieko; Momose, Yasunori

    2007-05-01

    A pattern fitting procedure using X-ray powder diffraction patterns was applied to study the crystallization kinetics of amorphous griseofulvin. From the optimized parameters obtained by pattern fitting, a change in the quantity and quality of griseofulvin crystals with crystallization was also investigated. Amorphous griseofulvin was prepared by cooling the melts followed by pulverization. X-ray diffraction patterns of amorphous griseofulvin were repeatedly measured every 20 h. The observed pattern was separated into crystalline diffraction intensity and amorphous scattering intensity by the nonlinear least-squares procedure. The fitting between the observed and simulated diffraction patterns was satisfactorily independent of the degree of crystallinity. Since a good linear relationship was found in a plot of amorphous scattering intensity against crystalline diffraction intensity, the degree of crystallinity can be determined according to Hermans' method. The diffraction peak width increased with higher diffraction angles with crystallization. The crystallization was biphasic: fast and slow crystallization with the growth of low disordered crystals and disordered crystals, respectively. The pattern fitting procedure is a powerful tool to analyze the X-ray diffraction patterns of semicrystalline materials. This procedure can simultaneously analyze the degree of crystallinity and crystal disorder in semicrystalline samples during crystallization.

  6. Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data.

    Science.gov (United States)

    Leech, Charlotte K; Fabbiani, Francesca P A; Shankland, Kenneth; David, William I F; Ibberson, Richard M

    2008-02-01

    The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

  7. Macromolecular X-ray structure determination using weak, single-wavelength anomalous data

    Energy Technology Data Exchange (ETDEWEB)

    Bunkóczi, Gábor; McCoy, Airlie J.; Echols, Nathaniel; Grosse-Kunstleve, Ralf W.; Adams, Paul D.; Holton, James M.; Read, Randy J.; Terwilliger, Thomas C.

    2014-12-22

    We describe a likelihood-based method for determining the substructure of anomalously scattering atoms in macromolecular crystals that allows successful structure determination by single-wavelength anomalous diffraction (SAD) X-ray analysis with weak anomalous signal. With the use of partial models and electron density maps in searches for anomalously scattering atoms, testing of alternative values of parameters and parallelized automated model-building, this method has the potential to extend the applicability of the SAD method in challenging cases.

  8. X-ray diffraction broadening effects in metallic alloys

    International Nuclear Information System (INIS)

    Kimmel, G.; Dayan, D.

    1996-01-01

    Although an extensive work had been done in the last decade in the field of line broadening analysis of XRPD there is still little agreement whether this method can be accepted as a characterization tool. The purpose of the present work is to demonstrate that a valuable information can be retrieved from line broadening effects in XRPD. In this work it was focused on the line broadening effects accompanied with typical processes in metallic systems. The following systems were studied:, pure iron, steels, and alloying effects in uranium alloys. The broadening analysis was linked to different variables like hardness, Izod notch toughness, amount of cold work, surface treatment, concentration of additional elements in solid solutions. The Williamson-Hall method was adopted providing fast and global view of resolved 'strain'-'size' effects, considering the entire diffraction spectrum. The size effect was occasionally approved by direct observations of STM or SEM for example. The results of the broadening analysis were well correlated with other measured parameters like toughness and hardness. It was found that alloying in metallic system is sometimes expressed by pure strain effect but cold work results in a mix of strain and size broadening. The complete view of our results lead us to believe that broadening effect can be quantified. Hence, it is recommended to establish a quantitative XRD line broadening analysis method as a novel tool for characterization of metallic materials. (author)

  9. Real-time direct and diffraction X-ray imaging of irregular silicon wafer breakage

    Directory of Open Access Journals (Sweden)

    Alexander Rack

    2016-03-01

    Full Text Available Fracture and breakage of single crystals, particularly of silicon wafers, are multi-scale problems: the crack tip starts propagating on an atomic scale with the breaking of chemical bonds, forms crack fronts through the crystal on the micrometre scale and ends macroscopically in catastrophic wafer shattering. Total wafer breakage is a severe problem for the semiconductor industry, not only during handling but also during temperature treatments, leading to million-dollar costs per annum in a device production line. Knowledge of the relevant dynamics governing perfect cleavage along the {111} or {110} faces, and of the deflection into higher indexed {hkl} faces of higher energy, is scarce due to the high velocity of the process. Imaging techniques are commonly limited to depicting only the state of a wafer before the crack and in the final state. This paper presents, for the first time, in situ high-speed crack propagation under thermal stress, imaged simultaneously in direct transmission and diffraction X-ray imaging. It shows how the propagating crack tip and the related strain field can be tracked in the phase-contrast and diffracted images, respectively. Movies with a time resolution of microseconds per frame reveal that the strain and crack tip do not propagate continuously or at a constant speed. Jumps in the crack tip position indicate pinning of the crack tip for about 1–2 ms followed by jumps faster than 2–6 m s−1, leading to a macroscopically observed average velocity of 0.028–0.055 m s−1. The presented results also give a proof of concept that the described X-ray technique is compatible with studying ultra-fast cracks up to the speed of sound.

  10. X-ray diffraction of modified and graft polymerised cellulose fibres

    International Nuclear Information System (INIS)

    Ouajai, S.; Hodzic, A.; Shanks, R.A.

    2003-01-01

    Full text: The aim of this research is to modify natural cellulosic fibres in order to improve and increase consistency of their performance in biodegradable materials. Fibre modification consisted of solvent extraction and NaOH treatment in order to remove wax and lignin before grafting with acrylonitrile monomer. The mechanical properties, moisture regain and pore structures were investigated. Finally an analysis of crystalline structure was performed using quantitative FTIR, WAXD and SAXS to assess the relationship between structure and properties after modification. Materials: Hemp (Cannabis sativa), Australian Hemp Resource and Manufacture (AHRM) and Flax (Durafibre Grade 1, 95 % purity), Cargill, Canada. Pretreatments: Dewaxing by acetone extraction, alkalisation with NaOH solutions, grafting reaction with acrylonitrile and AIBN thermal initiator after absorption of the monomer. Surface and pore structure analysis using Micromeritics ASAP 2000 BET adsorption instrument, FTIR Perkin-Elmer 2000 spectrometer, wide angle X-ray diffraction, Bruker AXS D8, Ni-filtered CuKα radiation (λ 0.1542 nm) at 40 kV and 35 mA. The diffractograms were recorded from 5 to 60 deg of 2 θ (Bragg angle) by a goniometer with a scintillation counter, scanning speed 0.02 deg/s and sampling rate of 2 data/s. The 2-D small-angle X-ray data was collected by Bruker AXS, Nanostar from 0.5 to 14 deg of 2θ (Bragg angle). Typical exposure time was 5 hours at 40 kV and 35 mA. Single fibre mechanical properties were carried out on a Rheometric DMTA IV at 0.03 mm/min. Moisture regain measurements were performed gravimetrically. The crystalline structure of the fibres were changed from cellulose I to cellulose II after NaOH treatment. The intensity of the 1431 cm -1 band was reduced while the 898 cm -1 band was increased and shifted to 893 cm -1 with an increase of NaOH concentration. X-ray diffractograms of flax and hemp were obtained for each treatment. Untreated fibre shows the

  11. First indirect x-ray imaging tests with an 88-mm diameter single crystal

    Energy Technology Data Exchange (ETDEWEB)

    Lumpkin, A. H. [Fermilab; Macrander, A. T. [Argonne

    2017-02-01

    Using the 1-BM-C beamline at the Advanced Photon Source (APS), we have performed the initial indirect x - ray imaging point-spread-function (PSF) test of a unique 88-mm diameter YAG:Ce single crystal of only 100 - micron thickness. The crystal was bonded to a fiber optic plat e (FOP) for mechanical support and to allow the option for FO coupling to a large format camera. This configuration resolution was compared to that of self - supported 25-mm diameter crystals, with and without an Al reflective coating. An upstream monochromator was used to select 17-keV x-rays from the broadband APS bending magnet source of synchrotron radiation. The upstream , adjustable Mo collimators were then used to provide a series of x-ray source transverse sizes from 200 microns down to about 15-20 microns (FWHM) at the crystal surface. The emitted scintillator radiation was in this case lens coupled to the ANDOR Neo sCMOS camera, and the indirect x-ray images were processed offline by a MATLAB - based image processing program. Based on single Gaussian peak fits to the x-ray image projected profiles, we observed a 10.5 micron PSF. This sample thus exhibited superior spatial resolution to standard P43 polycrystalline phosphors of the same thickness which would have about a 100-micron PSF. Lastly, this single crystal resolution combined with the 88-mm diameter makes it a candidate to support future x-ray diffraction or wafer topography experiments.

  12. X-ray diffraction investigation of cyclohexane derivatives at 293 K

    International Nuclear Information System (INIS)

    Drozdowski, Henryk; Nowakowski, Krzysztof; BLaszczak, ZdzisLaw

    2011-01-01

    This paper reports results of the X-ray diffraction structural studies of liquid cyclohexylamine C 6 H 11 -NH 2 and cyclohexanol C 6 H 11 -OH performed at 293 K. The method of X-ray scattering and Fourier analysis enabled the determination of the mean structural parameters of the liquids studied. The wide-angle X-ray scattering (WAXS) method provided new information on mutual arrangement and orientation of the molecules of the above mentioned compounds in the liquid phase. The measurements of scattered radiation intensity were performed in a wide range of wave vector (from S min =0.925 A -1 to S max =14.311 A -1 ), with the use of X-ray radiation MoK α (λ=0.71069 A). Angular distributions of X-ray scattered intensity were measured, and differential radial distribution functions of electron density (DRDFs) were calculated. The mean distances between the neighbouring molecules and the mean radii of coordination spheres were found. A simple model of short-range arrangement of the molecules was proposed, which seems to be valid for other polar monosubstituted cyclohexane derivatives in the liquid phase. - Highlights: → X-ray method enabled the determination of the structure of cyclohexane derivatives. → Determination of the mean parameters of the liquid structure has been discussed. → A simple model of short-range arrangement and orientation of the molecules was proposed. → Results are valid for a wide group of molecular liquids.

  13. About some practical aspects of X-ray diffraction : From powder to thin film

    Energy Technology Data Exchange (ETDEWEB)

    Valvoda, V. [Charles Univ. Prague (Czech Republic). Faculty of Mathematics and Physics

    1996-09-01

    Structure of thin films can be amorphous, polycrystalline or epitaxial, and the films can be prepared as a single layer films, multilayers or as graded films. A complete structure analysis of thin films by means of X-ray diffraction (XRD) usually needs more than one diffraction geometry to be used. Their principles, advantages and disadvantages will be shortly described, especially with respect to their different sampling depth and different response to orientation of diffracting crystallographic planes. Main differences in structure of thin films with respect to powder samples are given by a singular direction of their growth, by their adhesion to a substrate and often also by a simultaneous bombardment by atomic species during the growth. It means that a thermodynamically unstable atomic structures can be found too. These special features of growth of thin polycrystalline films are reflected in often found strong preferred orientation of grains and in residual stresses conserved in the films. The methods of structure analysis of thin films by XRD will be compared with other techniques which can supply structure images on different scales.

  14. LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

    International Nuclear Information System (INIS)

    Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.; Kuroda, Teruo; Ishitani, Ryuichiro; Suga, Hiroaki; Nureki, Osamu

    2016-01-01

    A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-ray diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters

  15. Study of oxide precipitates in silicon using X-ray diffraction techniques

    Czech Academy of Sciences Publication Activity Database

    Caha, O.; Bernatová, S.; Meduňa, M.; Svoboda, Milan; Buršík, Jiří

    2011-01-01

    Roč. 208, č. 11 (2011), s. 2587-2590 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA202/09/1013 Institutional research plan: CEZ:AV0Z20410507 Keywords : high-resolution X-ray diffraction * oxide precipitates * silicon Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.463, year: 2011

  16. Mössbauer effect studies and X-ray diffraction analysis of cobalt ...

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Cobalt ferrite (CoxFe3–xO4) is prepared in powder form by thermal decomposition of iron and cobalt salts and is analysed by X-ray diffraction and Mössbauer spectroscopic techniques. The variation of. Mössbauer parameters, lattice parameters and crystallite size of the products formed with variation in the.

  17. Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling

    Energy Technology Data Exchange (ETDEWEB)

    Veluraja, K., E-mail: veluraja@msuniv.ac.in [Department of Physics, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012 (India); Vennila, K.N. [CAS in Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, Tamilnadu 600025 (India); Umamakeshvari, K.; Jasmine, A. [Department of Physics, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012 (India); Velmurugan, D. [CAS in Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, Tamilnadu 600025 (India)

    2011-03-25

    Research highlights: {yields} Techniques to get oriented mucin fibre. {yields} X-ray fibre diffraction pattern for mucin. {yields} Molecular modeling of mucin based on X-ray fibre diffraction pattern. -- Abstract: The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 A. The high intense d-spacing signal at 4.22 A is attributed to the antiparallel {beta}-sheet structure identified in the fraction of the homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 A reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule.

  18. Mössbauer effect studies and X-ray diffraction analysis of cobalt ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 26; Issue 5. Mössbauer effect studies and X-ray diffraction analysis of cobalt ferrite prepared in powder form by thermal decomposition method. M D Joseph Sebastian B Rudraswamy M C Radhakrishna Ramani. Magnetic Materials Volume 26 Issue 5 August 2003 pp ...

  19. High-pressure X-ray diffraction of L-ALANINE crystal

    DEFF Research Database (Denmark)

    Olsen, J.S.; Gerward, Leif; Souza, A.G.

    2006-01-01

    L-ALANINE has been studied by X-ray diffraction at ambient temperature and pressure up to 10.3 GPa. The material is found to transform to a tetragonal structure between 2 and 3 GPa. and to a monoclinic structure between 8 and 10 GPa. The experimental bulk modulus is 25(5) GPa for the orthorhombic...

  20. Small angles X-ray diffraction and Mössbauer characterization of ...

    Indian Academy of Sciences (India)

    The effect of thermal annealing on the structure and magnetic properties of crystalline Tb/Fe multilayers has been studied using conversion electron Mössbauer spectrometry and small-angle X-ray diffraction. The growth of Tb–Fe amorphous alloy from the interface is observed with increasing annealing temperature.

  1. Characterization, crystallization and preliminary X-ray diffraction studies of tomato nuclease I

    Czech Academy of Sciences Publication Activity Database

    Koval, Tomáš; Dohnálek, Jan; Lipovová, P.; Podzimek, T.; Matoušek, Jaroslav

    2009-01-01

    Roč. 16, 1a (2009), b33 ISSN 1211-5894. [Discussions in Structural Molecular Biology /7./. 12.03.2009-14.03.2009, Nové Hrady] Institutional research plan: CEZ:AV0Z40500505 Keywords : X-ray diffraction * tomato nuclease Subject RIV: CD - Macromolecular Chemistry

  2. Origin of nondetectable x-ray diffraction peaks in nanocomposite CuTiZr alloys

    DEFF Research Database (Denmark)

    Jiang, Jianzhong; Kato, H.; Ohsuna, T.

    2003-01-01

    Microscopic structures of Cu60Ti10+xZr30-x (x=0 and 10) alloys have been investigated by transmission electron microscopy, x-ray diffraction (XRD) and differential scanning calorimeter (DSC). In the Cu60Ti10Zr30 samples annealed at 708 K for times ranging from 0 to 130 min, where the enthalpy...

  3. Quantitative phase analysis of uranium carbide from x-ray diffraction data using the Rietveld method

    International Nuclear Information System (INIS)

    Singh Mudher, K.D.; Krishnan, K.

    2003-01-01

    Quantitative phase analysis of a uranium carbide sample was carried out from the x-ray diffraction data by Rietveld profile fitting method. The method does not require the addition of any reference material. The percentage of UC, UC 2 and UO 2 phases in the sample were determined. (author)

  4. High-pressure phases of uranium monophosphide studied by synchrotron x-ray diffraction

    DEFF Research Database (Denmark)

    Olsen, J. Staun; Gerward, Leif; Benedict, U.

    1988-01-01

    X-ray diffraction studies have been performed on UP powder for pressures up to 51 GPa using synchrotron radiation and a diamond-anvil cell. At ambient pressure UP has the rocksalt structure. The bulk modulus has been determined to B0=102(4) GPa and its pressure derivative to B0’=4.0(8). The cubic...

  5. Electrochemical cell for in situ x-ray diffraction under ultrapure conditions

    DEFF Research Database (Denmark)

    Koop, T.; Schindler, W.; Kazimirov, A.

    1998-01-01

    of the crystal using a Luggin capillary and a standard reference electrode. We demonstrate the performance of our cell by in situ synchrotron x-ray diffraction measurements on ultrathin Co layers electrodeposited on Cu(001) in an aqueous H(2)SO(4)/CoSO(4) solution. (C) 1998 American Institute of Physics....

  6. A greedy method for reconstructing polycrystals from three-dimensional X-ray diffraction data

    DEFF Research Database (Denmark)

    Kulshreshth, Arun Kumar; Alpers, Andreas; Herman, Gabor T.

    2009-01-01

    An iterative search method is proposed for obtaining orientation maps inside polycrystals from three-dimensional X-ray diffraction (3DXRD) data. In each step, detector pixel intensities are calculated by a forward model based on the current estimate of the orientation map. The pixel at which the ...

  7. X-ray and neutron diffraction line broadening measurements in a martensitic steel for fusion technology

    International Nuclear Information System (INIS)

    Coppola, R.; Lukas, P.; Vrana, M.; Montanari, R.; Rustichelli, F.

    1995-01-01

    X-ray and neutron diffraction line broadening measurements have been carried out on a modified martensitic steel DIN 1.4914 for fusion technology (MANET) after quenching followed by tempering treatments at 700C. The results of the two experiments are discussed with reference to Cr redistribution phenomena in the matrix

  8. Standing-wave effects in grazing-incidence x-ray diffraction from polycrystalline multilayers

    Czech Academy of Sciences Publication Activity Database

    Krčmář, J.; Holý, V.; Horák, L.; Metzger, T. H.; Sobota, Jaroslav

    2008-01-01

    Roč. 103, č. 3 (2008), 033504:1-7 ISSN 0021-8979 Institutional research plan: CEZ:AV0Z20650511 Keywords : acoustic wave interference * carbon * crystallites * interface structure * nickel * optical multilayers * superlattices * X-ray diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.201, year: 2008

  9. Applications of X-ray diffraction method III: determination of crystallite size and strain

    International Nuclear Information System (INIS)

    Majid, C.A.; Hussain, M.A.

    1995-01-01

    The broadening of X-ray diffraction powder pattern peaks of metals and/or alloys etc. is normally caused by small crystalline size and/or by distortions within the crystallites as a consequence of dislocation configurations. Thus measure the broadening of diffraction peaks provides a tool to determine the crystallite size and strain in the sample. It is well known that rates of reaction between solid particles and a gas phase depend on the particle size. The knowledge about crystallite size and strain is useful for the investigation of important phenomena in materials. X-ray profile analysis is useful for the investigation of processes like crystal growth, solid solution formation, stacking faults and radiation damage etc. X-ray diffraction is most widely used for the determination of crystallite size and strain. This important application of X-ray diffraction is reviewed in this paper. Results on aluminium bulk samples and thin films treated under conditions are reported. Application of the method to UO/sub 2/ powder is discussed. (author)

  10. An introduction to three-dimensional X-ray diffraction microscopy

    DEFF Research Database (Denmark)

    Poulsen, Henning Friis

    2012-01-01

    Three-dimensional X-ray diffraction microscopy is a fast and nondestructive structural characterization technique aimed at studies of the individual crystalline elements (grains or subgrains) within millimetre-sized polycrystalline specimens. It is based on two principles: the use of highly...

  11. An X-ray diffraction study of direct-bonded silicon interfaces

    DEFF Research Database (Denmark)

    Howes, P.B.; Benamara, M.; Grey, F.

    1998-01-01

    Semiconductor wafer bonding techniques have been used to create a giant twist grain boundary from two Si(001) wafers. We show, using X-ray diffraction measurements that after annealing the interface forms a highly ordered superstructure with relaxations extending to many layers into the crystals ...

  12. A logical explanation of structurally unfit X-ray diffraction peaks in ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Abstract. In the present paper we suggest the cause and solution of some unidentified X-ray diffraction (XRD) peaks in ferroelectric ... to some structurally unfit minor peaks of all three trail samples show good agreement to the values estimated from the .... This shows that the value of 2θ limits the (a + b) val-.

  13. A simple model for dynamic small-angle X-ray diffraction in colloidal crystals

    NARCIS (Netherlands)

    de Beer, A.G.F.; Petukhov, A.V.

    2007-01-01

    A simple model is presented that allows calculation of the small-angle X-ray diffraction patterns of perfect colloidal crystals. The model is based on the Wentzel–Kramers–Brillouin approximation and permits a straightforward evaluation of multibeam interactions. Results are illustrated by several

  14. In situ X-ray diffraction environments for high-pressure reactions

    DEFF Research Database (Denmark)

    R. S. Hansen, Bjarne; Møller, Kasper Trans; Paskevicius, Mark

    2015-01-01

    New sample environments and techniques specifically designed for in situ powder X-ray diffraction studies up to 1000 bar (1 bar = 105 Pa) gas pressure are reported and discussed. The cells can be utilized for multiple purposes in a range of research fields. Specifically, investigations of gas–sol...

  15. High-pressure X-ray diffraction study of bulk- and nanocrystalline GaN

    DEFF Research Database (Denmark)

    Jorgensen, J.E.; Jakobsen, J.M.; Jiang, Jianzhong

    2003-01-01

    Bulk- and nanocrystalline GaN have been studied by high-pressure energy-dispersive X-ray diffraction. Pressure-induced structural phase transitions from the wurtzite to the NaCl phase were observed in both materials. The transition pressure was found to be 40 GPa for the bulk-crystalline GaN, whi...

  16. An x-ray diffraction study of interface roughness and diffusion in Ag/Pd superlattices

    NARCIS (Netherlands)

    Temst, K.; van Bael, M.J.; van Haesendonck, Ch.; Bruynseraede, Y.; de Groot, D.G.; Koeman, N.J.; Griessen, R.P.

    1999-01-01

    The influence of thermal annealing on the surface and interface roughness of epitaxial Ag/Pd superlattices has been quantitatively characterized by high-angle X-ray diffraction and atomic force microscopy. Although Ag and Pd form a continuous series of solid solutions, it is shown that thermal

  17. Electron Paramagnetic Resonance and X-ray Diffraction of Boron- and Phosphorus-Doped Nanodiamonds

    Science.gov (United States)

    Binh, Nguyen Thi Thanh; Dolmatov, V. Yu.; Lapchuk, N. M.; Shymanski, V. I.

    2017-11-01

    Powders of boron- and phosphorus-doped detonation nanodiamonds and sintered pellets of non-doped nanodiamond powders were studied using electron paramagnetic resonance and x-ray diffraction. Doping of detonation nanodiamond crystals with boron and phosphorus was demonstrated to be possible. These methods could be used to diagnose diamond nanocrystals doped during shock-wave synthesis.

  18. Revealing stacking sequences in inverse opals by microradian X-ray diffraction

    NARCIS (Netherlands)

    Sinitskii, A.; Abramova, V.; Grigorieva, N.; Grigoriev, S.; Snigirev, A.; Byelov, D.; Petukhov, A.V.

    2010-01-01

    We present the results of the structural analysis of inverse opal photonic crystals by microradian X-ray diffraction. Inverse opals based on different oxide materials (TiO2, SiO2 and Fe2O3) were fabricated by templating polystyrene colloidal crystal films grown by the vertical deposition technique.

  19. HIV protease inhibition seen by X-ray diffraction and molecular dynamics

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jindřich; Dohnálek, Jan; Skálová, Tereza; Dušková, Jarmila; Petroková, Hana; Vondráčková, Eva; Kolenko, P.; Zimmermann, K.

    2005-01-01

    Roč. 14, č. 1 (2005), s. 276 ISSN 0961-8368. [Symposium of the Protein Society /19./. 30.7.2005-3.8.2005, Boston] R&D Projects: GA AV ČR(CZ) KJB4050312 Keywords : HIV protease * X-ray diffraction * molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry

  20. Determination of the X-ray diffraction pattern and the lattice parameters of the nickel ferricyanide

    International Nuclear Information System (INIS)

    Fernandez Miranda, J.; Herrera Palma, V.

    1981-01-01

    The X-ray diffraction pattern of the nickel ferricyanide was found by Debye-Scherrer method. The measurements were made in cameras of 57,3 mm and 114 mm diameter. The crystal structure of the compound has been determined. The lattice parameter was measured by the least square method. (author)

  1. A logical explanation of structurally unfit X-ray diffraction peaks in ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Abstract. In the present paper we suggest the cause and solution of some unidentified X-ray diffraction (XRD) peaks in ferroelectric nanoparticles. Indeed, a relationship between the structurally unfit XRD peaks and domains in the ferroelectric nanoparticles is suggested. BaTiO3, PbTiO3 and ...

  2. Caracterization of the crystalline phases by X-Ray diffraction in electrode coatings

    International Nuclear Information System (INIS)

    Neves, M.C.G.P.; Souza Caillaux, Z. de

    1981-01-01

    Some electrodes and their respective coatings were studied in order to verify their compatibility with their utilization in the welding of base metals appropriate for the equipment of sugar and alcohol plants. The carried out studies include the characterization, by X-ray diffraction, of crystaline phases, existent in electrodes coatings. (Author) [pt

  3. Tensile behavior of orthorhombic alpha ''-titanium alloy studied by in situ X-ray diffraction

    DEFF Research Database (Denmark)

    Wang, X.D.; Lou, H.B.; Ståhl, Kenny

    2010-01-01

    The tensile behavior of a Ti-11%Zr-14%Nb-10%Sn alloy with pure orthorhombic alpha '' phase was studied by in situ X-ray diffraction using synchrotron radiation. It is found that no phase transformation happens during the whole tensile process. The "double-yielding" platforms of this alloy...

  4. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Caroline M., E-mail: carolmattosb@yahoo.com.br [Instituto de Arqueologia Brasileira (IAB), Belford Roxo, RJ (Brazil); Azeredo, Soraia R.; Lopes, Ricardo T., E-mail: soraia@lin.ufrj.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/LIN/UFRJ), Rio de Janeiro, RJ (Brazil). Laboratorio de Instrumentacao Nuclear; Souza, Sheila M.F.M de, E-mail: sferraz@ensp.fiocruz.br [Fundacao Oswaldo Cruz (ENSP/FIOCRUZ), Rio de Janeiro, RJ (Brazil). Escola Nacional de Saude Publica Sergio Arouca

    2013-07-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I{sub rel}). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  5. X-ray diffraction studies of sucrose and sucrose irradiated with γ-radiation

    International Nuclear Information System (INIS)

    Prasad, Mahendra

    1981-01-01

    In order to understand and solve numerous problems related to sugar quality and its storage life, X-ray diffraction studies of sucrose and sucrose irradiated with γ-radiation have been made. It is observed that the interplanar spacing 'd' in irradiated sucrose is reduced indicating the partial damage of sucrose lattice. (author)

  6. Residual stress estimation of ceramic thin films by X-ray diffraction and indentation techniques

    International Nuclear Information System (INIS)

    Atar, Erdem; Sarioglu, Cevat; Demirler, Ugur; Sabri Kayali, E.; Cimenoglu, Huseyin

    2003-01-01

    The residual stresses in ceramic thin films obtained by the indentation method have been found to be three times higher than those of the X-ray diffraction method. This discrepancy can be eliminated by setting the geometrical factor for the Vickers pyramid indenter to 1 in the relevant equation of the indentation method

  7. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    International Nuclear Information System (INIS)

    Barbosa, Caroline M.; Azeredo, Soraia R.; Lopes, Ricardo T.; Souza, Sheila M.F.M de

    2013-01-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I rel ). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  8. Small angles X-ray diffraction and Mössbauer characterization of ...

    Indian Academy of Sciences (India)

    Abstract. The effect of thermal annealing on the structure and magnetic properties of crystalline Tb/Fe multilayers has been studied using conversion electron Mössbauer spectrometry and small-angle X-ray diffraction. The growth of Tb–Fe amorphous alloy from the interface is observed with increasing annealing ...

  9. Toward atomic resolution diffractive imaging of isolated molecules with x-ray free-electron lasers

    DEFF Research Database (Denmark)

    Stern, Stephan; Holmegaard, Lotte; Filsinger, Frank

    2014-01-01

    We give a detailed account of the theoretical analysis and the experimental results of an x-ray-diffraction experiment on quantum-state selected and strongly laser-aligned gas-phase ensembles of the prototypical large asymmetric rotor molecule 2,5-diiodobenzonitrile, performed at the Linac Cohere...

  10. High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

    Science.gov (United States)

    Smither, Robert K [Hinsdale, IL

    2011-05-17

    A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

  11. Characterization of calcium crystals in Abelia using x-ray diffraction and electron microscopes

    Science.gov (United States)

    Localization, chemical composition, and morphology of calcium crystals in leaves and stems of Abelia mosanensis and A. ×grandiflora were analyzed with a variable pressure scanning electron microscope (VP-SEM) equipped with an X-ray diffraction system, low temperature SEM (LT-SEM) and a transmission ...

  12. Temperature-dependent vibrational spectroscopic and X-ray diffraction investigation of nanosized nickel chromite

    Czech Academy of Sciences Publication Activity Database

    Matulková, Irena; Holec, Petr; Němec, I.; Kitazawa, H.; Furubayashi, T.; Vejpravová, Jana

    2015-01-01

    Roč. 1090, Jun SI (2015), s. 70-75 ISSN 0022-2860 R&D Projects: GA ČR GAP108/10/1250 Institutional support: RVO:68378271 ; RVO:61388980 Keywords : vibrational spectroscopy * nickel chromite * X-ray diffraction * size effect Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.780, year: 2015

  13. A X-ray diffraction analysis on graphene layers of Assam coal

    Indian Academy of Sciences (India)

    The so-called turbostatic structure of carbons in coal with randomly oriented stacking of the lamellae (graphene) produces intense peaks, which are the dominant features in its X-ray diffraction profiles. The diffractogram may be conveniently divided into two regions of reciprocal space, the medium S region (1 < S < 3 Å) and ...

  14. Atoms in Action: Observing Atomic Motion with Dynamic in situ X-ray Diffraction

    Science.gov (United States)

    Cox, Jordan Michael

    Metal-organic framework (MOF) materials are rich in both structural diversity and application. These materials are comprised of metal atoms or clusters which are connected in a three-dimensional polymer-like network by bridging organic linker molecules. One of the major attractive features in MOFs is their permanent pore space which can potentially be used to adsorb or exchange foreign molecules from/with the surrounding environment. While MOFs are an active area of scientific interest, MOF materials are still relatively new, only 20 years old. As such, there is still much that needs to be understood about these materials before they can be effectively applied to widespread chemical problems like CO2 sequestration or low-pressure hydrogen fuel storage. One of the most important facets of MOF chemistry to understand in order to rationally design MOF materials with tailor-made properties is the relationship between the structural features in a MOF and the chemical and physical properties of that material. By examining in detail the atomic structure of a MOF with known properties under a variety of conditions, scientists can begin to unravel the guiding principles which govern these relationships. X-ray diffraction remains one of the most effective tools for determining the structure of a crystalline material with atomic resolution, and has been applied to the determination of MOF structures for years. Typically these experiments have been carried out using powder X-ray diffraction, but this technique lacks the high-resolution structural information found in single-crystal methods. Some studies have been reported which use specialized devices, sometimes called Environmental Control Cells, to study single crystalline MOFs under non-ambient chemical conditions in situ . However, these in situ studies are performed under static conditions. Even in cases where the ECC provides continued access to the local chemical environment during diffraction data collections, the

  15. Evaluation of the efficiency of clay stabilizers using X-ray diffraction

    International Nuclear Information System (INIS)

    Oliveira, Milena Ferreira de Siqueira; Lopes, Ricardo Tadeu

    2008-01-01

    The aim of this work was evaluate the effectiveness of six clay stabilizers polymeric cationic in inhibiting osmotic swelling in clays of montmorillonite group.Using the humid X-ray diffraction technique is possible to quantify the swelling clay by interlayer spacing that was obtained through survey of the diffraction trace of the clay in solution with stabilizer. The technique of efficiency analysis of the stabilizers using X-ray diffraction is done performing the diffraction trace of a sodium bentonite in solution with different concentrations of stabilizer, diluted in distilled water. The experimental results have shown that six stabilizers were analyzed, and only one was not efficient in the control of the osmotic swelling.The others were efficient, although in different concentration because of differences of chemical composition of each stabilizer. (author)

  16. Studies of clays and clay minerals using x-ray powder diffraction and the Rietveld method

    International Nuclear Information System (INIS)

    Bish, D.L.

    1993-01-01

    The Rietveld method was originally developed (Rietveld, 1967, 1969) to refine crystal structures using neutron powder diffraction data. Since then, the method has been increasingly used with X-ray powder diffraction data, and today it is safe to say that this is the most common application of the method. The method has been applied to numerous natural and synthetic materials, most of which do not usually form crystals large enough for study with single-crystal techniques. It is the ability to study the structures of materials for which sufficiently large single crystals do not exist that makes the method so powerful and popular. It would thus appear that the method is ideal for studying clays and clay minerals. In many cases this is true, but the assumptions implicit in the method and the disordered nature of many clay minerals can limit titsapplicability. This chapter will describe the Rietveld method, emphasizing the assumptions important for the study of disordered materials, and it will outline the potential applications of the method to these minerals. These applications include, in addition to the refinement of crystal structures, quantitative analysis of multicomponent mixtures, analysis of peak broadening, partial structure solution, and refinement of unit-cell parameters

  17. X-ray and neutron diffraction studies of B12 coenzymes in free and enzyme bound state

    International Nuclear Information System (INIS)

    Jogl, G.

    1999-11-01

    The molecular structure of the coenzyme B12 binding subunit S (GlmS) of glutamate mutase from Clostridium cochlearium has been determined with x-ray crystallographic methods. GlmS was crystallized with cyanocobalamin in three different crystal forms. High-resolution synchrotron diffraction data have been collected for two crystal forms (P212121, 1.7A; I422, 1.6A). The structure was solved with molecular replacement. In the GlmS crystal structure, cyanocobalamin is observed in its base-off constitution. The protein derived residue Histidin16 displaces the B12 dimethylbenzimidazole base and coordinates to the coenzyme's cobalt center. In a second part, the structure of the radical species cob(II)alamin was determined by single crystal neutron diffraction. Cob(II)alamin was synthesized from D2O and D6-acetone. Large crystals were grown by repeated seeding. Solvent deuterium positions for 2 out of 3 acetone molecules and 7 out of 15 water molecules were located from neutron diffraction data. For comparison with neutron results, a high-resolution synchrotron x-ray data set of cob(II)alamin was collected. Refinement of x-ray data gave the currently most accurate crystallographic structure of a cobalamin molecule. Solvent hydrogen positions have been compared for both structures. The hydrogen bond geometry of a solvent water cluster is analyzed from neutron diffraction results. (author)

  18. Modern neutron diffraction methods as a complementary tool to X-ray crystallography for structure research in materials science

    International Nuclear Information System (INIS)

    Heger, Gernot

    2011-01-01

    Neutron diffraction is a well established method in structure research of crystal structures and magnetic ordering. Whereas X-ray diffraction is the standard method for crystal structure determination yielding the total electron density distribution of crystalline materials, neutron diffraction by their nuclear interaction provides the nuclear density distribution and by magnetic dipole interaction the partial electron density distribution of unpaired electrons. Hence neutron crystallography is of special importance for detailed investigations of light elements with few electrons (most prominent example is the hydrogen distribution), to discriminate between different isotopes (e.g. between H and D), and for the determination of magnetic structures and spin density distributions. But neutrons are rare and expensive. There are only a few reactor and spallation sources around the world and the flux of neutron beams is almost 10 -3 smaller than that of a conventional X-ray tube. Therefore, neutron diffractometers and the strategy of data acquisition have to be optimized. Suitable samples, e.g. mm 3 large single crystals are needed, have to be prepared. Examples of modern instrumentation and methods are presented together with results from investigations on structural phase transitions induced by hydrogen-bond ordering (ferroelectric and proton conductor materials) and on complex magnetic systems. It is shown that the combination of X-ray/synchrotron and neutron diffraction is an important tool for a microscopic understanding of physical properties of crystalline materials. (author)

  19. X-ray diffraction measurements for solid methane at high pressures

    CERN Document Server

    Umemoto, S; Akahama, Y; Kawamura, H

    2002-01-01

    X-ray powder diffraction and Raman scattering experiments for solid methane were carried out at pressures up to 37 GPa and room temperature. The diffraction pattern of phase B at 16.9 GPa is assigned to a cubic lattice with lattice constant of 7.914 A (B. At the transition from phase B to the HP phase, the pressure-volume curve shows an anomaly without the structural change.

  20. REAL STRUCTURE AND RESIDUAL STRESSES IN ADVANCED WELDS DETERMINED BY X-RAY AND NEUTRON DIFFRACTION

    Directory of Open Access Journals (Sweden)

    Karel Trojan

    2017-07-01

    Full Text Available The paper outlines the capability of X-ray diffraction (XRD for evaluation of real structure changes and residual stresses (RS on cross-section of advanced thick welds due to the welding of ferromagnetic plates. The results of neutron diffraction describe a three-dimensional state of RS and also verify previous assumptions of RS redistribution as a result of the surface preparation for determination 2D maps measured by XRD.

  1. X-ray detectors for diffraction studies and their use with synchrotron radiation

    International Nuclear Information System (INIS)

    Milch, J.

    1976-02-01

    All techniques for X-ray diffraction studies on biological materials exhibit certain limitations. The characteristics of several X-ray detection systems, namely film, multiwire proportional counter and image intensified TV, are discussed and compared for application to specific biological studies. For the high count-rate situation existing at a synchrotron, it is shown that film is a good choice, but that the image intensified TV exhibits significant advantages. The details of such a system now being used at Princeton with a low intensity source are given and current results presented

  2. Phases quantification in titanium oxides by means of X-ray diffraction

    International Nuclear Information System (INIS)

    Macias B, L.R.; Garcia C, R.M.; Ita T, A. de; Chavez R, A.

    2001-01-01

    In this work two phases of titanium oxides are quantified which belong to the same crystalline system and by means of a computer program named Quanto created by the first author, contains the information for calculating the absorption coefficients, it can be quantified phases having one of the pure phases and the problem samples. In order to perform this work different mixtures of different titanium oxides were prepared measuring by means of the X-ray diffraction technique in the Siemens X-ray diffractometer of ININ which were processed with the Peakfit package and also they were evaluated by means of the computer program with the necessary information finding acceptable results. (Author)

  3. Preliminary study of determination of UO2 grain size using X-ray diffraction method

    International Nuclear Information System (INIS)

    Mulyana, T.; Sambodo, G. D.; Juanda, D.; Fatchatul, B.

    1998-01-01

    The determination of UO 2 grain size has accomplished using x-ray diffraction method. The UO 2 powder is obtained from sol-gel process. A copper target as radiation source in the x-ray diffractometer was used in this experiment with CμKα characteristic wavelength 1.54433 Angstrom. The result indicate that the UO 2 mean grain size on presintered (temperature 800 o C) has the value 456.8500 Angstrom and the UO 2 mean grain size on sintered (temperature 1700 o C) has value 651.4934 Angstrom

  4. Reflection-mode x-ray powder diffraction cell for in situ studies of electrochemical reactions

    International Nuclear Information System (INIS)

    Roberts, G.A.; Stewart, K.D.

    2004-01-01

    The design and operation of an electrochemical cell for reflection-mode powder x-ray diffraction experiments are discussed. The cell is designed for the study of electrodes that are used in rechargeable lithium batteries. It is designed for assembly in a glove box so that air-sensitive materials, such as lithium foil electrodes and carbonate-based electrolytes with lithium salts, can be used. The cell uses a beryllium window for x-ray transmission and electrical contact. A simple mechanism for compressing the electrodes is included in the design. Sample results for the cell are shown with a Cu Kα source and a position-sensitive detector

  5. X-ray diffraction in laser-irradiated epsomite crystals grown in presence of borax

    International Nuclear Information System (INIS)

    Zaitseva, E.V.; Portnov, V.N.; Faddeev, M.A.; Chuprunov, E.V.

    1997-01-01

    Relative changes in the intensities ΔI/I of the (220) and (440) X-ray diffraction reflection during laser irradiation of epsomite (MgSO 2 ·7H 2 O) crystals grown from an aqueous solution in the presence of borax (Na 2 B 4 O 7 ·10H 2 O) were measured using the CoK α , CuK α , MoK α radiations. The intensities measured depend on the real crystal structure dependent on the borax content in the solution. The dependence of ΔI/I is studied as a function of borax in the solution and X-ray-radiation wavelength

  6. X-ray diffraction analysis of substructures in plastically deformed BCC materials

    International Nuclear Information System (INIS)

    Klimanek, P.

    1993-01-01

    A procedure for line-shape analysis of broadened X-ray (or neutron) diffraction peaks is presented and specified for b.c.c. materials, which takes into account the effect of interfaces, internal stress of the 2nd kind and a dislocation distribution with weak defect correlation. Application of the technique is demonstrated by the estimation of dislocation densities in plastically deformed α-iron and steel. The results confirm that X-ray line-broadening analysis is suitable for integrated substructure characterization, but it becomes also evident that local structural inhomogeneity and the texture of the sample material must carefully included into the interpretation of experimental data. (orig.)

  7. A sample holder for in-house X-ray powder diffraction studies of protein powders

    DEFF Research Database (Denmark)

    Frankær, Christian Grundahl; Harris, Pernille; Ståhl, Kenny

    2011-01-01

    A sample holder for handling samples of protein for in-house X-ray powder diffraction (XRPD) analysis has been made and tested on lysozyme. The use of an integrated pinhole reduced the background, and good signal-to-noise ratios were obtained from only 7 l of sample, corresponding to approximately...... 2-3 mg of dry protein. The sample holder is further adaptable to X-ray absorption spectroscopy (XAS) measurements. Both XRPD and XAS at the Zn K-edge were tested with hexameric Zn insulin....

  8. Qualitative and quantitative determination of sediments phases in Chillon River by x-ray diffraction

    International Nuclear Information System (INIS)

    Miramira Tipula, Biviano; Zeballos Velasquez, Elvira; Chui Betancur, Heber; Valencia Salazar, Edilberto; Huaypar Vasquez, Yesena; Olivera de Lescano, Paula

    2008-01-01

    With this paper, we pretend to contribute with the recovery of Chillon River from a characterization of sediments. The objectives are the identification of pollution places along the bed of the Chillon River, from the Canta Province to Lima Province (Comas) and the determination of the preponderant factors of pollution. The qualitative and semi-quantitative determination of the sediments components have been carried out using the x-ray diffraction and x-ray fluorescence techniques, both of them will allow us to identify the pollute elements, for example the lead level in the Chillon River. (author)

  9. Diffraction. Single crystal, magnetic

    International Nuclear Information System (INIS)

    Heger, G.

    1999-01-01

    The analysis of crystal structure and magnetic ordering is usually based on diffraction phenomena caused by the interaction of matter with X-rays, neutrons, or electrons. Complementary information is achieved due to the different character of X-rays, neutrons and electrons, and hence their different interactions with matter and further practical aspects. X-ray diffraction using conventional laboratory equipment and/or synchrotron installations is the most important method for structure analyses. The purpose of this paper is to discuss special cases, for which, in addition to this indispensable part, neutrons are required to solve structural problems. Even though the huge intensity of modern synchrotron sources allows in principle the study of magnetic X-ray scattering the investigation of magnetic structures is still one of the most important applications of neutron diffraction. (K.A.)

  10. Flash X-ray

    International Nuclear Information System (INIS)

    Sato, Eiichi

    2003-01-01

    Generation of quasi-monochromatic X-ray by production of weakly ionized line plasma (flash X-ray), high-speed imaging by the X-ray and high-contrast imaging by the characteristic X-ray absorption are described. The equipment for the X-ray is consisted from the high-voltage power supply and condenser, turbo molecular pump, and plasma X-ray tube. The tube has a long linear anticathode to produce the line plasma and flash X-ray at 20 kA current at maximum. X-ray spectrum is measured by the imaging plate equipped in the computed radiography system after diffracted by a LiF single crystal bender. Cu anticathode generates sharp peaks of K X-ray series. The tissue images are presented for vertebra, rabbit ear and heart, and dog heart by X-ray fluoroscopy with Ce anticathode. Generation of K-orbit characteristic X-ray with extremely low bremsstrahung is to be attempted for medical use. (N.I.)

  11. Rapid, low dose X-ray diffractive imaging of the malaria parasite Plasmodium falciparum

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Michael W.M., E-mail: michael.jones@latrobe.edu.au [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Dearnley, Megan K. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Biochemistry and Molecular Biology, Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia); Riessen, Grant A. van [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Abbey, Brian [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Melbourne Centre for Nanofabrication, Victoria 3168 (Australia); Putkunz, Corey T. [ARC Centre of Excellence for Coherent X-Ray Science, School of Physics, The University of Melbourne, Victoria 3010 (Australia); Junker, Mark D. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Vine, David J. [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); McNulty, Ian [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); Centre for Nanoscale Materials, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Nugent, Keith A. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Peele, Andrew G. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Australian Synchrotron, 800 Blackburn Road, Clayton 3168 (Australia); Tilley, Leann [ARC Centre of Excellence for Coherent X-Ray Science, Department of Biochemistry and Molecular Biology, Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia)

    2014-08-01

    Phase-diverse X-ray coherent diffractive imaging (CDI) provides a route to high sensitivity and spatial resolution with moderate radiation dose. It also provides a robust solution to the well-known phase-problem, making on-line image reconstruction feasible. Here we apply phase-diverse CDI to a cellular sample, obtaining images of an erythrocyte infected by the sexual stage of the malaria parasite, Plasmodium falciparum, with a radiation dose significantly lower than the lowest dose previously reported for cellular imaging using CDI. The high sensitivity and resolution allow key biological features to be identified within intact cells, providing complementary information to optical and electron microscopy. This high throughput method could be used for fast tomographic imaging, or to generate multiple replicates in two-dimensions of hydrated biological systems without freezing or fixing. This work demonstrates that phase-diverse CDI is a valuable complementary imaging method for the biological sciences and ready for immediate application. - Highlights: • Phase-diverse coherent X-ray diffraction microscopy provides high-resolution and high-contrast images of intact biological samples. • Rapid nanoscale resolution imaging is demonstrated at orders of magnitude lower dose than previously possible. • Phase-diverse coherent X-ray diffraction microscopy is a robust technique for rapid, quantitative, and correlative X-ray phase imaging.

  12. Structural studies coupling X-ray diffraction and high-energy X-ray scattering in the UO2(2+)-HBr(aq) system.

    Science.gov (United States)

    Wilson, Richard E; Skanthakumar, S; Cahill, C L; Soderholm, L

    2011-11-07

    The structural chemistry of uranium(VI) in concentrated aqueous hydrobromic acid solutions was investigated using both single crystal X-ray diffraction and synchrotron-based high-energy X-ray scattering (HEXS) to reveal the structure of the uranium(VI) complexes in solution prior to crystallization. The crystal structures of a series of uranyl tetrabromide salts are reported, including Cs(2)UO(2)Br(4), Rb(2)UO(2)Br(4)·2H(2)O, K(2)UO(2)Br(4)·2H(2)O, and (NH(4))(2)UO(2)Br(4)·2H(2)O, as well as a molecular dimer of uranium(VI), (UO(2))(2)(OH)(2)Br(2)(H(2)O)(4). Limited correspondence exists between the structures observed in the solid state and those in solution. Quantitative analysis of the HEXS data show an average U-Br coordination number of 1.9(2) in solution, in contrast to the U-Br coordination number of 4 in the solid salts. © 2011 American Chemical Society

  13. In situ flow cell for combined X-ray absorption spectroscopy, X-ray diffraction, and mass spectrometry at high photon energies under solar thermochemical looping conditions

    Science.gov (United States)

    Rothensteiner, Matthäus; Jenni, Joel; Emerich, Hermann; Bonk, Alexander; Vogt, Ulrich F.; van Bokhoven, Jeroen A.

    2017-08-01

    An in situ/operando flow cell for transmission mode X-ray absorption spectroscopy (XAS), X-ray diffraction (XRD), and combined XAS/XRD measurements in a single experiment under the extreme conditions of two-step solar thermochemical looping for the dissociation of water and/or carbon dioxide was developed. The apparatus exposes materials to relevant conditions of both the auto-reduction and the oxidation sub-steps of the thermochemical cycle at ambient temperature up to 1773 K and enables determination of the composition of the effluent gases by online quadrupole mass spectrometry. The cell is based on a tube-in-tube design and is heated by means of a focusing infrared furnace. It was tested successfully for carbon dioxide splitting. In combined XAS/XRD experiments with an unfocused beam, XAS measurements were performed at the Ce K edge (40.4 keV) and XRD measurements at 64.8 keV and 55.9 keV. Furthermore, XRD measurements with a focused beam at 41.5 keV were carried out. Equimolar ceria-hafnia was auto-reduced in a flow of argon and chemically reduced in a flow of hydrogen/helium. Under reducing conditions, all cerium(iv) was converted to cerium(iii) and a cation-ordered pyrochlore-type structure was formed, which was not stable upon oxidation in a flow of carbon dioxide.

  14. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    International Nuclear Information System (INIS)

    Van de Voorde, Lien; Vekemans, Bart; Verhaeven, Eddy; Tack, Pieter; De Wolf, Robin; Garrevoet, Jan; Vandenabeele, Peter; Vincze, Laszlo

    2015-01-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg–Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position. - Highlights: • New X-ray fluorescence and X-ray diffraction instrument for non-destructive analysis • Commercially available, mobile system • One of the lightest and most compact of its kind • Characterization, data acquisition and analysis are performed. • Results of measurements on pigment model samples and cultural heritage materials

  15. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    Energy Technology Data Exchange (ETDEWEB)

    Van de Voorde, Lien, E-mail: lien.vandevoorde@ugent.be [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Vekemans, Bart [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Verhaeven, Eddy [Antwerp University, Faculty of Design Sciences, Mutsaardstraat 31, B-2000 Antwerpen (Belgium); Tack, Pieter; De Wolf, Robin; Garrevoet, Jan [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Vandenabeele, Peter [Ghent University, Department of Archaeology, Archaeometry Research Group, Sint-Pietersnieuwstraat 35, B-9000 Gent (Belgium); Vincze, Laszlo [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium)

    2015-08-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg–Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position. - Highlights: • New X-ray fluorescence and X-ray diffraction instrument for non-destructive analysis • Commercially available, mobile system • One of the lightest and most compact of its kind • Characterization, data acquisition and analysis are performed. • Results of measurements on pigment model samples and cultural heritage materials.

  16. Simultaneous Femtosecond X-ray Spectroscopy and Diffraction of Photosystem II at Room Temperature

    Science.gov (United States)

    Kern, Jan; Alonso-Mori, Roberto; Tran, Rosalie; Hattne, Johan; Gildea, Richard J.; Echols, Nathaniel; Glöckner, Carina; Hellmich, Julia; Laksmono, Hartawan; Sierra, Raymond G.; Lassalle-Kaiser, Benedikt; Koroidov, Sergey; Lampe, Alyssa; Han, Guangye; Gul, Sheraz; DiFiore, Dörte; Milathianaki, Despina; Fry, Alan R.; Miahnahri, Alan; Schafer, Donald W.; Messerschmidt, Marc; Seibert, M. Marvin; Koglin, Jason E.; Sokaras, Dimosthenis; Weng, Tsu-Chien; Sellberg, Jonas; Latimer, Matthew J.; Grosse-Kunstleve, Ralf W.; Zwart, Petrus H.; White, William E.; Glatzel, Pieter; Adams, Paul D.; Bogan, Michael J.; Williams, Garth J.; Boutet, Sébastien; Messinger, Johannes; Zouni, Athina; Sauter, Nicholas K.; Yachandra, Vittal K.; Bergmann, Uwe; Yano, Junko

    2013-01-01

    Intense femtosecond X-ray pulses produced at the Linac Coherent Light Source (LCLS) were used for simultaneous X-ray diffraction (XRD) and X-ray emission spectroscopy (XES) of microcrystals of Photosystem II (PS II) at room temperature. This method probes the overall protein structure and the electronic structure of the Mn4CaO5 cluster in the oxygen-evolving complex of PS II. XRD data are presented from both the dark state (S1) and the first illuminated state (S2) of PS II. Our simultaneous XRD/XES study shows that the PS II crystals are intact during our measurements at the LCLS, not only with respect to the structure of PS II, but also with regard to the electronic structure of the highly radiation sensitive Mn4CaO5 cluster, opening new directions for future dynamics studies. PMID:23413188

  17. Femtosecond x-ray photoelectron diffraction on gas-phase dibromobenzene molecules

    International Nuclear Information System (INIS)

    Rolles, D; Boll, R; Epp, S W; Erk, B; Foucar, L; Hömke, A; Adolph, M; Gorkhover, T; Aquila, A; Chapman, H N; Coppola, N; Delmas, T; Gumprecht, L; Holmegaard, L; Bostedt, C; Bozek, J D; Coffee, R; Decleva, P; Filsinger, F; Johnsson, P

    2014-01-01

    We present time-resolved femtosecond photoelectron momentum images and angular distributions of dissociating, laser-aligned 1,4-dibromobenzene (C 6 H 4 Br 2 ) molecules measured in a near-infrared pump, soft-x-ray probe experiment performed at an x-ray free-electron laser. The observed alignment dependence of the bromine 2p photoelectron angular distributions is compared to density functional theory calculations and interpreted in terms of photoelectron diffraction. While no clear time-dependent effects are observed in the angular distribution of the Br(2p) photoelectrons, other, low-energy electrons show a pronounced dependence on the time delay between the near-infrared laser and the x-ray pulse. (paper)

  18. Optimizing Monocapillary Optics for Synchrotron X-ray Diffraction, Fluorescence Imaging, and Spectroscopy Applications

    International Nuclear Information System (INIS)

    Bilderback, Donald H.; Kazimirov, Alexander; Gillilan, Richard; Cornaby, Sterling; Woll, Arthur; Zha, Chang-Sheng; Huang Rong

    2007-01-01

    A number of synchrotron x-ray applications such as powder diffraction in diamond anvil cells, microbeam protein crystallography, x-ray fluorescence imaging, etc. can benefit from using hollow glass monocapillary optics to improve the flux per square micron on a sample. We currently draw glass tubing into the desired elliptical shape so that only one-bounce under total reflection conditions is needed to bring the x-ray beam to a focus at a 25 to 50 mm distance beyond the capillary tip. For modest focal spot sizes of 10 to 20 microns, we can increase the intensity per square micron by factors of 10 to 1000. We show some of the results obtained at CHESS and Hasylab with capillaries focusing 5 to 40 keV radiation, their properties, and how even better the experimental results could be if more ideal capillaries were fabricated in the future

  19. Study of properties of chemically modified samples of halloysite mineral with X-ray fluorescence and X-ray powder diffraction methods

    Science.gov (United States)

    Banaś, D.; Kubala-Kukuś, A.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.; Czech, K.; Garnuszek, M.; Słomkiewicz, P.; Szczepanik, B.

    2013-12-01

    Elemental and chemical composition of raw and activated samples of halloysite mineral using wavelength dispersive X-ray fluorescence (WDXRF), total reflection X-ray fluorescence (TXRF) and X-ray powder diffraction (XRPD) methods were determined. As the result, it has been shown that application of the complementary X-ray spectrometry techniques allows very precise observation of changes in composition of halloysite mineral samples caused by its chemical modifications. Sample preparation procedure and usability of the research methods applied are described in details. Procedure of activation of raw halloysite mineral samples by etching them in sulfuric acid of various concentrations has been described and discussed. The ability of the samples to adsorb lead from intentionally contaminated water was tested and confirmed.

  20. Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction

    International Nuclear Information System (INIS)

    Emamzadah, Soheila; Petty, Tom J.; De Almeida, Victor; Nishimura, Taisuke; Joly, Jacques; Ferrer, Jean-Luc; Halazonetis, Thanos D.

    2009-01-01

    A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction. Microfluidics is a promising technology for the rapid identification of protein crystallization conditions. However, most of the existing systems utilize silicone elastomers as the chip material which, despite its many benefits, is highly permeable to water vapour. This limits the time available for protein crystallization to less than a week. Here, the use of a cyclic olefin homopolymer-based microfluidics system for protein crystallization and in situ X-ray diffraction is described. Liquid handling in this system is performed in 2 mm thin transparent cards which contain 500 chambers, each with a volume of 320 nl. Microbatch, vapour-diffusion and free-interface diffusion protocols for protein crystallization were implemented and crystals were obtained of a number of proteins, including chicken lysozyme, bovine trypsin, a human p53 protein containing both the DNA-binding and oligomerization domains bound to DNA and a functionally important domain of Arabidopsis Morpheus’ molecule 1 (MOM1). The latter two polypeptides have not been crystallized previously. For X-ray diffraction analysis, either the cards were opened to allow mounting of the crystals on loops or the crystals were exposed to X-rays in situ. For lysozyme, an entire X-ray diffraction data set at 1.5 Å resolution was collected without removing the crystal from the card. Thus, cyclic olefin homopolymer-based microfluidics systems have the potential to further automate protein crystallization and structural genomics efforts

  1. Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Emamzadah, Soheila [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland); Petty, Tom J. [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Biomedical Graduate Studies Genomics and Computational Biology Group, University of Pennsylvania, Philadelphia, PA 19104 (United States); De Almeida, Victor [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland); Nishimura, Taisuke [Department of Plant Biology, University of Geneva, CH-1205 Geneva (Switzerland); Joly, Jacques; Ferrer, Jean-Luc [Institut de Biologie Structurale J.-P. Ebel, CEA-CNRS-University J. Fourier, 38027 Grenoble CEDEX 1 (France); Halazonetis, Thanos D., E-mail: thanos.halazonetis@unige.ch [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland)

    2009-09-01

    A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction. Microfluidics is a promising technology for the rapid identification of protein crystallization conditions. However, most of the existing systems utilize silicone elastomers as the chip material which, despite its many benefits, is highly permeable to water vapour. This limits the time available for protein crystallization to less than a week. Here, the use of a cyclic olefin homopolymer-based microfluidics system for protein crystallization and in situ X-ray diffraction is described. Liquid handling in this system is performed in 2 mm thin transparent cards which contain 500 chambers, each with a volume of 320 nl. Microbatch, vapour-diffusion and free-interface diffusion protocols for protein crystallization were implemented and crystals were obtained of a number of proteins, including chicken lysozyme, bovine trypsin, a human p53 protein containing both the DNA-binding and oligomerization domains bound to DNA and a functionally important domain of Arabidopsis Morpheus’ molecule 1 (MOM1). The latter two polypeptides have not been crystallized previously. For X-ray diffraction analysis, either the cards were opened to allow mounting of the crystals on loops or the crystals were exposed to X-rays in situ. For lysozyme, an entire X-ray diffraction data set at 1.5 Å resolution was collected without removing the crystal from the card. Thus, cyclic olefin homopolymer-based microfluidics systems have the potential to further automate protein crystallization and structural genomics efforts.

  2. Microscopy of biological sample through advanced diffractive optics from visible to X-ray wavelength regime.

    Science.gov (United States)

    Di Fabrizio, Enzo; Cojoc, Dan; Emiliani, Valentina; Cabrini, Stefano; Coppey-Moisan, Maite; Ferrari, Enrico; Garbin, Valeria; Altissimo, Matteo

    2004-11-01

    The aim of this report is to demonstrate a unified version of microscopy through the use of advanced diffractive optics. The unified scheme derives from the technical possibility of realizing front wave engineering in a wide range of electromagnetic spectrum. The unified treatment is realized through the design and nanofabrication of phase diffractive elements (PDE) through which wave front beam shaping is obtained. In particular, we will show applications, by using biological samples, ranging from micromanipulation using optical tweezers to X-ray differential interference contrast (DIC) microscopy combined with X-ray fluorescence. We report some details on the design and physical implementation of diffractive elements that besides focusing also perform other optical functions: beam splitting, beam intensity, and phase redistribution or mode conversion. Laser beam splitting is used for multiple trapping and independent manipulation of micro-beads surrounding a cell as an array of tweezers and for arraying and sorting microscopic size biological samples. Another application is the Gauss to Laguerre-Gauss mode conversion, which allows for trapping and transfering orbital angular momentum of light to micro-particles immersed in a fluid. These experiments are performed in an inverted optical microscope coupled with an infrared laser beam and a spatial light modulator for diffractive optics implementation. High-resolution optics, fabricated by means of e-beam lithography, are demonstrated to control the intensity and the phase of the sheared beams in x-ray DIC microscopy. DIC experiments with phase objects reveal a dramatic increase in image contrast compared to bright-field x-ray microscopy. Besides the topographic information, fluorescence allows detection of certain chemical elements (Cl, P, Sc, K) in the same setup, by changing the photon energy of the x-ray beam. (c) 2005 Wiley-Liss, Inc.

  3. Sparse recovery of undersampled intensity patterns for coherent diffraction imaging at high X-ray energies.

    Science.gov (United States)

    Maddali, S; Calvo-Almazan, I; Almer, J; Kenesei, P; Park, J-S; Harder, R; Nashed, Y; Hruszkewycz, S O

    2018-03-21

    Coherent X-ray photons with energies higher than 50 keV offer new possibilities for imaging nanoscale lattice distortions in bulk crystalline materials using Bragg peak phase retrieval methods. However, the compression of reciprocal space at high energies typically results in poorly resolved fringes on an area detector, rendering the diffraction data unsuitable for the three-dimensional reconstruction of compact crystals. To address this problem, we propose a method by which to recover fine fringe detail in the scattered intensity. This recovery is achieved in two steps: multiple undersampled measurements are made by in-plane sub-pixel motion of the area detector, then this data set is passed to a sparsity-based numerical solver that recovers fringe detail suitable for standard Bragg coherent diffraction imaging (BCDI) reconstruction methods of compact single crystals. The key insight of this paper is that sparsity in a BCDI data set can be enforced by recognising that the signal in the detector, though poorly resolved, is band-limited. This requires fewer in-plane detector translations for complete signal recovery, while adhering to information theory limits. We use simulated BCDI data sets to demonstrate the approach, outline our sparse recovery strategy, and comment on future opportunities.

  4. A X-ray microscope for stored energy in single grains of cold-rolled steel

    International Nuclear Information System (INIS)

    Drakopoulos, M.; Snigireva, I.; Snigirev, A.; Castelnau, O.; Chauveau, T.; Bacroix, B.; Schroer, C.; Ungar, T.

    2000-01-01

    A new set-up for X-ray microdiffraction has been developed on the ESRF beamline ID22. This set-up allows microscopic characterization of materials in diffraction mode, the size of the focused beam being only of a few microns. This facilitates the measurement of material quantities as average size of the coherently diffracting volume, local dislocation density, residual stress, local fluctuation of the residual stress, and intragranular misorientation from single grains of a polycrystalline material. The first application on an IF-Ti steel after different thermomechanical treatments (recrystallization, cold-rolling, annealing) is presented

  5. Contained x-ray diffraction goniometer for examination of radioactive materials

    International Nuclear Information System (INIS)

    Smith, P.K.; Osgood, B.C.; Blaser, D.E.; Howell, R.E.; Stuhler, H.; Stauver, J.

    1987-11-01

    Radioactive materials are being characterized for chemical form and certain physical properties with an x-ray diffraction goniometer customized for containment in a shielded alpha glovebox. A Siemens D500 goniometer was customized by Siemens to locate the associated electronics and x-ray generator outside the glovebox to minimize corrosion and facilitate maintenance. A graphite monochromator is used with a shielded scintillation detector to separate diffracted x-radiation from nuclear radiation. The diffraction system is computer automated for data acquisition and reduction. The facility is designed to handle primarily alpha- and beta-emitting samples with moderate neutron and gamma radiation. Samples containing plutonium, enriched uranium, and other transuranic elements are analyzed in support of site nuclear operations and development programs on nuclear waste, chemical separations, reactor fuels, and product forms

  6. NXDC-neutron and x-ray diffraction code for crystal structures calculations

    International Nuclear Information System (INIS)

    Abbas, Y.; El-Sherif, A.

    1982-01-01

    A computer program NXDC for the calculations of neutron diffraction and x-ray diffraction intensities is reported. The program is very flexible and allows the intensity of a reflection with a given Miller indices to be calculated if the unit cell and its contents are specified together with the equipement used Neutrons or X-rays-and if necessary introducing temperature and absorption factors corrections. For the refinement of crystal structures provision is made for the comparison of the calculated intensities and the intergrated intensities observed from the diffraction diagrams using the least-squares analysis to obtain the reliability factor R. The program is written in FORTRAN Iv and is very suitable for minicomputers

  7. Rosalind Franklin's X-ray photo of DNA as an undergraduate optical diffraction experiment

    Science.gov (United States)

    Thompson, J.; Braun, G.; Tierney, D.; Wessels, L.; Schmitzer, H.; Rossa, B.; Wagner, H. P.; Dultz, W.

    2018-02-01

    Rosalind Franklin's X-ray diffraction patterns of DNA molecules rendered the important clue that DNA has the structure of a double helix. The most famous X-ray photograph, Photo 51, is still printed in most Biology textbooks. We suggest two optical experiments for undergraduates that make this historic achievement comprehensible for students by using macromodels of DNA and visible light to recreate a diffraction pattern similar to Photo 51. In these macromodels, we replace the double helix both mathematically and experimentally with its two-dimensional (flat) projection and explain why this is permissible. Basic optical concepts are used to infer certain well-known characteristics of DNA from the diffraction pattern.

  8. Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

    Science.gov (United States)

    Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

    2000-01-01

    A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

  9. Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

    Science.gov (United States)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

    2017-11-01

    The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

  10. JMFA2—a graphically interactive Java program that fits microfibril angle X-ray diffraction data

    Science.gov (United States)

    Steve P. Verrill; David E. Kretschmann; Victoria L. Herian

    2006-01-01

    X-ray diffraction techniques have the potential to decrease the time required to determine microfibril angles dramatically. In this paper, we discuss the latest version of a curve-fitting toll that permits us to reduce the time required to evaluate MFA X-ray diffraction patterns. Further, because this tool reflects the underlying physics more accurately than existing...

  11. Strain fields in crystalline solids: prediction and measurement of X- ray diffraction patterns and electron diffraction contrast images

    NARCIS (Netherlands)

    Bor, Teunis Cornelis

    2000-01-01

    Lattice imperfections, such as dislocations and misfitting particles, shift and/or broaden X-ray diffraction (XRD) line profiles. Most of the present analysis methods of the shift and broadening of XRD line profiles do not provide the characteristics of lattice imperfections. The main part of this

  12. Disorder and transport properties of In3SbTe2 - an X-ray, neutron and electron diffraction study

    International Nuclear Information System (INIS)

    Schroeder, Thorsten; Rosenthal, Tobias; Grott, Sebastian; Stiewe, Christian; Boor, Johannes de; Oeckler, Oliver

    2013-01-01

    Quenched metastable In 3 SbTe 2 was investigated by X-ray and neutron powder diffraction as well as by single-crystal X-ray diffraction. The average structure corresponds to the rocksalt type, the anion position being occupied by antimony and tellurium. Neutron data indicate no antisite disorder of indium and antimony. The compound is a high-temperature phase that can be quenched to yield a metastable compound at ambient temperature which, upon heating, decomposes at ca. 320 C into InSb and InTe. Diffuse scattering in reconstructed X-ray and selected area electron diffraction patterns indicates local distortions of the crystal structure due to static atom displacement along <100> from the average positions, caused by the different size of the anions, but no superstructure. The electrical conductivity of In 3 SbTe 2 is 3.2 x 10 4 S.cm -1 at 25 C, the temperature characteristics correspond to metallic behavior. Consequently, the thermal conductivity is also rather high. The decomposition into InSb and InTe reduces the electrical conductivity by a factor of 3 in heterogeneous microstructures. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. Ultra-small-angle x-ray scattering by single-crystal Al deformed in situ

    Science.gov (United States)

    Long, Gabrielle; Levine, Lyle

    1997-03-01

    Among the earliest small-angle x-ray scattering and small-angle neutron scattering experiments were attempts to study dislocation structures. These structures have proven to be very difficult to measure because of the intrinsically low contrast of the microstructure, and the requirement that multiple Bragg diffraction be strictly avoided. Thus, many attempts to measure dislocation structures have been compromised by these difficulties. We present results from ultra-small-angle x-ray scattering measurements on single-crystal Al, deformed in situ on beam line X23A3 at the National Synchrotron Light Source. Radiographic images, which are in the O-beam position for diffraction, were taken of the scattering volume. The Al crystal was also rotated to ensure that the scattering data would be accumulated in a region sufficiently distant from accidental Bragg diffractions. Stress-strain data were obtained simultaneously with the x-ray scattering data. We report on the evolution of dislocation structures from 0% strain to 18% strain.

  14. Syntheses and crystal structure determination by X-ray powder diffraction of new compounds of Benzovesamicol

    International Nuclear Information System (INIS)

    Rukiah, M.; Assaad, Th.

    2012-06-01

    The compound 2,2,2-Trifluoro-N-(1a,2,7,7 a-tetra-hydronaphtho[2,3-b]oxiren-3-yl)- acetamide, C 1 2H 1 0F 3 NO 2 , an important precursor in the preparation of benzovesamicol analogues for the diagnosis of Alzheimers disease, was prepared by the epoxidation of 5,8-dihydronaphthalene-1-amine using 3-chloroperoxybenzoic acid. The structure was determined by X-ray powder diffraction, multinuclear NMR spectroscopy and FT-IR spectroscopy. A pair of molecules form intermolecular N- H...O hydrogen bonds, involving the amino and oxirene groups, to produce a dimer.The two racemic compounds (2RS,3RS)-5-amino-3-(4-phenylpiperazin-1-yl)-1,2,3,4 tetrahydronaphthalene-2-ol, C 2 0H 2 5N 3 O, (I) and (2RS,3RS)-5-amino-3-[4-(3- methoxyphenyl)piperazin-1-yl]-1,2,3,4-tetrahydronaphthalene-2-ol, C 2 1H 2 7N 3 O 2 , (II) important benzovesamicol analogues for the diagnosis of Alzheimer's disease, have been synthesized and characterized by FT-IR, and 1 H and 13 C NMR spectroscopic analyses. The crystal structures were analyses using powder diffraction as no suitable single crystal were obtained. The two compounds are racemic mixtures of enantiomers which crystallize in the monoclinic system in a centrosymmetric space group (P21/c). Crystallography, in particular powder X-ray diffraction, was pivotal in revealing that the enantio-resolution did not succeed. In two compounds, the piperazine ring has a chair conformation, while the cyclohexene ring assumes a half-chair conformation. In (I) the crystal packing is mediated by weak contacts, principally by complementary intermolecular N--H...O hydrogen bonds that connect successive molecules into a chain. Further stabilization is provided by weak C--H...N contacts and by a weak intermolecular C--H...π interaction. While in (II), the crystal packing is dominated by intermolecular O--H...N hydrogen bonding which links molecules along the c direction. (authors)

  15. Diffraction-enhanced imaging of musculoskeletal tissues using a conventional x-ray tube.

    Science.gov (United States)

    Muehleman, Carol; Li, Jun; Connor, Dean; Parham, Christopher; Pisano, Etta; Zhong, Zhong

    2009-08-01

    In conventional projection radiography, cartilage and other soft tissues do not produce enough radiographic contrast to be distinguishable from each other. Diffraction-enhanced imaging (DEI) uses a monochromatic x-ray beam and a silicon crystal analyzer to produce images in which attenuation contrast is greatly enhanced and x-ray refraction at tissue boundaries can be detected. The aim of this study was to test the efficacy of conventional x-ray tube-based DEI for the detection of soft tissues in experimental samples. Cadaveric human tali (normal and degenerated) and a knee and thumb were imaged with DEI using a conventional x-ray tube and DEI setup that included a double-silicon crystal monochromator and a silicon crystal analyzer positioned between the imaged object and the detector. Diffraction-enhanced images of the cadaveric tali allowed the visualization of cartilage and its specific level of degeneration for each specimen. There was a significant correlation between the grade of cartilage integrity as assessed on the tube diffraction-enhanced images and on their respective histologic sections (r = 0.97, P = .01). Images of the intact knee showed the articular cartilage edge of the femoral condyle, even when superimposed by the tibia. In the thumb image, it was possible to visualize articular cartilage, tendons, and other soft tissues. DEI based on a conventional x-ray tube allows the visualization of skeletal and soft tissues simultaneously. Although more in-depth testing and optimization of the DEI setup must be carried out, these data demonstrate a proof of principle for further development of the technology for future clinical imaging.

  16. X-ray plane-wave diffraction effects in a crystal with third-order nonlinearity

    Energy Technology Data Exchange (ETDEWEB)

    Balyan, M. K., E-mail: mbalyan@ysu.am [Yerevan State University, Faculty of Physics (Armenia)

    2016-12-15

    The two-wave dynamical diffraction in the Laue geometry has been theoretically considered for a plane X-ray wave in a crystal with a third-order nonlinear response to the external field. An analytical solution to the problem stated is found for certain diffraction conditions. A nonlinear pendulum effect is analyzed. The nonlinear extinction length is found to depend on the incident-wave intensity. A pendulum effect of a new type is revealed: the intensities of the transmitted and diffracted waves periodically depend on the incidentwave intensity at a fixed crystal thickness. The rocking curves and Borrmann nonlinear effect are numerically calculated.

  17. Influence of preferred orientation of minerals in the mineralogical identification process by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Amanda Luzia da; Oliveira, Arno H. de [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear; Fernandes, Maria Lourdes Souza, E-mail: lourdesfernandes@ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de GeoCiencias. Centro de Pesquisa Professor Manoel Teixeira da Costa

    2011-07-01

    The X-ray diffraction corresponds to one of the main techniques for characterization of microstructures in crystalline materials, widely used in the identification of minerals in samples of geological materials. Some minerals have a property called preferred orientation which corresponds to the orientation tendency of the crystals of ground minerals to orient themselves in certain directions according to a preferred crystallographic plane. This property affects the analysis by X-ray diffraction and this fact can generates erroneous results in the characterization. The purpose of this study is to identify the negative influence of the preferred orientation of a mineral in the generation of diffraction patterns obtained in the X-ray diffraction analysis. For this, a sample of muscovite, a mineral of mica group, was prepared by two different methods: the frontal method and the back loading method. In the analysis using the frontal method there was displacement of the XRD pattern in the abscissa axis, where it was observed changes in interplanar distance and angle 2{theta} values, which are essential information for characterization and identification of a mineral. In the analysis using the back loading method, the generated XRD pattern showed no displacement in the axis of abscissas and showed interplanar distance and angle 2{theta} values closer to the real values for the muscovite. The results showed that one can only make improvements to the process of sample preparation minimizing the effect of preferred orientation in the analysis. There is no need to change conditions of diffractometer measurements. (author)

  18. Apparatus development for high-pressure X-ray diffraction using synchrotron radiation

    International Nuclear Information System (INIS)

    Martinez, L.G.; Orlando, M.T.D.; Rossi, J.L.; Passamai Junior, J.L.; Melo, F.C.L.; Ferreira, F.F.

    2006-01-01

    Some phenomena in the field of condensed matter physics can be studied when the matter is submitted to extreme conditions of pressure, magnetic fields or temperatures. Once submitted to these conditions it is generally necessary to measure the properties of the matter in situ. The existence of a synchrotron light laboratory in Brazil opens up the chance of studying materials in extreme conditions by techniques like X-ray diffraction and absorption. However, when compared to high-energy synchrotrons accelerators, the Brazilian source offers a narrower energy range and lower flux. These facts impose limitation to perform diffraction experiments by energy dispersion and, consequently, the use of pressure cells with denser anvils like diamond. However, for a lower-pressure range, preliminary studies showed the viability of measurements in an angular dispersion configuration. This allows the use of silicon carbide anvils B 4C . In this work it is described the development of a hydrostatic pressure cell suitable for X-rays diffraction measurements in the Brazilian Synchrotron Light Laboratory using materials and technologies developed by the institutions and researchers involved in this project (IPEN, UFES, CTA and LNLS). This development can provide the scientific community with the possibility of performing X-ray diffraction measurements under hydrostatic pressure, initially up to 2 GPa, with possibilities of increasing the maximum pressure to higher values, with or without application of magnetic fields and high or low temperatures. (author)

  19. The structural analysis of zinc borate glass by laboratory EXAFS and X-ray diffraction measurements

    International Nuclear Information System (INIS)

    Kajinami, Akihiko; Harada, Yasushi; Inoue, Shinsuke; Deki, Shigehito; Umesaki, Norimasa

    1999-01-01

    The structure of zinc borate glass has been investigated by laboratory EXAFS and X-ray diffraction measurement as preliminary investigations for the detailed study in SPring-8. The zinc borate glass was prepared in the range from 40 to 65 mol% of zinc oxide content. The X-ray diffraction was measured by horizontal θ-θ goniometer with 60 kV and 300 mA output of Mo target. The EXAFS of zinc borate glass was measured by laboratory EXAFS system with 20 kV, 100 mA output of Mo target for the K absorption edge of zinc atom. From the X-ray diffraction and the EXAFS measurements, it is found that the zinc ion is surrounded by four oxygen atoms and formed a tetrahedral structure whose (Zn-O) distance is about 2 A and that the structure is unchanged with the zinc oxide content. The diffraction data show that the neighboring structure of boron atom transforms from BO 4 tetrahedra to BO 3 tetragonal planar structure with increasing of the zinc oxide content. (author)

  20. Influence of preferred orientation of minerals in the mineralogical identification process by X-ray diffraction

    International Nuclear Information System (INIS)

    Silva, Amanda Luzia da; Oliveira, Arno H. de; Fernandes, Maria Lourdes Souza

    2011-01-01

    The X-ray diffraction corresponds to one of the main techniques for characterization of microstructures in crystalline materials, widely used in the identification of minerals in samples of geological materials. Some minerals have a property called preferred orientation which corresponds to the orientation tendency of the crystals of ground minerals to orient themselves in certain directions according to a preferred crystallographic plane. This property affects the analysis by X-ray diffraction and this fact can generates erroneous results in the characterization. The purpose of this study is to identify the negative influence of the preferred orientation of a mineral in the generation of diffraction patterns obtained in the X-ray diffraction analysis. For this, a sample of muscovite, a mineral of mica group, was prepared by two different methods: the frontal method and the back loading method. In the analysis using the frontal method there was displacement of the XRD pattern in the abscissa axis, where it was observed changes in interplanar distance and angle 2θ values, which are essential information for characterization and identification of a mineral. In the analysis using the back loading method, the generated XRD pattern showed no displacement in the axis of abscissas and showed interplanar distance and angle 2θ values closer to the real values for the muscovite. The results showed that one can only make improvements to the process of sample preparation minimizing the effect of preferred orientation in the analysis. There is no need to change conditions of diffractometer measurements. (author)

  1. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    Directory of Open Access Journals (Sweden)

    E. Han Dao

    2015-07-01

    Full Text Available In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  2. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals.

    Science.gov (United States)

    Dao, E Han; Sierra, Raymond G; Laksmono, Hartawan; Lemke, Henrik T; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L; Cohen, Aina E; Soltis, S Michael; DeMirci, Hasan

    2015-07-01

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  3. Versatile in situ powder X-ray diffraction cells for solid-gas investigations

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, Torben R.; Nielsen, Thomas K.; Joergensen, Jens-Erik [Aarhus Univ. (Denmark). Center for Energy Materials, Center for Materials Crystallography; Filinchuk, Yaroslav [European Synchrotron Radiation Facility, Grenoble (France). Swiss-Norwegian Beam Lines; Cerenius, Yngve [Lund Univ. (Sweden). MAX-lab; Gray, Evan MacA.; Webb, Colin J. [Griffith Univ., Nathan, Brisbane (Australia). Queensland Micro- and Nanotechnology Centre

    2010-12-15

    This paper describes new sample cells and techniques for in situ powder X-ray diffraction specifically designed for gas absorption studies up to ca 300 bar (1 bar = 100 000 Pa) gas pressure. The cells are for multipurpose use, in particular the study of solid-gas reactions in dosing or flow mode, but can also handle samples involved in solid-liquid-gas studies. The sample can be loaded into a single-crystal sapphire (Al{sub 2}O{sub 3}) capillary, or a quartz (SiO{sub 2}) capillary closed at one end. The advantages of a sapphire single-crystal cell with regard to rapid pressure cycling are discussed, and burst pressures are calculated and measured to be {proportional_to}300 bar. An alternative and simpler cell based on a thin-walled silicate or quartz glass capillary, connected to a gas source via a VCR fitting, enables studies up to {proportional_to}100 bar. Advantages of the two cell types are compared and their applications are illustrated by case studies. (orig.)

  4. Versatile in situ powder X-ray diffraction cells for solid-gas investigations

    International Nuclear Information System (INIS)

    Jensen, Torben R.; Nielsen, Thomas K.; Joergensen, Jens-Erik; Filinchuk, Yaroslav; Cerenius, Yngve; Gray, Evan MacA.; Webb, Colin J.

    2010-01-01

    This paper describes new sample cells and techniques for in situ powder X-ray diffraction specifically designed for gas absorption studies up to ca 300 bar (1 bar = 100 000 Pa) gas pressure. The cells are for multipurpose use, in particular the study of solid-gas reactions in dosing or flow mode, but can also handle samples involved in solid-liquid-gas studies. The sample can be loaded into a single-crystal sapphire (Al 2 O 3 ) capillary, or a quartz (SiO 2 ) capillary closed at one end. The advantages of a sapphire single-crystal cell with regard to rapid pressure cycling are discussed, and burst pressures are calculated and measured to be ∝300 bar. An alternative and simpler cell based on a thin-walled silicate or quartz glass capillary, connected to a gas source via a VCR fitting, enables studies up to ∝100 bar. Advantages of the two cell types are compared and their applications are illustrated by case studies. (orig.)

  5. X-ray diffraction investigation of cyclohexane derivatives at 293 K

    Energy Technology Data Exchange (ETDEWEB)

    Drozdowski, Henryk, E-mail: riemann@amu.edu.pl [Department of Optics, Faculty of Physics, A. Mickiewicz University, ul. Umultowska 85, 61-614 Poznan (Poland); Nowakowski, Krzysztof; BLaszczak, ZdzisLaw [Department of Optics, Faculty of Physics, A. Mickiewicz University, ul. Umultowska 85, 61-614 Poznan (Poland)

    2011-10-15

    This paper reports results of the X-ray diffraction structural studies of liquid cyclohexylamine C{sub 6}H{sub 11}-NH{sub 2} and cyclohexanol C{sub 6}H{sub 11}-OH performed at 293 K. The method of X-ray scattering and Fourier analysis enabled the determination of the mean structural parameters of the liquids studied. The wide-angle X-ray scattering (WAXS) method provided new information on mutual arrangement and orientation of the molecules of the above mentioned compounds in the liquid phase. The measurements of scattered radiation intensity were performed in a wide range of wave vector (from S{sub min}=0.925 A{sup -1} to S{sub max}=14.311 A{sup -1}), with the use of X-ray radiation MoK{sub {alpha}} ({lambda}=0.71069 A). Angular distributions of X-ray scattered intensity were measured, and differential radial distribution functions of electron density (DRDFs) were calculated. The mean distances between the neighbouring molecules and the mean radii of coordination spheres were found. A simple model of short-range arrangement of the molecules was proposed, which seems to be valid for other polar monosubstituted cyclohexane derivatives in the liquid phase. - Highlights: > X-ray method enabled the determination of the structure of cyclohexane derivatives. > Determination of the mean parameters of the liquid structure has been discussed. > A simple model of short-range arrangement and orientation of the molecules was proposed. > Results are valid for a wide group of molecular liquids.

  6. Neutron diffraction study of zoisite at 15 K and X-ray study at room temperature

    International Nuclear Information System (INIS)

    Smith, J.V.; Pluth, J.J.; Richardson, J.W. Jr.; Kvick, A.

    1987-01-01

    The crystal structure of zoisite, Ca 2 Al 3 Si 3 O 12 OH; Pnma, Z=4, was determined for crystals of the tanzanite gem variety at 15 K (neutron diffraction, a = 16.218(3), b = 5.5406(14), c = 10.033(3) A) and room temperature, ≅ 295 K (X-ray diffraction, a = 16.1909(15), b = 5.5466(5), c = 10.0323(6) A). Only one proton position was located with positional coordinates 0.2690(1), 0.25, 0.9753(2) and population factor 0.98(1) at 15 K. It forms a hydroxyl group with O(10) at 0.986(2) A and a hydrogen bond with O(4) at 1.757(2) A. There is no diffraction evidence of a second proton position to explain the weak infrared absorption at 2160 cm -1 at room temperature for both natural and synthetic zoisites; however, the detection level of 0.01 atom at the 2 σ level might be insufficient. The possibility of hydrogen bonding to two O(2) at 2.96 A from O(10) is discussed. Because the displacement ellipsoid of the proton at 15 K is oblate and smaller than the ones in staurolite, it is concluded that there is only a single center of motion of the proton. The wide ranges of Ca-O, Al-O and Si-O distances are consistent with valence balancing in which short distances go to oxygen atoms with low values of formal bond strength. The displacement ellipsoids at 295 K can be explained qualitatively by anisotropic thermal motion constrained by the bonding to the nearest neighbors. There is an additional overall anisotropy at 15 K which is unexplained. However, values of B iso are consistent with zero-point motion, and there is no evidence for positional disorder. (orig.)

  7. Milestone experiments for single pass UV/X-ray FELs

    International Nuclear Information System (INIS)

    Ben-Zvi, I.

    1994-01-01

    In the past decade, significant advances have been made in the theory and technology of high brightness electron beams and single pass FELS. These developments facilitate the construction of practical UV and X-ray FELs and has prompted proposals to the DOE for the construction of such facilities. There are several important experiments to be performed before committing to the construction of dedicated user facilities. Two experiments are under construction in the IR, the UCLA Self Amplified Spontaneous Emission experiment and the BNL laser seeded Harmonic Generation experiment. A multi-institution collaboration is being organized about a 210 MeV electron linac available at BNL and the 10 meter tong NISUS wiggler. This experiment will be done in the UV and will test various experimental aspects of electron beam dynamics, FEL exponential regime with gain guiding, start up from noise, seeding and harmonic generation. These experiments will advance the state of FEL research and lead towards future dedicated users' facilities

  8. Theoretical study of the properties of X-ray diffraction moiré fringes. I

    International Nuclear Information System (INIS)

    Yoshimura, Jun-ichi

    2015-01-01

    A detailed and comprehensive theoretical description of X-ray diffraction moiré fringes for a bicrystal specimen is given on the basis of a calculation by plane-wave dynamical diffraction theory, where the effect of the Pendellösung intensity oscillation on the moiré pattern is explained in detail. A detailed and comprehensive theoretical description of X-ray diffraction moiré fringes for a bicrystal specimen is given on the basis of a calculation by plane-wave dynamical diffraction theory. Firstly, prior to discussing the main subject of the paper, a previous article [Yoshimura (1997 ▸). Acta Cryst. A53, 810–812] on the two-dimensionality of diffraction moiré patterns is restated on a thorough calculation of the moiré interference phase. Then, the properties of moiré fringes derived from the above theory are explained for the case of a plane-wave diffraction image, where the significant effect of Pendellösung intensity oscillation on the moiré pattern when the crystal is strained is described in detail with theoretically simulated moiré images. Although such plane-wave moiré images are not widely observed in a nearly pure form, knowledge of their properties is essential for the understanding of diffraction moiré fringes in general

  9. X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase): perdeuteration of proteins for neutron diffraction

    International Nuclear Information System (INIS)

    Blum, Marc-Michael; Tomanicek, Stephen J.; John, Harald; Hanson, B. Leif; Rüterjans, Heinz; Schoenborn, Benno P.; Langan, Paul; Chen, Julian C.-H.

    2010-01-01

    The crystal structure of perdeuterated diisopropyl fluorophosphatase is reported and compared with the hydrogenated structure. Diffraction guidelines for neutron crystallography experiments are summarized. The signal-to-noise ratio is one of the limiting factors in neutron macromolecular crystallography. Protein perdeuteration, which replaces all H atoms with deuterium, is a method of improving the signal-to-noise ratio of neutron crystallography experiments by reducing the incoherent scattering of the hydrogen isotope. Detailed analyses of perdeuterated and hydrogenated structures are necessary in order to evaluate the utility of perdeuterated crystals for neutron diffraction studies. The room-temperature X-ray structure of perdeuterated diisopropyl fluorophosphatase (DFPase) is reported at 2.1 Å resolution. Comparison with an independently refined hydrogenated room-temperature structure of DFPase revealed no major systematic differences, although the crystals of perdeuterated DFPase did not diffract neutrons. The lack of diffraction is examined with respect to data-collection and crystallographic parameters. The diffraction characteristics of successful neutron structure determinations are presented as a guideline for future neutron diffraction studies of macromolecules. X-ray diffraction to beyond 2.0 Å resolution appears to be a strong predictor of successful neutron structures

  10. Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling.

    Science.gov (United States)

    Veluraja, K; Vennila, K N; Umamakeshvari, K; Jasmine, A; Velmurugan, D

    2011-03-25

    The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 Å. The high intense d-spacing signal at 4.22 Å is attributed to the antiparallel β-sheet structure identified in the fraction of the homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 Å reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. High-pressure x-ray diffraction of icosahedral Zr-Al-Ni-Cu-Ag quasicrystals

    DEFF Research Database (Denmark)

    Jiang, Jianzhong; Saksl, Karel; Rasmussen, Helge Kildahl

    2001-01-01

    The effect of pressure on the structural stability of icosahedral Zr-Al-Ni-Cu-Ag quasicrystals forming from a Zr65Al7.5Ni10Cu7.5Ag10 metallic glass with a supercooled liquid region of 44 K has been investigated by in situ high-pressure angle-dispersive x-ray powder diffraction at ambient temperat......The effect of pressure on the structural stability of icosahedral Zr-Al-Ni-Cu-Ag quasicrystals forming from a Zr65Al7.5Ni10Cu7.5Ag10 metallic glass with a supercooled liquid region of 44 K has been investigated by in situ high-pressure angle-dispersive x-ray powder diffraction at ambient...

  12. The biomechanics of amnion rupture: an X-ray diffraction study.

    Directory of Open Access Journals (Sweden)

    Che J Connon

    2007-11-01

    Full Text Available Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

  13. Correlated microradiography, X-ray microbeam diffraction and electron probe microanalysis of calcifications in an odontoma

    International Nuclear Information System (INIS)

    Aoba, T.; Yoshioka, C.; Yagi, T.

    1980-01-01

    Using microradiography, X-ray microbeam diffraction and electron probe microanalysis, a correlated morphologic and crystallographic study was performed on dysplastic enamel in a compound odontoma. The tumor was found in the lateral incisor-canine region of the left mandible of a 36-year-old woman. A conspicuous feature was the presence of hypomineralized areas, which were situated in the proximity of enamel surface and distinctly demarcated from the adjacent enamel. X-ray microbeam diffraction and electron microanalysis showed that these lesions have a lower crystallinity and a higher concentration of magnesium as compared with the adjacent enamel. In addition, the present study revealed the presence of two other types of calcifications: 1) calcified structures within the fissure or on the enamel surface, which include lacunae of varying size and which resemble a form of coronal cementum, and 2) spherical calcifications which may be an epithelial product. (author)

  14. Synchrotron radiation X-ray powder diffraction techniques applied in hydrogen storage materials - A review

    Directory of Open Access Journals (Sweden)

    Honghui Cheng

    2017-02-01

    Full Text Available Synchrotron radiation is an advanced collimated light source with high intensity. It has particular advantages in structural characterization of materials on the atomic or molecular scale. Synchrotron radiation X-ray powder diffraction (SR-XRPD has been successfully exploited to various areas of hydrogen storage materials. In the paper, we will give a brief introduction on hydrogen storage materials, X-ray powder diffraction (XRPD, and synchrotron radiation light source. The applications of ex situ and in situ time-resolved SR-XRPD in hydrogen storage materials, are reviewed in detail. Future trends and proposals in the applications of the advanced XRPD techniques in hydrogen storage materials are also discussed.

  15. Power X-ray diffraction under extreme conditions of pressure and temperature

    International Nuclear Information System (INIS)

    Fiquet, G.; Andrault, D.

    1999-01-01

    An important work has been carried out in the field of X-ray diffraction in obtaining accurate structure information from materials at extreme conditions of pressure and temperature. An experimental set-up combining a diamond-anvil high-pressure cell and a laser-heating technique has been installed at the high-pressure beamline ID30 at the ESRF (Grenoble) to study two major constituents of the Earth's deep interior: MgSiO 3 perovskite and iron. Experiments carried out on MgSiO 3 perovskite up to 86 GPa and over 2000 K yielded detailed structural information on this compound under these conditions and thus important constraints for the lower mantle mineralogical model, favouring a mixture of perovskite and magnesiowuestite. X-ray diffraction patterns recorded on imaging plates with micro-focused monochromatic radiation revealed a new high-temperature structure of iron above 40 GPa. (au)

  16. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    Energy Technology Data Exchange (ETDEWEB)

    Kiyota, Eduardo [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Sousa, Sylvia Morais de [Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Santos, Marcelo Leite dos; Costa Lima, Aline da [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Menossi, Marcelo [Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas-SP (Brazil); Yunes, José Andrés [Laboratório de Biologia Molecular, Centro Infantil Boldrini, Campinas-SP (Brazil); Aparicio, Ricardo, E-mail: aparicio@iqm.unicamp.br [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil)

    2007-11-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.

  17. Edge diffraction effect at the refraction of X rays in a diamond prism

    Science.gov (United States)

    Tur'yanskii, A. G.; Konovalov, O. V.; Gizha, S. S.; Beilin, N. D.

    2014-12-01

    The refraction of monochromatic X-ray radiation in an optically polished diamond prism has been studied. Measurements have been performed on the ID10 channel of the ESRF synchrotron (Grenoble). It has been found that parabolic geometric deviations of the profile of the refractive face of the prism from a plane are responsible for the interference pattern that is similar in the structure of oscillations to an edge diffraction effect. As a result, a diffraction pattern characteristic of the near-field Fresnel zone can be observed in the farfield zone. A high sensitivity to phase perturbations ensures the possibility of using this effect to analyze the parameters of an X-ray wavefront with a dimension of about 1 μm.

  18. Atomic structure of large angle grain boundaries determined by quantitative X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Fitzsimmons, M.R.; Sass, S.L.

    1988-01-01

    Quantitative X-ray diffraction techniques have been used to determine the atomic structure of the Σ = 5 and 13 [001] twist boundaries in Au with a resolution of 0.09 Angstrom or better. The reciprocal lattices of these boundaries were mapped out using synchrotron radiation. The atomic structures were obtained by testing model structures against the intensity observations with a chi square analysis. The boundary structure were modeled using polyhedra, including octahedra, special configurations of tetrahedra and Archimedian anti-prisms, interwoven together by the boundary symmetry. The results of this work point to the possibility of obtaining general rules for grain boundary structure based on X-ray diffraction observations that give the atomic positions with high resolution

  19. Setup for in situ x-ray diffraction study of swift heavy ion irradiated materials.

    Science.gov (United States)

    Kulriya, P K; Singh, F; Tripathi, A; Ahuja, R; Kothari, A; Dutt, R N; Mishra, Y K; Kumar, Amit; Avasthi, D K

    2007-11-01

    An in situ x-ray diffraction (XRD) setup is designed and installed in the materials science beam line of the Pelletron accelerator at the Inter-University Accelerator Centre for in situ studies of phase change in swift heavy ion irradiated materials. A high vacuum chamber with suitable windows for incident and diffracted X-rays is integrated with the goniometer and the beamline. Indigenously made liquid nitrogen (LN2) temperature sample cooling unit is installed. The snapshots of growth of particles with fluence of 90 MeV Ni ions were recorded using in situ XRD experiment, illustrating the potential of this in situ facility. A thin film of C60 was used to test the sample cooling unit. It shows that the phase of the C60 film transforms from a cubic lattice (at room temperature) to a fcc lattice at around T=255 K.

  20. Detectors for X-ray diffraction and scattering: current technology and future challenges

    International Nuclear Information System (INIS)

    Bahr, D.; Brugemann, L.; Gerndt, E.

    2003-01-01

    Full text: Detectors are crucial devices determining the quality, the reliability and the throughput of x-ray diffraction (XRD) and scattering investigations. This is of utmost importance in an industrial environment where in many cases untrained personnel or even without human intervention the experiments and data evaluations are running. The currently used technology of 0-dimensional to 2-dim XRD detectors is presented using selected examples. The application specific requirements on e.g. energy range and resolution, count rate limit, background and dynamic range, and size versus price are discussed. Due to the fact that x-ray diffraction investigations are becoming increasingly attractive in science, research and industry the advance in detector technology is pushed beyond existing limits. The discussion of the resultant market opportunities versus the cost of ownership and market entrance barrier is the final section of the presentation

  1. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    International Nuclear Information System (INIS)

    Kiyota, Eduardo; Sousa, Sylvia Morais de; Santos, Marcelo Leite dos; Costa Lima, Aline da; Menossi, Marcelo; Yunes, José Andrés; Aparicio, Ricardo

    2007-01-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR

  2. Quantitative strain analysis of surfaces and interfaces using extremely asymmetric x-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Akimoto, Koichi [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Emoto, Takashi, E-mail: akimoto@nagoya-u.j [Toyota National College of Technology, Toyota, Aichi 471-8525 (Japan)

    2010-12-01

    Strain can reduce carrier mobility and the reliability of electronic devices and affect the growth mode of thin films and the stability of nanometer-scale crystals. To control lattice strain, a technique for measuring the minute lattice strain at surfaces and interfaces is needed. Recently, an extremely asymmetric x-ray diffraction method has been developed for this purpose. By employing Darwin's dynamical x-ray diffraction theory, quantitative evaluation of strain at surfaces and interfaces becomes possible. In this paper, we review our quantitative strain analysis studies on native SiO{sub 2}/Si interfaces, reconstructed Si surfaces, Ni/Si(111)-H interfaces, sputtered III-V compound semiconductor surfaces, high-k/Si interfaces, and Au ion-implanted Si. (topical review)

  3. Analysis of diatomite sediments from a paleolake in central Mexico using PIXE, X-ray tomography and X-ray diffraction

    Science.gov (United States)

    Miranda, J.; Oliver, A.; Vilaclara, G.; Rico-Montiel, R.; Macías, V. M.; Ruvalcaba, J. L.; Zenteno, M. A.

    1994-03-01

    Diatomite samples from paleolake Tlaxcala, in Central Mexico, have been analyzed using proton induced X-ray emission (PIXE), X-ray tomography and X-ray diffraction. Chiseled blocks were scanned with a 0.7 MeV proton beam, 0.1 mm in diameter, in 0.25 mm steps across the sediments. X-ray tomography with the same step sizes was then applied, in order to compare the concentrations obtained with PIXE and the material density in the sediment layers. Three different kinds of layers were found, related to their colors: dark, white and gray. The composition of the layers is fairly uniform. The dark zone is enriched in Al, K, Ca, Ti, Mn, and Fe. This dark layer may be associated with eruptions of the Malitzin volcano. The white zone is found to contain diatomite of a high purity, with traces of K, Ca, and Fe, while the gray zones are also Al enriched, suggesting a clay contamination of the diatomite. X-ray diffraction of materials obtained from each main layer showed that the white and gray phases are highly amorphous, with a small component of cristobalite, as expected from the diatom sediment diagenesis, while the dark layer contains also important amounts of anorthite and orthoclase, supporting the volcanic origin of this layer.

  4. Crystallographic orientation study of silicon steels using X-ray diffraction, electrons diffraction and the Etch Pit method

    International Nuclear Information System (INIS)

    Santos, Hamilta de Oliveira

    1999-01-01

    The aim of the present study is the microstructural and crystallographic orientation of Fe-3%Si steel. The silicon steel shows good electrical properties and it is used in the nuclear and electrical power fields. The studied steel was supplied by Cia. Acos Especiais Itabira S/A - ACESITA. The material was received in the hot compressed condition, in one or two passes. The hot compressing temperatures used were 900, 1000 and 1100 deg C with soaking times ranging from 32 to 470 s. The material preferential crystallographic orientation was evaluated in every grain of the samples. The characterization techniques used were: scanning electron microscopy (SEM) using the etch pit method; X ray diffraction using the Laue back-reflection method; orientation imaging microscopy (OIM). Microstructural characterization in terms of grain size measurement and mean number of grains in the sample were also undertaken. The Laue method was found an easy technique to access crystallographic orientation of this work polycrystalline samples 2.5 mm average grain size. This was due to the inability to focus the X-rays on a single grain of the material. The scanning electron microscopy showed microcavities left by the etch pit method, which allowed the observation of the crystallographic orientation of each grain from the samples. No conclusive grain crystallographic orientation was possible to obtain by the OIM technique due to the non-existing rolling direction. A more extensive work with the OIM technique must be undertaken on the Fe-3%Si with oriented grains and non oriented grains. (author)

  5. Sample cell for in-field X-ray diffraction experiments

    Directory of Open Access Journals (Sweden)

    Viktor Höglin

    2015-01-01

    Full Text Available A sample cell making it possible to perform synchrotron radiation X-ray powder diffraction experiments in a magnetic field of 0.35 T has been constructed. The device is an add-on to an existing sample cell and contains a strong permanent magnet of NdFeB-type. Experiments have shown that the setup is working satisfactory making it possible to perform in-field measurements.

  6. In situ x-ray diffraction studies of YBa2Cu3Ox

    International Nuclear Information System (INIS)

    Williams, S.; Zheng, J.Q.; Shih, M.C.; Wang, X.K.; Lee, S.J.; Rippert, E.D.; Maglic, S.; Kajiyama, H.; Segel, D.; Dutta, P.; Chang, R.P.H.; Ketterson, J.B.; Roberts, T.; Lin, Y.; Kampwirth, R.T.; Gray, K.

    1992-01-01

    Using a specially designed off-axis faced magnetron sputtering chamber we have performed in situ x-ray diffraction studies of the growth of YBa 2 Cu 3 O x films using a synchrotron light source. The orientation and rocking curve width were studied as a function of substrate temperature, O 2 /Ar partial pressures, and deposition rate. Growth rate was studied on SrTiO 3 , LaAlO 3 , and MgO

  7. Qualitative characterization by x-ray diffraction from soils: mineralogy conditions to benefit the environment

    International Nuclear Information System (INIS)

    Fujiyama, Bruna Sayuri; Tavares, Mauricio de Moraes

    2010-01-01

    Four samples were collected from four soil profiles located in the Rural Federal University of Amazonia. These, were analyzed parameters such as color, texture, consistency, granulometry, porosity and water absorption. We identified the following soil types: Distrofic Yellow Latosoil; Lateritic Concretionary; distrofic Low Humic Gley. The work was to continue the qualitative analysis by X-rays diffraction, identifying the mineralogical composition of each sample. Explaining the mineralogical conditions that affect or benefit the environment. (author)

  8. Sparse recovery of undersampled intensity patterns for coherent diffraction imaging at high X-ray energies

    OpenAIRE

    Maddali, Siddharth; Calvo-Almazan, Irene; Almer, Jonathan; Kenesei, Peter; Park, Jun-Sang; Harder, Ross; Nashed, Youssef; Hruszkewycz, Stephan

    2017-01-01

    Coherent X-ray photons with energies higher than 50 keV offer new possibilities for imaging nanoscale lattice distortions in bulk crystalline materials using Bragg peak phase retrieval methods. However, the compression of reciprocal space at high energies typically results in poorly resolved fringes on an area detector, rendering the diffraction data unsuitable for the three-dimensional reconstruction of compact crystals. To address this problem, we propose a method by which to recover fine f...

  9. Time and space domain separation of pulsed X-ray beams diffracted from vibrating crystals

    Energy Technology Data Exchange (ETDEWEB)

    Nosik, V. L., E-mail: v-nosik@yandex.ru, E-mail: nosik@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography, Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)

    2016-11-15

    It is known that a set of additional reflections (satellites) may arise on rocking curves in the case of X-ray diffraction in the Bragg geometry from crystals where high-frequency ultrasonic vibrations are excited. It is shown that, under certain conditions, the pulse wave fields of the satellites and main reflection may be intersected in space (playing the role of pump and probe beams) and in time (forming interference superlattices).

  10. X-ray diffraction studies of red tomato nuclease TBN1

    Czech Academy of Sciences Publication Activity Database

    Kovaľ, Tomáš; Dohnálek, Jan; Lipovová, P.; Podzimek, T.; Matoušek, Jaroslav; Dušková, Jarmila; Skálová, Tereza; Štěpánková, Andrea; Kolenko, Petr; Hašek, Jindřich

    2010-01-01

    Roč. 17, 1a (2010), b40 ISSN 1211-5894. [Discussions in Structural Molecular Biology /8./. 18.03.2010-20.03.2010, Nové Hrady] R&D Projects: GA ČR GA202/06/0757 Institutional research plan: CEZ:AV0Z10100521; CEZ:AV0Z40500505 Keywords : plant bifunctional nuclease * crystallization * x-ray diffraction analysis Subject RIV: BM - Solid Matter Physics ; Magnetism

  11. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    Directory of Open Access Journals (Sweden)

    M. S. Conconi

    2014-12-01

    Full Text Available The firing transformations of traditional (clay based ceramics are of technological and archeological interest, and are usually reported qualitatively or semiquantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite, the low crystalline (metakaolinite and/or spinel type pre-mullite and glassy phases evolution of a triaxial (clay-quartz-feldspar ceramic fired in a wide temperature range between 900 and 1300 ºC. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 ºC spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and

  12. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    Energy Technology Data Exchange (ETDEWEB)

    Conconi, M.S.; Gauna, M.R.; Serra, M.F. [Centro de Tecnologia de Recursos Minerales y Ceramica (CETMIC), Buenos Aires (Argentina); Suarez, G.; Aglietti, E.F.; Rendtorff, N.M., E-mail: rendtorff@cetmic.unlp.edu.ar [Universidad Nacional de La Plata (UNLP), Buenos Aires (Argentina). Fac. de Ciencias Exactas. Dept. de Quimica

    2014-10-15

    The firing transformations of traditional (clay based) ceramics are of technological and archaeological interest, and are usually reported qualitatively or semi quantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite), the low crystalline (metakaolinite and/or spinel type pre-mullite) and glassy phases evolution of a triaxial (clay-quartz-feldspar) ceramic fired in a wide temperature range between 900 and 1300 deg C. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 deg C) spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy) phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and materials

  13. Drug design based on x-ray diffraction and steered molecular dynamics

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jindřich; Skálová, Tereza; Dohnálek, Jan; Dušková, Jarmila; Petroková, Hana; Vondráčková, Eva; Zimmermann, K.

    2005-01-01

    Roč. 12, č. 3 (2005), s. 208-210 ISSN 1211-5894. [VUFB Conference on Modern Methods in Synthesis and Analysis of Active Pharmaceutical Substances /5./. Praha, 23.11.2005-24.11.2005] R&D Projects: GA AV ČR KJB4050312 Institutional research plan: CEZ:AV0Z40500505 Keywords : drug design * X-ray diffraction * steered molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Qualitative mineralogical characterization of the sinter by X-ray diffraction

    International Nuclear Information System (INIS)

    Greca, M.C.; Pietroluongo, L.R.V.; Baliza, S.V.; Costa Pereira, E.A. da

    1987-01-01

    This paper aims the qualitative mineralogical characterization of sinters and raw materials employed on its fabrication, via X-ray diffraction technique. Thus, sample with constant coke breeze content and variable contents of sand, limestone, dunite and dolomite were prepared to obtain current sinter compositions, with variable basicity. The tests were performed at the research of the following institutions: Companhia Siderurgica Nacional, Centro de Tecnologia Mineral and Instituto Nacional de Tecnologia. (author) [pt

  15. Exploring the nanoworld in real and reciprocal space. Part 1 x-ray and electron diffractions

    International Nuclear Information System (INIS)

    Ng Inn Khuan; Kok Kuan Ying

    2003-01-01

    The articles highlight two of the main characterization techniques that are widely used in materials characterization laboratories, namely, X-ray Diffractometry (XRD) and Transmission Electron Microscopy (TEM). Part 1 of the article focuses on the diffraction while part 2 on imaging aspects of these techniques. The theoretical background for each technique is briefly covered and examples are given to illustrate the use of the techniques in solving some materials-related problem, particularly, for nanostructured systems. (Author)

  16. GaN quantum dot polarity determination by X-ray photoelectron diffraction

    Czech Academy of Sciences Publication Activity Database

    Romanyuk, Olexandr; Bartoš, Igor; Brault, J.; De Mierry, P.; Paskova, T.; Jiříček, Petr

    2016-01-01

    Roč. 389, Dec (2016), s. 1156-1160 ISSN 0169-4332 R&D Projects: GA ČR GA15-01687S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : GaN * semipolar GaN * quantum dots * X-ray photoelectron diffraction * surface polarity Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.387, year: 2016

  17. Diamond Thermal Expansion Measurement Using Transmitted X-ray Back-diffraction.

    OpenAIRE

    Giles, Carlos; Adriano, Cris; Lubambo, Adriana Freire; Cusatis, Cesar; Mazzaro, Irineu; Hönnicke, Marcelo Goncalves

    2015-01-01

    The linear thermal expansion coefficient of diamond has been measured using forward-diffracted profiles in X-ray backscattering. This experimental technique is presented as an alternative way of measuring thermal expansion coefficients of solids in the high-resolution Bragg backscattering geometry without the intrinsic difficulty of detecting the reflected beam. The temperature dependence of the lattice parameter is obtained from the high sensitivity of the transmitted profiles to the Bragg a...

  18. Calculated powder x-ray diffraction data for three tantalum tungstates

    International Nuclear Information System (INIS)

    Holcombe, C.E. Jr.

    1976-11-01

    A study was made of computer-simulated powder x-ray diffraction data for Ta 22 W 4 O 67 , Ta 2 WO 8 , and Ta 16 W 18 O 94 --the three compounds in the Ta 2 O 5 --WO 3 system from 27 to 69 mole percent WO 3 . The crystal structures of Ta 2 WO 8 and one form of Ta 16 W 18 O 94 (Type B) were deduced from reported data. 8 tables

  19. X-ray diffraction study of elemental erbium to 70 GPa

    International Nuclear Information System (INIS)

    Pravica, Michael G.; Romano, Edward; Quine, Zachary

    2005-01-01

    We have investigated phase transitions in elemental erbium in a diamond anvil cell (DAC) up to 70 GPa using angular-dispersive x-ray powder diffraction methods. We present evidence of a series of phase transitions that appear to follow the anticipated hcp→Sm-type→double hcp (dhcp)→distorted fcc sequence. In particular, we present evidence for the predicted dhcp→distorted fcc transition above 63 GPa. Equation of state data are also presented up to 70 GPa

  20. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    International Nuclear Information System (INIS)

    Conconi, M.S.; Gauna, M.R.; Serra, M.F.; Suarez, G.; Aglietti, E.F.; Rendtorff, N.M.

    2014-01-01

    The firing transformations of traditional (clay based) ceramics are of technological and archaeological interest, and are usually reported qualitatively or semi quantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite), the low crystalline (metakaolinite and/or spinel type pre-mullite) and glassy phases evolution of a triaxial (clay-quartz-feldspar) ceramic fired in a wide temperature range between 900 and 1300 deg C. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 deg C) spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy) phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and materials