
Sample records for single strand rna

  1. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.


    Furfine, E S; White, T C; Wang, A L; Wang, C C


    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  2. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids. (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R


    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  3. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth


    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  4. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples. (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J


    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  5. Understanding the similarity in thermophoresis between single- and double-stranded DNA or RNA (United States)

    Reichl, Maren; Herzog, Mario; Greiss, Ferdinand; Wolff, Manuel; Braun, Dieter


    Thermophoresis is the movement of molecules in a temperature gradient. For aqueous solutions its microscopic basis is debated. Understanding thermophoresis for this case is, however, important since it proved very useful to detect the binding affinity of biomolecules and since thermophoresis could have played an important role in early molecular evolution. Here we discuss why the thermophoresis of single- and double-stranded oligonucleotides - DNA and RNA - is surprisingly similar. This finding is understood by comparing the spherical capacitor model for single-stranded species with the case of a rod-shaped model for double-stranded oligonucleotides. The approach describes thermophoresis of DNA and RNA with fitted effective charges consistent with electrophoresis measurements and explains the similarity between single- and double-stranded species. We could not confirm the sign change for the thermophoresis of single- versus double-stranded DNA in crowded solutions containing polyethylene glycol [Y. T. Maeda, T. Tlusty, and A. Libchaber, Proc. Natl. Acad. Sci. USA 109, 17972 (2012), 10.1073/pnas.1215764109], but find a salt-independent offset while the Debye length dependence still satisfies the capacitor model. Overall, the analysis documents the continuous progress in the microscopic understanding of thermophoresis.

  6. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana


    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  7. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.


    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  8. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M


    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  9. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism. (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol


    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  10. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  11. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  12. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus. (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao


    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  13. Role of electrostatics in the assembly pathway of a single-stranded RNA virus. (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  14. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  15. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin. (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  16. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes. (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian


    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  17. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager


    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  18. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses. (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn


    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  19. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities. (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C


    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  20. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.


    Esteban, R; Fujimura, T; Wickner, R B


    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  1. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  2. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends (United States)


    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  3. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.


    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  4. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)


    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  5. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime


    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  6. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.


    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  7. Differentially expressed genes from RNA-Seq and functional enrichment results are affected by the choice of single-end versus paired-end reads and stranded versus non-stranded protocols. (United States)

    Corley, Susan M; MacKenzie, Karen L; Beverdam, Annemiek; Roddam, Louise F; Wilkins, Marc R


    RNA-Seq is now widely used as a research tool. Choices must be made whether to use paired-end (PE) or single-end (SE) sequencing, and whether to use strand-specific or non-specific (NS) library preparation kits. To date there has been no analysis of the effect of these choices on identifying differentially expressed genes (DEGs) between controls and treated samples and on downstream functional analysis. We undertook four mammalian transcriptomics experiments to compare the effect of SE and PE protocols on read mapping, feature counting, identification of DEGs and functional analysis. For three of these experiments we also compared a non-stranded (NS) and a strand-specific approach to mapping the paired-end data. SE mapping resulted in a reduced number of reads mapped to features, in all four experiments, and lower read count per gene. Up to 4.3% of genes in the SE data and up to 12.3% of genes in the NS data had read counts which were significantly different compared to the PE data. Comparison of DEGs showed the presence of false positives (average 5%, using voom) and false negatives (average 5%, using voom) using the SE reads. These increased further, by one or two percentage points, with the NS data. Gene ontology functional enrichment (GO) of the DEGs arising from SE or NS approaches, revealed striking differences in the top 20 GO terms, with as little as 40% concordance with PE results. Caution is therefore advised in the interpretation of such results. By comparison, there was overall consistency in gene set enrichment analysis results. A strand-specific protocol should be used in library preparation to generate the most reliable and accurate profile of expression. Ideally PE reads are also recommended particularly for transcriptome assembly. Whilst SE reads produce a DEG list with around 5% of false positives and false negatives, this method can substantially reduce sequencing cost and this saving could be used to increase the number of biological replicates

  8. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae) (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  9. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.


    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  10. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola. (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da


    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  11. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine


    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA)...

  12. Template role of double-stranded RNA in tombusvirus replication. (United States)

    Kovalev, Nikolay; Pogany, Judit; Nagy, Peter D


    Replication of plus-strand RNA [(+)RNA] viruses of plants is a relatively simple process that involves complementary minus-strand RNA [(-)RNA] synthesis and subsequent (+)RNA synthesis. However, the actual replicative form of the (-)RNA template in the case of plant (+)RNA viruses is not yet established unambiguously. In this paper, using a cell-free replication assay supporting a full cycle of viral replication, we show that replication of Tomato bushy stunt virus (TBSV) leads to the formation of double-stranded RNA (dsRNA). Using RNase digestion, DNAzyme, and RNA mobility shift assays, we demonstrate the absence of naked (-)RNA templates during replication. Time course experiments showed the rapid appearance of dsRNA earlier than the bulk production of new (+)RNAs, suggesting an active role for dsRNA in replication. Radioactive nucleotide chase experiments showed that the mechanism of TBSV replication involves the use of dsRNA templates in strand displacement reactions, where the newly synthesized plus strand replaces the original (+)RNA in the dsRNA. We propose that the use of dsRNA as a template for (+)RNA synthesis by the viral replicase is facilitated by recruited host DEAD box helicases and the viral p33 RNA chaperone protein. Altogether, this replication strategy allows TBSV to separate minus- and plus-strand syntheses in time and regulate asymmetrical RNA replication that leads to abundant (+)RNA progeny. Positive-stranded RNA viruses of plants use their RNAs as the templates for replication. First, the minus strand is synthesized by the viral replicase complex (VRC), which then serves as a template for new plus-strand synthesis. To characterize the nature of the (-)RNA in the membrane-bound viral replicase, we performed complete RNA replication of Tomato bushy stunt virus (TBSV) in yeast cell-free extracts and in plant extracts. The experiments demonstrated that the TBSV (-)RNA is present as a double-stranded RNA that serves as the template for TBSV

  13. Double-Stranded RNA Is Detected by Immunofluorescence Analysis in RNA and DNA Virus Infections, Including Those by Negative-Stranded RNA Viruses. (United States)

    Son, Kyung-No; Liang, Zhiguo; Lipton, Howard L


    Early biochemical studies of viral replication suggested that most viruses produce double-stranded RNA (dsRNA), which is essential for the induction of the host immune response. However, it was reported in 2006 that dsRNA could be detected by immunofluorescence antibody staining in double-stranded DNA and positive-strand RNA virus infections but not in negative-strand RNA virus infections. Other reports in the literature seemed to support these observations. This suggested that negative-strand RNA viruses produce little, if any, dsRNA or that more efficient viral countermeasures to mask dsRNA are mounted. Because of our interest in the use of dsRNA antibodies for virus discovery, particularly in pathological specimens, we wanted to determine how universal immunostaining for dsRNA might be in animal virus infections. We have detected the in situ formation of dsRNA in cells infected with vesicular stomatitis virus, measles virus, influenza A virus, and Nyamanini virus, which represent viruses from different negative-strand RNA virus families. dsRNA was also detected in cells infected with lymphocytic choriomeningitis virus, an ambisense RNA virus, and minute virus of mice (MVM), a single-stranded DNA (ssDNA) parvovirus, but not hepatitis B virus. Although dsRNA staining was primarily observed in the cytoplasm, it was also seen in the nucleus of cells infected with influenza A virus, Nyamanini virus, and MVM. Thus, it is likely that most animal virus infections produce dsRNA species that can be detected by immunofluorescence staining. The apoptosis induced in several uninfected cell lines failed to upregulate dsRNA formation. An effective antiviral host immune response depends on recognition of viral invasion and an intact innate immune system as a first line of defense. Double-stranded RNA (dsRNA) is a viral product essential for the induction of innate immunity, leading to the production of type I interferons (IFNs) and the activation of hundreds of IFN

  14. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)


    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  15. Programmable autonomous synthesis of single-stranded DNA (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng


    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  16. Infectious bursal disease virus capsid protein VP3 interacts both with VP1, the RNA-dependent RNA polymerase and with viral double-stranded RNA

    NARCIS (Netherlands)

    Tacken, M.G.J.; Peeters, B.P.H.; Thomas, A.A.M.; Rottier, P.J.M.; Boot, H.J.


    Infectious bursal disease virus (IBDV) is a double-stranded RNA (dsRNA) virus of the Birnaviridae family. Its two genome segments are encapsidated together with multiple copies of the viral RNA-dependent RNA polymerase, VP1, in a single-shell capsid that is composed of VP2 and VP3. In this study we

  17. Guide Strand 3'-End Modifications Regulate siRNA Specificity. (United States)

    Valenzuela, Rachel A P; Onizuka, Kazumitsu; Ball-Jones, Alexi A; Hu, Tiannan; Suter, Scott R; Beal, Peter A


    Short interfering RNA (siRNA)-triggered gene knockdown through the RNA interference (RNAi) pathway is widely used to study gene function, and siRNA-based therapeutics are in development. However, as the guide strand of an siRNA can function like a natural microRNA (miRNA), siRNAs often repress hundreds of off-target transcripts with complementarity only to the seed region (nucleotides 2-8) of the guide strand. Here, we describe novel guide strand 3'-end modifications derived from 1-ethynylribose (1-ER) and copper-catalyzed azide-alkyne cycloaddition reactions and evaluate their impact on target versus miRNA-like off-target knockdown. Surprisingly, when positioned at the guide strand 3'-end, the parent 1-ER modification substantially reduced off-target knockdown while having no measurable effect on on-target knockdown potency. In addition, these modifications were shown to modulate siRNA affinity for the hAgo2 PAZ domain. However, the change in PAZ domain binding affinity was not sufficient to predict the modification's effect on miRNA-like off targeting. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Viral counterdefense on RNA silencing : analysis of RNA silencing suppressors from arthropod-borne negative strand RNA plant viruses

    NARCIS (Netherlands)

    Schnettler, E.


    This thesis describes that RNA silencing suppressor (RSS) proteins encoded by negative-stranded RNA plant viruses are able to interfere with different RNA silencing pathways in a variety of organisms by interacting with double stranded (ds)RNA molecules. These RSS proteins are able to counteract the

  19. Accurate strand-specific quantification of viral RNA.

    Directory of Open Access Journals (Sweden)

    Nicole E Plaskon

    Full Text Available The presence of full-length complements of viral genomic RNA is a hallmark of RNA virus replication within an infected cell. As such, methods for detecting and measuring specific strands of viral RNA in infected cells and tissues are important in the study of RNA viruses. Strand-specific quantitative real-time PCR (ssqPCR assays are increasingly being used for this purpose, but the accuracy of these assays depends on the assumption that the amount of cDNA measured during the quantitative PCR (qPCR step accurately reflects amounts of a specific viral RNA strand present in the RT reaction. To specifically test this assumption, we developed multiple ssqPCR assays for the positive-strand RNA virus o'nyong-nyong (ONNV that were based upon the most prevalent ssqPCR assay design types in the literature. We then compared various parameters of the ONNV-specific assays. We found that an assay employing standard unmodified virus-specific primers failed to discern the difference between cDNAs generated from virus specific primers and those generated through false priming. Further, we were unable to accurately measure levels of ONNV (- strand RNA with this assay when higher levels of cDNA generated from the (+ strand were present. Taken together, these results suggest that assays of this type do not accurately quantify levels of the anti-genomic strand present during RNA virus infectious cycles. However, an assay permitting the use of a tag-specific primer was able to distinguish cDNAs transcribed from ONNV (- strand RNA from other cDNAs present, thus allowing accurate quantification of the anti-genomic strand. We also report the sensitivities of two different detection strategies and chemistries, SYBR(R Green and DNA hydrolysis probes, used with our tagged ONNV-specific ssqPCR assays. Finally, we describe development, design and validation of ssqPCR assays for chikungunya virus (CHIKV, the recent cause of large outbreaks of disease in the Indian Ocean

  20. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)


    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  1. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA. (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A


    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  2. Analysis of Double-Stranded RNA from Microbial Communities Identifies Double-Stranded RNA Virus-like Elements


    Decker, Carolyn J.; Parker, Roy


    Double-stranded RNA (dsRNA) can function as genetic information and may have served as genomic material before the existence of DNA-based life. By developing a method to purify dsRNA, we have investigated the diversity of dsRNA in microbial populations. We detect large dsRNAs in multiple microbial populations. Analysis of an aquatic microbial population reveals that some dsRNA sequences match metagenomic DNA, suggesting that microbes contain pools of sense-antisense transcripts. In addition, ...

  3. Infectious Bursal disease virus: ribonucleoprotein complexes of a double-stranded RNA virus. (United States)

    Luque, Daniel; Saugar, Irene; Rejas, María Teresa; Carrascosa, José L; Rodríguez, José F; Castón, José R


    Genome-binding proteins with scaffolding and/or regulatory functions are common in living organisms and include histones in eukaryotic cells, histone-like proteins in some double-stranded DNA (dsDNA) viruses, and the nucleocapsid proteins of single-stranded RNA viruses. dsRNA viruses nevertheless lack these ribonucleoprotein (RNP) complexes and are characterized by sharing an icosahedral T=2 core involved in the metabolism and insulation of the dsRNA genome. The birnaviruses, with a bipartite dsRNA genome, constitute a well-established exception and have a single-shelled T=13 capsid only. Moreover, as in many negative single-stranded RNA viruses, the genomic dsRNA is bound to a nucleocapsid protein (VP3) and the RNA-dependent RNA polymerase (VPg). We used electron microscopy and functional analysis to characterize these RNP complexes of infectious bursal disease virus, the best characterized member of the Birnaviridae family. Mild disruption of viral particles revealed that VP3, the most abundant core protein, present at approximately 450 copies per virion, is found in filamentous material tightly associated with the dsRNA. We developed a method to purify RNP and VPg-dsRNA complexes. Analysis of these complexes showed that they are linear molecules containing a constant amount of protein. Sensitivity assays to nucleases indicated that VP3 renders the genomic dsRNA less accessible for RNase III without introducing genome compaction. Additionally, we found that these RNP complexes are functionally competent for RNA synthesis in a capsid-independent manner, in contrast to most dsRNA viruses.

  4. Human DNA polymerase η accommodates RNA for strand extension. (United States)

    Su, Yan; Egli, Martin; Guengerich, F Peter


    Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase α, telomerase, and the mitochondrial human DNA polymerase (hpol) γ have been shown to tolerate an entire RNA strand. Y-family hpol η is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol η is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol η, as well as another Y-family DNA polymerase, hpol κ, accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions, such as 8-oxo-2'-deoxyguanosine or cyclobutane pyrimidine dimer, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA-accommodating ability of hpol η redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol η in vivo . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. RNA-directed repair of DNA double-strand breaks. (United States)

    Yang, Yun-Gui; Qi, Yijun


    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits (United States)

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  7. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block. (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P


    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  8. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.


    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  9. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang


    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  10. Design and Assessment of a Real Time Reverse Transcription-PCR Method to Genotype Single-Stranded RNA Male-Specific Coliphages (Family Leviviridae). (United States)

    A real-time, reverse transcription-PCR (RT-qPCR) assay was developed to differentiate the four genogroups of male-specific ssRNA coliphages (FRNA) (family Leviviridae). As FRNA display a trend of source-specificity (human sewage or animal waste) at the genogroup level, this assa...

  11. Herpetic keratoconjunctivitis: Therapy with synthetic double-stranded RNA (United States)

    Friedman, I.; Evans, C.; Meighan, C.W.; Foote, L.J.; Aiello, P.V.; Park, J.H.; Baron, S.


    A study was undertaken in rabbits to determine how late in the course of keratoconjunctivitis caused by herpes simplex recovery could be effected by an inducer of interferon. Interferon was induced by means of synthetic double-stranded RNA copolymer formed with polynosinic acid : polycytidilic acid RNA. Therapy promotes recovery from severe and fully established keratoconjunctivitis for which treatment was begun as late as 3 days after virus inoculation. No drug toxicity was observed in the therapeutic dose range. These findings further support the proposed role of the interferon mechanism in the natural recovery of already established viral infection. They also suggest the usefulness of interferon inducers in viral infections of man.

  12. Analysis of double-stranded RNA from microbial communities identifies double-stranded RNA virus-like elements. (United States)

    Decker, Carolyn J; Parker, Roy


    Double-stranded RNA (dsRNA) can function as genetic information and may have served as genomic material before the existence of DNA-based life. By developing a method to purify dsRNA, we have investigated the diversity of dsRNA in microbial populations. We detect large dsRNAs in multiple microbial populations. Analysis of an aquatic microbial population reveals that some dsRNA sequences match metagenomic DNA, suggesting that microbes contain pools of sense-antisense transcripts. In addition, ∼30% of the dsRNA sequences are not present in the corresponding DNA pool and are strongly biased toward encoding novel proteins. Of these "dsRNA unique" sequences, only a small percentage share similarity to known viruses, a large fraction assemble into RNA virus-like contigs, and the remaining fraction has an unexplained origin. These results have uncovered dsRNA virus-like elements and underscore that dsRNA potentially represents an additional reservoir of genetic information in microbial populations. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Hepatitis C virus double-stranded RNA is the predominant form in human liver and in interferon-treated cells. (United States)

    Klepper, Arielle; Eng, Francis J; Doyle, Erin H; El-Shamy, Ahmed; Rahman, Adeeb H; Fiel, M Isabel; Avino, Gonzalo Carrasco; Lee, Moonju; Ye, Fei; Roayaie, Sasan; Bansal, Meena B; MacDonald, Margaret R; Schiano, Thomas D; Branch, Andrea D


    Hepatitis C virus (HCV) is unique among RNA viruses in its ability to establish chronic infection in the majority of exposed adults. HCV persists in the liver despite interferon (IFN)-stimulated gene (ISG) induction; robust induction actually predicts treatment failure and viral persistence. It is unclear which forms of HCV RNA are associated with ISG induction and IFN resistance during natural infections. To thoroughly delineate HCV RNA populations, we developed conditions that fully separate the strands of long double-stranded RNA (dsRNA) and allow the released RNAs to be quantified in reverse transcription/polymerase chain reaction assays. These methods revealed that dsRNA, a pathogen-associated molecular pattern (PAMP), comprised 52% (standard deviation, 28%) of the HCV RNA in the livers of patients with chronic infection. HCV dsRNA was proportionally higher in patients with the unfavorable IL28B TT (rs12979860) genotype. Higher ratios of HCV double-stranded to single-stranded RNA (ssRNA) correlated positively with ISG induction. In Huh-7.5 cells, IFN treatment increased the total amount of HCV dsRNA through a process that required de novo viral RNA synthesis and shifted the ratio of viral dsRNA/ssRNA in favor of dsRNA. This shift was blocked by ribavirin (RBV), an antiviral drug that reduces relapse in HCV patients. Northern blotting established that HCV dsRNA contained genome-length minus strands. HCV dsRNA is the predominant form in the HCV-infected liver and has features of both a PAMP and a genomic reservoir. Interferon treatment increased rather than decreased HCV dsRNA. This unexpected finding suggests that HCV produces dsRNA in response to IFN, potentially to antagonize antiviral defenses. (Hepatology 2017;66:357-370). © 2016 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

  14. Nuclear proteins hijacked by mammalian cytoplasmic plus strand RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Lloyd, Richard E., E-mail:


    Plus strand RNA viruses that replicate in the cytoplasm face challenges in supporting the numerous biosynthetic functions required for replication and propagation. Most of these viruses are genetically simple and rely heavily on co-opting cellular proteins, particularly cellular RNA-binding proteins, into new roles for support of virus infection at the level of virus-specific translation, and building RNA replication complexes. In the course of infectious cycles many nuclear-cytoplasmic shuttling proteins of mostly nuclear distribution are detained in the cytoplasm by viruses and re-purposed for their own gain. Many mammalian viruses hijack a common group of the same factors. This review summarizes recent gains in our knowledge of how cytoplasmic RNA viruses use these co-opted host nuclear factors in new functional roles supporting virus translation and virus RNA replication and common themes employed between different virus groups. - Highlights: • Nuclear shuttling host proteins are commonly hijacked by RNA viruses to support replication. • A limited group of ubiquitous RNA binding proteins are commonly hijacked by a broad range of viruses. • Key virus proteins alter roles of RNA binding proteins in different stages of virus replication.

  15. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias


    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Assembly of large icosahedral double-stranded RNA viruses. (United States)

    Poranen, Minna M; Bamford, Dennis H


    Double-stranded RNA (dsRNA) viruses are a diverse group of viruses infecting hosts from bacteria to higher eukaryotes. Among the hosts are humans, domestic animals, and economically important plant species. Fine details of high-resolution virion structures have revealed common structural characteristics unique to these viruses including an internal icosahedral capsid built from 60 asymmetric dimers (120 monomers!) of the major coat protein. Here we focus mainly on the structures and assembly principles of large icosahedral dsRNA viruses belonging to the families of Cystoviridae and Reoviridae. It is obvious that there are a variety of assembly pathways utilized by different viruses starting from similar building blocks and reaching in all cases a similar capsid architecture. This is true even with closely related viruses indicating that the assembly pathway per se is not an indicator of relatedness and is achieved with minor changes in the interacting components.

  17. Complex shapes self-assembled from single-stranded DNA tiles. (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng


    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  18. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ (United States)

    Gray, J.W.; Pinkel, D.


    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  19. [Diverse double-stranded RNA viruses infecting fungi]. (United States)

    Chiba, Sotaro; Suzuki, Nobuhiro


    Most of reported fungal viruses (mycoviruses) have double-stranded RNA (dsRNA) genomes. This may reflect the simple, easy method for mycovirus hunting that entails detection of dsRNAs as a sign of viral infections. There are an increasing number of screens of various fungi, particularly phytopathogenic fungi for viruses pathogenic to host fungi or able to confer hypovirulence to them. This bases on an attractive research field of biological control of fungal plant diseases using viruses (virocontrol), mainly targeting important phytopathogenic fungi. While isolated viruses usually induce asymptomatic symptoms, they show a considerably high level of diversity. As of 2014, fungal dsRNA viruses are classified into six families: Reoviridae, Totiviridae, Chrysoviridae, Partitiviridae, Megabirnaviridae and Quadriviridae. These exclude unassigned mycoviruses which will definitely be placed into distinct families and/or genera. In this review article, dsRNA viruses isolated from the kingdom Fungi including as-yet-unclassified taxa are overviewed. Some recent achievements in the related field are briefly introduced as well.

  20. Global organization of a positive-strand RNA virus genome.

    Directory of Open Access Journals (Sweden)

    Baodong Wu

    Full Text Available The genomes of plus-strand RNA viruses contain many regulatory sequences and structures that direct different viral processes. The traditional view of these RNA elements are as local structures present in non-coding regions. However, this view is changing due to the discovery of regulatory elements in coding regions and functional long-range intra-genomic base pairing interactions. The ∼4.8 kb long RNA genome of the tombusvirus tomato bushy stunt virus (TBSV contains these types of structural features, including six different functional long-distance interactions. We hypothesized that to achieve these multiple interactions this viral genome must utilize a large-scale organizational strategy and, accordingly, we sought to assess the global conformation of the entire TBSV genome. Atomic force micrographs of the genome indicated a mostly condensed structure composed of interconnected protrusions extending from a central hub. This configuration was consistent with the genomic secondary structure model generated using high-throughput selective 2'-hydroxyl acylation analysed by primer extension (i.e. SHAPE, which predicted different sized RNA domains originating from a central region. Known RNA elements were identified in both domain and inter-domain regions, and novel structural features were predicted and functionally confirmed. Interestingly, only two of the six long-range interactions known to form were present in the structural model. However, for those interactions that did not form, complementary partner sequences were positioned relatively close to each other in the structure, suggesting that the secondary structure level of viral genome structure could provide a basic scaffold for the formation of different long-range interactions. The higher-order structural model for the TBSV RNA genome provides a snapshot of the complex framework that allows multiple functional components to operate in concert within a confined context.

  1. Human Ku70 protein binds hairpin RNA and double stranded DNA through two different sites. (United States)

    Anisenko, Andrey N; Knyazhanskaya, Ekaterina S; Zatsepin, Timofey S; Gottikh, Marina B


    Human protein Ku usually functions in the cell as a complex of two subunits, Ku70 and Ku80. The Ku heterodimer plays a key role in the non-homologous end joining DNA repair pathway by specifically recognizing the DNA ends at the site of the lesion. The binding of the Ku heterodimer to DNA has been well-studied, and its interactions with RNA have been also described. However, Ku70 subunit is known to have independent DNA binding capability, which is less characterized. RNA binding properties of Ku70 have not been yet specially studied. We have prepared recombinant full-length Ku70 and a set of its truncated mutants in E. coli, and studied their interactions with nucleic acids of various structures: linear single- and double-stranded DNA and RNA, as well as closed circular DNA and hairpin RNA. Ku70 has demonstrated a high affinity binding to double stranded DNA and hairpin RNA with a certain structure only. Interestingly, in contrast to the Ku heterodimer, Ku70 is found to interact with closed circular DNA. We also show for the first time that Ku70 employs two different sites for DNA and RNA binding. The double-stranded DNA is recognized by the C-terminal part of Ku70 including SAP domain as it has been earlier demonstrated, whereas hairpin RNA binding is provided by amino acids 251-438. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  2. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela


    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  3. Double-stranded DNA dissociates into single strands when dragged into a poor solvent. (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E


    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  4. Probing electronic coupling between adenine bases in RNA strands from synchrotron radiation circular dichroism experiments

    DEFF Research Database (Denmark)

    Nielsen, Lisbeth Munksgård; Hoffmann, Søren Vrønning; Nielsen, Steen Brøndsted


    Circular dichroism spectra (176–330 nm) of RNA adenine oligomers, (rA)n (n = 1–10, 12, 15, and 20), reveal electronic coupling between two bases in short strands. The number of interacting bases in long strands is more and larger than that reported previously for the corresponding DNA strands....

  5. Characterization of a novel double-stranded RNA mycovirus conferring hypovirulence from the phytopathogenic fungus Botryosphaeria dothidea. (United States)

    Zhai, Lifeng; Xiang, Jun; Zhang, Meixin; Fu, Min; Yang, Zuokun; Hong, Ni; Wang, Guoping


    A novel double-stranded RNA (dsRNA) virus, designated as Botryosphaeria dothidea RNA virus 1 (BdRV1), isolated from a hypovirulent strain YZN115 of Botryosphaeria dothidea was biologically and molecularly characterized. The genome of BdRV1 comprises of five dsRNAs. Each dsRNA contains a single open reading frame. The proteins encoded by dsRNA1-4 shared significant amino acid identities of 55%, 47%, 43% and 53% with the corresponding proteins of Aspergillus fumigatus tetramycovirus-1. DsRNA1, 3, and 4 of BdRV1 encoded an RNA-dependent RNA polymerase, a viral methyltransferase, and a P-A-S-rich protein, respectively. Function of proteins encoded by the dsRNA2 and dsRNA5 were unknown. BdRV1 conferred hypovirulence for its host and could be transmitted through conidia and hyphae contact. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries. (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan


    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  7. Targeting the MicroRNA Passenger Strand for Regulating Therapeutic Transgenes. (United States)

    Kim, Sung Jin; Lee, Chang Ho; Lee, Seong-Wook


    Gene therapy strategies have been developed, which can tissue or disease specifically regulate expression of exogenous transgenes by means of endogenous microRNA (miRNA) activity. However, the use of an endogenous guide strand to regulate an exogenous transgene could affect expression of endogenous miRNA target genes. In this study, we developed a new regulatory system of exogenous transgene expression by targeting the passenger strand. We constructed reporter constructs harboring miRNA-122 guide or passenger target sites with perfect or imperfect complementarity. We observed downregulation of an exogenous transgene harboring the miRNA-122 target sites against either the guide or passenger strand in cells expressing the cognate miRNA or cells stably expressing the miRNA target site. Moreover, the transgene activity as well as the gene expression level increased specifically by intracellular introduction of the antisense RNA against the corresponding strand. Endogenous target gene expression was induced by the transgene construct harboring the miRNA guide strand target sites, but not the passenger strand target sites. Importantly, the therapeutic transgene activity was efficiently regulated by targeting the passenger strand. These results suggested that an approach to passenger strand-regulated expression of therapeutic transgenes could be applied more safely as a therapeutic tool.

  8. RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics (United States)

    Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.


    Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

  9. Synthesis of double-stranded RNA in a virus-enriched fraction from Agaricus bisporus

    International Nuclear Information System (INIS)

    Sriskantha, A.; Wach, P.; Schlagnhaufer, B.; Romaine, C.P.


    Partially purified virus preparations from sporophores of Agaricus bisporus affected with LaFrance disease had up to a 15-fold-higher RNA-dependent RNA polymerase activity than did comparable preparations from health sporophores. Enzyme activity was dependent upon the presence of Mg 2+ and the four nucleoside triphosphates and was insensitive to actinomycin D, α-amanitin, and rifampin. The 3 H-labeled enzyme reaction products were double-stranded RNA (dsRNA) as indicated by CF-11 cellulose column chromatography and by their ionic-strength-dependent sensitivity to hydrolysis by RNase A. The principal dsRNA products had estimated molecular weights of 4.3 /times/ 10 6 and 1.4 /times/ 10 6 . Cs 2 SO 4 equilibrium centrifugation of the virus preparation resolved a single peak of RNA polymerase activity that banded with a 35-nm spherical virus particle containing dsRNAs with molecular weights of 4.3 /times/ 10 6 and 1.4 /times/ 10 6 . The data suggest that the RNA-dependent RNA polymerase associated with the 35-nm spherical virus is a replicase which catalyzes the synthesis of the genomic dsRNAs

  10. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.


    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  11. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)


    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  12. Identification of Cis-Acting Elements on Positive-Strand Subgenomic mRNA Required for the Synthesis of Negative-Strand Counterpart in Bovine Coronavirus

    Directory of Open Access Journals (Sweden)

    Po-Yuan Yeh


    Full Text Available It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(−-strand] complement. However, the cis-acting elements on the positive-strand [(+-strand] sgmRNA required for (−-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV sgmRNA 7 required for the synthesis of its (−-strand counterpart by deletion mutagenesis. The major findings are as follows. (1 Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (−-strand sgmRNA complement. (2 Deletions of the 3' untranslated region (UTR bulged stem-loop showed no effect on (−-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (−-strand sgmRNA. (3 Nucleotides positioned from −15 to −34 of the sgmRNA 7 3'-terminal region are required for efficient (−-strand sgmRNA synthesis. (4 Nucleotide species at the 3'-most position (−1 of sgmRNA 7 is correlated to the efficiency of (−-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (−-strand sgmRNA synthesis in BCoV.

  13. Viral Proteins That Bind Double-Stranded RNA: Countermeasures Against Host Antiviral Responses


    Krug, Robert M.


    Several animal viruses encode proteins that bind double-stranded RNA (dsRNA) to counteract host dsRNA-dependent antiviral responses. This article discusses the structure and function of the dsRNA-binding proteins of influenza A virus and Ebola viruses (EBOVs).

  14. The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses

    International Nuclear Information System (INIS)

    McCown, Matthew; Diamond, Michael S.; Pekosz, Andrew


    Short interfering double-stranded RNAs (siRNAs) expressed under the control of an RNA polymerase I promoter system were used to target gene expression of influenza A and West Nile virus. Decreased RNA and protein expression was induced in a sequence-specific manner--reducing sequence complementarity from 21 to 17 nucleotides abrogated the siRNA effect. Reduced M 2 expression resulted in a decrease in total and infectious influenza A virus production. WNV protein expression, genomic RNA, and infectious virus production were all dramatically reduced by siRNAs targeting two distinct viral sequences. The data demonstrate the utility of plasmid-driven siRNAs in regulating the expression of single viral genes, global viral gene expression, as a potential antiviral treatment, and as a genetic tool for viruses whose genomes are difficult to manipulate

  15. Improved single-strand DNA sizing accuracy in capillary electrophoresis.


    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B


    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  16. Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells

    NARCIS (Netherlands)

    Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M|info:eu-repo/dai/nl/156614723; van Rij, Ronald P


    Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in

  17. CRISPRstrand: predicting repeat orientations to determine the crRNA-encoding strand at CRISPR loci

    DEFF Research Database (Denmark)

    Alkhnbashi, Omer S.; Costa, Fabrizio; Shah, Shiraz Ali


    Motivation: The discovery of CRISPR-Cas systems almost 20 years ago rapidly changed our perception of the bacterial and archaeal immune systems. CRISPR loci consist of several repetitive DNA sequences called repeats, inter-spaced by stretches of variable length sequences called spacers. This CRISPR...... array is transcribed and processed into multiple mature RNA species (crRNAs). A single crRNA is integrated into an interference complex, together with CRISPR-associated (Cas) proteins, to bind and degrade invading nucleic acids. Although existing bioinformatics tools can recognize CRISPR loci...... by their characteristic repeat-spacer architecture, they generally output CRISPR arrays of ambiguous orientation and thus do not determine the strand from which crRNAs are processed. Knowledge of the correct orientation is crucial for many tasks, including the classification of CRISPR conservation, the detection...

  18. Yeast double-stranded RNA virus L-A deliberately synthesizes RNA transcripts with 5'-diphosphate. (United States)

    Fujimura, Tsutomu; Esteban, Rosa


    L-A is a persistent double-stranded RNA virus commonly found in the yeast Saccharomyces cerevisiae. Isolated L-A virus synthesizes positive strand transcripts in vitro. We found that the 5' termini of the transcripts are diphosphorylated. The 5'-terminal nucleotide is G, and GDP was the best substrate among those examined to prime the reaction. When GTP was used, the triphosphate of GTP incorporated into the 5'-end was converted to diphosphate. This activity was not dependent on host CTL1 RNA triphosphatase. The 5'-end of the GMP-primed transcript also was converted to diphosphate, the beta-phosphate of which was derived from the gamma-phosphate of ATP present in the polymerization reaction. These results demonstrate that L-A virus commands elaborate enzymatic systems to ensure its transcript to be 5'-diphosphorylated. Transcripts of M1, a satellite RNA of L-A virus, also had diphosphate at the 5' termini. Because viral transcripts are released from the virion into the cytoplasm to be translated and encapsidated into a new viral particle, a stage most vulnerable to degradation in the virus replication cycle, our results suggest that the 5'-diphosphate status is important for transcript stability. Consistent with this, L-A transcripts made in vitro are resistant to the affinity-purified Ski1p 5'-exonuclease. We also discuss the implication of these findings on translation of viral RNA. Because the viral transcript has no conventional 5'-cap structure, this work may shed light on the metabolism of non-self-RNA in yeast.

  19. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux


    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  20. Detection and molecular characterization of double-stranded RNA viruses in Philippine Trichomonas vaginalis isolates. (United States)

    Rivera, Windell L; Justo, Christine Aubrey C; Relucio-San Diego, Mary Ann Cielo V; Loyola, Lorenz M


    The flagellated protozoon Trichomonas vaginalis that parasitizes the urogenital tract of humans was reported to harbor double-stranded RNA (dsRNA) viruses. These viruses, identified as Trichomonas vaginalis virus (TVV), belong to the genus Trichomonasvirus of the family Totiviridae. Four species, formally recognized by the International Committee on Taxonomy of Viruses (ICTV), have been reported and distinguished by pairwise comparisons of the sequences of genes coding for major capsid protein (CP) and RNA-dependent RNA polymerase (RdRp). Reverse transcription polymerase chain reaction (RT-PCR) was used to amplify the complimentary DNA of target virus genes coding for CP and RdRp. Sequence analyses confirmed the identity of the TVV isolates from T. vaginalis cultures. A total of 35 dsRNA viruses were identified from 18 (19%) T. vaginalis isolates. Multiple TVV species were observed in six of the 18 T. vaginalis cultures. Phylogenetic analyses show monophyly in TVV1 and TVV2 whereas TVV3 and TVV4 appear paraphyletic. The phylogeny of Philippine Trichomonasvirus reflects the global distribution of its host. This is the first study in the Philippines and one of the two reports worldwide to detect the four TVVs and their concurrent infection in a single T. vaginalis isolate. Copyright © 2015. Published by Elsevier B.V.

  1. Identification of a protein linked to nascent poliovirus RNA and to the polyuridylic acid of negative-strand RNA. (United States)

    Pettersson, R F; Ambros, V; Baltimore, D


    A protein similar to that previously demonstrated on poliovirus RNA and replicative intermediate RNA (VPg) was found on all sizes of nascent viral RNA molecules and on the polyuridylic acid isolated from negative-strand RNA. 32P-labeled nascent chains were released from their template RNA and fractionated by exclusion chromatography on agarose. Fingerprint analysis using two-dimensional polyacrylamide gels of RNase T1 oligonucleotides derived from nascent chains of different lengths showed that a size fractionation of nascent chains was achieved. VPg was recovered from nascent chains varying in length from 7,500 nucleotides (full-sized RNA) to about 500 nucleotides. No other type of 5' terminus could be demonstrated on nascent RNA, and the yield of VPg was consistent with one molecule of the protein on each nascent chain. These results are consistent with the concept that the protein is added to the 5' end of the growing RNA chains at a very early stage, possibly as a primer of RNA synthesis. Analysis of the polyuridylic acid tract isolated from the replicative intermediate and double-stranded RNAs indicated that a protein of the same size as that found on the nascent chains and virion RNA is also linked to the negative-strand RNAs. It is likely that a similar mechanism is responsible for initiation of synthesis of both plus- and minus-strand RNAs.

  2. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications (United States)

    Hong, Ka Lok


    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  3. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.


    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  4. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der


    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  5. Use of Cellular Decapping Activators by Positive-Strand RNA Viruses

    Directory of Open Access Journals (Sweden)

    Jennifer Jungfleisch


    Full Text Available Positive-strand RNA viruses have evolved multiple strategies to not only circumvent the hostile decay machinery but to trick it into being a priceless collaborator supporting viral RNA translation and replication. In this review, we describe the versatile interaction of positive-strand RNA viruses and the 5′-3′ mRNA decay machinery with a focus on the viral subversion of decapping activators. This highly conserved viral trickery is exemplified with the plant Brome mosaic virus, the animal Flock house virus and the human hepatitis C virus.

  6. Disruption of Specific RNA-RNA Interactions in a Double-Stranded RNA Virus Inhibits Genome Packaging and Virus Infectivity. (United States)

    Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly


    Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs

  7. MDA5 Detects the Double-Stranded RNA Replicative Form in Picornavirus-Infected Cells

    Directory of Open Access Journals (Sweden)

    Qian Feng


    Full Text Available RIG-I and MDA5 are cytosolic RNA sensors that play a critical role in innate antiviral responses. Major advances have been made in identifying RIG-I ligands, but our knowledge of the ligands for MDA5 remains restricted to data from transfection experiments mostly using poly(I:C, a synthetic dsRNA mimic. Here, we dissected the IFN-α/β-stimulatory activity of different viral RNA species produced during picornavirus infection, both by RNA transfection and in infected cells in which specific steps of viral RNA replication were inhibited. Our results show that the incoming genomic plus-strand RNA does not activate MDA5, but minus-strand RNA synthesis and production of the 7.5 kbp replicative form trigger a strong IFN-α/β response. IFN-α/β production does not rely on plus-strand RNA synthesis and thus generation of the partially double-stranded replicative intermediate. This study reports MDA5 activation by a natural RNA ligand under physiological conditions.

  8. Monomer dynamics in single- and double-stranded DNA coils (United States)

    Tothova, J.; Brutovsky, B.; Lisy, V.


    In our paper (Tothova et al., Czech. J. Phys. 55, 221 (2005)), the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique (R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)) has been interpreted within the bead-spring theory. Optimizing the joint Rouse-Zimm model to the experimental data, the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dynamics have been determined. Recently, these data have been corrected (R. Shusterman et al., Phys. Rev. Lett. 98, 029901 (2007)). In the present work, the fits of the theory to the new data are given. The main conclusions of our preceding paper remain unchanged but some of the polymer parameters have changed. The new data allow a significantly better agreement with the theory than the previous ones. Our calculations confirm that dsDNA follows mainly the classical Zimm-type kinetics rather than the Rouse one as it was proposed by Shusterman et al. Single-stranded DNA also behaves predominantly as the Zimm polymer. To support these conclusions, we analyze the draining effects on the monomer dynamics and the applicability of simple “universal” laws, according to which the monomer mean square displacement scales with the time as t1/2 and t2/3 for the Rouse and Zimm polymers, respectively.

  9. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W


    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation


    NARCIS (Netherlands)



    Mycelium of Pleurotus ostreatus var. florida with a decreased growth rate contained seven double-stranded RNA segments and isometrical virus particles with diameters of 24 and 30 nm. Mycelium with a normal growth rate lacked dsRNA. Protoclones from virus-containing mycelium contained one to seven of

  11. Positive-Strand RNA Viruses Infecting the Red Imported Fire Ant, Solenopsis invicta

    Directory of Open Access Journals (Sweden)

    Steven M. Valles


    Full Text Available The imported fire ants, Solenopsis invicta and S. richteri were introduced into the USA between 1918 and 1945. Since that time, they have expanded their USA range to include some 138 million hectares. Their introduction has had significant economic consequences with costs associated with damage and control efforts estimated at 6 billion dollars annually in the USA. The general consensus of entomologists and myrmecologists is that permanent, sustainable control of these ants in the USA will likely depend on self-sustaining biological control agents. A metagenomics approach successfully resulted in discovery of three viruses infecting S. invicta. Solenopsis invicta virus 1 (SINV-1, SINV-2, and SINV-3 are all positive, single-stranded RNA viruses and represent the first viral discoveries in any ant species. Molecular characterization, host relationships, and potential development and use of SINV-1, SINV-2, and SINV-3 as biopesticides are discussed.

  12. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface. (United States)

    Akbari, Fahimeh; Foroutan, Masumeh


    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  13. Diphosphates at the 5' end of the positive strand of yeast L-A double-stranded RNA virus as a molecular self-identity tag. (United States)

    Fujimura, Tsutomu; Esteban, Rosa


    The 5'end of RNA conveys important information on self-identity. In mammalian cells, double-stranded RNA (dsRNA) with 5'di- or triphosphates generated during virus infection is recognized as foreign and elicits the host innate immune response. Here, we analyze the 5' ends of the dsRNA genome of the yeast L-A virus. The positive strand has largely diphosphates with a minor amount of triphosphates, while the negative strand has only diphosphates. Although the virus can produce capped transcripts by cap snatching, neither strand carried a cap structure, suggesting that only non-capped transcripts serve as genomic RNA for encapsidation. We also found that the 5' diphosphates of the positive but not the negative strand within the dsRNA genome are crucial for transcription in vitro. Furthermore, the presence of a cap structure in the dsRNA abrogated its template activity. Given that the 5' diphosphates of the transcripts are also essential for cap acquisition and that host cytosolic RNAs (mRNA, rRNA, and tRNA) are uniformly devoid of 5' pp-structures, the L-A virus takes advantage of its 5' terminal diphosphates, using them as a self-identity tag to propagate in the host cytoplasm. © 2016 John Wiley & Sons Ltd.

  14. The 3'-terminal 55 nucleotides of bovine coronavirus defective interfering RNA harbor cis-acting elements required for both negative- and positive-strand RNA synthesis.

    Directory of Open Access Journals (Sweden)

    Wei-Yu Liao

    Full Text Available The synthesis of the negative-strand [(--strand] complement of the ∼30 kilobase, positive-strand [(+-strand] coronaviral genome is a necessary early step for genome replication. The identification of cis-acting elements required for (--strand RNA synthesis in coronaviruses, however, has been hampered due to insufficiencies in the techniques used to detect the (--strand RNA species. Here, we employed a method of head-to-tail ligation and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR to detect and quantitate the synthesis of bovine coronavirus (BCoV defective interfering (DI RNA (- strands. Furthermore, using the aforementioned techniques along with Northern blot assay, we specifically defined the cis-acting RNA elements within the 3'-terminal 55 nucleotides (nts which function in the synthesis of (-- or (+-strand BCoV DI RNA. The major findings are as follows: (i nts from -5 to -39 within the 3'-terminal 55 nts are the cis-acting elements responsible for (--strand BCoV DI RNA synthesis, (ii nts from -3 to -34 within the 3'-terminal 55 nts are cis-acting elements required for (+-strand BCoV DI RNA synthesis, and (iii the nucleotide species at the 3'-most position (-1 is important, but not critical, for both (-- and (+-strand BCoV DI RNA synthesis. These results demonstrate that the 3'-terminal 55 nts in BCoV DI RNA harbor cis-acting RNA elements required for both (-- and (+-strand DI RNA synthesis and extend our knowledge on the mechanisms of coronavirus replication. The method of head-to-tail ligation and qRT-PCR employed in the study may also be applied to identify other cis-acting elements required for (--strand RNA synthesis in coronaviruses.

  15. Offset configurations for single- and double-strand DNA inside single-walled carbon nanotubes. (United States)

    Alshehri, Mansoor H; Cox, Barry J; Hill, James M


    Nanotechnology is a rapidly expanding research area, and it is believed that the unique properties of molecules at the nano-scale will prove to be of substantial benefit to mankind, especially so in medicine and electronics. Here we use applied mathematical modelling exploiting the basic principles of mechanics and the 6-12 Lennard-Jones potential function together with the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities. We consider the equilibrium offset positions for both single-strand and double-strand DNA molecules inside a single-walled carbon nanotube, and we predict offset positions with reference to the cross-section of the carbon nanotube. For the double-strand DNA, the potential energy is determined for the general case for any helical phase angle ϕ, but we also consider a special case when ϕ = π, which leads to a substantial simplification in the analytical expression for the energy. As might be expected, our results confirm that the global minimum energy positions for a single-strand DNA molecule and a double-strand DNA molecule will lie off axis and they become closer to the tube wall as the radius of the tube increases.

  16. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der


    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  17. Characterization of the double stranded RNA dependent RNase activity associated with recombinant reverse transcriptases.


    Ben-Artzi, H; Zeelon, E; Le-Grice, S F; Gorecki, M; Panet, A


    An in situ gel assay was applied to the study of double stranded RNA dependent RNase activity associated with reverse transcriptase (RT) of HIV-1 and murine leukemia virus. Polyacrylamide gels containing [32P] RNA/RNA substrate were used for electrophoresis of proteins under denaturing conditions. The proteins were renatured and in situ enzymatic degradation of 32P-RNA/RNA was followed. E. coli RNaseIII, but not E. coli RNaseH, was active in this in situ gel assay, indicating specificity of t...

  18. Structural Analyses of Avocado sunblotch viroid Reveal Differences in the Folding of Plus and Minus RNA Strands

    Directory of Open Access Journals (Sweden)

    Clémentine Delan-Forino


    Full Text Available Viroids are small pathogenic circular single-stranded RNAs, present in two complementary sequences, named plus and minus, in infected plant cells. A high degree of complementarities between different regions of the RNAs allows them to adopt complex structures. Since viroids are naked non-coding RNAs, interactions with host factors appear to be closely related to their structural and catalytic characteristics. Avocado sunblotch viroid (ASBVd, a member of the family Avsunviroidae, replicates via a symmetric RNA-dependant rolling-circle process, involving self-cleavage via hammerhead ribozymes. Consequently, it is assumed that ASBVd plus and minus strands adopt similar structures. Moreover, by computer analyses, a quasi-rod-like secondary structure has been predicted. Nevertheless, secondary and tertiary structures of both polarities of ASBVd remain unsolved. In this study, we analyzed the characteristic of each strand of ASBVd through biophysical analyses. We report that ASBVd transcripts of plus and minus polarities exhibit differences in electrophoretic mobility under native conditions and in thermal denaturation profiles. Subsequently, the secondary structures of plus and minus polarities of ASBVd were probed using the RNA-selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE method. The models obtained show that both polarities fold into different structures. Moreover, our results suggest the existence of a kissing-loop interaction within the minus strand that may play a role in in vivo viroid life cycle.

  19. Elastic properties of alternative versus single-stranded leveling archwires. (United States)

    Rucker, Brian K; Kusy, Robert P


    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  20. Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Xiaofei [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, London, Ontario N5V 4T3 (Canada); College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang 310036 (China); Deng, Ping; Cui, Hongguang [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, London, Ontario N5V 4T3 (Canada); Wang, Aiming, E-mail: [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, London, Ontario N5V 4T3 (Canada)


    Double-stranded RNA (dsRNA) is an important type of RNA that plays essential roles in diverse cellular processes in eukaryotic organisms and a hallmark in infections by positive-sense RNA viruses. Currently, no in vivo technology has been developed for visualizing dsRNA in living cells. Here, we report a dsRNA binding-dependent fluorescence complementation (dRBFC) assay that can be used to efficiently monitor dsRNA distribution and dynamics in vivo. The system consists of two dsRNA-binding proteins, which are fused to the N- and C-terminal halves of the yellow fluorescent protein (YFP). Binding of the two fusion proteins to a common dsRNA brings the split YFP halves in close proximity, leading to the reconstitution of the fluorescence-competent structure and restoration of fluorescence. Using this technique, we were able to visualize the distribution and trafficking of the replicative RNA intermediates of positive-sense RNA viruses in living cells. - Highlights: • A live-cell imaging system was developed for visualizing dsRNA in vivo. • It uses dsRNA binding proteins fused with two halves of a fluorescent protein. • Binding to a common dsRNA enables the reporter to become fluorescent. • The system can efficiently monitor viral RNA replication in living cells.

  1. Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation

    International Nuclear Information System (INIS)

    Cheng, Xiaofei; Deng, Ping; Cui, Hongguang; Wang, Aiming


    Double-stranded RNA (dsRNA) is an important type of RNA that plays essential roles in diverse cellular processes in eukaryotic organisms and a hallmark in infections by positive-sense RNA viruses. Currently, no in vivo technology has been developed for visualizing dsRNA in living cells. Here, we report a dsRNA binding-dependent fluorescence complementation (dRBFC) assay that can be used to efficiently monitor dsRNA distribution and dynamics in vivo. The system consists of two dsRNA-binding proteins, which are fused to the N- and C-terminal halves of the yellow fluorescent protein (YFP). Binding of the two fusion proteins to a common dsRNA brings the split YFP halves in close proximity, leading to the reconstitution of the fluorescence-competent structure and restoration of fluorescence. Using this technique, we were able to visualize the distribution and trafficking of the replicative RNA intermediates of positive-sense RNA viruses in living cells. - Highlights: • A live-cell imaging system was developed for visualizing dsRNA in vivo. • It uses dsRNA binding proteins fused with two halves of a fluorescent protein. • Binding to a common dsRNA enables the reporter to become fluorescent. • The system can efficiently monitor viral RNA replication in living cells.

  2. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.


    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  3. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)


    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  4. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela


    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  5. The complete genome sequence of a double-stranded RNA mycovirus from Fusarium graminearum strain HN1. (United States)

    Wang, Luan; Wang, Shuangchao; Yang, Xiufen; Zeng, Hongmei; Qiu, Dewen; Guo, Lihua


    The complete nucleotide sequence of a double-stranded RNA (dsRNA) mycovirus, Fusarium graminearum dsRNA virus 5 (FgV5), was identified and characterized. The FgV5 genome comprises two dsRNA genome segments of 2030 bp and 1740 bp. FgV5 dsRNA1 contains a single open reading frame (ORF1), which is predicted to encode a protein of 613 amino acids (aa) with a molecular mass of 70.4 kDa and has a conserved RNA-dependent RNA polymerase (RdRp) motif. FgV5 dsRNA2 is predicted to contain two discontinuous ORFs (ORF2 and ORF3) that code for products of unknown function. Sequence comparisons showed that FgV5 has the highest aa sequence identities to Fusarium graminearum virus 4 (FgV4) (83.01% for ORF1, 78.70% for ORF2, and 76.27% for ORF3), suggesting that FgV5 and FgV4 should be regarded as members of different species. Phylogenetic analysis indicated that FgV5 belongs to a taxonomically unassigned dsRNA mycovirus group that is related to the families Amalgaviridae and Partitiviridae. Here, we propose that FgV5 and related viruses are members of a yet to be named and formally recognized new family.

  6. Emaravirus: A Novel Genus of Multipartite, Negative Strand RNA Plant Viruses (United States)

    Mielke-Ehret, Nicole; Mühlbach, Hans-Peter


    Ringspot symptoms in European mountain ash (Sorbus aucuparia L.), fig mosaic, rose rosette, raspberry leaf blotch, pigeonpea sterility mosaic (Cajanus cajan) and High Plains disease of maize and wheat were found to be associated with viruses that share several characteristics. They all have single-stranded multipartite RNA genomes of negative orientation. In some cases, double membrane-bound virus-like particles of 80 to 200 nm in diameter were found in infected tissue. Furthermore, at least five of these viruses were shown to be vectored by eriophyid mites. Sequences of European mountain ash ringspot-associated virus (EMARaV), Fig mosaic virus (FMV), rose rosette virus (RRV), raspberry leaf blotch virus (RLBV), pigeonpea sterility mosaic virus and High Plains virus strongly support their potential phylogenetic relationship. Therefore, after characterization of EMARaV, the novel genus Emaravirus was established, and FMV was the second virus species assigned to this genus. The recently sequenced RRV and RLBV are supposed to be additional members of this new group of plant RNA viruses. PMID:23170170

  7. Emaravirus: A Novel Genus of Multipartite, Negative Strand RNA Plant Viruses

    Directory of Open Access Journals (Sweden)

    Hans-Peter Mühlbach


    Full Text Available Ringspot symptoms in European mountain ash (Sorbus aucuparia L., fig mosaic, rose rosette, raspberry leaf blotch, pigeonpea sterility mosaic (Cajanus cajan and High Plains disease of maize and wheat were found to be associated with viruses that share several characteristics. They all have single-stranded multipartite RNA genomes of negative orientation. In some cases, double membrane-bound virus-like particles of 80 to 200 nm in diameter were found in infected tissue. Furthermore, at least five of these viruses were shown to be vectored by eriophyid mites. Sequences of European mountain ash ringspot-associated virus (EMARaV, Fig mosaic virus (FMV, rose rosette virus (RRV, raspberry leaf blotch virus (RLBV, pigeonpea sterility mosaic virus and High Plains virus strongly support their potential phylogenetic relationship. Therefore, after characterization of EMARaV, the novel genus Emaravirus was established, and FMV was the second virus species assigned to this genus. The recently sequenced RRV and RLBV are supposed to be additional members of this new group of plant RNA viruses.

  8. Single-molecule observations of RNA-RNA kissing interactions in a DNA nanostructure. (United States)

    Takeuchi, Yosuke; Endo, Masayuki; Suzuki, Yuki; Hidaka, Kumi; Durand, Guillaume; Dausse, Eric; Toulmé, Jean-Jacques; Sugiyama, Hiroshi


    RNA molecules uniquely form a complex through specific hairpin loops, called a kissing complex. The kissing complex is widely investigated and used for the construction of RNA nanostructures. Molecular switches have also been created by combining a kissing loop and a ligand-binding aptamer to control the interactions of RNA molecules. In this study, we incorporated two kinds of RNA molecules into a DNA origami structure and used atomic force microscopy to observe their ligand-responsive interactions at the single-molecule level. We used a designed RNA aptamer called GTPswitch, which has a guanosine triphosphate (GTP) responsive domain and can bind to the target RNA hairpin named Aptakiss in the presence of GTP. We observed shape changes of the DNA/RNA strands in the DNA origami, which are induced by the GTPswitch, into two different shapes in the absence and presence of GTP, respectively. We also found that the switching function in the nanospace could be improved by using a cover strand over the kissing loop of the GTPswitch or by deleting one base from this kissing loop. These newly designed ligand-responsive aptamers can be used for the controlled assembly of the various DNA and RNA nanostructures.

  9. Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA (United States)


    2 Beeologics Inc., Miami, Florida, USA Introduction Mosquitoes ( Diptera : Culicidae) are the most medi- cally important arthropods worldwide, vectoring...insecticides can create a long-term burden on species diversity and ecosystem sustainability. Double-stranded RNA (dsRNA) is an attractive alternative as a...insecticide against a variety of insect orders including Coleoptera (Baum et al. 2007; Whyard et al. 2009), Diptera (Walshe et al. 2009; Whyard et al. 2009

  10. Baculovirus-mediated gene silencing in insect cells using intracellularly produced long double-stranded RNA

    NARCIS (Netherlands)

    Huang, Yi; Deng, F.; Hu, Z.H.; Vlak, J.M.; Wang, H.


    Double-stranded RNA-mediated interference (RNAi) has recently emerged as a powerful reverse genetics tool to silence gene expression in multiple organisms, including plants, nematodes and insects. In this study, DNA vectors capable of promoting the synthesis of long hairpin dsRNAs in vivo from a DNA

  11. Long DNA passenger strand highly improves the activity of RNA/DNA hybrid siRNAs. (United States)

    Ida, Hiroyuki; Fukuda, Kosuke; Tachibana, Akira; Tanabe, Toshizumi


    Small interfering RNAs (siRNAs) are potent tools in biomedical research, which can reduce the expression level of target proteins through RNAi pathway. They are composed of 19-25 bp double strand RNA (dsRNAs), therefore, stimulate dsRNAs dependent interferon responses in a non-specific manner. This problem has prevented siRNAs from being applied as new therapeautic agents. In the present paper, we tried to circumvent interferon responses using RNA/DNA hetero siRNAs (HsiRNAs) composed of RNA guide and DNA passenger strands. It was previously reported that siRNAs which were partially substituted with DNA had RNAi activity and that DNA substitution often caused the activity loss. In our results, HsiRNAs, in which the passenger strand of siRNAs were exchanged with DNA also showed much lower activity than that of parental siRNAs. Here, we found that attachment of 5' flanking sequence to DNA passenger strand improved the activity of HsiRNAs. Furthermore, the effective HsiRNAs induced much lower interferon responses than parental siRNAs. Thus, HsiRNAs with 5' flanking sequence are expected to be novel siRNA drug candidates. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Induction of virus resistance by exogenous application of double-stranded RNA. (United States)

    Mitter, Neena; Worrall, Elizabeth A; Robinson, Karl E; Xu, Zhi Ping; Carroll, Bernard J


    Exogenous application of double-stranded RNA (dsRNA) for virus resistance in plants represents a very attractive alternative to virus resistant transgenic crops or pesticides targeting virus vectors. However, the instability of dsRNA sprayed onto plants is a major challenge as spraying naked dsRNA onto plants provides protection against homologous viruses for only 5 days. Innovative approaches, such as the use of nanoparticles as carriers of dsRNA for improved stability and sustained release, are emerging as key disruptive technologies. Knowledge is still limited about the mechanism of entry, transport and processing of exogenously applied dsRNA in plants. Cost of dsRNA and regulatory framework will be key influencers towards practical adoption of this technology. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. DMPD: Transcriptional signaling by double-stranded RNA: role of TLR3. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15733829 Transcriptional signaling by double-stranded RNA: role of TLR3. Sen GC, Sa...rkar SN. Cytokine Growth Factor Rev. 2005 Feb;16(1):1-14. (.png) (.svg) (.html) (.csml) Show Transcriptional sign...aling by double-stranded RNA: role of TLR3. PubmedID 15733829 Title Transcriptional signaling by double

  14. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages. (United States)

    Kodaira, K; Godson, N G; Taketo, A


    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  15. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.


    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  16. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.


    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  17. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  18. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast. (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A


    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  19. Plant insects and mites uptake double-stranded RNA upon its exogenous application on tomato leaves. (United States)

    Gogoi, Anupam; Sarmah, Nomi; Kaldis, Athanasios; Perdikis, Dionysios; Voloudakis, Andreas


    Exogenously applied double-stranded RNA (dsRNA) molecules onto tomato leaves, moved rapidly from local to systemic leaves and were uptaken by agricultural pests namely aphids, whiteflies and mites. Four small interfering RNAs, deriving from the applied dsRNA, were molecularly detected in plants, aphids and mites but not in whiteflies. Double-stranded RNA (dsRNA) acts as the elicitor molecule of the RNA silencing (RNA interference, RNAi), the endogenous and evolutionary conserved surveillance system present in all eukaryotes. DsRNAs and their subsequent degradation products, namely the small interfering RNAs (siRNAs), act in a sequence-specific manner to control gene expression. Exogenous application of dsRNAs onto plants elicits resistance against plant viruses. In the present work, exogenously applied dsRNA molecules, derived from Zucchini yellow mosaic virus (ZYMV) HC-Pro region, onto tomato plants were detected in aphids (Myzus persicae), whiteflies (Trialeurodes vaporariorum) and mites (Tetranychus urticae) that were fed on treated as well as systemic tomato leaves. Furthermore, four siRNAs, deriving from the dsRNA applied, were detected in tomato and the agricultural pests fed on treated tomato plants. More specifically, dsRNA was detected in agricultural pests at 3 and 10 dpt (days post treatment) in dsRNA-treated leaves and at 14 dpt in systemic leaves. In addition, using stem-loop RT-PCR, siRNAs were detected in agricultural pests at 3 and 10 dpt in aphids and mites. Surprisingly, in whiteflies carrying the applied dsRNA, siRNAs were not molecularly detected. Our results showed that, upon exogenous application of dsRNAs molecules, these moved rapidly within tomato and were uptaken by agricultural pests fed on treated tomato. As a result, this non-transgenic method has the potential to control important crop pests via RNA silencing of vital genes of the respective pests.

  20. A double-stranded RNA as the genome of a potential virus infecting Vicia faba. (United States)

    Liu, Weixia; Chen, Jishuang


    Preparations of double-stranded (ds) RNAs extracted from naturally infected Vicia faba Linn. growing in Hangzhou, Zhejiang Province, Eastern China displayed 3 dominant bands (FaR1, FaR2, and FaR3). FaR2 and FaR3 were found to be identical to the genomic dsRNAs of a recently reported Vicia cryptic virus (VCV). The positive strand of FaR1 contained two large open reading frames (ORFs), ORF1 and ORF2. The putative proteins encoded by these ORFs were found to have certain similarities to the putative capsid protein [ABO36237] and RNA-dependent RNA polymerase [ABC96788], respectively, of Tomato yellow stunt virus. Thus, FaR1 may represent the genome of a new dsRNA virus, which we have named Vicia cryptic virus M.

  1. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.


    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  2. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.


    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  3. RNA interference by feeding in vitro-synthesized double-stranded RNA to planarians: methodology and dynamics. (United States)

    Rouhana, Labib; Weiss, Jennifer A; Forsthoefel, David J; Lee, Hayoung; King, Ryan S; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A


    The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced by means of injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. Copyright © 2013 Wiley Periodicals, Inc.

  4. Ultrastructure of the replication sites of positive-strand RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Harak, Christian; Lohmann, Volker, E-mail:


    Positive strand RNA viruses replicate in the cytoplasm of infected cells and induce intracellular membranous compartments harboring the sites of viral RNA synthesis. These replication factories are supposed to concentrate the components of the replicase and to shield replication intermediates from the host cell innate immune defense. Virus induced membrane alterations are often generated in coordination with host factors and can be grouped into different morphotypes. Recent advances in conventional and electron microscopy have contributed greatly to our understanding of their biogenesis, but still many questions remain how viral proteins capture membranes and subvert host factors for their need. In this review, we will discuss different representatives of positive strand RNA viruses and their ways of hijacking cellular membranes to establish replication complexes. We will further focus on host cell factors that are critically involved in formation of these membranes and how they contribute to viral replication. - Highlights: • Positive strand RNA viruses induce massive membrane alterations. • Despite the great diversity, replication complexes share many similarities. • Host factors play a pivotal role in replication complex biogenesis. • Use of the same host factors by several viruses hints to similar functions.

  5. Gene Mapping of Rotavirus Double-Stranded RNA Segments by Northern Blot Hybridization: Application to Segments 7, 8, and 9


    Dyall-Smith, Michael L.; Azad, Ahmed A.; Holmes, Ian H.


    Cloned DNA copies of double-stranded RNA segments 7, 8, and 9 of UK bovine rotavirus were nick-translated with [α-32P]ATP and hybridized to double-stranded RNA of various rotavirus strains which had been separated on long polyacrylamide gels and then transferred to o-aminophenylthioether paper. Specific hybridization of the UK calf clones to the separated RNA segments allowed the corresponding genes of four different rotaviruses to be rapidly determined.

  6. Processing of double-stranded RNA in mammalian cells: a direct antiviral role? (United States)

    Gantier, Michael P


    Processing of viral double-stranded RNA (dsRNA) into small interfering RNAs (siRNAs) contributes directly to an antiviral effect in plants and invertebrates, which is amplified through the recruitment of RNA interference (RNAi). In mammals, viral dsRNAs are the substrate of the innate immune response and limit viral spread by impacting on cellular translation and cytokine production, as well as promoting cell death. Recent studies suggest that viral siRNAs also exert a direct antiviral activity in mammalian cells. Here, I review the current knowledge of dsRNA processing in mammalian cells and discuss the recent findings in light of the complex interplay between RNAi and dsRNA-driven innate immune responses toward the common goal of virus restriction.

  7. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals (United States)


    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  8. Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Sepúlveda Felipe


    Full Text Available Abstract Background In most of the infected fungi, the mycoviruses are latent or cryptic, the infected fungus does not show disease symptoms, and it is phenotypically identical to a non-infected strain of the same species. Because of these properties, the initial stage in the search for fungi infected with mycoviruses is the detection of their viral genome, which in most of the described cases corresponds to double-stranded RNA (dsRNA. So to analyze a large number of fungal isolates it is necessary to have a simple and rapid method to detect dsRNA. Results A rapid method to isolate dsRNA from a virus-infected filamentous fungus, Botrytis cinerea, and from a killer strain of Saccharomyces cerevisiae using commercial minicolumns packed with CF11 cellulose was developed. In addition to being a rapid method, it allows to use small quantities of yeasts or mycelium as starting material, being obtained sufficient dsRNA quantity that can later be analyzed by agarose gel electrophoresis, treated with enzymes for its partial characterization, amplified by RT-PCR and cloned in appropriate vectors for further sequencing. Conclusions The method yields high quality dsRNA, free from DNA and ssRNA. The use of nucleases to degrade the DNA or the ssRNA is not required, and it can be used to isolate dsRNA from any type of fungi or any biological sample that contains dsRNA.

  9. Single-molecule correlated chemical probing of RNA. (United States)

    Homan, Philip J; Favorov, Oleg V; Lavender, Christopher A; Kursun, Olcay; Ge, Xiyuan; Busan, Steven; Dokholyan, Nikolay V; Weeks, Kevin M


    Complex higher-order RNA structures play critical roles in all facets of gene expression; however, the through-space interaction networks that define tertiary structures and govern sampling of multiple conformations are poorly understood. Here we describe single-molecule RNA structure analysis in which multiple sites of chemical modification are identified in single RNA strands by massively parallel sequencing and then analyzed for correlated and clustered interactions. The strategy thus identifies RNA interaction groups by mutational profiling (RING-MaP) and makes possible two expansive applications. First, we identify through-space interactions, create 3D models for RNAs spanning 80-265 nucleotides, and characterize broad classes of intramolecular interactions that stabilize RNA. Second, we distinguish distinct conformations in solution ensembles and reveal previously undetected hidden states and large-scale structural reconfigurations that occur in unfolded RNAs relative to native states. RING-MaP single-molecule nucleic acid structure interrogation enables concise and facile analysis of the global architectures and multiple conformations that govern function in RNA.

  10. Plant viruses of the Amalgaviridae family evolved via recombination between viruses with double-stranded and negative-strand RNA genomes. (United States)

    Krupovic, Mart; Dolja, Valerian V; Koonin, Eugene V


    Plant viruses of the recently recognized family Amalgaviridae have monopartite double-stranded (ds) RNA genomes and encode two proteins: an RNA-dependent RNA polymerase (RdRp) and a putative capsid protein (CP). Whereas the RdRp of amalgaviruses has been found to be most closely related to the RdRps of dsRNA viruses of the family Partitiviridae, the provenance of their CP remained obscure. Here we show that the CP of amalgaviruses is homologous to the nucleocapsid proteins of negative-strand RNA viruses of the genera Phlebovirus (Bunyaviridae) and Tenuivirus. The chimeric genomes of amalgaviruses are a testament to the effectively limitless gene exchange between viruses that shaped the evolution of the virosphere.

  11. Two Negative-Strand RNA Viruses Identified in Watermelon Represent a Novel Clade in the Order Bunyavirales

    Directory of Open Access Journals (Sweden)

    Min Xin


    Full Text Available Two novel negative-sense, single-stranded (ss RNA viruses were identified in watermelon plants and named watermelon crinkle leaf-associated virus 1 and 2 (WCLaV-1 and -2, respectively. The multipartite genomes consist of three RNA molecules of ~6.8, 1.4, and 1.3 kb. The genomes and the deduced proteins of RNA1 and RNA3 show features resembling those of members in the genus Phlebovirus and Tenuivirus; however, the predicted proteins encoded by RNA2 are related to the movement protein (MP in the genus Ophiovirus and Emaravirus. Furthermore, these two viruses define a novel clade in the family Phenuiviridae, order Bunyavirales, which is phylogenetically related to the viruses in the above four genera. Moreover, after mechanical inoculation with WCLaV-1 seedlings of the natural host watermelon plants develop crinkling similar to those observed in the field. These findings enhance our understanding of the evolution and the classification of ssRNA viruses.

  12. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity. (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity* (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  14. Efficient double-stranded RNA production methods for utilization in plant virus control. (United States)

    Voloudakis, Andreas E; Holeva, Maria C; Sarin, L Peter; Bamford, Dennis H; Vargas, Marisol; Poranen, Minna M; Tenllado, Francisco


    Double-stranded RNA (dsRNA) is an inducer molecule of the RNA silencing (RNA interference, RNAi) pathway that is present in all higher eukaryotes and controls gene expression at the posttranscriptional level. This mechanism allows the cell to recognize aberrant genetic material in a highly sequence specific manner. This ultimately leads to degradation of the homologous target sequence, rendering the plant cell resistant to subcellular pathogens. Consequently, dsRNA-mediated resistance has been exploited in transgenic plants to convey resistance against viruses. In addition, it has been shown that enzymatically synthesized specific dsRNA molecules can be applied directly onto plant tissue to induce resistance against the cognate virus. This strongly implies that dsRNA molecules are applicable as efficacious agents in crop protection, which will fuel the demand for cost-effective dsRNA production methods. In this chapter, the different methods for dsRNA production-both in vitro and in vivo-are described in detail.

  15. Transient RNA-DNA Hybrids Are Required for Efficient Double-Strand Break Repair. (United States)

    Ohle, Corina; Tesorero, Rafael; Schermann, Géza; Dobrev, Nikolay; Sinning, Irmgard; Fischer, Tamás


    RNA-DNA hybrids are a major internal cause of DNA damage within cells, and their degradation by RNase H enzymes is important for maintaining genomic stability. Here, we identified an unexpected role for RNA-DNA hybrids and RNase H enzymes in DNA repair. Using a site-specific DNA double-strand break (DSB) system in Schizosaccharomyces pombe, we showed that RNA-DNA hybrids form as part of the homologous-recombination (HR)-mediated DSB repair process and that RNase H enzymes are essential for their degradation and efficient completion of DNA repair. Deleting RNase H stabilizes RNA-DNA hybrids around DSB sites and strongly impairs recruitment of the ssDNA-binding RPA complex. In contrast, overexpressing RNase H1 destabilizes these hybrids, leading to excessive strand resection and RPA recruitment and to severe loss of repeat regions around DSBs. Our study challenges the existing model of HR-mediated DSB repair and reveals a surprising role for RNA-DNA hybrids in maintaining genomic stability. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.


    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  17. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder


    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  18. Single slit interference made easy with a strand of hair and a laser (United States)

    Messer, Rebecca


    Students can easily measure the width of a strand of their own hair with a monochromatic light source such as a laser. This inexpensive activity engages students in an application of single slit diffraction using Babinet's principle.

  19. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.


    Barany, F; Boeke, J D


    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  20. Identifying the Location of a Single Protein along the DNA Strand Using Solid-State Nanopores. (United States)

    Yu, Jae-Seok; Lim, Min-Cheol; Huynh, Duyen Thi Ngoc; Kim, Hyung-Jun; Kim, Hyun-Mi; Kim, Young-Rok; Kim, Ki-Bum


    Solid-state nanopore has been widely studied as an effective tool to detect and analyze small biomolecules, such as DNA, RNA, and proteins, at a single molecule level. In this study, we demonstrate a rapid identification of the location of zinc finger protein (ZFP), which is bound to a specific locus along the length of a double-stranded DNA (dsDNA) to a single protein resolution using a low noise solid-state nanopore. When ZFP labeled DNAs were driven through a nanopore by an externally applied electric field, characteristic ionic current signals arising from the passage of the DNA/ZFP complex and bare DNA were detected, which enabled us to identify the locations of ZFP binding site. We examined two DNAs with ZFP binding sites at different positions and found that the location of the additional current drop derived from the DNA/ZFP complex is well-matched with a theoretical one along the length of the DNA molecule. These results suggest that the protein binding site on DNA can be mapped or that genetic information can be read at a single molecule level using solid-state nanopores.

  1. Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix. (United States)

    Yaegashi, Hajime; Shimizu, Takeo; Ito, Tsutae; Kanematsu, Satoko


    RNA silencing acts as a defense mechanism against virus infection in a wide variety of organisms. Here, we investigated inductions of RNA silencing against encapsidated double-stranded RNA (dsRNA) fungal viruses (mycoviruses), including a partitivirus (RnPV1), a quadrivirus (RnQV1), a victorivirus (RnVV1), a mycoreovirus (RnMyRV3), and a megabirnavirus (RnMBV1) in the phytopathogenic fungus Rosellinia necatrix Expression profiling of RNA silencing-related genes revealed that a dicer-like gene, an Argonaute-like gene, and two RNA-dependent RNA polymerase genes were upregulated by RnMyRV3 or RnMBV1 infection but not by other virus infections or by constitutive expression of dsRNA in R. necatrix Massive analysis of viral small RNAs (vsRNAs) from the five mycoviruses showed that 19- to 22-nucleotide (nt) vsRNAs were predominant; however, their ability to form duplexes with 3' overhangs and the 5' nucleotide preferences of vsRNAs differed among the five mycoviruses. The abundances of 19- to 22-nt vsRNAs from RnPV1, RnQV1, RnVV1, RnMyRV3, and RnMBV1 were 6.8%, 1.2%, 0.3%, 13.0%, and 24.9%, respectively. Importantly, the vsRNA abundances and accumulation levels of viral RNA were not always correlated, and the origins of the vsRNAs were distinguishable among the five mycoviruses. These data corroborated diverse interactions between encapsidated dsRNA mycoviruses and RNA silencing. Moreover, a green fluorescent protein (GFP)-based sensor assay in R. necatrix revealed that RnMBV1 infection induced silencing of the target sensor gene (GFP gene and the partial RnMBV1 sequence), suggesting that vsRNAs from RnMBV1 activated the RNA-induced silencing complex. Overall, this study provides insights into RNA silencing against encapsidated dsRNA mycoviruses. Encapsidated dsRNA fungal viruses (mycoviruses) are believed to replicate inside their virions; therefore, there is a question of whether they induce RNA silencing. Here, we investigated inductions of RNA silencing against

  2. Analyses of the radiation of birnaviruses from diverse host phyla and of their evolutionary affinities with other double-stranded RNA and positive strand RNA viruses using robust structure-based multiple sequence alignments and advanced phylogenetic methods. (United States)

    Gibrat, Jean-François; Mariadassou, Mahendra; Boudinot, Pierre; Delmas, Bernard


    Birnaviruses form a distinct family of double-stranded RNA viruses infecting animals as different as vertebrates, mollusks, insects and rotifers. With such a wide host range, they constitute a good model for studying the adaptation to the host. Additionally, several lines of evidence link birnaviruses to positive strand RNA viruses and suggest that phylogenetic analyses may provide clues about transition. We characterized the genome of a birnavirus from the rotifer Branchionus plicalitis. We used X-ray structures of RNA-dependent RNA polymerases and capsid proteins to obtain multiple structure alignments that allowed us to obtain reliable multiple sequence alignments and we employed "advanced" phylogenetic methods to study the evolutionary relationships between some positive strand and double-stranded RNA viruses. We showed that the rotifer birnavirus genome exhibited an organization remarkably similar to other birnaviruses. As this host was phylogenetically very distant from the other known species targeted by birnaviruses, we revisited the evolutionary pathways within the Birnaviridae family using phylogenetic reconstruction methods. We also applied a number of phylogenetic approaches based on structurally conserved domains/regions of the capsid and RNA-dependent RNA polymerase proteins to study the evolutionary relationships between birnaviruses, other double-stranded RNA viruses and positive strand RNA viruses. We show that there is a good correlation between the phylogeny of the birnaviruses and that of their hosts at the phylum level using the RNA-dependent RNA polymerase (genomic segment B) on the one hand and a concatenation of the capsid protein, protease and ribonucleoprotein (genomic segment A) on the other hand. This correlation tends to vanish within phyla. The use of advanced phylogenetic methods and robust structure-based multiple sequence alignments allowed us to obtain a more accurate picture (in terms of probability of the tree topologies) of the

  3. Use of S1 nuclease in deep sequencing for detection of double-stranded RNA viruses. (United States)

    Shimada, Saya; Nagai, Makoto; Moriyama, Hiromitsu; Fukuhara, Toshiyuki; Koyama, Satoshi; Omatsu, Tsutomu; Furuya, Tetsuya; Shirai, Junsuke; Mizutani, Tetsuya


    Metagenomic approach using next-generation DNA sequencing has facilitated the detection of many pathogenic viruses from fecal samples. However, in many cases, majority of the detected sequences originate from the host genome and bacterial flora in the gut. Here, to improve efficiency of the detection of double-stranded (ds) RNA viruses from samples, we evaluated the applicability of S1 nuclease on deep sequencing. Treating total RNA with S1 nuclease resulted in 1.5-28.4- and 10.1-208.9-fold increases in sequence reads of group A rotavirus in fecal and viral culture samples, respectively. Moreover, increasing coverage of mapping to reference sequences allowed for sufficient genotyping using analytical software. These results suggest that library construction using S1 nuclease is useful for deep sequencing in the detection of dsRNA viruses.

  4. Scavenger receptors in human airway epithelial cells: role in response to double-stranded RNA.

    Directory of Open Access Journals (Sweden)

    Audrey Dieudonné

    Full Text Available Scavenger receptors and Toll-like receptors (TLRs cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (dsRNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed at defining the role played by scavenger receptors expressed by bronchial epithelial cells in the control of the innate response to dsRNA both in vitro and in vivo. Expression of several scavenger receptor involved in pathogen recognition was first evaluated in human bronchial epithelial cells in steady-state and inflammatory conditions. Their implication in the uptake of dsRNA and the subsequent cell activation was evaluated in vitro by competition with ligand of scavenger receptors including maleylated ovalbumin and by RNA silencing. The capacity of maleylated ovalbumin to modulate lung inflammation induced by dsRNA was also investigated in mice. Exposure to tumor necrosis factor-α increased expression of the scavenger receptors LOX-1 and CXCL16 and the capacity to internalize maleylated ovalbumin, whereas activation by TLR ligands did not. In contrast, the expression of SR-B1 was not modulated in these conditions. Interestingly, supplementation with maleylated ovalbumin limited dsRNA uptake and inhibited subsequent activation of bronchial epithelial cells. RNA silencing of LOX-1 and SR-B1 strongly blocked the dsRNA-induced cytokine production. Finally, administration of maleylated ovalbumin in mice inhibited the dsRNA-induced infiltration and activation of inflammatory cells in bronchoalveolar spaces and lung draining lymph nodes. Together, our data characterize the function of SR-B1 and LOX-1 in bronchial epithelial cells and their implication in dsRNA-induced responses, a finding that might be relevant during respiratory viral infections.

  5. Sequence requirements for RNA strand transfer during nidovirus discontinuous subgenomic RNA synthesis

    NARCIS (Netherlands)

    Pasternak, A. O.; van den Born, E.; Spaan, W. J.; Snijder, E. J.


    Nidovirus subgenomic mRNAs contain a leader sequence derived from the 5' end of the genome fused to different sequences ('bodies') derived from the 3' end. Their generation involves a unique mechanism of discontinuous subgenomic RNA synthesis that resembles copy-choice RNA recombination. During this

  6. Two Novel Relative Double-Stranded RNA Mycoviruses Infecting Fusarium poae Strain SX63. (United States)

    Wang, Luan; Zhang, Jingze; Zhang, Hailong; Qiu, Dewen; Guo, Lihua


    Two novel double-stranded RNA (dsRNA) mycoviruses, termed Fusarium poae dsRNA virus 2 (FpV2) and Fusarium poae dsRNA virus 3 (FpV3), were isolated from the plant pathogenic fungus, Fusarium poae strain SX63, and molecularly characterized. FpV2 and FpV3, with respective genome sequences of 9518 and 9419 base pairs (bps), are both predicted to contain two discontinuous open reading frames (ORFs), ORF1 and ORF2. A hypothetical polypeptide (P1) and a RNA-dependent RNA polymerase (RdRp) are encoded by ORF1 and ORF2, respectively. Phytoreo_S7 domain (pfam07236) homologs were detected downstream of the RdRp domain (RdRp_4; pfam02123) of the ORF2-coded proteins of both FpV2 and FpV3. The same shifty heptamers (GGAAAAC) were both found immediately before the stop codon UAG of ORF1 in FpV2 and FpV3, which could mediate programmed -1 ribosomal frameshifting (-1 PRF). Phylogenetic analysis based on RdRp sequences clearly place FpV2 and FpV3 in a taxonomically unassigned dsRNA mycovirus group. Together, with a comparison of genome organization, a new taxonomic family termed Fusagraviridae is proposed to be created to include FpV2- and FpV3-related dsRNA mycoviruses, within which FpV2 and FpV3 would represent two distinct virus species.

  7. Conserved asymmetry underpins homodimerization of Dicer-associated double-stranded RNA-binding proteins. (United States)

    Heyam, Alex; Coupland, Claire E; Dégut, Clément; Haley, Ruth A; Baxter, Nicola J; Jakob, Leonhard; Aguiar, Pedro M; Meister, Gunter; Williamson, Michael P; Lagos, Dimitris; Plevin, Michael J


    Double-stranded RNA-binding domains (dsRBDs) are commonly found in modular proteins that interact with RNA. Two varieties of dsRBD exist: canonical Type A dsRBDs interact with dsRNA, while non-canonical Type B dsRBDs lack RNA-binding residues and instead interact with other proteins. In higher eukaryotes, the microRNA biogenesis enzyme Dicer forms a 1:1 association with a dsRNA-binding protein (dsRBP). Human Dicer associates with HIV TAR RNA-binding protein (TRBP) or protein activator of PKR (PACT), while Drosophila Dicer-1 associates with Loquacious (Loqs). In each case, the interaction involves a region of the protein that contains a Type B dsRBD. All three dsRBPs are reported to homodimerize, with the Dicer-binding region implicated in self-association. We report that these dsRBD homodimers display structural asymmetry and that this unusual self-association mechanism is conserved from flies to humans. We show that the core dsRBD is sufficient for homodimerization and that mutation of a conserved leucine residue abolishes self-association. We attribute differences in the self-association properties of Loqs, TRBP and PACT to divergence of the composition of the homodimerization interface. Modifications that make TRBP more like PACT enhance self-association. These data are examined in the context of miRNA biogenesis and the protein/protein interaction properties of Type B dsRBDs. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae. (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E


    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  9. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler


    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  10. Identification and sequence determination of a novel double-stranded RNA mycovirus from the entomopathogenic fungus Beauveria bassiana. (United States)

    Kotta-Loizou, Ioly; Sipkova, Jana; Coutts, Robert H A


    An isolate of the entomopathogenic fungus Beauveria bassiana was found to contain five double-stranded (ds) RNA elements ranging from 1.5 to more than 3 kbp. The complete sequence of the largest dsRNA element is described here. Analysis of the RdRp nucleotide sequence reveals its similarity to unclassified dsRNA elements, such as Alternaria longipes dsRNA virus 1, and its distant relationship to the RNA-dependent RNA polymerases of members of the family Partitiviridae.

  11. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.


    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  12. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    NARCIS (Netherlands)

    A. Balestrini (Alessia); D. Ristic (Dejan); I. Dionne (Isabelle); X.Z. Liu (Xiao); C. Wyman (Claire); R.J. Wellinger (Raymund); J.H.J. Petrini (John)


    textabstractSingle-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the

  13. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores. (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei


    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  14. Identification of Novel Positive-Strand RNA Viruses by Metagenomic Analysis of Archaea-Dominated Yellowstone Hot Springs (United States)

    Bolduc, Benjamin; Shaughnessy, Daniel P.; Wolf, Yuri I.; Koonin, Eugene V.; Roberto, Francisco F.


    There are no known RNA viruses that infect Archaea. Filling this gap in our knowledge of viruses will enhance our understanding of the relationships between RNA viruses from the three domains of cellular life and, in particular, could shed light on the origin of the enormous diversity of RNA viruses infecting eukaryotes. We describe here the identification of novel RNA viral genome segments from high-temperature acidic hot springs in Yellowstone National Park in the United States. These hot springs harbor low-complexity cellular communities dominated by several species of hyperthermophilic Archaea. A viral metagenomics approach was taken to assemble segments of these RNA virus genomes from viral populations isolated directly from hot spring samples. Analysis of these RNA metagenomes demonstrated unique gene content that is not generally related to known RNA viruses of Bacteria and Eukarya. However, genes for RNA-dependent RNA polymerase (RdRp), a hallmark of positive-strand RNA viruses, were identified in two contigs. One of these contigs is approximately 5,600 nucleotides in length and encodes a polyprotein that also contains a region homologous to the capsid protein of nodaviruses, tetraviruses, and birnaviruses. Phylogenetic analyses of the RdRps encoded in these contigs indicate that the putative archaeal viruses form a unique group that is distinct from the RdRps of RNA viruses of Eukarya and Bacteria. Collectively, our findings suggest the existence of novel positive-strand RNA viruses that probably replicate in hyperthermophilic archaeal hosts and are highly divergent from RNA viruses that infect eukaryotes and even more distant from known bacterial RNA viruses. These positive-strand RNA viruses might be direct ancestors of RNA viruses of eukaryotes. PMID:22379100

  15. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi


    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  16. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.


    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  17. Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea.

    Directory of Open Access Journals (Sweden)

    Hajime Muraguchi

    Full Text Available The basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC. To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.

  18. Widespread horizontal gene transfer from double-stranded RNA viruses to eukaryotic nuclear genomes. (United States)

    Liu, Huiquan; Fu, Yanping; Jiang, Daohong; Li, Guoqing; Xie, Jiatao; Cheng, Jiasen; Peng, Youliang; Ghabrial, Said A; Yi, Xianhong


    Horizontal gene transfer commonly occurs from cells to viruses but rarely occurs from viruses to their host cells, with the exception of retroviruses and some DNA viruses. However, extensive sequence similarity searches in public genome databases for various organisms showed that the capsid protein and RNA-dependent RNA polymerase genes from totiviruses and partitiviruses have widespread homologs in the nuclear genomes of eukaryotic organisms, including plants, arthropods, fungi, nematodes, and protozoa. PCR amplification and sequencing as well as comparative evidence of junction coverage between virus and host sequences support the conclusion that these viral homologs are real and occur in eukaryotic genomes. Sequence comparison and phylogenetic analysis suggest that these genes were likely transferred horizontally from viruses to eukaryotic genomes. Furthermore, we present evidence showing that some of the transferred genes are conserved and expressed in eukaryotic organisms and suggesting that these viral genes are also functional in the recipient genomes. Our findings imply that horizontal transfer of double-stranded RNA viral genes is widespread among eukaryotes and may give rise to functionally important new genes, thus entailing that RNA viruses may play significant roles in the evolution of eukaryotes.

  19. Nucleoproteins of Negative Strand RNA Viruses; RNA Binding, Oligomerisation and Binding to Polymerase Co-Factor

    Directory of Open Access Journals (Sweden)

    Thibaut Crépin


    Full Text Available Commentary on Tawar, R.G.; Duquerroy, S.; Vonrhein, C.; Varela, P.F.; Damier-Piolle, L.; Castagné, N.; MacLellan, K.; Bedouelle, H.; Bricogne, G.; Bhella, D.; Eléouët, J.-F.; Rey, F.A. Crystal structure of a nucleocapsid-like nucleoprotein-RNA complex of respiratory syncytial virus. Science 2009, 326, 1279-1283.

  20. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks. (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P


    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  1. Laser ablation MC-ICPMS to study longitudinal stable isotopic variations in single human hair strands

    International Nuclear Information System (INIS)

    Santamaria-Fernandez, R.; Hearn, R.; Giner Martinez-Sierra, J.


    Full text: There is a need for novel approaches to measure stable isotopic variations in human tissues to provide information regarding the geographical origin and lifestyle of individuals. In this work, a method for the measurement of longitudinal sulfur isotopic variations in single hair strands has been developed. The method validation, uncertainty evaluation, in-house characterization of a horse hair sample and the potential of the method as a forensic tool to obtain information from single hair strands will be discussed. In addition, a new method for carbon isotope ratio measurements by MC-ICPMS has been developed and results will be presented. (author)

  2. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Petrov, S.I.


    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  3. Synthetic double-stranded RNA induces interleukin-32 in bronchial epithelial cells. (United States)

    Ota, Kyoko; Kawaguchi, Mio; Fujita, Junichi; Kokubu, Fumio; Huang, Shau-Ku; Morishima, Yuko; Matsukura, Satoshi; Kurokawa, Masatsugu; Ishii, Yukio; Satoh, Hiroaki; Sakamoto, Tohru; Hizawa, Nobuyuki


    Interleukin (IL)-32 is a novel cytokine and is involved in the pathogenesis of various inflammatory diseases, including asthma and COPD. However, the regulatory mechanisms of IL-32 expression and its precise pathogenic role remain to be defined. Given that viral infections are known to potentially cause and exacerbate airway inflammation, in this study, we investigated the expression of IL-32 induced by synthetic double-stranded (ds) RNA, and its signaling mechanisms involved. Bronchial epithelial cells were stimulated with synthetic dsRNA poly I:C. The levels of IL-32 expression were analyzed using real-time PCR and ELISA. The involvement of transforming growth factor β-activated kinase 1 (TAK1) and a subunit of nuclear factor-κB (NF-κB), p65 was determined by western blot analyses. TAK1 inhibitor, 5Z-7-Oxozeaenol and NF-κB inhibitor, BAY 11-7082 were added to the culture to identify key signaling events leading to the expression of IL-32. Finally, the effect of short interfering RNAs (siRNAs) targeting TAK1 and p65 was investigated. dsRNA significantly induced IL-32 gene and protein expression, concomitant with activation of TAK1 and p65. Pretreatment of 5Z-7-Oxozeaenol diminished dsRNA-induced phosphorylation of NF-κB. Both 5Z-7-Oxozeaenol and BAY 11-7082 significantly abrogated dsRNA-induced IL-32 production. Moreover, transfection of the cells with siRNAs targeting TAK1 and p65 inhibited the expression of IL-32. The expression of IL-32 is induced by dsRNA via the TAK1-NF-κB signaling pathway in bronchial epithelial cells. IL-32 is involved in the pathogenesis of airway inflammation, and may be a novel therapeutic target for airway inflammatory diseases.

  4. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana. (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L


    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  5. Inactivation of the type I interferon pathway reveals long double-stranded RNA-mediated RNA interference in mammalian cells. (United States)

    Maillard, Pierre V; Van der Veen, Annemarthe G; Deddouche-Grass, Safia; Rogers, Neil C; Merits, Andres; Reis E Sousa, Caetano


    RNA interference (RNAi) elicited by long double-stranded (ds) or base-paired viral RNA constitutes the major mechanism of antiviral defence in plants and invertebrates. In contrast, it is controversial whether it acts in chordates. Rather, in vertebrates, viral RNAs induce a distinct defence system known as the interferon (IFN) response. Here, we tested the possibility that the IFN response masks or inhibits antiviral RNAi in mammalian cells. Consistent with that notion, we find that sequence-specific gene silencing can be triggered by long dsRNAs in differentiated mouse cells rendered deficient in components of the IFN pathway. This unveiled response is dependent on the canonical RNAi machinery and is lost upon treatment of IFN-responsive cells with type I IFN Notably, transfection with long dsRNA specifically vaccinates IFN-deficient cells against infection with viruses bearing a homologous sequence. Thus, our data reveal that RNAi constitutes an ancient antiviral strategy conserved from plants to mammals that precedes but has not been superseded by vertebrate evolution of the IFN system. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  6. A rapid, simple, and inexpensive method for the preparation of strand-specific RNA-Seq libraries. (United States)

    Hunt, Arthur G


    High-throughput sequencing of short cDNA tags, or RNA-Seq, has become a staple of genome-wide gene expression studies in plants. RNA-Seq libraries necessarily contain tags that correspond to the mRNA-poly(A) junction, or polyadenylation site, and thus may be mined for data that can help study alternative polyadenylation. This report presents a simple, rapid, and inexpensive method for preparing strand-specific RNA-Seq libraries from varying quantities of total RNA.

  7. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  8. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism. (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol


    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  9. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays. (United States)

    Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P


    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  10. Hepatitis delta antigen requires a flexible quasi-double-stranded RNA structure to bind and condense hepatitis delta virus RNA in a ribonucleoprotein complex. (United States)

    Griffin, Brittany L; Chasovskikh, Sergey; Dritschilo, Anatoly; Casey, John L


    The circular genome and antigenome RNAs of hepatitis delta virus (HDV) form characteristic unbranched, quasi-double-stranded RNA secondary structures in which short double-stranded helical segments are interspersed with internal loops and bulges. The ribonucleoprotein complexes (RNPs) formed by these RNAs with the virus-encoded protein hepatitis delta antigen (HDAg) perform essential roles in the viral life cycle, including viral replication and virion formation. Little is understood about the formation and structure of these complexes and how they function in these key processes. Here, the specific RNA features required for HDAg binding and the topology of the complexes formed were investigated. Selective 2'OH acylation analyzed by primer extension (SHAPE) applied to free and HDAg-bound HDV RNAs indicated that the characteristic secondary structure of the RNA is preserved when bound to HDAg. Notably, the analysis indicated that predicted unpaired positions in the RNA remained dynamic in the RNP. Analysis of the in vitro binding activity of RNAs in which internal loops and bulges were mutated and of synthetically designed RNAs demonstrated that the distinctive secondary structure, not the primary RNA sequence, is the major determinant of HDAg RNA binding specificity. Atomic force microscopy analysis of RNPs formed in vitro revealed complexes in which the HDV RNA is substantially condensed by bending or wrapping. Our results support a model in which the internal loops and bulges in HDV RNA contribute flexibility to the quasi-double-stranded structure that allows RNA bending and condensing by HDAg. RNA-protein complexes (RNPs) formed by the hepatitis delta virus RNAs and protein, HDAg, perform critical roles in virus replication. Neither the structures of these RNPs nor the RNA features required to form them have been characterized. HDV RNA is unusual in that it forms an unbranched quasi-double-stranded structure in which short base-paired segments are interspersed

  11. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

  12. Cap snatching in yeast L-BC double-stranded RNA totivirus. (United States)

    Fujimura, Tsutomu; Esteban, Rosa


    Yeast L-A double-stranded RNA virus furnishes its transcript with a 5' cap structure by a novel cap-snatching mechanism in which m(7)Gp from a host mRNA cap structure is transferred to the 5'-diphosphate terminus of the viral transcript. His-154 of the coat protein Gag forms an m(7)Gp adduct, and the H154R mutation abolishes both m(7)Gp adduct formation and cap snatching. Here we show that L-BC, another totivirus closely related to L-A, also synthesizes 5'-diphosphorylated transcripts and transfers m(7)Gp from mRNA to the 5' termini of the transcripts. L-BC Gag also covalently binds to the cap structure and the mutation H156R, which corresponds to H154R of L-A Gag, abolishes cap adduct formation. Cap snatching of the L-BC virus is very similar to that of L-A; N7 methylation of the mRNA cap is essential for cap donor activity, and only 5'-diphosphorylated RNA is used as cap acceptor. L-BC cap snatching is also activated by viral transcription. Furthermore, both viruses require Mg(2+) and Mn(2+) for cap snatching. These cations are not only required for transcription activation but also directly involved in the cap transfer process. These findings support our previous proposal that the cap-snatching mechanism of the L-A virus is shared by fungal totiviruses closely related to L-A. Interestingly, L-A and L-BC viruses accept either viral transcript as cap acceptor in vitro. Because L-A and L-BC viruses cohabit in many yeast strains, it raises the possibility that their cohabitation in the same host may be beneficial for their mutual cap acquisition.

  13. Parallel-stranded DNA and RNA duplexes - structural features and potential applications. (United States)

    Szabat, Marta; Kierzek, Ryszard


    Nowadays, decades after the discovery of the right-handed B form of DNA, it is well known that nucleic acids have great conformational flexibility, exhibiting a large degree of variation in their structure. In nature, DNA and RNA exist in an antiparallel orientation, stabilized by Watson-Crick base pairs. However, in some cases, nucleic acid fragments with specific nucleotide sequences can adopt a parallel orientation involving non-canonical base pairing. Interestingly, parallel-stranded duplexes have been found in specific chromosome regions. Furthermore, parallel oriented regions have also been found in bacterial (Escherichia coli, Listeria innocua) and insect genomes (Drosophila melanogaster). These unusual structures could have a remarkable evolutionary role, as well as significant impact on biological processes. For example, parallel stretches were shown to be involved in processing the 3' ends of mRNAs and in specific gene silencing. Moreover, certain types of parallel-stranded duplexes may be useful tools, with several practical applications. They can constitute excellent templates for the formation of other structures and for the development of antigene and antisense approaches. © 2017 Federation of European Biochemical Societies.

  14. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)


    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.

  15. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    International Nuclear Information System (INIS)

    Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo


    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity

  16. Double-stranded RNA viral infection of Trichomonas vaginalis (TVV1) in Iranian isolates. (United States)

    Khanaliha, Khadijeh; Masoumi-Asl, Hossein; Bokharaei-Salim, Farah; Tabatabaei, Azardokht; Naghdalipoor, Mehri


    The Totiviridae family includes a number of viruses that can infect protozoan parasites such as Leishmania and Giardia and fungi like Saccharomyces cerevisiae. Some isolates of Trichomonas vaginalis are also infected with one or more double-stranded RNA (dsRNA) viruses. In this study, the frequency of Trichomonas vaginalis virus (TVV1) was evaluated in Iranian isolates of T. vaginalis in Tehran, Iran. One thousand five hundred vaginal samples were collected from patients attending obstetrics and gynaecology hospitals associated with Iran University of Medical Sciences in Tehran, Iran from October 2015 to September 2016. Trichomonas vaginalis isolates were cultured in Diamond's modified medium. Nucleic acids were extracted using a DNA/RNA extraction kit and RT-PCR was performed. Among 1500 collected vaginal samples, 8 (0.53%) cases of T. vaginalis infection were found. Half (4/8) of the T. vaginalis positive cases were infected with TVV1. Phylogenetic mapping indicated that the Iranian isolates were most closely related to TVV1-OC5, TVV1-UR1. Iranian isolates of T. vaginalis were infected with TVV1. The frequency of viral infection (TVV1) in T. vaginalis isolates found in this study is higher than previously reported in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles. (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng


    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  18. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.


    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  19. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail:


    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  20. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder


    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  1. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP


    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  2. Effects of single-stranded DNA binding proteins on primer extension by telomerase. (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim


    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  3. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket. (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter


    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  4. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket


    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter


    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  5. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B


    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  6. Efficient CRISPR/Cas9-Mediated Genome Editing Using a Chimeric Single-Guide RNA Molecule

    KAUST Repository

    Butt, Haroon


    The CRISPR/Cas9 system has been applied in diverse eukaryotic organisms for targeted mutagenesis. However, targeted gene editing is inefficient and requires the simultaneous delivery of a DNA template for homology-directed repair (HDR). Here, we used CRISPR/Cas9 to generate targeted double-strand breaks and to deliver an RNA repair template for HDR in rice (Oryza sativa). We used chimeric single-guide RNA (cgRNA) molecules carrying both sequences for target site specificity (to generate the double-strand breaks) and repair template sequences (to direct HDR), flanked by regions of homology to the target. Gene editing was more efficient in rice protoplasts using repair templates complementary to the non-target DNA strand, rather than the target strand. We applied this cgRNA repair method to generate herbicide resistance in rice, which showed that this cgRNA repair method can be used for targeted gene editing in plants. Our findings will facilitate applications in functional genomics and targeted improvement of crop traits.

  7. Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering. (United States)

    Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko


    Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

  8. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.


    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  9. Effects of double-stranded RNA on virulence of Paecilomyces fumosoroseus (Deuteromycotina: Hyphomycetes against the silverleaf whitefly, Bemisia tabaci strain B (Homoptera: Aleyrodidae

    Directory of Open Access Journals (Sweden)

    Andréia Cristiane Souza Azevedo


    Full Text Available Bands of double-stranded RNA (dsRNA were detected in three out of twelve isolates of Paecilomyces fumosoroseus. Identity of these bands was confirmed by RNAse, DNAse and S1 nuclease treatments. The cure of dsRNA for one isolate (P92 was successfully carried out for a single conidium subculture. Isogenic strains, with or without dsRNA, were submitted to virulence tests against the whitefly Bemisia tabaci strain B. In contrast to findings for some phytopathogenic fungi, these dsRNA fragments did not cause hypovirulence in P. fumosoroseus.Bandas de dsRNA foram detectadas em três dos doze isolados de Paecilomyces fumosoroseus. A identidade destas bandas foi provada através de tratamentos com RNAse, DNAse e S1 nuclease. A cura do dsRNA para um dos isolados (P92 foi obtida através do isolamento de colônias monospóricas. Linhagens isogênicas, com e sem dsRNA, foram submetidas ao teste de virulência contra a mosca branca Bemisia tabaci biotipo B. Ao contrário do que ocorre para vários fungos fitopatogênicos, os fragmentos de dsRNA não causaram hipovirulência em P. fumosoroseus.

  10. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud


    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  11. Double-stranded RNA-dependent protein kinase regulates the motility of breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Mei Xu

    Full Text Available Double-stranded RNA (dsRNA-dependent protein kinase (PKR is an interferon-induced protein kinase that plays a central role in the anti-viral process. Due to its pro-apoptotic and anti-proliferative action, there is an increased interest in PKR modulation as an anti-tumor strategy. PKR is overexpressed in breast cancer cells; however, the role of PKR in breast cancer cells is unclear. The expression/activity of PKR appears inversely related to the aggressiveness of breast cancer cells. The current study investigated the role of PKR in the motility/migration of breast cancer cells. The activation of PKR by a synthesized dsRNA (PIC significantly decreased the motility of several breast cancer cell lines (BT474, MDA-MB231 and SKBR3. PIC inhibited cell migration and blocked cell membrane ruffling without affecting cell viability. PIC also induced the reorganization of the actin cytoskeleton and impaired the formation of lamellipodia. These effects of PIC were reversed by the pretreatment of a selective PKR inhibitor. PIC also activated p38 mitogen-activated protein kinase (MAPK and its downstream MAPK-activated protein kinase 2 (MK2. PIC-induced activation of p38 MAPK and MK2 was attenuated by the PKR inhibitor and the PKR siRNA, but a selective p38 MAPK inhibitor (SB203580 or other MAPK inhibitors did not affect PKR activity, indicating that PKR is upstream of p38 MAPK/MK2. Cofilin is an actin severing protein and regulates membrane ruffling, lamellipodia formation and cell migration. PIC inhibited cofilin activity by enhancing its phosphorylation at Ser3. PIC activated LIM kinase 1 (LIMK1, an upstream kinase of cofilin in a p38 MAPK-dependent manner. We concluded that the activation of PKR suppressed cell motility by regulating the p38 MAPK/MK2/LIMK/cofilin pathway.

  12. Alternaria inhibits double-stranded RNA-induced cytokine production through Toll-like receptor 3. (United States)

    Wada, Kota; Kobayashi, Takao; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito


    Fungi may be involved in asthma and chronic rhinosinusitis (CRS). Peripheral blood mononuclear cells from CRS patients produce interleukin (IL)-5, IL-13 and interferon (IFN)-γ in the presence of Alternaria. In addition, Alternaria produces potent Th2-like adjuvant effects in the airway. Therefore, we hypothesized that Alternaria may inhibit Th1-type defense mechanisms against virus infection. Dendritic cells (DCs) were generated from mouse bone marrow. The functional responses were assessed by expression of cell surface molecules by FACS (MHC class II, CD40, CD80, CD86 and OX40L). Production of IL-6, chemokine CXCL10 (IP-10), chemokine CXCL11 (I-TAC) and IFN-β was measured by ELISA. Toll-like receptor 3 (TLR3) mRNA and protein expression was detected by quantitative real-time PCR and Western blot. Alternaria and polyinosinic-polycytidylic acid (poly I:C) enhanced cell surface expression of MHC class II, CD40, CD80, CD86 and OX40L, and IL-6 production in a concentration-dependent manner. However, Alternaria significantly inhibited production of IP-10, I-TAC and IFN-β, induced by viral double-stranded RNA (dsRNA) mimic poly I:C. TLR3 mRNA expression and protein production by poly I:C were significantly inhibited by Alternaria. These reactions are likely caused by heat-stable factor(s) in Alternaria extract with >100 kDa molecular mass. These findings suggest that the fungus Alternaria may inhibit production of IFN-β and other cytokines by DCs by suppressing TLR3 expression. These results indicate that Alternaria may inhibit host innate immunity against virus infection. Copyright © 2013 S. Karger AG, Basel.

  13. Alternaria Inhibits Double-stranded RNA-Induced Cytokines Productions through TLR3 (United States)

    Wada, Kota; Kobayashi, Takao; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito


    Background Fungi may be involved in asthma and chronic rhinosinusitis (CRS). PBMCs from CRS patients produce IL-5, IL-13 and INF-γ by Alternaria. In addition, Alternaria produces potent Th2-like adjuvant effects in the airway. Therefore, we hypothesized that Alternaria may inhibit Th1-type defense mechanisms against virus infection. Methods Dendritic cells (DCs) were generated from mouse bone marrow. The functional responses were assessed by expression of cell surface molecules by FACS (MHC Class II, CD40, CD80, CD86 and OX40L. Production of IL-6, IP-10, I-TAC and IFN -β were measured by ELISA. TLR3 mRNA and protein expression were detected by quantitative Real time-PCR and Western blot. Results Alternaria and poly I:C enhanced cell surface expression of MHC Class II, CD40, CD80, CD86 and OX40L, and IL-6 production in a concentration-dependent manner. However, Alternaria significantly inhibited IP-10, I-TAC and IFN-β production induced by viral double-stranded RNA (dsRNA)-mimic poly I:C. TLR3 mRNA expression and protein production by poly I:C were significantly inhibited by Alternaria. These reactions are likely caused by heat-stable factor(s) in Alternaria extract with >100 kDa molecular mass. Conclusion These findings suggest that fungus, Alternaria may inhibit production of IFN-β and other cytokines by DCs by suppressing TLR3 expression. These results indicate that Alternaria may inhibit host innate immunity against virus infection. PMID:23711857

  14. siRNA-like double-stranded RNAs are specifically protected against degradation in human cell extract.

    Directory of Open Access Journals (Sweden)

    John A H Hoerter

    Full Text Available RNA interference (RNAi is a set of intracellular pathways in eukaryotes that controls both exogenous and endogenous gene expression. The power of RNAi to knock down (silence any gene of interest by the introduction of synthetic small-interfering (siRNAs has afforded powerful insight into biological function through reverse genetic approaches and has borne a new field of gene therapeutics. A number of questions are outstanding concerning the potency of siRNAs, necessitating an understanding of how short double-stranded RNAs are processed by the cell. Recent work suggests unmodified siRNAs are protected in the intracellular environment, although the mechanism of protection still remains unclear. We have developed a set of doubly-fluorophore labeled RNAs (more precisely, RNA/DNA chimeras to probe in real-time the stability of siRNAs and related molecules by fluorescence resonance energy transfer (FRET. We find that these RNA probes are substrates for relevant cellular degradative processes, including the RNase H1 mediated degradation of an DNA/RNA hybrid and Dicer-mediated cleavage of a 24-nucleotide (per strand double-stranded RNA. In addition, we find that 21- and 24-nucleotide double-stranded RNAs are relatively protected in human cytosolic cell extract, but less so in blood serum, whereas an 18-nucleotide double-stranded RNA is less protected in both fluids. These results suggest that RNAi effector RNAs are specifically protected in the cellular environment and may provide an explanation for recent results showing that unmodified siRNAs in cells persist intact for extended periods of time.

  15. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail:


    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  16. Role of alfalfa mosaic virus coat protein in regulation of the balance between viral plus and minus strand RNA synthesis

    NARCIS (Netherlands)

    van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.


    Replication of wild type RNA 3 of alfalfa mosaic virus (AIMV) and mutants with frameshifts in the P3 or coat protein (CP) genes was studied in protoplasts from tobacco plants transformed with DNA copies of AIMV RNAs 1 and 2. Accumulation of viral plus and minus strand RNAs was monitored with

  17. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage. (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime


    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  18. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes. (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M


    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  19. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  20. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.


    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  1. Large-scale production and antiviral efficacy of multi-target double-stranded RNA for the prevention of white spot syndrome virus (WSSV) in shrimp. (United States)

    Thammasorn, Thitiporn; Sangsuriya, Pakkakul; Meemetta, Watcharachai; Senapin, Saengchan; Jitrakorn, Sarocha; Rattanarojpong, Triwit; Saksmerprome, Vanvimon


    RNA interference (RNAi) is a specific and effective approach for inhibiting viral replication by introducing double-stranded (ds)RNA targeting the viral gene. In this study, we employed a combinatorial approach to interfere multiple gene functions of white spot syndrome virus (WSSV), the most lethal shrimp virus, using a single-batch of dsRNA, so-called "multi-WSSV dsRNA." A co-cultivation of RNase-deficient E. coli was developed to produce dsRNA targeting a major structural protein (VP28) and a hub protein (WSSV051) with high number of interacting protein partners. For a co-cultivation of transformed E. coli, use of Terrific broth (TB) medium was shown to improve the growth of the E. coli and multi-WSSV dsRNA yields as compared to the use of Luria Bertani (LB) broth. Co-culture expression was conducted under glycerol feeding fed-batch fermentation. Estimated yield of multi-WSSV dsRNA (μg/mL culture) from the fed-batch process was 30 times higher than that obtained under a lab-scale culture with LB broth. Oral delivery of the resulting multi-WSSV dsRNA reduced % cumulative mortality and delayed average time to death compared to the non-treated group after WSSV challenge. The present study suggests a co-cultivation technique for production of antiviral dsRNA with multiple viral targets. The optimal multi-WSSV dsRNA production was achieved by the use of glycerol feeding fed-batch cultivation with controlled pH and dissolved oxygen. The cultivation technique developed herein should be feasible for industrial-scale RNAi applications in shrimp aquaculture. Interference of multiple viral protein functions by a single-batch dsRNA should also be an ideal approach for RNAi-mediated fighting against viruses, especially the large and complicated WSSV.

  2. Acquisition of functions on the outer capsid surface during evolution of double-stranded RNA fungal viruses. (United States)

    Mata, Carlos P; Luque, Daniel; Gómez-Blanco, Josué; Rodríguez, Javier M; González, José M; Suzuki, Nobuhiro; Ghabrial, Said A; Carrascosa, José L; Trus, Benes L; Castón, José R


    Unlike their counterparts in bacterial and higher eukaryotic hosts, most fungal viruses are transmitted intracellularly and lack an extracellular phase. Here we determined the cryo-EM structure at 3.7 Å resolution of Rosellinia necatrix quadrivirus 1 (RnQV1), a fungal double-stranded (ds)RNA virus. RnQV1, the type species of the family Quadriviridae, has a multipartite genome consisting of four monocistronic segments. Whereas most dsRNA virus capsids are based on dimers of a single protein, the ~450-Å-diameter, T = 1 RnQV1 capsid is built of P2 and P4 protein heterodimers, each with more than 1000 residues. Despite a lack of sequence similarity between the two proteins, they have a similar α-helical domain, the structural signature shared with the lineage of the dsRNA bluetongue virus-like viruses. Domain insertions in P2 and P4 preferential sites provide additional functions at the capsid outer surface, probably related to enzyme activity. The P2 insertion has a fold similar to that of gelsolin and profilin, two actin-binding proteins with a function in cytoskeleton metabolism, whereas the P4 insertion suggests protease activity involved in cleavage of the P2 383-residue C-terminal region, absent in the mature viral particle. Our results indicate that the intimate virus-fungus partnership has altered the capsid genome-protective and/or receptor-binding functions. Fungal virus evolution has tended to allocate enzyme activities to the virus capsid outer surface.

  3. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.


    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  4. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.


    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  5. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification


    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei


    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  6. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.


    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  7. A novel virus-like double-stranded RNA in an obligate biotroph arbuscular mycorrhizal fungus: a hidden player in mycorrhizal symbiosis. (United States)

    Ikeda, Yoji; Shimura, Hanako; Kitahara, Ryoko; Masuta, Chikara; Ezawa, Tatsuhiro


    Arbuscular mycorrhizal (AM) fungi form mutualistic associations with most land plants and enhance phosphorus uptake of the host plants. Fungal viruses (mycoviruses) that possess a double-stranded RNA (dsRNA) genome often affect plant-fungal interactions via altering phenotypic expression of their host fungi. The present study demonstrates, for the first time, the presence of dsRNAs, which are highly likely to be mycoviruses, in AM fungi. dsRNA was extracted from mycelia of Glomus sp. strain RF1, purified, and subjected to electrophoresis. The fungus was found to harbor various dsRNA segments that differed in size. Among them, a 4.5-kbp segment was termed Glomus sp. strain RF1 virus-like medium dsRNA (GRF1V-M) and characterized in detail. The GRF1V-M genome segment was 4,557 nucleotides in length and encoded RNA-dependent RNA polymerase and a structural protein. GRF1V-M was phylogenetically distinct and could not be assigned to known genera of mycovirus. The GRF1V-M-free culture line of Glomus sp. strain RF1, which was raised by single-spore isolation, produced twofold greater number of spores and promoted plant growth more efficiently than the GRF1V-M-positive lines. These observations suggest that mycoviruses in AM fungi, at least some of them, have evolved under unique selection pressures and are a biologically active component in the symbiosis.

  8. Biophysical characterization of the association of histones with single-stranded DNA. (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier


    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis. (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef


    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  10. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study. (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero


    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  11. Characterization of Botrytis cinerea negative-stranded RNA virus 1, a new mycovirus related to plant viruses, and a reconstruction of host pattern evolution in negative-sense ssRNA viruses. (United States)

    Donaire, Livia; Pagán, Israel; Ayllón, María A


    The molecular characterization of a novel negative single-stranded RNA virus infecting the plant pathogenic fungus Botrytis cinerea is reported here. Comparison of the sequence of Botrytis cinerea negative-stranded RNA virus 1 (BcNSRV-1) showed a strong identity with RNA dependent RNA polymerases (RdRps) of plant pathogenic emaraviruses and tospoviruses. We have also found all the molecular signatures present in the RdRp of the genus Emaravirus and in other genera of family Bunyaviridae: the conserved TPD triplet and RY dinucleotide, the three basic residues in premotif A and the conserved motifs A, B, C, D, and E. Our results showed that BcNSRV-1 is phylogenetically close to members of the genus Emaravirus and of the family Bunyaviridae, and an ancestral state reconstruction using the conserved RdRp motifs of type members of each family of (-)ssRNA viruses indicated that BcNSRV-1 could possibly derive from an invertebrate and vertebrate-infecting virus. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Universal, colorimetric microRNA detection strategy based on target-catalyzed toehold-mediated strand displacement reaction (United States)

    Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu


    In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.

  13. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding. (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath


    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  14. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks. (United States)

    Pachkowski, Brian; Nakamura, Jun


    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  15. Developing single-molecule TPM experiments for direct observation of successful RecA-mediated strand exchange reaction. (United States)

    Fan, Hsiu-Fang; Cox, Michael M; Li, Hung-Wen


    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5'-to-3' fashion, using a synapse segment with a wide and continuous size distribution.

  16. A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis (United States)

    Rey, Félix A.


    The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS) proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132), which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region) suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation. PMID:28151973

  17. A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis.

    Directory of Open Access Journals (Sweden)

    Danilo Dubrau


    Full Text Available The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132, which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation.

  18. A universal and label-free impedimetric biosensing platform for discrimination of single nucleotide substitutions in long nucleic acid strands. (United States)

    Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y


    We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  20. The impact of base stacking on the conformations and electrostatics of single-stranded DNA. (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois


    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Measles virus C protein impairs production of defective copyback double-stranded viral RNA and activation of protein kinase R. (United States)

    Pfaller, Christian K; Radeke, Monte J; Cattaneo, Roberto; Samuel, Charles E


    Measles virus (MV) lacking expression of C protein (C(KO)) is a potent activator of the double-stranded RNA (dsRNA)-dependent protein kinase (PKR), whereas the isogenic parental virus expressing C protein is not. Here, we demonstrate that significant amounts of dsRNA accumulate during C(KO) mutant infection but not following parental virus infection. dsRNA accumulated during late stages of infection and localized with virus replication sites containing N and P proteins. PKR autophosphorylation and stress granule formation correlated with the timing of dsRNA appearance. Phospho-PKR localized to dsRNA-containing structures as revealed by immunofluorescence. Production of dsRNA was sensitive to cycloheximide but resistant to actinomycin D, suggesting that dsRNA is a viral product. Quantitative PCR (qPCR) analyses revealed reduced viral RNA synthesis and a steepened transcription gradient in C(KO) virus-infected cells compared to those in parental virus-infected cells. The observed alterations were further reflected in lower viral protein expression levels and reduced C(KO) virus infectious yield. RNA deep sequencing confirmed the viral RNA expression profile differences seen by qPCR between C(KO) mutant and parental viruses. After one subsequent passage of the C(KO) virus, defective interfering RNA (DI-RNA) with a duplex structure was obtained that was not seen with the parental virus. We conclude that in the absence of C protein, the amount of PKR activator RNA, including DI-RNA, is increased, thereby triggering innate immune responses leading to impaired MV growth.

  2. Amide linkages mimic phosphates in RNA interactions with proteins and are well tolerated in the guide strand of short interfering RNAs. (United States)

    Mutisya, Daniel; Hardcastle, Travis; Cheruiyot, Samwel K; Pallan, Pradeep S; Kennedy, Scott D; Egli, Martin; Kelley, Melissa L; Smith, Anja van Brabant; Rozners, Eriks


    While the use of RNA interference (RNAi) in molecular biology and functional genomics is a well-established technology, in vivo applications of synthetic short interfering RNAs (siRNAs) require chemical modifications. We recently found that amides as non-ionic replacements for phosphodiesters may be useful modifications for optimization of siRNAs. Herein, we report a comprehensive study of systematic replacement of a single phosphate with an amide linkage throughout the guide strand of siRNAs. The results show that amides are surprisingly well tolerated in the seed and central regions of the guide strand and increase the silencing activity when placed between nucleosides 10 and 12, at the catalytic site of Argonaute. A potential explanation is provided by the first crystal structure of an amide-modified RNA-DNA with Bacillus halodurans RNase H1. The structure reveals how small changes in both RNA and protein conformation allow the amide to establish hydrogen bonding interactions with the protein. Molecular dynamics simulations suggest that these alternative binding modes may compensate for interactions lost due to the absence of a phosphodiester moiety. Our results suggest that an amide can mimic important hydrogen bonding interactions with proteins required for RNAi activity and may be a promising modification for optimization of biological properties of siRNAs. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. The cellular RNA helicase UAP56 is required for prevention of double-stranded RNA formation during influenza A virus infection. (United States)

    Wisskirchen, Christian; Ludersdorfer, Thomas H; Müller, Dominik A; Moritz, Eva; Pavlovic, Jovan


    The cellular DEAD box RNA helicase UAP56 plays a pivotal role in the efficient transcription/replication of influenza A virus. UAP56 is recruited by the nucleoprotein (NP) of influenza A viruses, and recent data revealed that the RNA helicase is required for the nuclear export of a subset of spliced and unspliced viral mRNAs. The fact that influenza viruses do not produce detectable amounts of double-stranded RNA (dsRNA) intermediates during transcription/replication suggests the involvement of cellular RNA helicases. Hence, we examined whether the RNA-unwinding activity of UAP56 or its paralog URH49 plays a role in preventing the accumulation of dsRNA during infection. First, our data showed that not only UAP56 but also its paralog URH49 can interact with NPs of avian and human influenza A viruses. The small interfering RNA (siRNA)-mediated depletion of either RNA helicase reduced the transport of M1 and hemagglutinin (HA) mRNAs and, to a lesser extent, NP and NS1 mRNAs into the cytoplasm. Moreover, we found that virus infection of UAP56-depleted cells leads to the rapid accumulation of dsRNA in the perinuclear region. In parallel, we observed a robust virus-mediated activation of dsRNA-dependent protein kinase R (PKR), indicating that the cellular RNA helicase UAP56 may be recruited by influenza virus to prevent dsRNA formation. The accumulation of dsRNA was blocked when actinomycin D or cycloheximide was used to inhibit viral transcription/replication or translation, respectively. In summary, we demonstrate that UAP56 is utilized by influenza A viruses to prevent the formation of dsRNA and, hence, the activation of the innate immune response.

  4. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.


    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  5. Crystallization of the avian reovirus double-stranded RNA-binding and core protein σA

    Energy Technology Data Exchange (ETDEWEB)

    Hermo-Parrado, X. Lois; Guardado-Calvo, Pablo [Departamento de Bioquímica y Biología Molecular, Facultad de Farmacia, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Llamas-Saiz, Antonio L. [Unidad de Difracción de Rayos X, Laboratorio Integral de Dinámica y Estructura de Biomoléculas José R. Carracido, Edificio CACTUS, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Fox, Gavin C. [Spanish CRG Beamline BM16, European Synchrotron Radiation Facility (ESRF), 6 Rue Jules Horowitz, BP 220, F-38043 Grenoble (France); Vazquez-Iglesias, Lorena; Martínez-Costas, José; Benavente, Javier [Departamento de Bioquímica y Biología Molecular, Facultad de Farmacia, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Raaij, Mark J. van, E-mail: [Departamento de Bioquímica y Biología Molecular, Facultad de Farmacia, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Unidad de Difracción de Rayos X, Laboratorio Integral de Dinámica y Estructura de Biomoléculas José R. Carracido, Edificio CACTUS, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain)


    The avian reovirus double-stranded RNA-binding and core protein σA has been crystallized in space group P1, with unit-cell parameters a = 103.2, b = 129.9, c = 144.0 Å, α = 93.8, β = 105.1, γ = 98.2°. A complete data set has been collected to 2.3 Å resolution and analyzed. The avian reovirus protein σA plays a dual role: it is a structural protein forming part of the transcriptionally active core, but it has also been implicated in the resistance of the virus to interferon by strongly binding double-stranded RNA and thus inhibiting the double-stranded RNA-dependent protein kinase. The σA protein has been crystallized from solutions containing ammonium sulfate at pH values around 6. Crystals belonging to space group P1, with unit-cell parameters a = 103.2, b = 129.9, c = 144.0 Å, α = 93.8, β = 105.1, γ = 98.2° were grown and a complete data set has been collected to 2.3 Å resolution. The self-rotation function suggests that σA may form symmetric arrangements in the crystals.

  6. Crystallization of the avian reovirus double-stranded RNA-binding and core protein σA

    International Nuclear Information System (INIS)

    Hermo-Parrado, X. Lois; Guardado-Calvo, Pablo; Llamas-Saiz, Antonio L.; Fox, Gavin C.; Vazquez-Iglesias, Lorena; Martínez-Costas, José; Benavente, Javier; Raaij, Mark J. van


    The avian reovirus double-stranded RNA-binding and core protein σA has been crystallized in space group P1, with unit-cell parameters a = 103.2, b = 129.9, c = 144.0 Å, α = 93.8, β = 105.1, γ = 98.2°. A complete data set has been collected to 2.3 Å resolution and analyzed. The avian reovirus protein σA plays a dual role: it is a structural protein forming part of the transcriptionally active core, but it has also been implicated in the resistance of the virus to interferon by strongly binding double-stranded RNA and thus inhibiting the double-stranded RNA-dependent protein kinase. The σA protein has been crystallized from solutions containing ammonium sulfate at pH values around 6. Crystals belonging to space group P1, with unit-cell parameters a = 103.2, b = 129.9, c = 144.0 Å, α = 93.8, β = 105.1, γ = 98.2° were grown and a complete data set has been collected to 2.3 Å resolution. The self-rotation function suggests that σA may form symmetric arrangements in the crystals

  7. The double-stranded RNA-activated protein kinase mediates viral-induced encephalitis

    International Nuclear Information System (INIS)

    Scheuner, Donalyn; Gromeier, Matthias; Davies, Monique V.; Dorner, Andrew J.; Song Benbo; Patel, Rupali V.; Wimmer, Eckard J.; McLendon, Roger E.; Kaufman, Randal J.


    The double-stranded (ds) RNA-activated protein kinase (PKR) plays an important role in control of viral infections and cell growth. We have studied the role of PKR in viral infection in mice that are defective in the PKR signaling pathway. Transgenic mice were derived that constitutively express a trans-dominant-negative kinase-defective mutant PKR under control of the β-actin promoter. The trans-dominant-negative PKR mutant expressing transgenic mice do not have a detectable phenotype, similar to observations with PKR knock-out mice. The requirement for PKR in viral pathogenesis was studied by intracerebral infection of mice with a mouse-adapted poliovirus. Histopathological analysis revealed diffuse encephalomyelitis with severe inflammatory lesions throughout the central nervous system (CNS) in infected wild-type mice. In contrast, histopathological evaluation of virus-injected trans-dominant-negative PKR transgenic mice as well as PKR knock-out mice yielded no signs of tissue damage associated with inflammatory host responses. However, the virus did replicate in both models of PKR-deficient mice at a level equal to that observed in wild-type infected mice. Although the results indicate a clear difference in susceptibility to poliovirus-induced encephalitis, this difference manifests clinically as a slight delay in fatal neuropathy in trans-dominant-negative PKR transgenic and PKR knock-out animals. Our observations support the finding that viral-induced PKR activation may play a significant role in pathogenesis by mediating the host response to viral CNS infection. They support PKR to be an effective target to control tissue damage due to deleterious host responses to viral infection

  8. An Approach to Detect and Study DNA Double-Strand Break Repair by Transcript RNA Using a Spliced-Antisense RNA Template. (United States)

    Keskin, Havva; Storici, Francesca


    A double-strand break (DSB) is one of the most dangerous DNA lesion, and its repair is crucial for genome stability. Homologous recombination is considered the safest way to repair a DNA DSB and requires an identical or nearly identical DNA template, such as a sister chromatid or a homologous chromosome for accurate repair. Can transcript RNA serve as donor template for DSB repair? Here, we describe an approach that we developed to detect and study DNA repair by transcript RNA. Key features of the method are: (i) use of antisense (noncoding) RNA as template for DSB repair by RNA, (ii) use of intron splicing to distinguish the sequence of the RNA template from that of the DNA that generates the RNA template, and (iii) use of a trans and cis system to study how RNA repairs a DSB in homologous but distant DNA or in its own DNA, respectively. This chapter provides details on how to use a spliced-antisense RNA template to detect and study DSB repair by RNA in trans or cis in yeast cells. Our approach for detection of DSB repair by RNA in cells can be applied to cell types other than yeast, such as bacteria, mammalian cells, or other eukaryotic cells. © 2018 Elsevier Inc. All rights reserved.

  9. Cellular 5'-3' mRNA exonuclease Xrn1 controls double-stranded RNA accumulation and anti-viral responses. (United States)

    Burgess, Hannah M; Mohr, Ian


    By accelerating global mRNA decay, many viruses impair host protein synthesis, limiting host defenses and stimulating virus mRNA translation. Vaccinia virus (VacV) encodes two decapping enzymes (D9, D10) that remove protective 5' caps on mRNAs, presumably generating substrates for degradation by the host exonuclease Xrn1. Surprisingly, we find VacV infection of Xrn1-depleted cells inhibits protein synthesis, compromising virus growth. These effects are aggravated by D9 deficiency and dependent upon a virus transcription factor required for intermediate and late mRNA biogenesis. Considerable double-stranded RNA (dsRNA) accumulation in Xrn1-depleted cells is accompanied by activation of host dsRNA-responsive defenses controlled by PKR and 2'-5' oligoadenylate synthetase (OAS), which respectively inactivate the translation initiation factor eIF2 and stimulate RNA cleavage by RNase L. This proceeds despite VacV-encoded PKR and RNase L antagonists being present. Moreover, Xrn1 depletion sensitizes uninfected cells to dsRNA treatment. Thus, Xrn1 is a cellular factor regulating dsRNA accumulation and dsRNA-responsive innate immune effectors. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen


    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  11. Long-term suppression of HIV-1C virus production in human peripheral blood mononuclear cells by LTR heterochromatization with a short double-stranded RNA. (United States)

    Singh, Anand; Palanichamy, Jayanth K; Ramalingam, Pradeep; Kassab, Muzaffer A; Bhagat, Mohita; Andrabi, Raiees; Luthra, Kalpana; Sinha, Subrata; Chattopadhyay, Parthaprasad


    A region in the conserved 5' long terminal repeat (LTR) promoter of the integrated HIV-1C provirus was identified for effective targeting by a short double-stranded RNA (dsRNA) to cause heterochromatization leading to a long-lasting decrease in viral transcription, replication and subsequent productive infection in human host cells. Small interfering RNAs (siRNAs) were transfected into siHa cells containing integrated LTR-luciferase reporter constructs and screened for efficiency of inducing transcriptional gene silencing (TGS). TGS was assessed by a dual luciferase assay and real-time PCR. Chromatin modification at the targeted region was also studied. The efficacy of potent siRNA was then checked for effectiveness in TZM-bl cells and human peripheral blood mononuclear cells (PBMCs) infected with HIV-1C virus. Viral Gag-p24 antigen levels were determined by ELISA. One HIV-1C LTR-specific siRNA significantly decreased luciferase activity and its mRNA expression with no such effect on HIV-1B LTR. This siRNA-mediated TGS was induced by histone methylation, which leads to heterochromatization of the targeted LTR region. The same siRNA also substantially suppressed viral replication in TZM-bl cells and human PBMCs infected with various HIV-1C clinical isolates for ≥3 weeks after a single transfection, even of a strain that had a mismatch in the target region. We have identified a potent dsRNA that causes long-term suppression of HIV-1C virus production in vitro and ex vivo by heritable epigenetic modification at the targeted C-LTR region. This dsRNA has promising therapeutic potential in HIV-1C infection, the clade responsible for more than half of AIDS cases worldwide.

  12. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.


    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  13. Radiobiological study on DNA strand breaks and repair using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Ikushima, Takaji


    Single cell gel electrophoresis (SCGE) provides a novel method to measure DNA damage in individual cells and more importantly, to assess heterogeneity in response within a mixed population of cells. Cells embedded in agarose are lysed, subjected to electrophoresis, stained with a fluorescent DNA-specific dye, and viewed under a fluorescence microscope. Damaged cells display 'comets', broken DNA migrating farther to the anode in the electric field. We have previously used this technique to quantify DNA damage induced by moderate doses of low and high LET radiations in cultured Chinese hamster cells. The assay has been optimized in terms of lysing and electrophoresis conditions, and applied to analyse the DNA strand breaks, their repair kinetics and heterogeneity in response in individual Chinese hamster cells exposed to gamma-rays, and to KUR thermal neutrons with and without 10 B or to KEK PF monochromatic soft X-rays as well as to a radio-mimetic agent, neocarzinostatin. The DNA double-strand breaks induced by boron-neutron captured reactions were repaired at a slower rate, but a heterogeneity in response might not contribute to the difference. The neocarzinostatin-induced DNA damage were efficiently repaired in a dose-dependent fashion. The initial amount of gamma-ray induced DNA double-strand breaks was not significantly altered in cells pre-exposed to very low adapting dose. (author)

  14. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.


    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  15. Double-stranded RNA induces similar pulmonary dysfunction to respiratory syncytial virus in BALB/c mice. (United States)

    Aeffner, Famke; Traylor, Zachary P; Yu, Erin N Z; Davis, Ian C


    Both respiratory syncytial virus (RSV) and influenza A virus induce nucleotide/P2Y purinergic receptor-mediated impairment of alveolar fluid clearance (AFC), which contributes to formation of lung edema. Although genetically dissimilar, both viruses generate double-stranded RNA replication intermediates, which act as Toll-like receptor (TLR)-3 ligands. We hypothesized that double-stranded RNA/TLR-3 signaling underlies nucleotide-mediated inhibition of amiloride-sensitive AFC in both infections. We found that addition of the synthetic double-stranded RNA analog poly-inosinic-cytidylic acid [poly(I:C)] (500 ng/ml) to the AFC instillate resulted in nucleotide/P2Y purinergic receptor-mediated inhibition of amiloride-sensitive AFC in BALB/c mice but had no effect on cystic fibrosis transmembrane regulator (CFTR)-mediated Cl(-) transport. Poly(I:C) also induced acute keratinocyte cytokine-mediated AFC insensitivity to stimulation by the β-adrenergic agonist terbutaline. Inhibitory effects of poly(I:C) on AFC were absent in TLR-3(-/-) mice and were not replicated by addition to the AFC instillate of ligands for other TLRs except TLR-2. Intranasal poly(I:C) administration (250 μg/mouse) similarly induced nucleotide-dependent AFC inhibition 2-3 days later, together with increased lung water content and neutrophilic inflammation. Intranasal treatment of BALB/c mice with poly(I:C) did not induce airway hyperresponsiveness at day 2 but did result in insensitivity to airway bronchodilation by β-adrenergic agonists. These findings suggest that viral double-stranded RNA replication intermediates induce nucleotide-mediated impairment of amiloride-sensitive AFC in both infections, together with β-adrenergic agonist insensitivity. Both of these effects also occur in RSV infection. However, double-stranded RNA replication intermediates do not appear to be sufficient to induce either adenosine-mediated, CFTR-dependent Cl(-) secretion in the lung or severe, lethal hypoxemia, both

  16. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted


    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  17. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams


    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  18. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora. (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E


    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  19. An RNA toolbox for single-molecule force spectroscopy studies

    NARCIS (Netherlands)

    Vilfan, I.D.; Kamping, W.; Van den Hout, M.; Candelli, A.; Hage, S.; Dekker, N.H.


    Precise, controllable single-molecule force spectroscopy studies of RNA and RNA-dependent processes have recently shed new light on the dynamics and pathways of RNA folding and RNAenzyme interactions. A crucial component of this research is the design and assembly of an appropriate RNA construct.

  20. Characterizing the mechanism of action of double-stranded RNA activity against western corn rootworm (Diabrotica virgifera virgifera LeConte.

    Directory of Open Access Journals (Sweden)

    Renata Bolognesi

    Full Text Available RNA interference (RNAi has previously been shown to be effective in western corn rootworm (WCR, Diabrotica virgifera virgifera LeConte larvae via oral delivery of synthetic double-stranded RNA (dsRNA in an artificial diet bioassay, as well as by ingestion of transgenic corn plant tissues engineered to express dsRNA. Although the RNAi machinery components appear to be conserved in Coleopteran insects, the key steps in this process have not been reported for WCR. Here we characterized the sequence of events that result in mortality after ingestion of a dsRNA designed against WCR larvae. We selected the Snf7 ortholog (DvSnf7 as the target mRNA, which encodes an essential protein involved in intracellular trafficking. Our results showed that dsRNAs greater than or equal to approximately 60 base-pairs (bp are required for biological activity in artificial diet bioassays. Additionally, 240 bp dsRNAs containing a single 21 bp match to the target sequence were also efficacious, whereas 21 bp short interfering (si RNAs matching the target sequence were not. This result was further investigated in WCR midgut tissues: uptake of 240 bp dsRNA was evident in WCR midgut cells while a 21 bp siRNA was not, supporting the size-activity relationship established in diet bioassays. DvSnf7 suppression was observed in a time-dependent manner with suppression at the mRNA level preceding suppression at the protein level when a 240 bp dsRNA was fed to WCR larvae. DvSnf7 suppression was shown to spread to tissues beyond the midgut within 24 h after dsRNA ingestion. These events (dsRNA uptake, target mRNA and protein suppression, systemic spreading, growth inhibition and eventual mortality comprise the overall mechanism of action by which DvSnf7 dsRNA affects WCR via oral delivery and provides insights as to how targeted dsRNAs in general are active against insects.

  1. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Directory of Open Access Journals (Sweden)

    Nidhi Thakur

    Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  2. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene. (United States)

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K


    Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  3. Profile and functional analysis of small RNAs derived from Aspergillus fumigatus infected with double-stranded RNA mycoviruses. (United States)

    Özkan, Selin; Mohorianu, Irina; Xu, Ping; Dalmay, Tamas; Coutts, Robert H A


    Mycoviruses are viruses that naturally infect and replicate in fungi. Aspergillus fumigatus, an opportunistic pathogen causing fungal lung diseases in humans and animals, was recently shown to harbour several different types of mycoviruses. A well-characterised defence against virus infection is RNA silencing. The A. fumigatus genome encodes essential components of the RNA silencing machinery, including Dicer, Argonaute and RNA-dependent RNA polymerase (RdRP) homologues. Active silencing of double-stranded (ds)RNA and the generation of small RNAs (sRNAs) has been shown for several mycoviruses and it is anticipated that a similar mechanism will be activated in A. fumigatus isolates infected with mycoviruses. To investigate the existence and nature of A. fumigatus sRNAs, sRNA-seq libraries of virus-free and virus-infected isolates were created using Scriptminer adapters and compared. Three dsRNA viruses were investigated: Aspergillus fumigatus partitivirus-1 (AfuPV-1, PV), Aspergillus fumigatus chrysovirus (AfuCV, CV) and Aspergillus fumigatus tetramycovirus-1 (AfuTmV-1, NK) which were selected because they induce phenotypic changes such as coloration and sectoring. The dsRNAs of all three viruses, which included two conventionally encapsidated ones PV and CV and one unencapsidated example NK, were silenced and yielded characteristic vsiRNAs together with co-incidental silencing of host fungal genes which shared sequence homology with the viral genomes. Virus-derived sRNAs were detected and characterised in the presence of virus infection. Differentially expressed A. fumigatus microRNA-like (miRNA-like) sRNAs and small interfering RNAs (siRNAs) were detected and validated. Host sRNA loci which were differentially expressed as a result of virus infection were also identified. To our knowledge, this is the first study reporting the sRNA profiles of A. fumigatus isolates.

  4. Amide linkages mimic phosphates in RNA interactions with proteins and are well tolerated in the guide strand of short interfering RNAs (United States)

    Mutisya, Daniel; Hardcastle, Travis; Cheruiyot, Samwel K.; Pallan, Pradeep S.; Kennedy, Scott D.; Egli, Martin; Kelley, Melissa L.; Smith, Anja van Brabant


    Abstract While the use of RNA interference (RNAi) in molecular biology and functional genomics is a well-established technology, in vivo applications of synthetic short interfering RNAs (siRNAs) require chemical modifications. We recently found that amides as non-ionic replacements for phosphodiesters may be useful modifications for optimization of siRNAs. Herein, we report a comprehensive study of systematic replacement of a single phosphate with an amide linkage throughout the guide strand of siRNAs. The results show that amides are surprisingly well tolerated in the seed and central regions of the guide strand and increase the silencing activity when placed between nucleosides 10 and 12, at the catalytic site of Argonaute. A potential explanation is provided by the first crystal structure of an amide-modified RNA–DNA with Bacillus halodurans RNase H1. The structure reveals how small changes in both RNA and protein conformation allow the amide to establish hydrogen bonding interactions with the protein. Molecular dynamics simulations suggest that these alternative binding modes may compensate for interactions lost due to the absence of a phosphodiester moiety. Our results suggest that an amide can mimic important hydrogen bonding interactions with proteins required for RNAi activity and may be a promising modification for optimization of biological properties of siRNAs. PMID:28854734

  5. Amide linkages mimic phosphates in RNA interactions with proteins and are well tolerated in the guide strand of short interfering RNAs

    Energy Technology Data Exchange (ETDEWEB)

    Mutisya, Daniel; Hardcastle, Travis; Cheruiyot, Samwel K.; Pallan, Pradeep S.; Kennedy, Scott D.; Egli, Martin; Kelley, Melissa L.; Smith, Anja van Brabant; Rozners, Eriks


    While the use of RNA interference (RNAi) in molecular biology and functional genomics is a well-established technology, in vivo applications of synthetic short interfering RNAs (siRNAs) require chemical modifications. We recently found that amides as non-ionic replacements for phosphodiesters may be useful modifications for optimization of siRNAs. Herein, we report a comprehensive study of systematic replacement of a single phosphate with an amide linkage throughout the guide strand of siRNAs. The results show that amides are surprisingly well tolerated in the seed and central regions of the guide strand and increase the silencing activity when placed between nucleosides 10 and 12, at the catalytic site of Argonaute. A potential explanation is provided by the first crystal structure of an amide-modified RNA–DNA with Bacillus halodurans RNase H1. The structure reveals how small changes in both RNA and protein conformation allow the amide to establish hydrogen bonding interactions with the protein. Molecular dynamics simulations suggest that these alternative binding modes may compensate for interactions lost due to the absence of a phosphodiester moiety. Our results suggest that an amide can mimic important hydrogen bonding interactions with proteins required for RNAi activity and may be a promising modification for optimization of biological properties of siRNAs.

  6. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities. (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce


    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  7. Identification and molecular characterization of a new nonsegmented double-stranded RNA virus isolated from Culex mosquitoes in Japan. (United States)

    Isawa, Haruhiko; Kuwata, Ryusei; Hoshino, Keita; Tsuda, Yoshio; Sakai, Kouji; Watanabe, Shumpei; Nishimura, Miho; Satho, Tomomitsu; Kataoka, Michiyo; Nagata, Noriyo; Hasegawa, Hideki; Bando, Hisanori; Yano, Kazuhiko; Sasaki, Toshinori; Kobayashi, Mutsuo; Mizutani, Tetsuya; Sawabe, Kyoko


    Two infectious agents were isolated from Culex species mosquitoes in Japan and were identified as distinct strains of a new RNA virus by a method for sequence-independent amplification of viral nucleic acids. The virus designated Omono River virus (OMRV) replicated in mosquito cells in which it produced a severe cytopathic effect. Icosahedral virus particles of approximately 40 nm in diameter were detected in the cytoplasm of infected cells. The OMRV genome was observed to consist of a nonsegmented, 7.6-kb double-stranded RNA (dsRNA) and contain two overlapping open reading frames (ORFs), namely ORF1 and ORF2. ORF1 was found to encode a putative dsRNA-binding protein, a major capsid protein, and other putative proteins, which might be generated by co- and/or post-translational processing of the ORF1 polyprotein precursor, and ORF2 was found to encode a putative RNA-dependent RNA polymerase (RdRp), which could be translated as a fusion with the ORF1 product by a -1 ribosomal frameshift. Phylogenetic analysis based on RdRp revealed that OMRV is closely related to penaeid shrimp infectious myonecrosis virus and Drosophila totivirus, which are tentatively assigned to the family Totiviridae. These results indicated that OMRV is a new member of the family of nonsegmented dsRNA viruses infecting arthropod hosts, but not fungal or protozoan hosts. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids. (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi


    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification. (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei


    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  10. Viral double-strand RNA-binding proteins can enhance innate immune signaling by toll-like Receptor 3.

    Directory of Open Access Journals (Sweden)

    Yvonne Lai

    Full Text Available Toll-like Receptor 3 (TLR3 detects double-stranded (ds RNAs to activate innate immune responses. While poly(I:C is an excellent agonist for TLR3 in several cell lines and in human peripheral blood mononuclear cells, viral dsRNAs tend to be poor agonists, leading to the hypothesis that additional factor(s are likely required to allow TLR3 to respond to viral dsRNAs. TLR3 signaling was examined in a lung epithelial cell line by quantifying cytokine production and in human embryonic kidney cells by quantifying luciferase reporter levels. Recombinant 1b hepatitis C virus polymerase was found to enhance TLR3 signaling in the lung epithelial BEAS-2B cells when added to the media along with either poly(I:C or viral dsRNAs. The polymerase from the genotype 2a JFH-1 HCV was a poor enhancer of TLR3 signaling until it was mutated to favor a conformation that could bind better to a partially duplexed RNA. The 1b polymerase also co-localizes with TLR3 in endosomes. RNA-binding capsid proteins (CPs from two positive-strand RNA viruses and the hepadenavirus hepatitis B virus (HBV were also potent enhancers of TLR3 signaling by poly(I:C or viral dsRNAs. A truncated version of the HBV CP that lacked an arginine-rich RNA-binding domain was unable to enhance TLR3 signaling. These results demonstrate that several viral RNA-binding proteins can enhance the dsRNA-dependent innate immune response initiated by TLR3.

  11. Antiviral activity of double-stranded RNA-binding protein PACT against influenza A virus mediated via suppression of viral RNA polymerase. (United States)

    Chan, Chi-Ping; Yuen, Chun-Kit; Cheung, Pak-Hin Hinson; Fung, Sin-Yee; Lui, Pak-Yin; Chen, Honglin; Kok, Kin-Hang; Jin, Dong-Yan


    PACT is a double-stranded RNA-binding protein that has been implicated in host-influenza A virus (IAV) interaction. PACT facilitates the action of RIG-I in the activation of the type I IFN response, which is suppressed by the viral nonstructural protein NS1. PACT is also known to interact with the IAV RNA polymerase subunit PA. Exactly how PACT exerts its antiviral activity during IAV infection remains to be elucidated. In the current study, we demonstrated the interplay between PACT and IAV polymerase. Induction of IFN-β by the IAV RNP complex was most robust when both RIG-I and PACT were expressed. PACT-dependent activation of IFN-β production was suppressed by the IAV polymerase subunits, polymerase acidic protein, polymerase basic protein 1 (PB1), and PB2. PACT associated with PA, PB1, and PB2. Compromising PACT in IAV-infected A549 cells resulted in the augmentation of viral RNA (vRNA) transcription and replication and IFN-β production. Furthermore, vRNA replication was boosted by knockdown of PACT in both A549 cells and IFN-deficient Vero cells. Thus, the antiviral activity of PACT is mediated primarily via its interaction with and inhibition of IAV polymerase. Taken together, our findings reveal a new facet of the host-IAV interaction in which the interplay between PACT and IAV polymerase affects the outcome of viral infection and antiviral response.-Chan, C.-P., Yuen, C.-K., Cheung, P.-H. H., Fung, S.-Y., Lui, P.-Y., Chen, H., Kok, K.-H., Jin, D.-Y. Antiviral activity of double-stranded RNA-binding protein PACT against influenza A virus mediated via suppression of viral RNA polymerase.

  12. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.


    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  13. The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks. (United States)

    Balestrini, Alessia; Ristic, Dejan; Dionne, Isabelle; Liu, Xiao Z; Wyman, Claire; Wellinger, Raymund J; Petrini, John H J


    Single-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  14. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Alessia Balestrini


    Full Text Available Single-ended double-strand breaks (DSBs are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs.

  15. A Transformed Bacterium Expressing Double-Stranded RNA Specific to Integrin ?1 Enhances Bt Toxin Efficacy against a Polyphagous Insect Pest, Spodoptera exigua


    Kim, Eunseong; Park, Youngjin; Kim, Yonggyun


    Background Oral toxicity of double-stranded RNA (dsRNA) specific to integrin ?1 subunit (SeINT) was known in a polyphagous insect pest, Spodoptera exigua. For an application of the dsRNA to control the insect pest, this study prepared a transformed Escherichia coli expressing dsRNA specific to SeINT. Principal Findings The dsRNA expression was driven by T7 RNA polymerase overexpressed by an inducer in the transformed E. coli. The produced dsRNA amount was proportional to the number of the cul...

  16. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  17. Protection of Macrobrachium rosenbergii against white tail disease by oral administration of bacterial expressed and encapsulated double-stranded RNA. (United States)

    Naveen Kumar, Singaiah; Karunasagar, Indrani; Karunasagar, Iddya


    White tail disease (WTD) of cultured Macrobrachium rosenbergii is caused by M. rosenbergii nodavirus (MrNV) and an extra small virus (XSV), both present together, and the mortality rate can be as high as 100% within 2 or 3 days of infection. Possible protection of M. rosenbergii against WTD by oral administration of bacterial expressed and encapsulated double-stranded RNA (dsRNA) was studied. Juvenile M. rosenbergii were fed with the feed coated with inactivated bacteria encapsulated dsRNA of MrNV and XSV genes individually and in combination for 7 days followed by challenge with WTD causing agents at 24 h and 72 h post-feeding. Test animals fed with a combination of dsRNA of MrNV and XSV capsid genes showed the highest relative percent survival (RPS) when compared to other treatments with RPS of 80% and 75% at 24 and 72 h respectively. One hundred percent mortality was observed in test animals fed with control dsRNA coated feed. Although in the literature, injection is the most common method used to deliver dsRNA, this study shows that oral administration is effective, feasible and economical. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Double-Stranded RNA Derived from Lactic Acid Bacteria Augments Th1 ImmunityviaInterferon-β from Human Dendritic Cells. (United States)

    Kawashima, Tadaomi; Ikari, Naho; Watanabe, Yohei; Kubota, Yoshiro; Yoshio, Sachiyo; Kanto, Tatsuya; Motohashi, Shinichiro; Shimojo, Naoki; Tsuji, Noriko M


    Lactic acid bacteria (LAB) are one of the major commensal species in the small intestine and known for contributing to maintenance of protective immunity and immune homeostasis. However, currently there has been no evidence regarding the cellular mechanisms involved in the probiotic effects of LAB on human immune cells. Here, we demonstrated that LAB double-stranded RNA (dsRNA) triggered interferon-β (IFN-β) production by human dendritic cells (DCs), which activated IFN-γ-producing T cells. Interleukin-12 (IL-12) secretion from human DCs in response to LAB was abrogated by depletion of bacterial dsRNA, and was attenuated by neutralizing IFN-β, indicating LAB dsRNA primarily activated the IFN-β/IL-12 pathway. Moreover, the induction of IL-12 secretion from DCs by LAB was abolished by the inhibition of endosomal acidification, confirming the critical role of the endosomal digestion of LAB. In a coculture of human naïve CD4 + T cells and BDCA1 + DCs, DCs stimulated with LAB containing dsRNA induced IFN-γ-producing T cells. These results indicate that human DCs activated by LAB enhance Th1 immunity depending on IFN-β secretion in response to bacterial dsRNA.

  19. Using double-stranded RNA for the control of Laem-Singh Virus (LSNV) in Thai P. monodon. (United States)

    Saksmerprome, Vanvimon; Thammasorn, Thitiporn; Jitrakorn, Sarocha; Wongtripop, Somjai; Borwornpinyo, Suparerk; Withyachumnarnkul, Boonsirm


    Viral inhibition by double-stranded (ds)RNA is a potential therapeutic approach for controlling shrimp viral diseases. Here, we describe the successful oral application of dsRNA targeting Laem-Singh Virus (LSNV) to diminish monodon slow growth syndrome (MSGS) in Thai Penaeus monodon. Shrimp feed formulated with bacterially expressed LSNV-dsRNA was given to shrimp for 9 weeks. RT-PCR results revealed that all control shrimp were LSNV-positive at the end of experiment, while the shrimp that received dsRNA-feed exhibited 20-60% LSNV reduction. The average body weight of treated shrimp (number of shrimp=100) was significantly higher than that of the control group. Such increase is likely due to the elimination of MSGS caused by LSNV, as size variation of the treated group is much lower than that in the control group. This study demonstrates for the first time that feed with LSNV-specific dsRNA promotes the overall growth of P. monodon and relieves MSGS condition in LSNV-infected shrimp. The work reaffirms the potential of dsRNA application for controlling viral disease in shrimp farming. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns. (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John


    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  1. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles. (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha


    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  2. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong


    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  3. The interaction between the helicase DHX33 and IPS-1 as a novel pathway to sense double-stranded RNA and RNA viruses in myeloid dendritic cells. (United States)

    Liu, Ying; Lu, Ning; Yuan, Bin; Weng, Leiyun; Wang, Feng; Liu, Yong-Jun; Zhang, Zhiqiang


    In eukaryotes, there are at least 60 members of the DExD/H helicase family, many of which are able to sense viral nucleic acids. By screening all known family members, we identified the helicase DHX33 as a novel double-stranded RNA (dsRNA) sensor in myeloid dendritic cells (mDCs). The knockdown of DHX33 using small heteroduplex RNA (shRNA) blocked the ability of mDCs to produce type I interferon (IFN) in response to poly I:C and reovirus. The HELICc domain of DHX33 was shown to bind poly I:C. The interaction between DHX33 and IPS-1 is mediated by the HELICc region of DHX33 and the C-terminal domain of IPS-1 (also referred to MAVS and VISA). The inhibition of DHX33 expression by RNA interference blocked the poly I:C-induced activation of MAP kinases, NF-κB and IRF3. The interaction between the helicase DHX33 and IPS-1 was independent of RIG-I/MDA5 and may be a novel pathway for sensing poly I:C and RNA viruses in mDCs.

  4. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.


    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  5. Mutations Abrogating VP35 Interaction with Double-Stranded RNA Render Ebola Virus Avirulent in Guinea Pigs

    Energy Technology Data Exchange (ETDEWEB)

    Prins, Kathleen C.; Delpeut, Sebastien; Leung, Daisy W.; Reynard, Olivier; Volchkova, Valentina A.; Reid, St. Patrick; Ramanan, Parameshwaran; Cárdenas, Washington B.; Amarasinghe, Gaya K.; Volchkov, Viktor E.; Basler, Christopher F. (CNRS-INSERM); (Mount Sinai Hospital); (LB-Ecuador); (Iowa State)


    Ebola virus (EBOV) protein VP35 is a double-stranded RNA (dsRNA) binding inhibitor of host interferon (IFN)-{alpha}/{beta} responses that also functions as a viral polymerase cofactor. Recent structural studies identified key features, including a central basic patch, required for VP35 dsRNA binding activity. To address the functional significance of these VP35 structural features for EBOV replication and pathogenesis, two point mutations, K319A/R322A, that abrogate VP35 dsRNA binding activity and severely impair its suppression of IFN-{alpha}/{beta} production were identified. Solution nuclear magnetic resonance (NMR) spectroscopy and X-ray crystallography reveal minimal structural perturbations in the K319A/R322A VP35 double mutant and suggest that loss of basic charge leads to altered function. Recombinant EBOVs encoding the mutant VP35 exhibit, relative to wild-type VP35 viruses, minimal growth attenuation in IFN-defective Vero cells but severe impairment in IFN-competent cells. In guinea pigs, the VP35 mutant virus revealed a complete loss of virulence. Strikingly, the VP35 mutant virus effectively immunized animals against subsequent wild-type EBOV challenge. These in vivo studies, using recombinant EBOV viruses, combined with the accompanying biochemical and structural analyses directly correlate VP35 dsRNA binding and IFN inhibition functions with viral pathogenesis. Moreover, these studies provide a framework for the development of antivirals targeting this critical EBOV virulence factor.

  6. Complete sequence of a double-stranded RNA from the phytopathogenic fungus Erysiphe cichoracearum that might represent a novel endornavirus. (United States)

    Du, Zhenguo; Lin, Wenzhong; Qiu, Ping; Liu, Xiaojuan; Guo, Lingfang; Wu, Kangcheng; Zhang, Songbai; Wu, Zujian


    A double-stranded RNA (dsRNA) HBJZ1506 recovered from the phytopathogenic fungus Erysiphe cichoracearum infecting Calendula officinalis in Jingzhou, Hubei Province, China, was sequenced. HBJZ1506 comprises 11,908 nucleotides (nt) and contains a 11,859-nt-long open reading frame (ORF) coding for a polypeptide that is 61 % identical to that of a putative endornavirus named grapevine endophyte endornavirus (GeEV). The putative polyprotein has an RNA-dependent RNA polymerase (RdRp) domain and an RNA helicase domain, which show homology to and have an arrangement that is similar to that of their counterparts in approved or putative endornaviruses. In a phylogenetic tree constructed using amino acid sequences of the RdRp region of HBJZ1506 and selected endornaviruses, HBJZ1506 clustered with endornaviruses and formed a well-supported monophyletic branch with GeEV. These results suggest that HBJZ1506 might represent a novel endornavirus, for which the name Erysiphe cichoracearum endornavirus (EcEV) is proposed.

  7. Physicochemical properties of double-stranded RNA used to discover a reo-like virus from blue crab Callinectes sapidus. (United States)

    Bowers, Holly A; Messick, Gretchen A; Hanif, Ammar; Jagus, Rosemary; Carrion, Lee; Zmora, Oded; Schott, Eric J


    Mortality among blue crab Callinectes sapidus in soft shell production facilities is typically 25% or greater. The harvest, handling, and husbandry practices of soft shell crab production have the potential to spread or exacerbate infectious crab diseases. To investigate the possible role of viruses in soft shell crab mortalities, we took advantage of the physicochemical properties of double-stranded RNA (dsRNA) to isolate a putative virus genome. Further characterization confirmed the presence of a reo-like virus that possesses 12 dsRNA genome segments. The virus was present in >50% of dead or dying soft shell crabs, but fewer than 5% of healthy hard crabs. Injection of the virus caused mortality and resulted in the appearance of viral RNA and virus inclusions in hemocytes. The genome of the virus was partially sequenced and the information used to develop a reverse transcription polymerase chain reaction (RT-PCR) assay that is able to detect the virus genome in as little as 7.5 pg of total RNA. The molecular tools developed during this study will allow us to quantify prevalence of the blue crab reo-like virus in captive (soft shell facilities, aquaculture operations) and wild populations and facilitate understanding of the role this virus has in blue crab life history.

  8. Activation of innate antiviral immune response via double-stranded RNA-dependent RLR receptor-mediated necroptosis. (United States)

    Wang, Wei; Wang, Wei-Hua; Azadzoi, Kazem M; Su, Ning; Dai, Peng; Sun, Jianbin; Wang, Qin; Liang, Ping; Zhang, Wentao; Lei, Xiaoying; Yan, Zhen; Yang, Jing-Hua


    Viruses induce double-stranded RNA (dsRNA) in the host cells. The mammalian system has developed dsRNA-dependent recognition receptors such as RLRs that recognize the long stretches of dsRNA as PAMPs to activate interferon-mediated antiviral pathways and apoptosis in severe infection. Here we report an efficient antiviral immune response through dsRNA-dependent RLR receptor-mediated necroptosis against infections from different classes of viruses. We demonstrated that virus-infected A549 cells were efficiently killed in the presence of a chimeric RLR receptor, dsCARE. It measurably suppressed the interferon antiviral pathway but promoted IL-1β production. Canonical cell death analysis by morphologic assessment, phosphatidylserine exposure, caspase cleavage and chemical inhibition excluded the involvement of apoptosis and consistently suggested RLR receptor-mediated necroptosis as the underlying mechanism of infected cell death. The necroptotic pathway was augmented by the formation of RIP1-RIP3 necrosome, recruitment of MLKL protein and the activation of cathepsin D. Contributing roles of RIP1 and RIP3 were confirmed by gene knockdown. Furthermore, the necroptosis inhibitor necrostatin-1 but not the pan-caspase inhibitor zVAD impeded dsCARE-dependent infected cell death. Our data provides compelling evidence that the chimeric RLR receptor shifts the common interferon antiviral responses of infected cells to necroptosis and leads to rapid death of the virus-infected cells. This mechanism could be targeted as an efficient antiviral strategy.

  9. The dengue virus conceals double-stranded RNA in the intracellular membrane to escape from an interferon response. (United States)

    Uchida, Leo; Espada-Murao, Lyre Anni; Takamatsu, Yuki; Okamoto, Kenta; Hayasaka, Daisuke; Yu, Fuxun; Nabeshima, Takeshi; Buerano, Corazon C; Morita, Kouichi


    The dengue virus (DENV) circulates between humans and mosquitoes and requires no other mammals or birds for its maintenance in nature. The virus is well-adapted to humans, as reflected by high-level viraemia in patients. To investigate its high adaptability, the DENV induction of host type-I interferon (IFN) was assessed in vitro in human-derived HeLa cells and compared with that induced by the Japanese encephalitis virus (JEV), a closely related arbovirus that generally exhibits low viraemia in humans. A sustained viral spread with a poor IFN induction was observed in the DENV-infected cells, whereas the JEV infection resulted in a self-limiting and abortive infection with a high IFN induction. There was no difference between DENV and JEV double-stranded RNA (dsRNA) as IFN inducers. Instead, the dsRNA was poorly exposed in the cytosol as late as 48 h post-infection (p.i.), despite the high level of DENV replication in the infected cells. In contrast, the JEV-derived dsRNA appeared in the cytosol as early as 24 h p.i. Our results provided evidence for the first time in DENV, that concealing dsRNA in the intracellular membrane diminishes the effect of the host defence mechanism, a strategy that differs from an active suppression of IFN activity.

  10. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.


    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  11. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan


    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  12. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik


    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  13. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.


    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  14. Visualization of DNA Double-Strand Break Repair at the Single-Molecule Level

    Energy Technology Data Exchange (ETDEWEB)

    Dynan, William S.; Li, Shuyi; Mernaugh, Raymond; Wragg, Stephanie; Takeda, Yoshihiko


    Exposure to low doses of ionizing radiation is universal. The signature injury from ionizing radiation exposure is induction of DNA double-strand breaks (DSBs). The first line of defense against DSBs is direct ligation of broken DNA ends via the nonhomologous end-joining pathway. Because even a relatively high environmental exposure induces only a few DSBs per cell, our current understanding of the response to this exposure is limited by the ability to measure DSB repair events reliably in situ at a single-molecule level. To address this need, we have taken advantage of biological amplification, measuring relocalization of proteins and detection of protein phosphorylation as a surrogate for detection of broken ends themselves. We describe the use of specific antibodies to investigate the kinetics and mechanism of repair of very small numbers of DSBs in human cells by the nonhomologous end-joining pathway.

  15. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata). (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian


    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  16. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  17. Strand-specific RNA-seq reveals widespread occurrence of novel cis-natural antisense transcripts in rice

    Directory of Open Access Journals (Sweden)

    Lu Tingting


    Full Text Available Abstract Background Cis-natural antisense transcripts (cis-NATs are RNAs transcribed from the antisense strand of a gene locus, and are complementary to the RNA transcribed from the sense strand. Common techniques including microarray approach and analysis of transcriptome databases are the major ways to globally identify cis-NATs in various eukaryotic organisms. Genome-wide in silico analysis has identified a large number of cis-NATs that may generate endogenous short interfering RNAs (nat-siRNAs, which participate in important biogenesis mechanisms for transcriptional and post-transcriptional regulation in rice. However, the transcriptomes are yet to be deeply sequenced to comprehensively investigate cis-NATs. Results We applied high-throughput strand-specific complementary DNA sequencing technology (ssRNA-seq to deeply sequence mRNA for assessing sense and antisense transcripts that were derived under salt, drought and cold stresses, and normal conditions, in the model plant rice (Oryza sativa. Combined with RAP-DB genome annotation (the Rice Annotation Project Database build-5 data set, 76,013 transcripts corresponding to 45,844 unique gene loci were assembled, in which 4873 gene loci were newly identified. Of 3819 putative rice cis-NATs, 2292 were detected as expressed and giving rise to small RNAs from their overlapping regions through integrated analysis of ssRNA-seq data and small RNA data. Among them, 503 cis-NATs seemed to be associated with specific conditions. The deep sequence data from isolated epidermal cells of rice seedlings further showed that 54.0% of cis-NATs were expressed simultaneously in a population of homogenous cells. Nearly 9.7% of rice transcripts were involved in one-to-one or many-to-many cis-NATs formation. Furthermore, only 17.4-34.7% of 223 many-to-many cis-NAT groups were all expressed and generated nat-siRNAs, indicating that only some cis-NAT groups may be involved in complex regulatory networks. Conclusions

  18. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    DEFF Research Database (Denmark)

    Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten


    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

  19. Killer toxin-secreting double-stranded RNA mycoviruses in the yeasts Hanseniaspora uvarum and Zygosaccharomyces bailii. (United States)

    Schmitt, M J; Neuhausen, F


    Killer toxin-secreting strains of the yeasts Hanseniaspora uvarum and Zygosaccharomyces bailii were shown to contain linear double-stranded RNAs (dsRNAs) that persist within the cytoplasm of the infected host cell as encapsidated virus-like particles. In both yeasts, L- and M-dsRNAs were associated with 85-kDa major capsid protein, whereas the additional Z-dsRNA (2.8 kb), present only in the wild-type Z. bailii killer strain, was capsid protein, whereas the additional Z-dsRNA (2.8 kb), present only in the wild-type Z. bailii killer strain, was shown to be encapsidated by a 35-kDa coat protein. Although Northern (RNA) blot hybridizations indicated that L-dsRNA from Z. bailii is a LA species, additional peptide maps of the purified 85-kDa capsid from Z. bailii and the 88- and 80-kDa major coat proteins from K1 and K28 killer viruses of Saccharomyces cerevisiae revealed distinctly different patterns of peptides. Electron microscopy of purified Z. bailii viruses (ZbV) identified icosahedral particles 40 nm in diameter which were undistinguishable from the S. cerevisiae killer viruses. We demonstrated that purified ZbVs are sufficient to confer the Z. bailii killer phenotype on transfected spheroplasts of a S. cerevisiae nonkiller strain and that the resulting transfectants secreted even more killer toxin that the original ZbV donor strain did. Curing experiments with ZbV-transfected S. cerevisiae strains indicated that the M-dsRNA satellite from Z. bailii contains the genetic information for toxin production, whereas expression of toxin immunity might be dependent on Z-dsRNA, which resembles a new dsRNA replicon in yeasts that is not dependent on an LA helper virus to be stably maintained and replicated within the cell. Images PMID:8107238

  20. A new virus discovered by immunocapture of double-stranded RNA, a rapid method for virus enrichment in metagenomic studies. (United States)

    Blouin, Arnaud G; Ross, Howard A; Hobson-Peters, Jody; O'Brien, Caitlin A; Warren, Ben; MacDiarmid, Robin


    Next-generation sequencing technologies enable the rapid identification of viral infection of diseased organisms. However, despite a consistent decrease in sequencing costs, it is difficult to justify their use in large-scale surveys without a virus sequence enrichment technique. As the majority of plant viruses have an RNA genome, a common approach is to extract the double-stranded RNA (dsRNA) replicative form, to enrich the replicating virus genetic material over the host background. The traditional dsRNA extraction is time-consuming and labour-intensive. We present an alternative method to enrich dsRNA from plant extracts using anti-dsRNA monoclonal antibodies in a pull-down assay. The extracted dsRNA can be amplified by reverse transcriptase-polymerase chain reaction and sequenced by next-generation sequencing. In our study, we have selected three distinct plant hosts: Māori potato (Solanum tuberosum), rengarenga (Arthropodium cirratum) and broadleaved dock (Rumex obtusifolius) representing a cultivated crop, a New Zealand-native ornamental plant and a weed, respectively. Of the sequence data obtained, 31-74% of the reads were of viral origin, and we identified five viruses including Potato virus Y and Potato virus S in potato; Turnip mosaic virus in rengarenga (a new host record); and in the dock sample Cherry leaf roll virus and a novel virus belonging to the genus Macluravirus. We believe that this new assay represents a significant opportunity to upscale virus ecology studies from environmental, primary industry and/or medical samples. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  1. Elimination of double strand nuclease activity from S1 nuclease prepared from crude alpha amylase. (United States)

    Hahn, W E; Van Ness, J


    Single strand-specific s1 nuclease prepared as previously described from crude alpha amylase by DEAE-cellulose chromatography also contains nuclease which degrades double strand nucleic acid. The double strand activity can be removed by repeating the DEAE-cellulose chromatography procedure at least two additional times. S1 nuclease prepared by this procedure does not degrade double strand sheared DNA as measured by Sephadex chromatography. Under the same conditions single strand DNA is completely degraded. Thus, S1 nuclease prepared by this procedure is suitable for use in removing single strand regions in DNA/DNA duplexes and DNA/RNA hybrids. PMID:940774

  2. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama


    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  3. OsRDR6 plays role in host defense against double-stranded RNA virus, Rice Dwarf Phytoreovirus. (United States)

    Hong, Wei; Qian, Dan; Sun, Runhong; Jiang, Lin; Wang, Yu; Wei, Chunhong; Zhang, Zhongkai; Li, Yi


    RNAi is a major antiviral defense response in plant and animal model systems. RNA-dependent RNA polymerase 6 (RDR6) is an essential component of RNAi, which plays an important role in the resistance against viruses in the model plants. We found previously that rice RDR6 (OsRDR6) functioned in the defense against Rice stripe virus (RSV), and Rice Dwarf Phytoreovirus (RDV) infection resulted in down-regulation of expression of RDR6. Here we report our new findings on the function of OsRDR6 against RDV. Our result showed that down-regulation of OsRDR6 through the antisense (OsRDR6AS) strategy increased rice susceptibility to RDV infection while over-expression of OsRDR6 had no effect on RDV infection. The accumulation of RDV vsiRNAs was reduced in the OsRDR6AS plants. In the OsRDR6 over-expressed plants, the levels of OsRDR6 RNA transcript and protein were much higher than that in the control plants. Interestingly, the accumulation level of OsRDR6 protein became undetectable after RDV infection. This finding indicated that the translation and/or stability of OsRDR6 protein were negatively impacted upon RDV infection. This new finding provides a new light on the function of RDR6 in plant defense response and the cross-talking between factors encoded by host plant and double-stranded RNA viruses.

  4. Chicken MDA5 senses short double-stranded RNA with implications for antiviral response against avian influenza viruses in chicken. (United States)

    Hayashi, Tsuyoshi; Watanabe, Chiaki; Suzuki, Yasushi; Tanikawa, Taichiro; Uchida, Yuko; Saito, Takehiko


    Mammalian melanoma differentiation-associated gene-5 (MDA5) and retinoic acid-inducible gene-I (RIG-I) selectively sense double-stranded RNA (dsRNA) according to length, as well as various RNA viruses to induce an antiviral response. RIG-I, which plays a predominant role in the induction of antiviral responses against influenza virus infection, has been considered to be lacking in chicken, putting the function of chicken MDA5 (chMDA5) under the spotlight. Here, we show that chMDA5, unlike mammalian MDA5, preferentially senses shorter dsRNA synthetic analogues, poly(I:C), in chicken DF-1 fibroblasts. A requirement for caspase activation and recruitment domains for chMDA5-mediated chicken interferon beta (chIFNβ) induction and its interaction with mitochondrial antiviral signaling proteins were demonstrated. We also found that chMDA5 is involved in chIFNβ induction against avian influenza virus infection. Our findings imply that chMDA5 compensates in part the function of RIG-I in chicken, and highlights the importance of chMDA5 in the innate immune response in chicken. © 2013 S. Karger AG, Basel.

  5. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni


    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  6. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.


    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  7. Characterization of the nanostructure of complexes formed by single- or double-stranded oligonucleotides with a cationic surfactant. (United States)

    Liu, Xiaoyang; Abbott, Nicholas L


    We report the use of dynamic light scattering (DLS), small-angle neutron scattering (SANS), and small-angle X-ray scattering (SAXS) to characterize the nanostructure of complexes formed by either single- or double-stranded oligonucleotides with a cationic surfactant (cetyltrimethylammonium bromide, CTAB) in aqueous solution (1 mM Li(2)SO(4)). For single-stranded oligonucleotides 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', both the appearance of two Bragg peaks (at 0.14 and 0.28 Å(-1)) in SAXS spectra with a spacing of 1:2 and form factor fits to SANS spectra are consistent with the presence of multilamellar vesicles (with, on average, 6-9 layers with a periodicity of 45-48 Å). Some samples showed evidence of an additional Bragg peak (at 0.20 Å(-1)) associated with periodic packing (with a periodicity of 31 Å) of the oligonucleotides within the lamellae of the nanostructure. The nucleotide composition of the single-stranded oligonucleotides was also found to impact the number and size of the complexes formed with CTAB. In contrast to 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', 5'-T(20)-3' did not change the state of aggregation of CTAB (globular micelles) over a wide range of oligonucleotide:CTAB charge ratios. These results support the proposition that hydrophobic interactions, as well as electrostatics, play a central role in the formation of complexes between cationic amphiphiles and single-stranded oligonucleotides and thus give rise to nanostructures that depend on nucleotide composition. In contrast to the single-stranded oligonucleotides, for double-stranded oligonucleotides mixed with CTAB, three Bragg peaks (0.13, 0.23, and 0.25 Å(-1)) in SAXS spectra with a spacing ratio of 1:√3:√4 and characteristic changes in SANS spectra indicate formation of a hexagonal nanostructure. Also, the composition of the double-stranded oligonucleotides did not measurably impact the nanostructure of complexes formed with CTAB, suggesting that electrostatic

  8. Dendritic cells activated by double-stranded RNA induce arthritis via autocrine type I IFN signaling. (United States)

    Narendra, Sudeep Chenna; Chalise, Jaya Prakash; Höök, Nina; Magnusson, Mattias


    Viral dsRNA can be found at the site of inflammation in RA patients, and intra-articular injection of dsRNA induces arthritis by activating type I IFN signaling in mice. Further, DCs, a major source of IFN-α, can be found in the synovium of RA patients. We therefore determined the occurrence of DCs in dsRNA-induced arthritis and their ability to induce arthritis. Here, we show, by immunohistochemistry, that cells expressing the pan-DC marker CD11c and the pDC marker 120G8 are present in the inflamed synovium in dsRNA-induced arthritis. Flt3L-generated and splenic DCs preactivated with dsRNA before intra-articular injection, but not mock-stimulated cells, clearly induced arthritis. Induction of arthritis was dependent on type I IFN signaling in the donor DCs, whereas IFNAR expression in the recipient was not required. Sorting of the Flt3L-DC population into cDCs (CD11c(+), PDCA-1(-)) and pDCs (CD11c(+), PDCA-1(+)) revealed that both subtypes were arthritogenic and produced type I IFN if treated with dsRNA. Taken together, these results demonstrate that viral nucleic acids can elicit arthritis by activating type I IFN signaling in DCs. Once triggered, autocrine type I IFN signaling in dsRNA-activated DCs is sufficient to propagate arthritis.

  9. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles. (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng


    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  10. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop. (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S


    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  11. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA. (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M


    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  12. BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction (United States)

    Townsley, Brad T.; Covington, Michael F.; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R.


    Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries. PMID:26052336

  13. BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction.

    Directory of Open Access Journals (Sweden)

    Brad Thomas Townsley


    Full Text Available Next Generation Sequencing (NGS is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing inherent properties of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE libraries and can easily extend to full transcript coverage shotgun (SHO type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.

  14. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.


    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  15. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.


    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  16. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak


    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  17. Alpha-lipoic acid effects on brain glial functions accompanying double-stranded RNA antiviral and inflammatory signaling. (United States)

    Scumpia, Philip O; Kelly-Scumpia, Kindra; Stevens, Bruce R


    Double-stranded RNAs (dsRNA) serve as viral ligands that trigger innate immunity in astrocytes and microglial, as mediated through Toll-like receptor 3 (TLR3) and dsRNA-dependent protein kinase (PKR). Beneficial transient TLR3 and PKR anti-viral signaling can become deleterious when events devolve into inflammation and cytotoxicity. Viral products in the brain cause glial cell dysfunction, and are a putative etiologic factor in neuropsychiatric disorders, notably schizophrenia, bipolar disorder, Parkinson's, and autism spectrum. Alpha-lipoic acid (LA) has been proposed as a possible therapeutic neuroprotectant. The objective of this study was to test our hypothesis that LA can control untoward antiviral mechanisms associated with neural dysfunction. Utilizing rat brain glial cultures (91% astrocytes:9% microglia) treated with PKR- and TLR3-ligand/viral mimetic dsRNA, polyinosinic-polycytidylic acid (polyI:C), we report in vitro glial antiviral signaling and LA reduction of the effects of this signaling. LA blunted the dsRNA-stimulated expression of IFNα/β-inducible genes Mx1, PKR, and TLR3. And in polyI:C treated cells, LA promoted gene expression of rate-limiting steps that benefit healthy neural redox status in glutamateric systems. To this end, LA decreased dsRNA-induced inflammatory signaling by downregulating IL-1β, IL-6, TNFα, iNOS, and CAT2 transcripts. In the presence of polyI:C, LA prevented cultured glial cytotoxicity which was correlated with increased expression of factors known to cooperatively control glutamate/cystine/glutathione redox cycling, namely glutamate uptake transporter GLAST/EAAT1, γ-glutamyl cysteine ligase catalytic and regulatory subunits, and IL-10. Glutamate exporting transporter subunits 4F2hc and xCT were downregulated by LA in dsRNA-stimulated glia. l-Glutamate net uptake was inhibited by dsRNA, and this was relieved by LA. Glutathione synthetase mRNA levels were unchanged by dsRNA or LA. This study demonstrates the protective

  18. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail:


    The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.

  19. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.


    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  20. Inhibition of antiviral innate immunity by birnavirus VP3 protein via blockage of viral double-stranded RNA binding to the host cytoplasmic RNA detector MDA5. (United States)

    Ye, Chengjin; Jia, Lu; Sun, Yanting; Hu, Boli; Wang, Lun; Lu, Xingmeng; Zhou, Jiyong


    Chicken MDA5 (chMDA5), the sole known pattern recognition receptor for cytoplasmic viral RNA in chickens, initiates type I interferon (IFN) production. Infectious bursal disease virus (IBDV) evades host innate immunity, but the mechanism is unclear. We report here that IBDV inhibited antiviral innate immunity via the chMDA5-dependent signaling pathway. IBDV infection did not induce efficient type I interferon (IFN) production but antagonized the antiviral activity of beta interferon (IFN-β) in DF-1 cells pretreated with IFN-α/β. Dual-luciferase assays and inducible expression systems demonstrated that IBDV protein VP3 significantly inhibited IFN-β expression stimulated by naked IBDV genomic double-stranded RNA (dsRNA). The VP3 protein competed strongly with chMDA5 to bind IBDV genomic dsRNA in vitro and in vivo, and VP3 from other birnaviruses also bound dsRNA. Site-directed mutagenesis confirmed that deletion of the VP3 dsRNA binding domain restored IFN-β expression. Our data demonstrate that VP3 inhibits antiviral innate immunity by blocking binding of viral genomic dsRNA to MDA5. MDA5, a known pattern recognition receptor and cytoplasmic viral RNA sensor, plays a critical role in host antiviral innate immunity. Many pathogens escape or inhibit the host antiviral immune response, but the mechanisms involved are unclear for most pathogens. We report here that birnaviruses inhibit host antiviral innate immunity via the MDA5-dependent signaling pathway. The antiviral innate immune system involving IFN-β did not function effectively during birnavirus infection, and the viral protein VP3 significantly inhibited IFN-β expression stimulated by naked viral genomic dsRNA. We also show that VP3 blocks MDA5 binding to viral genomic dsRNA in vitro and in vivo. Our data reveal that birnavirus-encoded viral protein VP3 is an inhibitor of the antiviral innate immune response and inhibits the antiviral innate immune response via the MDA5-dependent signaling pathway

  1. Ectromelia virus accumulates less double-stranded RNA compared to vaccinia virus in BS-C-1 cells. (United States)

    Frey, Tiffany R; Lehmann, Michael H; Ryan, Colton M; Pizzorno, Marie C; Sutter, Gerd; Hersperger, Adam R


    Most orthopoxviruses, including vaccinia virus (VACV), contain genes in the E3L and K3L families. The protein products of these genes have been shown to combat PKR, a host defense pathway. Interestingly, ectromelia virus (ECTV) contains an E3L ortholog but does not possess an intact K3L gene. Here, we gained insight into how ECTV can still efficiently evade PKR despite lacking K3L. Relative to VACV, we found that ECTV-infected BS-C-1 cells accumulated considerably less double-stranded (ds) RNA, which was due to lower mRNA levels and less transcriptional read-through of some genes by ECTV. The abundance of dsRNA in VACV-infected cells, detected using a monoclonal antibody, was able to activate the RNase L pathway at late time points post-infection. Historically, the study of transcription by orthopoxviruses has largely focused on VACV as a model. Our data suggest that there could be more to learn by studying other members of this genus. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Spectroscopic studies on the binding interaction of phenothiazinium dyes, azure A and azure B to double stranded RNA polynucleotides (United States)

    Khan, Asma Yasmeen; Suresh Kumar, Gopinatha


    This manuscript presents spectroscopic characterization of the interaction of two phenothiazinium dyes, azure A and azure B with double stranded (ds) ribonucleic acids, poly(A).poly(U), poly(C).poly(G) and poly(I).poly(C). Absorbance and fluorescence studies revealed that these dyes bind to the RNAs with binding affinities of the order 106 M-1 to poly(A).poly(U), and 105 M-1 to poly(C).poly(G) and poly(I).poly(C), respectively. Fluorescence quenching and viscosity data gave conclusive evidence for the intercalation of the dyes to these RNA duplexes. Circular dichroism results suggested that the conformation of the RNAs was perturbed on interaction and the dyes acquired strong induced optical activity on binding. Azure B bound to all the three RNAs stronger than azure A and the binding affinity varied as poly(A).poly(U) > poly(C).poly(G) > poly(I).poly(C) for both dyes.

  3. Three-dimensional structure of a protozoal double-stranded RNA virus that infects the enteric pathogen Giardia lamblia. (United States)

    Janssen, Mandy E W; Takagi, Yuko; Parent, Kristin N; Cardone, Giovanni; Nibert, Max L; Baker, Timothy S


    Giardia lamblia virus (GLV) is a small, nonenveloped, nonsegmented double-stranded RNA (dsRNA) virus infecting Giardia lamblia, the most common protozoan pathogen of the human intestine and a major agent of waterborne diarrheal disease worldwide. GLV (genus Giardiavirus) is a member of family Totiviridae, along with several other groups of protozoal or fungal viruses, including Leishmania RNA viruses and Trichomonas vaginalis viruses. Interestingly, GLV is more closely related than other Totiviridae members to a group of recently discovered metazoan viruses that includes penaeid shrimp infectious myonecrosis virus (IMNV). Moreover, GLV is the only known protozoal dsRNA virus that can transmit efficiently by extracellular means, also like IMNV. In this study, we used transmission electron cryomicroscopy and icosahedral image reconstruction to examine the GLV virion at an estimated resolution of 6.0 Å. Its outermost diameter is 485 Å, making it the largest totivirus capsid analyzed to date. Structural comparisons of GLV and other totiviruses highlighted a related "T=2" capsid organization and a conserved helix-rich fold in the capsid subunits. In agreement with its unique capacity as a protozoal dsRNA virus to survive and transmit through extracellular environments, GLV was found to be more thermoresistant than Trichomonas vaginalis virus 1, but no specific protein machinery to mediate cell entry, such as the fiber complexes in IMNV, could be localized. These and other structural and biochemical findings provide a basis for future work to dissect the cell entry mechanism of GLV into a "primitive" (early-branching) eukaryotic host and an important enteric pathogen of humans. Numerous pathogenic bacteria, including Corynebacterium diphtheriae, Salmonella enterica, and Vibrio cholerae, are infected with lysogenic bacteriophages that contribute significantly to bacterial virulence. In line with this phenomenon, several pathogenic protozoa, including Giardia lamblia

  4. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.


    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  5. Single and double strand breaks induced by 3H incorporated in DNA of cultured human kidney cells

    International Nuclear Information System (INIS)

    Tisljar-Lentulis, G.; Henneberg, P.; Mielke, T.; Feinendegen, L.E.


    In the course of the investigations of the biological effects of radionuclides incorporated in DNA single (SSB) and double strand breaks (DSB) caused tritium-decay were measured and compared with respective data resulting from 125 I. Tritium bound to thymidine and iododeoxyuridine seems to be more effective than tritium bound to other DNA-precursors. On the basis of decay, methyl- 3 H thymidine appears to be more effective with regard to the production of strand breaks than 3 H in position 6 of the pyrimidine ring. Based on the numbers of strand-breaks per rad, position 6 is more effective in accordance with data obtained by F. Krasin et al. The ratio of SSBs to DSBs per tritium decay appears to be approximately 8 in mammlian cells. Not only SSBs but also DSBs induced by 3 H in mammalian cells are reapairable. (orig./AJ) [de

  6. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos


    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  7. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems. (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela


    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  8. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan


    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  9. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool. (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita


    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  10. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska


    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  11. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.


    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  12. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  13. Examination for double-stranded RNA viruses in Trichomonas gallinae and identification of a novel sequence of a Trichomonas vaginalis virus. (United States)

    Gerhold, Richard W; Allison, Andrew B; Sellers, Holly; Linnemann, Erich; Chang, T-H; Alderete, John F


    To determine if double-stranded RNA (dsRNA) viruses exist and are potential virulence factors in Trichomonas gallinae, virus purification via ultracentrifugation was attempted for 12 T. gallinae isolates recovered from wild birds. Following purification, virus-like particles were not observed by transmission electron microscopy, nor were dsRNA segments visualized in agarose gels after electrophoresis of extracted RNA from any of the 12 T. gallinae isolates. However, virus particles and dsRNA segments were detected from a previously determined virus-infected T. vaginalis isolate as a control using identical purification procedures. Subsequent reverse transcription-polymerase chain reaction analysis of the dsRNA of the virus in this isolate revealed a novel sequence of the RNA-dependent RNA polymerase gene of T. vaginalis viruses.

  14. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms. (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A


    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Genome transcription/translation of segmented, negative-strand RNA viruses

    NARCIS (Netherlands)

    Geerts-Dimitriadou, C.


    The requirements for alignment of capped RNA leader sequences along the viral genome during influenza transcription initiation (“cap-snatching”) have long been an enigma. Previous work on Tomato spotted wilt virus (TSWV) transcription initiation has revealed that this virus displays a

  16. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  17. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee


    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  18. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail:; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki


    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  19. Rnnotator: an automated de novo transcriptome assembly pipeline from stranded RNA-Seq reads

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Jeffrey; Bruno, Vincent M.; Fang, Zhide; Meng, Xiandong; Blow, Matthew; Zhang, Tao; Sherlock, Gavin; Snyder, Michael; Wang, Zhong


    Background: Comprehensive annotation and quantification of transcriptomes are outstanding problems in functional genomics. While high throughput mRNA sequencing (RNA-Seq) has emerged as a powerful tool for addressing these problems, its success is dependent upon the availability and quality of reference genome sequences, thus limiting the organisms to which it can be applied. Results: Here, we describe Rnnotator, an automated software pipeline that generates transcript models by de novo assembly of RNA-Seq data without the need for a reference genome. We have applied the Rnnotator assembly pipeline to two yeast transcriptomes and compared the results to the reference gene catalogs of these organisms. The contigs produced by Rnnotator are highly accurate (95percent) and reconstruct full-length genes for the majority of the existing gene models (54.3percent). Furthermore, our analyses revealed many novel transcribed regions that are absent from well annotated genomes, suggesting Rnnotator serves as a complementary approach to analysis based on a reference genome for comprehensive transcriptomics. Conclusions: These results demonstrate that the Rnnotator pipeline is able to reconstruct full-length transcripts in the absence of a complete reference genome.

  20. Simultaneous detection of mRNA and protein in single cells using immunofluorescence-combined single-molecule RNA FISH. (United States)

    Kochan, Jakub; Wawro, Mateusz; Kasza, Aneta


    Although the concept of combining immunofluorescence (IF) with single-molecule RNA fluorescence in situ hybridization (smRNA FISH) seems obvious, the specific materials used during IF and smRNA FISH make it difficult to perform these procedures simultaneously on the same specimen. Even though there are reports where IF and smRNA FISH were combined with success, these were insufficient in terms of signal intensities, staining patterns, and GFP-compatibility, and a detailed exploration of the various factors that influence IF and smRNA FISH outcome has not been published yet. Here, we report a detailed study of conditions and reagents used in classic IF and smRNA FISH that allowed us to establish an easy, robust, and GFP-compatible procedure. Our protocol enables simultaneous detection of mRNA and protein quantity as well as the subcellular distribution of these molecules in single cells by combining an RNase-free modification of the IF technique and the more recent smRNA FISH method. Using this procedure, we have shown the direct interaction of RNase MCPIP1 with IL-6 mRNA. We also demonstrate the use of our protocol in heterogeneous cell population analysis, revealing cell-to-cell differences in mRNA and protein content.

  1. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores. (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei


    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  2. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants (United States)

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  3. Viral phosphodiesterases that antagonize double-stranded RNA signaling to RNase L by degrading 2-5A. (United States)

    Silverman, Robert H; Weiss, Susan R


    The host interferon (IFN) antiviral response involves a myriad of diverse biochemical pathways that disrupt virus replication cycles at many different levels. As a result, viruses have acquired and evolved genes that antagonize the host antiviral proteins. IFNs inhibit viral infections in part through the 2',5'-oligoadenylate (2-5A) synthetase (OAS)/RNase L pathway. OAS proteins are pathogen recognition receptors that exist at different basal levels in different cell types and that are IFN inducible. Upon activation by the pathogen-associated molecular pattern viral double-stranded RNA, certain OAS proteins synthesize 2-5A from ATP. 2-5A binds to the antiviral enzyme RNase L causing its dimerization and activation. Recently, disparate RNA viruses, group 2a betacoronaviruses, and group A rotaviruses, have been shown to produce proteins with 2',5'-phosphodiesterase (PDE) activities that eliminate 2-5A thereby evading the antiviral activity of the OAS/RNase L pathway. These viral proteins are members of the eukaryotic-viral LigT-like group of 2H phosphoesterases, so named for the presence of 2 conserved catalytic histidine residues. Here, we will review the biochemistry, biology, and implications of viral and cellular 2',5'-PDEs that degrade 2-5A. In addition, we discuss alternative viral and cellular strategies for limiting the activity of OAS/RNase L.

  4. DEAF1 is a Pellino1-interacting protein required for interferon production by Sendai virus and double-stranded RNA. (United States)

    Ordureau, Alban; Enesa, Karine; Nanda, Sambit; Le Francois, Brice; Peggie, Mark; Prescott, Alan; Albert, Paul R; Cohen, Philip


    Double-stranded (ds) RNA of viral origin, a ligand for Melanoma Differentiation-associated gene 5 (MDA5) and Toll-Like Receptor 3 (TLR3), induces the TANK-Binding Kinase 1 (TBK1)-dependent phosphorylation and activation of Interferon Regulatory Factor 3 (IRF3) and the E3 ubiquitin ligase Pellino1, which are required for interferon β (IFNβ) gene transcription. Here, we report that Pellino1 interacts with the transcription factor Deformed Epidermal Autoregulatory Factor 1 (DEAF1). The interaction is independent of the E3 ligase activity of Pellino1, but weakened by the phosphorylation of Pellino1. We show that DEAF1 binds to the IFNβ promoter and to IRF3 and IRF7, that it is required for the transcription of the IFNβ gene and IFNβ secretion in MEFs infected with Sendai virus or transfected with poly(I:C). DEAF1 is also needed for TLR3-dependent IFNβ production. Taken together, our results identify DEAF1 as a novel component of the signal transduction network by which dsRNA of viral origin stimulates IFNβ production.

  5. Innate immune recognition of double-stranded RNA triggers increased expression of NKG2D ligands after virus infection. (United States)

    Esteso, Gloria; Guerra, Susana; Valés-Gómez, Mar; Reyburn, Hugh T


    Self/non-self-discrimination by the innate immune system relies on germline-encoded, non-rearranging receptors expressed by innate immune cells recognizing conserved pathogen-associated molecular patterns. The natural killer group 2D (NKG2D) receptor is a potent immune-activating receptor that binds human genome-encoded ligands, whose expression is negligible in normal tissues, but increased in stress and disease conditions for reasons that are incompletely understood. Here it is not clear how the immune system reconciles receptor binding of self-proteins with self/non-self-discrimination to avoid autoreactivity. We now report that increased expression of NKG2D ligands after virus infection depends on interferon response factors activated by the detection of viral double-stranded RNA by pattern-recognition receptors (RIG-I/MDA-5) and that NKG2D ligand up-regulation can be blocked by the expression of viral dsRNA-binding proteins. Thus, innate immunity-mediated recognition of viral nucleic acids triggers the infected cell to release interferon for NK cell recruitment and to express NKG2D ligands to become more visible to the immune system. Finally, the observation that NKG2D-ligand induction is a consequence of signaling by pattern-recognition receptors that have been selected over evolutionary time to be highly pathogen-specific explains how the risks of autoreactivity in this system are minimized. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Metallothionein mRNA induction is correlated with the decrease of DNA strand breaks in cadmium exposed zebra mussels. (United States)

    Vincent-Hubert, Françoise; Châtel, Amélie; Gourlay-Francé, Catherine


    We have previously shown that cadmium (Cd) and benzo[a]pyrene (BaP) induced early DNA damages in zebra mussels, and that the level of DNA strand breaks (SB) returned to a basal level after 3 days of exposure to Cd. The aim of the present study was to go further in the mechanisms of Cd and BaP detoxification. For that purpose, expression of genes encoding for metallothionein (MT), aryl hydrocarbon receptor (AHR), P-gp, catalase, glutathione S-transferase and heat shock protein 70 (HSP70) proteins have been measured using RT-qPCR. Data reported here show that Cd is a strong inducer of MT and HSP70 genes, and that BaP is a strong inducer of P-gp and AHR genes. Exposure to Cd and BaP resulted in moderate changes in antioxidant enzymes mRNA. Since the increase of MT mRNA occurred when the DNA SB level returned to its basal level, we can suggest that MT is implicated in cadmium detoxification. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong


    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  8. Strand-specific RNA-seq analysis of the Lactobacillus delbrueckii subsp. bulgaricus transcriptome. (United States)

    Zheng, Huajun; Liu, Enuo; Shi, Tao; Ye, Luyi; Konno, Tomonobu; Oda, Munehiro; Ji, Zai-Si


    Lactobacillus delbrueckii subsp. bulgaricus 2038 (Lb. bulgaricus 2038) is an industrial bacterium that is used as a starter for dairy products. We proposed several hypotheses concerning its industrial features previously. Here, we utilized RNA-seq to explore the transcriptome of Lb. bulgaricus 2038 from four different growth phases under whey conditions. The most abundantly expressed genes in the four stages were mainly involved in translation (for the logarithmic stage), glycolysis (for control/lag stages), lactic acid production (all the four stages), and 10-formyl tetrahydrofolate production (for the stationary stage). The high expression of genes like d-lactate dehydrogenase was thought as a result of energy production, and consistent expression of EPS synthesis genes, the restriction-modification (RM) system and the CRISPR/Cas system were validated for explaining the advantage of this strain in yoghurt production. Several postulations, like NADPH production through GapN bypass, converting aspartate into carbon-skeleton intermediates, and formate production through degrading GTP, were proved not working under these culture conditions. The high expression of helicase genes and co-expressed amino acids/oligopeptides transporting proteins indicated that the helicase might mediate the strain obtaining nitrogen source from the environment. The transport system of Lb. bulgaricus 2038 was found to be regulated by antisense RNA, hinting the potential application of non-coding RNA in regulating lactic acid bacteria (LAB) gene expression. Our study has primarily uncovered Lb. bulgaricus 2038 transcriptome, which could gain a better understanding of the regulation system in Lb. bulgaricus and promote its industrial application.

  9. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.


    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  10. Distinct circular single-stranded DNA viruses exist in different soil types. (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael


    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. A high throughput system for the preparation of single stranded templates grown in microculture. (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M


    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  12. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)


    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  13. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.


    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  14. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  15. Double-stranded RNA-specific adenosine deaminase 1 (ADAR1) promotes EIAV replication and infectivity. (United States)

    Tang, Yan-Dong; Na, Lei; Fu, Li-Hua; Yang, Fei; Zhu, Chun-Hui; Tang, Li; Li, Qiang; Wang, Jia-Yi; Li, Zhan; Wang, Xue-Feng; Li, Cheng-Yao; Wang, Xiaojun; Zhou, Jian-Hua


    Adenosine deaminases that act on RNA (ADARs) have been reported to be functional on various viruses. ADAR1 may exhibit antiviral or proviral activity depending on the type of virus. Human immunodeficiency virus (HIV)-1 is the most well-studied lentivirus with respect to its interaction with ADAR1, and variable results have been reported. In this study, we demonstrated that equine ADAR1 (eADAR1) was a positive regulator of equine infectious anemia virus (EIAV), another lentivirus of the Retroviridae family. First, eADAR1 significantly promoted EIAV replication, and the enhancement of viral protein expression was associated with the long terminal repeat (LTR) and Rev response element (RRE) regions. Second, the RNA binding domain 1 of eADAR1 was essential only for enhancing LTR-mediated gene expression. Third, in contrast with APOBEC proteins, which have been shown to reduce lentiviral infectivity, eADAR1 increased the EIAV infectivity. This study indicated that eADAR1 was proviral rather than antiviral for EIAV. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard


    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  17. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.


    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  18. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.


    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  19. Complex organisation and structure of the ghrelin antisense strand gene GHRLOS, a candidate non-coding RNA gene

    Directory of Open Access Journals (Sweden)

    Herington Adrian C


    Full Text Available Abstract Background The peptide hormone ghrelin has many important physiological and pathophysiological roles, including the stimulation of growth hormone (GH release, appetite regulation, gut motility and proliferation of cancer cells. We previously identified a gene on the opposite strand of the ghrelin gene, ghrelinOS (GHRLOS, which spans the promoter and untranslated regions of the ghrelin gene (GHRL. Here we further characterise GHRLOS. Results We have described GHRLOS mRNA isoforms that extend over 1.4 kb of the promoter region and 106 nucleotides of exon 4 of the ghrelin gene, GHRL. These GHRLOS transcripts initiate 4.8 kb downstream of the terminal exon 4 of GHRL and are present in the 3' untranslated exon of the adjacent gene TATDN2 (TatD DNase domain containing 2. Interestingly, we have also identified a putative non-coding TATDN2-GHRLOS chimaeric transcript, indicating that GHRLOS RNA biogenesis is extremely complex. Moreover, we have discovered that the 3' region of GHRLOS is also antisense, in a tail-to-tail fashion to a novel terminal exon of the neighbouring SEC13 gene, which is important in protein transport. Sequence analyses revealed that GHRLOS is riddled with stop codons, and that there is little nucleotide and amino-acid sequence conservation of the GHRLOS gene between vertebrates. The gene spans 44 kb on 3p25.3, is extensively spliced and harbours multiple variable exons. We have also investigated the expression of GHRLOS and found evidence of differential tissue expression. It is highly expressed in tissues which are emerging as major sites of non-coding RNA expression (the thymus, brain, and testis, as well as in the ovary and uterus. In contrast, very low levels were found in the stomach where sense, GHRL derived RNAs are highly expressed. Conclusion GHRLOS RNA transcripts display several distinctive features of non-coding (ncRNA genes, including 5' capping, polyadenylation, extensive splicing and short open reading

  20. Addendum to "Monomer motion in single- and double-stranded DNA coils" [arXiv: cond-mat/0509399


    Tothova, J.; Brutovsky, B.; Lisy, V.


    In our work [J. Tothova et al., cond-mat/0509399] the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique [R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)] has been interpreted within the joint Rouse-Zimm theory. Optimizing the theory to the experimental data the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dy...

  1. Study of a steel strand tension sensor with difference single bypass excitation structure based on the magneto-elastic effect

    International Nuclear Information System (INIS)

    Tang Dedong; Huang Shanglian; Chen Weimin; Jiang Jianshan


    With many steel strands used in various important machines and architectural structures, health monitoring of strand tension becomes more and more important to ensure the equipment or structures' safety. Contrasted with the method of vibration frequency and strain gages, the method of measuring the steel strand tension based on the magneto-elastic effect is more capable of meeting the requirements of health monitoring. Yet the structure of the sensor is mainly a sleeve structure, and the steel strand to be measured serves as the core of primary and secondary solenoids. This structure is very difficult to fix and maintain. On the other hand, a change of temperature will strongly affect measurement results, and experiments prove that temperature error compensation by using a temperature compensation curve is not effective enough. Therefore in this paper the principle of a cable tension sensor based on the magneto-elastic effect is expounded, the theory of temperature influence is explored, a difference structure by single bypass excitation is devised, its magnetic loop is analyzed, an experiment is designed, and experiments on temperature compensation and pulling tension are carried out. The experiment results indicated that the structure of the sensor is feasible, temperature errors can be compensated for automatically, after which temperature errors become less than 0.012 MPa °C −1 , and repeating errors of tension are less than 0.15%, which meet the measurement requirements

  2. Study of a steel strand tension sensor with difference single bypass excitation structure based on the magneto-elastic effect (United States)

    Tang, Dedong; Huang, Shanglian; Chen, Weimin; Jiang, Jianshan


    With many steel strands used in various important machines and architectural structures, health monitoring of strand tension becomes more and more important to ensure the equipment or structures' safety. Contrasted with the method of vibration frequency and strain gages, the method of measuring the steel strand tension based on the magneto-elastic effect is more capable of meeting the requirements of health monitoring. Yet the structure of the sensor is mainly a sleeve structure, and the steel strand to be measured serves as the core of primary and secondary solenoids. This structure is very difficult to fix and maintain. On the other hand, a change of temperature will strongly affect measurement results, and experiments prove that temperature error compensation by using a temperature compensation curve is not effective enough. Therefore in this paper the principle of a cable tension sensor based on the magneto-elastic effect is expounded, the theory of temperature influence is explored, a difference structure by single bypass excitation is devised, its magnetic loop is analyzed, an experiment is designed, and experiments on temperature compensation and pulling tension are carried out. The experiment results indicated that the structure of the sensor is feasible, temperature errors can be compensated for automatically, after which temperature errors become less than 0.012 MPa °C-1, and repeating errors of tension are less than 0.15%, which meet the measurement requirements.

  3. Heterodimers as the Structural Unit of the T=1 Capsid of the Fungal Double-Stranded RNA Rosellinia necatrix Quadrivirus 1. (United States)

    Luque, Daniel; Mata, Carlos P; González-Camacho, Fernando; González, José M; Gómez-Blanco, Josué; Alfonso, Carlos; Rivas, Germán; Havens, Wendy M; Kanematsu, Satoko; Suzuki, Nobuhiro; Ghabrial, Said A; Trus, Benes L; Castón, José R


    Most double-stranded RNA (dsRNA) viruses are transcribed and replicated in a specialized icosahedral capsid with a T=1 lattice consisting of 60 asymmetric capsid protein (CP) dimers. These capsids help to organize the viral genome and replicative complex(es). They also act as molecular sieves that isolate the virus genome from host defense mechanisms and allow the passage of nucleotides and viral transcripts. Rosellinia necatrix quadrivirus 1 (RnQV1), the type species of the family Quadriviridae, is a dsRNA fungal virus with a multipartite genome consisting of four monocistronic segments (segments 1 to 4). dsRNA-2 and dsRNA-4 encode two CPs (P2 and P4, respectively), which coassemble into ∼450-Å-diameter capsids. We used three-dimensional cryo-electron microscopy combined with complementary biophysical techniques to determine the structures of RnQV1 virion strains W1075 and W1118. RnQV1 has a quadripartite genome, and the capsid is based on a single-shelled T=1 lattice built of P2-P4 dimers. Whereas the RnQV1-W1118 capsid is built of full-length CP, P2 and P4 of RnQV1-W1075 are cleaved into several polypeptides, maintaining the capsid structural organization. RnQV1 heterodimers have a quaternary organization similar to that of homodimers of reoviruses and other dsRNA mycoviruses. The RnQV1 capsid is the first T=1 capsid with a heterodimer as an asymmetric unit reported to date and follows the architectural principle for dsRNA viruses that a 120-subunit capsid is a conserved assembly that supports dsRNA replication and organization. Given their importance to health, members of the family Reoviridae are the basis of most structural and functional studies and provide much of our knowledge of dsRNA viruses. Analysis of bacterial, protozoal, and fungal dsRNA viruses has improved our understanding of their structure, function, and evolution, as well. Here, we studied a dsRNA virus that infects the fungus Rosellinia necatrix, an ascomycete that is pathogenic to a wide

  4. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.


    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  5. Strand Analysis, a free online program for the computational identification of the best RNA interference (RNAi targets based on Gibbs free energy

    Directory of Open Access Journals (Sweden)

    Tiago Campos Pereira


    Full Text Available The RNA interference (RNAi technique is a recent technology that uses double-stranded RNA molecules to promote potent and specific gene silencing. The application of this technique to molecular biology has increased considerably, from gene function identification to disease treatment. However, not all small interfering RNAs (siRNAs are equally efficient, making target selection an essential procedure. Here we present Strand Analysis (SA, a free online software tool able to identify and classify the best RNAi targets based on Gibbs free energy (deltaG. Furthermore, particular features of the software, such as the free energy landscape and deltaG gradient, may be used to shed light on RNA-induced silencing complex (RISC activity and RNAi mechanisms, which makes the SA software a distinct and innovative tool.

  6. Cryphonectria nitschkei virus 1 structure shows that the capsid protein of chrysoviruses is a duplicated helix-rich fold conserved in fungal double-stranded RNA viruses. (United States)

    Gómez-Blanco, Josué; Luque, Daniel; González, José M; Carrascosa, José L; Alfonso, Carlos; Trus, Benes; Havens, Wendy M; Ghabrial, Said A; Castón, José R


    Cryoelectron microscopy reconstruction of Cryphonectria nitschkei virus 1, a double-stranded RNA (dsRNA) virus, shows that the capsid protein (60 copies/particle) is formed by a repeated helical core, indicative of gene duplication. This unusual organization is common to chrysoviruses. The arrangement of many of these putative α-helices is conserved in the totivirus L-A capsid protein, suggesting a shared motif. Our results indicate that a 120-subunit T=1 capsid is a conserved architecture that optimizes dsRNA replication and organization.

  7. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  8. Effects of 3-Deoxyadenosine (Cordycepin) on the repair of X-ray-induced DNA single- and double-strand breaks in chinese hamster V79 cells

    International Nuclear Information System (INIS)

    Hiraoka, Wakako; Kuwabara, Mikinori; Sato, Fumiaki


    The ability of cordycepin to inhibit the repair of DNA strand breaks was examined with X-irradiated Chinese hamster V79 cells in log-phase culture. A filter elution technique revealed that 70 μM cordycepin did not inhibit the repair of single-strand breaks but inhibited the repair of double-strand breaks. These findings confirmed the fact that the increase in the lethality of cordycepin in X-irradiated cultured mammalian cells was attributable to unrepaired DNA double-strand breaks. (author)

  9. Single-cell sequencing of the small-RNA transcriptome. (United States)

    Faridani, Omid R; Abdullayev, Ilgar; Hagemann-Jensen, Michael; Schell, John P; Lanner, Fredrik; Sandberg, Rickard


    Little is known about the heterogeneity of small-RNA expression as small-RNA profiling has so far required large numbers of cells. Here we present a single-cell method for small-RNA sequencing and apply it to naive and primed human embryonic stem cells and cancer cells. Analysis of microRNAs and fragments of tRNAs and small nucleolar RNAs (snoRNAs) reveals the potential of microRNAs as markers for different cell types and states.

  10. Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells

    Directory of Open Access Journals (Sweden)

    Spyros Darmanis


    Full Text Available Significant advances have been made in methods to analyze genomes and transcriptomes of single cells, but to fully define cell states, proteins must also be accessed as central actors defining a cell’s phenotype. Methods currently used to analyze endogenous protein expression in single cells are limited in specificity, throughput, or multiplex capability. Here, we present an approach to simultaneously and specifically interrogate large sets of protein and RNA targets in lysates from individual cells, enabling investigations of cell functions and responses. We applied our method to investigate the effects of BMP4, an experimental therapeutic agent, on early-passage glioblastoma cell cultures. We uncovered significant heterogeneity in responses to treatment at levels of RNA and protein, with a subset of cells reacting in a distinct manner to BMP4. Moreover, we found overall poor correlation between protein and RNA at the level of single cells, with proteins more accurately defining responses to treatment.

  11. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy


    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  12. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray. (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  13. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  14. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system. (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus


    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  15. Molecular characterization of double-stranded RNA virus in Trichomonas vaginalis Egyptian isolates and its association with pathogenicity. (United States)

    El-Gayar, Eman K; Mokhtar, Amira B; Hassan, Wael A


    Trichomoniasis is a common human sexually transmitted infection caused by Trichomonas vaginalis. The parasite can be infected with double-stranded RNA viruses (TVV). This viral infection may have important implications on trichomonal virulence and disease pathogenesis. This study aimed to determine the prevalence of T. vaginalis virus among isolates obtained from infected (symptomatic and asymptomatic) women in Ismailia City, Egypt, and to correlate the virus-infected isolates with the clinical manifestations of patients. In addition, the pathogenicity of TVV infected isolates on mice was also evaluated. T. vaginalis isolates were obtained from symptomatic and asymptomatic female patients followed by axenic cultivation in Diamond's TYM medium. The presence of T. vaginalis virus was determined from total extraction of nucleic acids (DNA-RNA) followed by reverse transcriptase-PCR. Representative samples were inoculated intraperitoneally in female albino/BALB mice to assess the pathogenicity of different isolates. A total of 110 women were examined; 40 (36.3 %) samples were positive for T. vaginalis infection. Of these 40 isolates, 8 (20 %) were infected by TVV. Five isolates contained TVV-2 virus species, and the remaining three isolates were infected withTVV-4 variant. A significant association was found between the presence of TVV and particular clinical manifestations of trichomoniasis. Experimental mice infection showed varying degrees of pathogenicity. This is the first report on T. vaginalis infection by TVV in Egypt. The strong association detected between TVV and particular clinical features of trichomoniasis and also the degree of pathogenicity in experimentally infected mice may indicate a possible clinical significance of TVV infection of T. vaginalis isolates.

  16. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    Energy Technology Data Exchange (ETDEWEB)

    Kownin, P.; Bateman, E.; Paule, M.R.


    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  17. Spectroscopic studies on the binding interaction of phenothiazinium dyes, azure A and azure B to double stranded RNA polynucleotides. (United States)

    Khan, Asma Yasmeen; Suresh Kumar, Gopinatha


    This manuscript presents spectroscopic characterization of the interaction of two phenothiazinium dyes, azure A and azure B with double stranded (ds) ribonucleic acids, poly(A).poly(U), poly(C).poly(G) and poly(I).poly(C). Absorbance and fluorescence studies revealed that these dyes bind to the RNAs with binding affinities of the order 10(6)M(-1) to poly(A).poly(U), and 10(5)M(-1) to poly(C).poly(G) and poly(I).poly(C), respectively. Fluorescence quenching and viscosity data gave conclusive evidence for the intercalation of the dyes to these RNA duplexes. Circular dichroism results suggested that the conformation of the RNAs was perturbed on interaction and the dyes acquired strong induced optical activity on binding. Azure B bound to all the three RNAs stronger than azure A and the binding affinity varied as poly(A).poly(U)>poly(C).poly(G)>poly(I).poly(C) for both dyes. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism. (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong


    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  19. Single particle labeling of RNA virus in live cells. (United States)

    Liu, Xiaohui; Ouyang, Ting; Ouyang, Hongsheng; Ren, Linzhu


    Real-time and visual tracking of viral infection is crucial for elucidating the infectious and pathogenesis mechanisms. To track the virus successfully, an efficient labeling method is necessary. In this review, we first discuss the practical labeling techniques for virus tracking in live cells. We then describe the current knowledge of interactions between RNA viruses (especially influenza viruses, immunodeficiency viruses, and Flaviviruses) and host cellular structures, obtained using single particle labeling techniques combined with real-time fluorescence microscopy. Single particle labeling provides an easy system for understanding the RNA virus life cycle. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio


    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  1. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  2. Recombinant modified vaccinia virus Ankara generating excess early double-stranded RNA transiently activates protein kinase R and triggers enhanced innate immune responses. (United States)

    Wolferstätter, Michael; Schweneker, Marc; Späth, Michaela; Lukassen, Susanne; Klingenberg, Marieken; Brinkmann, Kay; Wielert, Ursula; Lauterbach, Henning; Hochrein, Hubertus; Chaplin, Paul; Suter, Mark; Hausmann, Jürgen


    Double-stranded RNA (dsRNA) is an important molecular pattern associated with viral infection and is detected by various extra- and intracellular recognition molecules. Poxviruses have evolved to avoid producing dsRNA early in infection but generate significant amounts of dsRNA late in infection due to convergent transcription of late genes. Protein kinase R (PKR) is activated by dsRNA and triggers major cellular defenses against viral infection, including protein synthesis shutdown, apoptosis, and type I interferon (IFN-I) production. The poxviral E3 protein binds and sequesters viral dsRNA and is a major antagonist of the PKR pathway. We found that the highly replication-restricted modified vaccinia virus Ankara (MVA) engineered to produce excess amounts of dsRNA early in infection showed enhanced induction of IFN-β in murine and human cells in the presence of an intact E3L gene. IFN-β induction required a minimum overlap length of 300 bp between early complementary transcripts and was strongly PKR dependent. Excess early dsRNA produced by MVA activated PKR early but transiently in murine cells and induced enhanced systemic levels of IFN-α, IFN-γ, and other cytokines and chemokines in mice in a largely PKR-dependent manner. Replication-competent chorioallantois vaccinia virus Ankara (CVA) generating excess early dsRNA also enhanced IFN-I production and was apathogenic in mice even at very high doses but showed no in vitro host range defect. Thus, genetically adjuvanting MVA and CVA to generate excess early dsRNA is an effective method to enhance innate immune stimulation by orthopoxvirus vectors and to attenuate replicating vaccinia virus in vivo. Efficient cellular sensing of pathogen-specific components, including double-stranded RNA (dsRNA), is an important prerequisite of an effective antiviral immune response. The prototype poxvirus vaccinia virus (VACV) and its derivative modified vaccinia virus Ankara (MVA) produce dsRNA as a by-product of viral

  3. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes


    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar


    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  4. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris


    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  5. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA. (United States)

    Rogers, Cody M; Bochman, Matthew L


    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate. (United States)

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Measurement of longitudinal sulfur isotopic variations by laser ablation MC-ICP-MS in single human hair strands. (United States)

    Santamaria-Fernandez, Rebeca; Giner Martínez-Sierra, Justo; Marchante-Gayón, J M; García-Alonso, J Ignacio; Hearn, Ruth


    A new method for the measurement of longitudinal variations of sulfur isotope amount ratios in single hair strands using a laser ablation system coupled to a multicollector inductively coupled plasma mass spectrometer (LA-MC-ICP-MS) is reported here for the first time. Ablation parameters have been optimized for the measurement of sulfur isotope ratios in scalp human hair strands of 80-120-microm thickness and different washing procedures have been evaluated. The repeatability of the method has been tested and the ability to measure sulfur isotopic variations in 1,000-microm-long hair segments has been evaluated. A horse hair sample previously characterized for carbon and nitrogen isotope ratios in an interlaboratory study has been characterized by LA-MC-ICP-MS to be used as an in-house standard for the bracketing of human hair strands. (34)S/(32)S isotope amount ratios have been measured and corrected for instrumental mass bias adopting the external standardization approach using National Institute of Standards and Technology (NIST) RM8553 and full uncertainty budgets have been calculated using the Kragten approach. Results are reported as both (34)S/(32)S isotope amount ratios and deltaS(V-CDT) values (sulfur isotopic differences relative to a reference sample expressed in the Vienna Canyon Diablo Troilite (V-CDT) scale) calculated using NIST RM8553, NIST RM8554, and NIST RM8556 to anchor results to the V-CDT scale. The main advantage of the new method versus conventional gas source isotope ratio mass spectrometry measurements is that longitudinal variations in sulfur isotope amount ratios can be resolved. Proof of concept is shown with human scalp hair strands from three individuals, two UK residents and one traveler (long periods of time abroad). The method enables monitoring of longitudinal isotope ratio variations in single hair strands. Absolute ratios are reported and delta(34)S(V-CDT) values are plotted for comparison. Slight variations of 5 per thousand

  8. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity. (United States)

    Monnet, Jordan; Kozelka, Jiří


    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Activation of double-stranded RNA-dependent protein kinase inhibits proliferation of pancreatic β-cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shan-Shan [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China); Department of Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing (China); Jiang, Teng [Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, Nanjing (China); Wang, Yi; Gu, Li-Ze [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China); Department of Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing (China); Wu, Hui-Wen [Laboratory Center for Basic Medical Sciences, Nanjing Medical University, Nanjing (China); Tan, Lan [Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, Nanjing (China); Guo, Jun, E-mail: [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China); Department of Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing (China)


    Highlights: •PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in β-cells. •Activated PKR inhibited β-cell proliferation by arresting cell cycle at G1 phase. •Activated PKR fully abrogated the pro-proliferative effects of IGF-I on β-cells. -- Abstract: Double-stranded RNA-dependent protein kinase (PKR) is revealed to participate in the development of insulin resistance in peripheral tissues in type 2 diabetes (T2DM). Meanwhile, PKR is also characterized as a critical regulator of cell proliferation. To date, no study has focused on the impact of PKR on the proliferation of pancreatic β-cells. Here, we adopted insulinoma cell lines and mice islet β-cells to investigate: (1) the effects of glucolipotoxicity and pro-inflammatory cytokines on PKR activation; (2) the effects of PKR on proliferation of pancreatic β-cells and its underlying mechanisms; (3) the actions of PKR on pro-proliferative effects of IGF-I and its underlying pathway. Our results provided the first evidence that PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in pancreatic β-cells, and activated PKR significantly inhibited cell proliferation by arresting cell cycle at G1 phase. Reductions in cyclin D1 and D2 as well as increases in p27 and p53 were associated with the anti-proliferative effects of PKR, and proteasome-dependent degradation took part in the reduction of cyclin D1 and D2. Besides, PKR activation abrogated the pro-proliferative effects of IGF-I by activating JNK and disrupting IRS1/PI3K/Akt signaling pathway. These findings indicate that the anti-proliferative actions of PKR on pancreatic β-cells may contribute to the pathogenesis of T2DM.

  10. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants. (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin


    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  11. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  12. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda


    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  13. Viable deletions of the M13 complementary strand origin


    Kim, Myoung Hee; Hines, Jane C.; Ray, Dan S.


    The single-stranded DNA of bacteriophage M13 is converted to a duplex replicative form by a mechanism involving RNA-primed initiation at a single unique site on the viral DNA. The DNA sequence that specifies the RNA primer is contained largely within one of two adjacent hairpin structures protected from DNase degradation by RNA polymerase. We have used in vitro techniques to construct a series of M13 mutants having deletions in the region of the complementary strand origin. Deletions of the d...

  14. Double stranded RNA-dependent protein kinase is involved in osteoclast differentiation of RAW264.7 cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Teramachi, Junpei [Department of Histology and Oral Histology, Institute of Health Biosciences, The University of Tokushima Graduate School, Kuramoto, Tokushima 770-8504 (Japan); Morimoto, Hiroyuki; Baba, Ryoko; Doi, Yoshiaki [Department of Anatomy, School of Medicine, University of Occupational and Environmental Health, Yahatanishi, Kitakyushu 807-8555 (Japan); Hirashima, Kanji [Department of Histology and Oral Histology, Institute of Health Biosciences, The University of Tokushima Graduate School, Kuramoto, Tokushima 770-8504 (Japan); Haneji, Tatsuji, E-mail: [Department of Histology and Oral Histology, Institute of Health Biosciences, The University of Tokushima Graduate School, Kuramoto, Tokushima 770-8504 (Japan)


    Double-stranded RNA-dependent protein kinase (PKR) plays a critical role in antiviral defence of the host cells. PKR is also involved in cell cycle progression, cell proliferation, cell differentiation, tumorigenesis, and apoptosis. We previously reported that PKR is required for differentiation and calcification of osteoblasts. However, it is unknown about the role of PKR in osteoclast differentiation. A dominant-negative PKR mutant cDNA, in which the amino acid lysine at 296 was replaced with arginine, was transfected into RAW264.7 cells. We have established the cell line that stably expresses the PKR mutant gene (PKR-K/R). Phosphorylation of PKR and {alpha}-subunit of eukaryotic initiation factor 2 was not stimulated by polyinosic-polycytidylic acid in the PKR-K/R cells. RANKL stimulated the formation of TRAP-positive multinuclear cells in RAW264.7 cells. However, TRAP-positive multinuclear cells were not formed in the PKR-K/R cells even when the cells were stimulated with higher doses of RANKL. A specific inhibitor of PKR, 2-aminopurine, also suppressed the RANKL-induced osteoclast differentiation in RAW264.7 cells. The expression of macrophage fusion receptor and dendritic cell-specific transmembrane protein significantly decreased in the PKR-K/R cells by real time PCR analysis. The results of RT-PCR revealed that the mRNA expression of osteoclast markers (cathepsin K and calcitonin receptor) was suppressed in the PKR-K/R cells and RAW264.7 cells treated with 2-aminopurine. Expression of NF-{kappa}B protein was suppressed in the PKR-K/R cells and 2-aminopurine-treated RAW264.7 cells. The level of STAT1 protein expression was elevated in the PKR-K/R cells compared with that of the wild-type cells. Immunohistochemical study showed that PKR was localized in osteoclasts of metatarsal bone of newborn mouse. The finding that the PKR-positive multinuclear cells should be osteoclasts was confirmed by TRAP-staining. Our present study indicates that PKR plays important

  15. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte. (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E


    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  16. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  17. String-nets, single and double-stranded quantum loop gases for non-Abelian anyons


    Velenich, Andrea; Chamon, Claudio; Wen, Xiao-Gang


    String-net condensation can give rise to non-Abelian anyons whereas loop condensation usually gives rise to Abelian anyons. It has been proposed that generalized quantum loop gases with non-orthogonal inner products can produce non-Abelian anyons. We detail an exact mapping between the string-net and the generalized loop models and explain how the non-orthogonal products arise. We also introduce a loop model of double-stranded nets where quantum loops with an orthogonal inner product and loca...

  18. Effects of chitin synthase double-stranded RNA on molting and oogenesis in the Chagas disease vector Rhodnius prolixus. (United States)

    Mansur, Juliana F; Alvarenga, Evelyn S L; Figueira-Mansur, Janaina; Franco, Thiago A; Ramos, Isabela B; Masuda, Hatisaburo; Melo, Ana C A; Moreira, Mônica F


    In this study, we provided the demonstration of the presence of a single CHS gene in the Rhodnius prolixus (a blood-sucking insect) genome that is expressed in adults (integument and ovary) and in the integument of nymphs during development. This CHS gene appears to be essential for epidermal integrity and egg formation in R. prolixus. Because injection of CHS dsRNA was effective in reducing CHS transcript levels, phenotypic alterations in the normal course of ecdysis occurred. In addition, two phenotypes with severe cuticle deformations were observed, which were associated with loss of mobility and lifetime. The CHS dsRNA treatment in adult females affected oogenesis, reducing the size of the ovary and presenting a greater number of atresic oocytes and a smaller number of chorionated oocytes compared with the control. The overall effect was reduced oviposition. The injection of CHS dsRNA modified the natural course of egg development, producing deformed eggs that were dark in color and unable to hatch, distinct from the viable eggs laid by control females. The ovaries, which were examined under fluorescence microscopy using a probe for chitin detection, showed a reduced deposition on pre-vitellogenic and vitellogenic oocytes compared with control. Taken together, these data suggest that the CHS gene is fundamentally important for ecdysis, oogenesis and egg hatching in R. prolixus and also demonstrated that the CHS gene is a good target for controlling Chagas disease vectors. Published by Elsevier Ltd.

  19. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB). (United States)

    van Loon, Barbara; Samson, Leona D


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  20. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles. (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique


    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  1. Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera. (United States)

    Israni, B; Rajam, M V


    RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

  2. A Transformed Bacterium Expressing Double-Stranded RNA Specific to Integrin β1 Enhances Bt Toxin Efficacy against a Polyphagous Insect Pest, Spodoptera exigua.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Oral toxicity of double-stranded RNA (dsRNA specific to integrin β1 subunit (SeINT was known in a polyphagous insect pest, Spodoptera exigua. For an application of the dsRNA to control the insect pest, this study prepared a transformed Escherichia coli expressing dsRNA specific to SeINT.The dsRNA expression was driven by T7 RNA polymerase overexpressed by an inducer in the transformed E. coli. The produced dsRNA amount was proportional to the number of the cultured bacteria. The transformed bacteria gave a significant oral toxicity to S. exigua larvae with a significant reduction of the SeINT expression. The resulting insect mortality increased with the fed number of the bacteria. Pretreatment with an ultra-sonication to disrupt bacterial cell wall/membrane significantly increased the insecticidal activity of the transformed bacteria. The larvae treated with the transformed bacteria suffered tissue damage in the midgut epithelium, which exhibited a marked loss of cell-cell contacts and underwent a remarkable cell death. Moreover, these treated larvae became significantly susceptible to a Cry toxin derived from Bacillus thuringiensis (Bt.This study provides a novel and highly efficient application technique to use dsRNA specific to an integrin gene by mixing with a biopesticide, Bt.

  3. A Transformed Bacterium Expressing Double-Stranded RNA Specific to Integrin β1 Enhances Bt Toxin Efficacy against a Polyphagous Insect Pest, Spodoptera exigua. (United States)

    Kim, Eunseong; Park, Youngjin; Kim, Yonggyun


    Oral toxicity of double-stranded RNA (dsRNA) specific to integrin β1 subunit (SeINT) was known in a polyphagous insect pest, Spodoptera exigua. For an application of the dsRNA to control the insect pest, this study prepared a transformed Escherichia coli expressing dsRNA specific to SeINT. The dsRNA expression was driven by T7 RNA polymerase overexpressed by an inducer in the transformed E. coli. The produced dsRNA amount was proportional to the number of the cultured bacteria. The transformed bacteria gave a significant oral toxicity to S. exigua larvae with a significant reduction of the SeINT expression. The resulting insect mortality increased with the fed number of the bacteria. Pretreatment with an ultra-sonication to disrupt bacterial cell wall/membrane significantly increased the insecticidal activity of the transformed bacteria. The larvae treated with the transformed bacteria suffered tissue damage in the midgut epithelium, which exhibited a marked loss of cell-cell contacts and underwent a remarkable cell death. Moreover, these treated larvae became significantly susceptible to a Cry toxin derived from Bacillus thuringiensis (Bt). This study provides a novel and highly efficient application technique to use dsRNA specific to an integrin gene by mixing with a biopesticide, Bt.

  4. Reduction in deformed wing virus infection in larval and adult honey bees (Apis mellifera L.) by double-stranded RNA ingestion. (United States)

    Desai, S D; Eu, Y-J; Whyard, S; Currie, R W


    Deformed wing virus (DWV) is a serious pathogen of the honey bee, Apis mellifera L., vectored by the parasitic mite Varroa destructor. The virus is associated with wing deformity in symptomatic bees, and premature death and reduced colony performance in asymptomatic bees. In the present study we reduced DWV infection by feeding both first instar larvae and adult A. mellifera with a double-stranded (ds) RNA construct, DWV-dsRNA, which is specific to DWV in DWV-inoculated bees, by mixing it with their food. We showed that feeding DWV to larvae causes wing deformity in adult bees in the absence of varroa mites and decreases survival rates of adult bees relative to bees not fed DWV. Feeding larvae with DWV-dsRNA in advance of inoculation with virus reduced the DWV viral level and reduced wing deformity relative to larvae fed DWV or DWV with green fluorescent protein-dsRNA (probably a result of RNA silencing), but did not affect survival to the adult stage. Feeding DWV-dsRNA did not affect larval survival rates, which suggests that dsRNA is non-toxic to larvae. Feeding adult workers with DWV-dsRNA in advance of inoculation with virus increased their longevity and reduced DWV concentration relative to controls. © 2012 The Authors. Insect Molecular Biology © 2012 The Royal Entomological Society.

  5. Inhibition of Taura syndrome virus replication in Litopenaeus vannamei through silencing the LvRab7 gene using double-stranded RNA. (United States)

    Ongvarrasopone, Chalermporn; Saejia, Pipop; Chanasakulniyom, Mayuree; Panyim, Sakol


    Taura syndrome virus (TSV) is a major cause of high mortality in Pacific white shrimp (Litopenaeus vannamei, Lv). Previously, silencing of Penaeus monodon Rab7 (PmRab7) by injecting double-stranded RNA corresponding to PmRab7 (dsRNA-PmRab7) prevented white spot syndrome virus or yellow head virus infection. Rab7 is proposed to be involved in intracellular trafficking of the viruses. This study aimed to investigate whether knockdown of Rab7 in L. vannamei by dsRNA-PmRab7 could inhibit replication of TSV. RNA interference (RNAi) technology using dsRNA targeting the LvRab7 gene was used to silence the mRNA expression of LvRab7. The silencing of the LvRab7 gene inhibited TSV replication dramatically when compared to groups receiving dsRNA-GFP or NaCl. This is the first demonstration that dsRNA targeting the endogenous shrimp gene LvRab7 strongly reduces TSV replication. It provides further evidence that LvRab7 is involved in the endosomal trafficking pathway of viruses infecting penaeid shrimp.

  6. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae. (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael


    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia


    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  8. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.


    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  9. String-nets, single- and double-stranded quantum loop gases for non-Abelian anyons

    Energy Technology Data Exchange (ETDEWEB)

    Velenich, Andrea; Chamon, Claudio [Physics Department, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 (United States); Wen Xiaogang, E-mail: velenich@bu.ed [Department of Physics, Massachusetts Institute of Technology, Cambridge, MA 02215 (United States)


    String-nets and quantum loop gases are two prominent microscopic lattice models to describe topological phases. String-net condensation can give rise to both Abelian and non-Abelian anyons, whereas loop condensation usually produces Abelian anyons. It has been proposed, however, that generalized quantum loop gases with non-orthogonal inner products could support non-Abelian anyons. We detail an exact mapping between the string-net and these generalized loop models and explain how the non-orthogonal products arise. We also introduce an equivalent loop model of double-stranded nets where quantum loops with an orthogonal inner product and local interactions supports non-Abelian Fibonacci anyons. Finally, we emphasize the origin of the sign problem in systems with non-Abelian excitations and its consequences on the complexity of their ground state wavefunctions. (fast track communication)

  10. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.


    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M


    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  11. Self-consistent modeling of entangled network strands and linear dangling structures in a single-strand mean-field slip-link model

    DEFF Research Database (Denmark)

    Jensen, Mette Krog; Khaliullin, Renat; Schieber, Jay D.


    knowledge about the effect of dangling ends and soluble structures. To interpret our recent experimental results, we exploit a molecular model that can predict LVE data and non-linear stress–strain data. The slip-link model has proven to be a robust tool for both LVE and non-linear stress–strain predictions...... strands in the ensemble are attached to the network in both ends. Next we add dangling strands to the network representing the stoichiometric imbalance, or imperfections during curing. By considering monodisperse network strands without dangling ends, we find that the relative low-frequency plateau, G0/GN......0G0G0N, decreases linearly with the average number of entanglements. The decrease from GN0G0N to G 0 is a result of monomer fluctuations between entanglements, which is similar to “longitudinal modes” in tube theory. It is found that the slope of G′ is dependent on the fraction of network strands...

  12. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio


    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  13. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Directory of Open Access Journals (Sweden)

    Bray Clifford M


    Full Text Available Abstract Background DNA ligase enzymes catalyse the joining of adjacent polynucleotides and as such play important roles in DNA replication and repair pathways. Eukaryotes possess multiple DNA ligases with distinct roles in DNA metabolism, with clear differences in the functions of DNA ligase orthologues between animals, yeast and plants. DNA ligase 1, present in all eukaryotes, plays critical roles in both DNA repair and replication and is indispensable for cell viability. Results Knockout mutants of atlig1 are lethal. Therefore, RNAi lines with reduced levels of AtLIG1 were generated to allow the roles and importance of Arabidopsis DNA ligase 1 in DNA metabolism to be elucidated. Viable plants were fertile but displayed a severely stunted and stressed growth phenotype. Cell size was reduced in the silenced lines, whilst flow cytometry analysis revealed an increase of cells in S-phase in atlig1-RNAi lines relative to wild type plants. Comet assay analysis of isolated nuclei showed atlig1-RNAi lines displayed slower repair of single strand breaks (SSBs and also double strand breaks (DSBs, implicating AtLIG1 in repair of both these lesions. Conclusion Reduced levels of Arabidopsis DNA ligase 1 in the silenced lines are sufficient to support plant development but result in retarded growth and reduced cell size, which may reflect roles for AtLIG1 in both replication and repair. The finding that DNA ligase 1 plays an important role in DSB repair in addition to its known function in SSB repair, demonstrates the existence of a previously uncharacterised novel pathway, independent of the conserved NHEJ. These results indicate that DNA ligase 1 functions in both DNA replication and in repair of both ss and dsDNA strand breaks in higher plants.

  14. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. (United States)

    Castro-Chavez, Fernando


    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  15. LNA units present in the (2'-OMe)-RNA strand stabilize parallel duplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA and parallel triplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA/RNA. An improved tool for the inhibition of reverse transcription. (United States)

    Maciaszek, Anna; Krakowiak, Agnieszka; Janicka, Magdalena; Tomaszewska-Antczak, Agnieszka; Sobczak, Milena; Mikołajczyk, Barbara; Guga, Piotr


    Homopurine phosphorothioate analogs of DNA, possessing all phosphorus atoms of RP configuration ([All-RP-PS]-DNA), when interact with appropriate complementary RNA or (2'-OMe)-RNA templates, form parallel triplexes or parallel duplexes of very high thermodynamic stability. The present results show that T-LNA or 5-Me-C-LNA units introduced into the parallel Hoogsteen-paired (2'-OMe)-RNA strands (up to four units in the oligomers of 9 or 12 nt in length) stabilize these parallel complexes. At neutral pH, dodecameric parallel duplexes have Tm values of 62-68 °C, which are by 4-10 °C higher than Tm for the reference duplex (with no LNA units present), while for the corresponding triplexes, Tm values exceeded 85 °C. For nonameric parallel duplexes, melting temperatures of 38-62 °C were found and (2'-OMe)-RNA oligomers containing 5-Me-C-LNA units stabilized the complexes more efficiently than the T-LNA containing congeners. In both series the stability of the parallel complexes increased with an increasing number of LNA units present. The same trend was observed in experiments of reverse transcription RNA→DNA (using AMV RT reverse transcriptase) where the formation of parallel triplexes (consisting of an RNA template, [All-RP-PS]-DNA nonamer and Hoogsteen-paired (2'-OMe)-RNA strands containing the LNA units) led to the efficient inhibition of the process. Under the best conditions checked (four 5-Me-C-LNA units, three-fold excess over the RNA template) the inhibition was 94% effective, compared to 71% inhibition observed in the reference system with the Hoogsteen-paired (2'-OMe)-RNA strand carrying no LNA units. This kind of complexation may "arrest" harmful RNA oligomers (e.g., viral RNA or mRNA of unwanted proteins) and, beneficially, exclude them from enzymatic processes, otherwise leading to viral or genetic diseases.

  16. Exogenous application of double-stranded RNA molecules from TMV p126 and CP genes confers resistance against TMV in tobacco. (United States)

    Konakalla, Naga Charan; Kaldis, Athanasios; Berbati, Margarita; Masarapu, Hema; Voloudakis, Andreas E


    External application of dsRNA molecules from Tobacco mosaic virus (TMV) p126 and CP genes confers significant resistance against TMV infection. Exogenously applied dsRNA exhibits a rapid systemic trafficking in planta , and it is processed successfully by DICER-like proteins producing small interfering RNAs. RNA interference (RNAi) is a sequence-specific, post-transcriptional gene silencing mechanism, induced by double-stranded RNA (dsRNA), which protects eukaryotic cells against invasive nucleic acids like viruses and transposons. In the present study, we used a non-transgenic strategy to induce RNAi in Nicotiana tabacum cv. Xanthi plants against TMV. DsRNA molecules for the p126 (TMV silencing suppressor) and coat protein (CP) genes were produced by a two-step PCR approach followed by in vitro transcription. The application of TMV p126 dsRNA onto tobacco plants induced greater resistance against TMV infection as compared to CP dsRNA (65 vs. 50 %). This study also reported the fast systemic spread of TMV p126 dsRNA from the treated (local) to non-treated (systemic) leaves beginning from 1 h post-application, confirmed by both conventional and real-time RT-PCR. Furthermore, we employed a stem-loop RT-PCR and confirmed the presence of a putative viral siRNA for up to 9 days in local leaves and up to 6 days in systemic leaves post-application. The approach employed could represent a simple and environmentally safe way for the control of plant viruses in future agriculture.

  17. Accurate single nucleotide variant detection in viral populations by combining probabilistic clustering with a statistical test of strand bias (United States)


    Background Deep sequencing is a powerful tool for assessing viral genetic diversity. Such experiments harness the high coverage afforded by next generation sequencing protocols by treating sequencing reads as a population sample. Distinguishing true single nucleotide variants (SNVs) from sequencing errors remains challenging, however. Current protocols are characterised by high false positive rates, with results requiring time consuming manual checking. Results By statistical modelling, we show that if multiple variant sites are considered at once, SNVs can be called reliably from high coverage viral deep sequencing data at frequencies lower than the error rate of the sequencing technology, and that SNV calling accuracy increases as true sequence diversity within a read length increases. We demonstrate these findings on two control data sets, showing that SNV detection is more reliable on a high diversity human immunodeficiency virus sample as compared to a moderate diversity sample of hepatitis C virus. Finally, we show that in situations where probabilistic clustering retains false positive SNVs (for instance due to insufficient sample diversity or systematic errors), applying a strand bias test based on a beta-binomial model of forward read distribution can improve precision, with negligible cost to true positive recall. Conclusions By combining probabilistic clustering (implemented in the program ShoRAH) with a statistical test of strand bias, SNVs may be called from deeply sequenced viral populations with high accuracy. PMID:23879730

  18. Single nucleotide-level mapping of DNA double-strand breaks in human HEK293T cells

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope


    Full Text Available Constitutional biological processes involve the generation of DNA double-strand breaks (DSBs. The production of such breaks and their subsequent resolution are also highly relevant to neurodegenerative diseases and cancer, in which extensive DNA fragmentation has been described Stephens et al. (2011, Blondet et al. (2001. Tchurikov et al. Tchurikov et al. (2011, 2013 have reported previously that frequent sites of DSBs occur in chromosomal domains involved in the co-ordinated expression of genes. This group report that hot spots of DSBs in human HEK293T cells often coincide with H3K4me3 marks, associated with active transcription Kravatsky et al. (2015 and that frequent sites of DNA double-strand breakage are likely to be relevant to cancer genomics Tchurikov et al. (2013, 2016 . Recently, they applied a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended DSB sites and mapped these to the human genome within defined co-ordinate ‘windows’. In this paper, we re-analyse public RAFT data to derive sites of DSBs at the single-nucleotide level across the built genome for human HEK293T cells ( This refined mapping, combined with accessory ENCODE data tracks and ribosomal DNA-related sequence annotations, will likely be of value for the design of clinically relevant targeted assays such as those for cancer susceptibility, diagnosis, treatment-matching and prognostication.

  19. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  20. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System. (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder


    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  1. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara


    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  2. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti


    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  3. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  4. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  5. Modeling of the catalytic core of Arabidopsis thaliana Dicer-like 4 protein and its complex with double-stranded RNA. (United States)

    Mickiewicz, Agnieszka; Sarzyńska, Joanna; Miłostan, Maciej; Kurzyńska-Kokorniak, Anna; Rybarczyk, Agnieszka; Łukasiak, Piotr; Kuliński, Tadeusz; Figlerowicz, Marek; Błażewicz, Jacek


    Plant Dicer-like proteins (DCLs) belong to the Ribonuclease III (RNase III) enzyme family. They are involved in the regulation of gene expression and antiviral defense through RNA interference pathways. A model plant, Arabidopsis thaliana encodes four DCL proteins (AtDCL1-4) that produce different classes of small regulatory RNAs. Our studies focus on AtDCL4 that processes double-stranded RNAs (dsRNAs) into 21 nucleotide trans-acting small interfering RNAs. So far, little is known about the structures of plant DCLs and the complexes they form with dsRNA. In this work, we present models of the catalytic core of AtDCL4 and AtDCL4-dsRNA complex constructed by computational methods. We built a homology model of the catalytic core of AtDCL4 comprising Platform, PAZ, Connector helix and two RNase III domains. To assemble the AtDCL4-dsRNA complex two modeling approaches were used. In the first method, to establish conformations that allow building a consistent model of the complex, we used Normal Mode Analysis for both dsRNA and AtDCL4. The second strategy involved template-based approach for positioning of the PAZ domain and manual arrangement of the Connector helix. Our results suggest that the spatial orientation of the Connector helix, Platform and PAZ relative to the RNase III domains is crucial for measuring dsRNA of defined length. The modeled complexes provide information about interactions that may contribute to the relative orientations of these domains and to dsRNA binding. All these information can be helpful for understanding the mechanism of AtDCL4-mediated dsRNA recognition and binding, to produce small RNA of specific size. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample. (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao


    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  7. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)


    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  8. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.


    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  9. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.


    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  10. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi


    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  11. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.


    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  12. Investigation on accordance of DNA double-strand break of blood between in vivo and in vitro irradiation using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Liu Qiang; Jiang Enhai; Li Jin; Tang Weisheng; Wang Zhiquan; Zhao Yongcheng; Fan Feiyue


    Objective: To observe the consistency of DNA double-strand break between in vivo and in vitro irradiation, as a prophase study in radiation biodosimetry using single cell gel electrophoresis (SCGE). Methods: Detect DNA double-strand break after whole-body and in vitro radiation in mice lymphocytes using neutral single cell gel electrophoresis. The comet images were processed by CASP software and all the data were analysed by SPSS12.0. Results: There is no difference between in vivo and in vitro irradiation group in HDNA%, TDNA%, CL, TL, TM and OTM. Conclusion: The result of neutral single cell gel electrophoresis shortly after in vitro irradiation can precisely reflect the DNA double-strand break of lymphocytes in whole-body irradiation. (authors)

  13. A new wine Saccharomyces cerevisiae killer toxin (Klus), encoded by a double-stranded rna virus, with broad antifungal activity is evolutionarily related to a chromosomal host gene. (United States)

    Rodríguez-Cousiño, Nieves; Maqueda, Matilde; Ambrona, Jesús; Zamora, Emiliano; Esteban, Rosa; Ramírez, Manuel


    Wine Saccharomyces cerevisiae strains producing a new killer toxin (Klus) were isolated. They killed all the previously known S. cerevisiae killer strains, in addition to other yeast species, including Kluyveromyces lactis and Candida albicans. The Klus phenotype is conferred by a medium-size double-stranded RNA (dsRNA) virus, Saccharomyces cerevisiae virus Mlus (ScV-Mlus), whose genome size ranged from 2.1 to 2.3 kb. ScV-Mlus depends on ScV-L-A for stable maintenance and replication. We cloned and sequenced Mlus. Its genome structure is similar to that of M1, M2, or M28 dsRNA, with a 5'-terminal coding region followed by two internal A-rich sequences and a 3'-terminal region without coding capacity. Mlus positive strands carry cis-acting signals at their 5' and 3' termini for transcription and replication similar to those of killer viruses. The open reading frame (ORF) at the 5' portion codes for a putative preprotoxin with an N-terminal secretion signal, potential Kex2p/Kexlp processing sites, and N-glycosylation sites. No sequence homology was found either between the Mlus dsRNA and M1, M2, or M28 dsRNA or between Klus and the K1, K2, or K28 toxin. The Klus amino acid sequence, however, showed a significant degree of conservation with that of the product of the host chromosomally encoded ORF YFR020W of unknown function, thus suggesting an evolutionary relationship.

  14. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii. (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten


    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  15. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana. (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef


    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  16. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol. (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  17. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  18. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata


    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  19. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles. (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun


    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  20. Mutational analysis of vaccinia virus E3 protein: the biological functions do not correlate with its biochemical capacity to bind double-stranded RNA. (United States)

    Dueck, Kevin J; Hu, YuanShen Sandy; Chen, Peter; Deschambault, Yvon; Lee, Jocelyn; Varga, Jessie; Cao, Jingxin


    Vaccinia E3 protein has the biochemical capacity of binding to double-stranded RNA (dsRNA). The best characterized biological functions of the E3 protein include its host range function, suppression of cytokine expression, and inhibition of interferon (IFN)-induced antiviral activity. Currently, the role of the dsRNA binding capacity in the biological functions of the E3 protein is not clear. To further understand the mechanism of the E3 protein biological functions, we performed alanine scanning of the entire dsRNA binding domain of the E3 protein to examine the link between its biochemical capacity of dsRNA binding and biological functions. Of the 115 mutants examined, 20 were defective in dsRNA binding. Although the majority of the mutants defective in dsRNA binding also showed defective replication in HeLa cells, nine mutants (I105A, Y125A, E138A, F148A, F159A, K171A, L182A, L183A, and I187/188A) retained the host range function to various degrees. Further examination of a set of representative E3L mutants showed that residues essential for dsRNA binding are not essential for the biological functions of E3 protein, such as inhibition of protein kinase R (PKR) activation, suppression of cytokine expression, and apoptosis. Thus, data described in this communication strongly indicate the E3 protein performs its biological functions via a novel mechanism which does not correlate with its dsRNA binding activity. dsRNAs produced during virus replication are important pathogen-associated molecular patterns (PAMPs) for inducing antiviral immune responses. One of the strategies used by many viruses to counteract such antiviral immune responses is achieved by producing dsRNA binding proteins, such as poxvirus E3 family proteins, influenza virus NS1, and Ebola virus V35 proteins. The most widely accepted model for the biological functions of this class of viral dsRNA binding proteins is that they bind to and sequester viral dsRNA PAMPs; thus, they suppress the related

  1. RNA-dependent RNA targeting by CRISPR-Cas9


    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A


    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA...

  2. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR. (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk


    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  3. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian


    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  4. Understanding the kinetic mechanism of RNA single base pair formation. (United States)

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie


    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model.

  5. Sendai virus C protein plays a role in restricting PKR activation by limiting the generation of intracellular double-stranded RNA. (United States)

    Takeuchi, Kenji; Komatsu, Takayuki; Kitagawa, Yoshinori; Sada, Kiyonao; Gotoh, Bin


    Sendai virus (SeV) C protein is a multifunctional protein that plays important roles in regulating viral genome replication and transcription, antagonizing the host interferon system, suppressing virus-induced apoptosis, and facilitating virus assembly and budding. We here report a novel role of SeV C protein, the limitation of double-stranded RNA (dsRNA) generation for maintaining the rate of protein synthesis in infected cells. It was found that the intracellular protein synthesis rate was maintained even after wild-type (wt) SeV infection, but markedly suppressed following C-knockout SeV infection. This indicates the requirement of C protein for maintaining protein synthesis after infection. In contrast to wt SeV infection, C-knockout SeV infection caused phosphorylation of both the translation initiation factor eIF2alpha and dsRNA-dependent protein kinase (PKR). Phosphorylation of eIF2alpha occurred mainly due to the action of PKR, since knockdown of PKR by small interfering RNA limited eIF2alpha phosphorylation. C protein, however, could inhibit neither poly(I):poly(C)-activated nor Newcastle disease virus-induced phosphorylation of PKR and eIF2alpha, suggesting that C protein does not target common pathways leading to PKR activation. Immunofluorescent staining experiments with a monoclonal antibody specifically recognizing dsRNA revealed generation of a large amount of dsRNA in cells infected with C-knockout SeV but not wt SeV. The dsRNA generation as well as phosphorylation of PKR and eIF2alpha induced by C-knockout SeV was markedly suppressed in cells constitutively expressing C protein. Taken together, these results demonstrate that the SeV C protein limits generation of dsRNA, thereby keeping PKR inactive to maintain intracellular protein synthesis.

  6. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.


    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  7. Unpaired 5' ppp-nucleotides, as found in arenavirus double-stranded RNA panhandles, are not recognized by RIG-I. (United States)

    Marq, Jean-Baptiste; Kolakofsky, Daniel; Garcin, Dominique


    Arenavirus and bunyavirus RNA genomes are unusual in that they are found in circular nucleocapsids, presumably due to the annealing of their complementary terminal sequences. Moreover, arenavirus genome synthesis initiates with GTP at position +2 of the template rather than at the precise 3' end (position +1). After formation of a dinucleotide, 5' pppGpC(OH) is then realigned on the template before this primer is extended. The net result of this "prime and realign" mechanism of genome initiation is that 5' pppG is found as an unpaired 5' nucleotide when the complementary genome ends anneal to form a double-stranded (dsRNA) panhandle. Using 5' pppRNA made in vitro and purified so that all dsRNA side products are absent, we have determined that both this 5' nucleotide overhang, as well as mismatches within the dsRNA (as found in some arenavirus genomes), clearly reduce the ability of these model dsRNAs to induce interferon upon transfection into cells. The presence of this unpaired 5' ppp-nucleotide is thus another way that some viruses appear to use to avoid detection by cytoplasmic pattern recognition receptors.

  8. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova


    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  9. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek


    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  10. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter. (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi


    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  11. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family. (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław


    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  12. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija


    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  13. Large Domain Motions in Ago Protein Controlled by the Guide DNA-Strand Seed Region Determine the Ago-DNA-mRNA Complex Recognition Process (United States)

    Xia, Zhen; Huynh, Tien; Ren, Pengyu; Zhou, Ruhong


    The recognition mechanism and cleavage activity of argonaute (Ago), miRNA, and mRNA complexes are the core processes to the small non-coding RNA world. The 5′ nucleation at the ‘seed’ region (position 2–8) of miRNA was believed to play a significant role in guiding the recognition of target mRNAs to the given miRNA family. In this paper, we have performed all-atom molecular dynamics simulations of the related and recently revealed Ago-DNA:mRNA ternary complexes to study the dynamics of the guide-target recognition and the effect of mutations by introducing “damaging” C·C mismatches at different positions in the seed region of the DNA-RNA duplex. Our simulations show that the A-form-like helix duplex gradually distorts as the number of seed mismatches increases and the complex can survive no more than two such mismatches. Severe distortions of the guide-target heteroduplex are observed in the ruinous 4-sites mismatch mutant, which give rise to a bending motion of the PAZ domain along the L1/L2 “hinge-like” connection segment, resulting in the opening of the nucleic-acid-binding channel. These long-range interactions between the seed region and PAZ domain, moderated by the L1/L2 segments, reveal the central role of the seed region in the guide-target strands recognition: it not only determines the guide-target heteroduplex’s nucleation and propagation, but also regulates the dynamic motions of Ago domains around the nucleic-acid-binding channel. PMID:23382927

  14. Terahertz time-domain spectroscopy and imaging of artificial RNA

    DEFF Research Database (Denmark)

    Fischer, Bernd M.; Hoffmann, Matthias; Helm, Hanspeter


    We use terahertz time-domain spectroscopy (THz-TDS) to measure the far-infrared dielectric function of two artificial RNA single strands, composed of polyadenylic acid (poly-A) and polycytidylic acid (poly-C). We find a significant difference in the absorption between the two types of RNA strands...

  15. Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA. (United States)

    Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi


    A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.


    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  17. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.


    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  18. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.


    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  19. Opposing Roles of Double-Stranded RNA Effector Pathways and Viral Defense Proteins Revealed with CRISPR-Cas9 Knockout Cell Lines and Vaccinia Virus Mutants. (United States)

    Liu, Ruikang; Moss, Bernard


    Vaccinia virus (VACV) decapping enzymes and cellular exoribonuclease Xrn1 catalyze successive steps in mRNA degradation and prevent double-stranded RNA (dsRNA) accumulation, whereas the viral E3 protein can bind dsRNA. We showed that dsRNA and E3 colocalized within cytoplasmic viral factories in cells infected with a decapping enzyme mutant as well as with wild-type VACV and that they coprecipitated with antibody. An E3 deletion mutant induced protein kinase R (PKR) and eukaryotic translation initiation factor alpha (eIF2α) phosphorylation earlier and more strongly than a decapping enzyme mutant even though less dsRNA was made, leading to more profound effects on viral gene expression. Human HAP1 and A549 cells were genetically modified by clustered regularly interspaced short palindromic repeat-Cas9 (CRISPR-Cas9) to determine whether the same pathways restrict E3 and decapping mutants. The E3 mutant replicated in PKR knockout (KO) HAP1 cells in which RNase L is intrinsically inactive but only with a double knockout (DKO) of PKR and RNase L in A549 cells, indicating that both pathways decreased replication equivalently and that no additional dsRNA pathway was crucial. In contrast, replication of the decapping enzyme mutant increased significantly (though less than that of wild-type virus) in DKO A549 cells but not in DKO HAP1 cells where a smaller increase in viral protein synthesis occurred. Xrn1 KO A549 cells were viable but nonpermissive for VACV; however, wild-type and mutant viruses replicated in triple-KO cells in which RNase L and PKR were also inactivated. Since KO of PKR and RNase L was sufficient to enable VACV replication in the absence of E3 or Xrn1, the poor replication of the decapping mutant, particularly in HAP1 DKO, cells indicated additional translational defects. Viruses have evolved ways of preventing or counteracting the cascade of antiviral responses that double-stranded RNA (dsRNA) triggers in host cells. We showed that the dsRNA produced in

  20. PI3K-delta mediates double-stranded RNA-induced upregulation of B7-H1 in BEAS-2B airway epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Kan-o, Keiko [Research Institute for Diseases of the Chest, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Matsumoto, Koichiro, E-mail: [Research Institute for Diseases of the Chest, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Asai-Tajiri, Yukari; Fukuyama, Satoru; Hamano, Saaka; Seki, Nanae; Nakanishi, Yoichi [Research Institute for Diseases of the Chest, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Inoue, Hiromasa [Research Institute for Diseases of the Chest, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Department of Pulmonary Medicine, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan)


    Highlights: •Double-stranded RNA upregulates B7-H1 on BEAS-2B airway epithelial cells. •The upregulation of B7-H1 is attenuated by inhibition of PI3Kδ isoform. •PI3Kδ-mediated upregulation of B7-H1 is independent of NF-κB activation. •Inhibition of PI3Kδ may prevent persistent viral infection induced by B7-H1. -- Abstract: Airway viral infection disturbs the health-related quality of life. B7-H1 (also known as PD-L1) is a coinhibitory molecule associated with the escape of viruses from the mucosal immunity, leading to persistent infection. Most respiratory viruses generate double-stranded (ds) RNA during replication. The stimulation of cultured airway epithelial cells with an analog of viral dsRNA, polyinosinic-polycytidylic acid (poly IC) upregulates the expression of B7-H1 via activation of the nuclear factor κB(NF-κB). The mechanism of upregulation was investigated in association with phosphatidylinositol 3-kinases (PI3Ks). Poly IC-induced upregulation of B7-H1 was profoundly suppressed by a pan-PI3K inhibitor and partially by an inhibitor or a small interfering (si)RNA for PI3Kδ in BEAS-2B cells. Similar results were observed in the respiratory syncytial virus-infected cells. The expression of p110δ was detected by Western blot and suppressed by pretreatment with PI3Kδ siRNA. The activation of PI3Kδ is typically induced by oxidative stress. The generation of reactive oxygen species was increased by poly IC. Poly IC-induced upregulation of B7-H1 was attenuated by N-acetyl-L-cysteine, an antioxidant, or by oxypurinol, an inhibitor of xanthine oxidase. Poly IC-induced activation of NF-κB was suppressed by a pan-PI3K inhibitor but not by a PI3Kδ inhibitor. These results suggest that PI3Kδ mediates dsRNA-induced upregulation of B7-H1 without affecting the activation of NF-κB.

  1. PI3K-delta mediates double-stranded RNA-induced upregulation of B7-H1 in BEAS-2B airway epithelial cells

    International Nuclear Information System (INIS)

    Kan-o, Keiko; Matsumoto, Koichiro; Asai-Tajiri, Yukari; Fukuyama, Satoru; Hamano, Saaka; Seki, Nanae; Nakanishi, Yoichi; Inoue, Hiromasa


    Highlights: •Double-stranded RNA upregulates B7-H1 on BEAS-2B airway epithelial cells. •The upregulation of B7-H1 is attenuated by inhibition of PI3Kδ isoform. •PI3Kδ-mediated upregulation of B7-H1 is independent of NF-κB activation. •Inhibition of PI3Kδ may prevent persistent viral infection induced by B7-H1. -- Abstract: Airway viral infection disturbs the health-related quality of life. B7-H1 (also known as PD-L1) is a coinhibitory molecule associated with the escape of viruses from the mucosal immunity, leading to persistent infection. Most respiratory viruses generate double-stranded (ds) RNA during replication. The stimulation of cultured airway epithelial cells with an analog of viral dsRNA, polyinosinic-polycytidylic acid (poly IC) upregulates the expression of B7-H1 via activation of the nuclear factor κB(NF-κB). The mechanism of upregulation was investigated in association with phosphatidylinositol 3-kinases (PI3Ks). Poly IC-induced upregulation of B7-H1 was profoundly suppressed by a pan-PI3K inhibitor and partially by an inhibitor or a small interfering (si)RNA for PI3Kδ in BEAS-2B cells. Similar results were observed in the respiratory syncytial virus-infected cells. The expression of p110δ was detected by Western blot and suppressed by pretreatment with PI3Kδ siRNA. The activation of PI3Kδ is typically induced by oxidative stress. The generation of reactive oxygen species was increased by poly IC. Poly IC-induced upregulation of B7-H1 was attenuated by N-acetyl-L-cysteine, an antioxidant, or by oxypurinol, an inhibitor of xanthine oxidase. Poly IC-induced activation of NF-κB was suppressed by a pan-PI3K inhibitor but not by a PI3Kδ inhibitor. These results suggest that PI3Kδ mediates dsRNA-induced upregulation of B7-H1 without affecting the activation of NF-κB

  2. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis. (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef


    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  3. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  4. Organization of DNA partners and strand exchange mechanisms during Flp site-specific recombination analyzed by difference topology, single molecule FRET and single molecule TPM. (United States)

    Ma, Chien-Hui; Liu, Yen-Ting; Savva, Christos G; Rowley, Paul A; Cannon, Brian; Fan, Hsiu-Fang; Russell, Rick; Holzenburg, Andreas; Jayaram, Makkuni


    Flp site-specific recombination between two target sites (FRTs) harboring non-homology within the strand exchange region does not yield stable recombinant products. In negatively supercoiled plasmids containing head-to-tail sites, the reaction produces a series of knots with odd-numbered crossings. When the sites are in head-to-head orientation, the knot products contain even-numbered crossings. Both types of knots retain parental DNA configuration. By carrying out Flp recombination after first assembling the topologically well defined Tn3 resolvase synapse, it is possible to determine whether these knots arise by a processive or a dissociative mechanism. The nearly exclusive products from head-to-head and head-to-tail oriented "non-homologous" FRT partners are a 4-noded knot and a 5-noded knot, respectively. The corresponding products from a pair of native (homologous) FRT sites are a 3-noded knot and a 4-noded catenane, respectively. These results are consistent with non-homology-induced two rounds of dissociative recombination by Flp, the first to generate reciprocal recombinants containing non-complementary base pairs and the second to produce parental molecules with restored base pairing. Single molecule fluorescence resonance energy transfer (smFRET) analysis of geometrically restricted FRTs, together with single molecule tethered particle motion (smTPM) assays of unconstrained FRTs, suggests that the sites are preferentially synapsed in an anti-parallel fashion. This selectivity in synapse geometry occurs prior to the chemical steps of recombination, signifying early commitment to a productive reaction path. The cumulative topological, smFRET and smTPM results have implications for the relative orientation of DNA partners and the directionality of strand exchange during recombination mediated by tyrosine site-specific recombinases. Copyright © 2013. Published by Elsevier Ltd.

  5. A new wine Torulaspora delbrueckii killer strain with broad antifungal activity and its toxin-encoding double-stranded RNA virus (United States)

    Ramírez, Manuel; Velázquez, Rocío; Maqueda, Matilde; López-Piñeiro, Antonio; Ribas, Juan C.


    Wine Torulaspora delbrueckii strains producing a new killer toxin (Kbarr-1) were isolated and selected for wine making. They killed all the previously known Saccharomyces cerevisiae killer strains, in addition to other non-Saccharomyces yeasts. The Kbarr-1 phenotype is encoded by a medium-size 1.7 kb dsRNA, TdV-Mbarr-1, which seems to depend on a large-size 4.6 kb dsRNA virus (TdV-LAbarr) for stable maintenance and replication. The TdV-Mbarr-1 dsRNA was sequenced by new generation sequencing techniques. Its genome structure is similar to those of S. cerevisiae killer M dsRNAs, with a 5′-end coding region followed by an internal A-rich sequence and a 3′-end non-coding region. Mbarr-1 RNA positive strand carries cis acting signals at its 5′ and 3′ termini for transcription and replication respectively, similar to those RNAs of yeast killer viruses. The ORF at the 5′ region codes for a putative preprotoxin with an N-terminal secretion signal, potential Kex2p/Kexlp processing sites, and N-glycosylation sites. No relevant sequence identity was found either between the full sequence of Mbarr-1 dsRNA and other yeast M dsRNAs, or between their respective toxin-encoded proteins. However, a relevant identity of TdV-Mbarr-1 RNA regions to the putative replication and packaging signals of most of the M-virus RNAs suggests that they are all evolutionarily related. PMID:26441913

  6. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.


    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  7. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian


    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  8. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.


    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  9. Hepatitis C virus replicative double-stranded RNA is a potent interferon inducer that triggers interferon production through MDA5. (United States)

    Du, Xiaoting; Pan, Tingting; Xu, Jun; Zhang, Yang; Song, Wuhui; Yi, Zhigang; Yuan, Zhenghong


    The cytoplasmic RNA sensors, retinoic acid-inducible gene I and melanoma differentiation-associated gene 5, play crucial roles in innate sensing of hepatitis C virus (HCV). However, the exact identity of the IFN inducer generated during HCV infection is poorly understood. To identify the IFN inducer, we extracted the RNAs from HCV-replicating cells and introduced these into IFN signalling-competent cells to examine IFN production. RNAs isolated from HCV-replicating cells triggered robust IFN-β and IFN-λ production in Huh7 cells in a viral replication-dependent manner, preferentially through the melanoma differentiation-associated gene 5 but not through the retinoic acid-inducible gene I-mediated pathway. The IFN-inducing capacity of HCV RNA survived after calf intestinal alkaline phosphatase and ssRNA-specific S1 nuclease treatment, but was completely eliminated by dsRNA-specific RNase III digestion, suggesting that viral replicative dsRNA is an IFN inducer. Furthermore, HCV viral RNA extracted from replicating cells was sensitive to 5'-monophosphate-dependent 5'→3' exonuclease (TER) digestion, suggesting that the HCV genome lacks a 5'-triphosphate or -diphosphate. In semi-permeabilized cells, the HCV IFN inducer primarily resided in an enclosed membranous structure that protects the IFN inducer from RNase digestion. Taken together, we identified HCV replicative dsRNA as a viral IFN inducer enclosed within the viral replication factory.

  10. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI. (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O


    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  11. Novel Bat Influenza Virus NS1 Proteins Bind Double-Stranded RNA and Antagonize Host Innate Immunity. (United States)

    Turkington, Hannah L; Juozapaitis, Mindaugas; Kerry, Philip S; Aydillo, Teresa; Ayllon, Juan; García-Sastre, Adolfo; Schwemmle, Martin; Hale, Benjamin G


    We demonstrate that novel bat HL17NL10 and HL18NL11 influenza virus NS1 proteins are effective interferon antagonists but do not block general host gene expression. Solving the RNA-binding domain structures revealed the canonical NS1 symmetrical homodimer, and RNA binding required conserved basic residues in this domain. Interferon antagonism was strictly dependent on RNA binding, and chimeric bat influenza viruses expressing NS1s defective in this activity were highly attenuated in interferon-competent cells but not in cells unable to establish antiviral immunity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. A thermodynamic investigation on the binding of phenothiazinium dyes azure A and azure B to double stranded RNA polynucleotides

    International Nuclear Information System (INIS)

    Khan, Asma Yasmeen; Suresh Kumar, Gopinatha


    Highlights: • The binding affinity of azure B was higher than azure A to the RNAs. • The binding of dyes stabilized the melting of poly(A).poly(U) and poly(I).poly(C). • Binding of azure A was enthalpy dominated but azure B binding was favoured by both enthalpy and entropy. • Nonpolyelectrolytic forces were found to play a crucial role in the binding process. • Enthalpy–entropy compensation phenomenon was seen in all the systems. - Abstract: The thermodynamics of the reactions of the two phenothiazinium dyes azure A and azure B with the three double stranded ribonucleic acids, poly(A).poly(U), poly(C).poly(G), poly(I).poly(C) were investigated using DSC and ITC. The bound dyes stabilized the RNAs against thermal strand separation. The binding of azure A to the RNAs was predominantly enthalpy dominated while the binding of azure B was favoured by both negative enthalpy and favourable entropy changes. Although electrostatic interaction had a significant role in the binding, non-polyelectrolytic forces dominated the binding process. The negative values of heat capacity changes for the binding suggested a substantial hydrophobic contribution to the binding process. The overall binding affinity of both the dyes to the RNAs varied in the order, poly(A).poly(U) > poly(C).poly(G) > poly(I).poly(C).

  13. The C proteins of human parainfluenza virus type 1 limit double-stranded RNA accumulation that would otherwise trigger activation of MDA5 and protein kinase R. (United States)

    Boonyaratanakornkit, Jim; Bartlett, Emmalene; Schomacker, Henrick; Surman, Sonja; Akira, Shizuo; Bae, Yong-Soo; Collins, Peter; Murphy, Brian; Schmidt, Alexander


    Human parainfluenza virus type 1 (HPIV1) is an important respiratory pathogen in young children, the immunocompromised, and the elderly. We found that infection with wild-type (WT) HPIV1 suppressed the innate immune response in human airway epithelial cells by preventing not only phosphorylation of interferon regulatory factor 3 (IRF3) but also degradation of IκBβ, thereby inhibiting IRF3 and NF-κB activation, respectively. Both of these effects were ablated by a F170S substitution in the HPIV1 C proteins (F170S) or by silencing the C open reading frame [P(C-)], resulting in a potent beta interferon (IFN-β) response. Using murine knockout cells, we found that IFN-β induction following infection with either mutant relied mainly on melanoma-associated differentiation gene 5 (MDA5) rather than retinoic acid-inducible gene I (RIG-I). Infection with either mutant, but not WT HPIV1, induced a significant accumulation of intracellular double-stranded RNA (dsRNA). These mutant viruses directed a marked increase in the accumulation of viral genome, antigenome, and mRNA that was coincident with the accumulation of dsRNA. In addition, the amount of viral proteins was reduced compared to that of WT HPIV1. Thus, the accumulation of dsRNA might be a result of an imbalance in the N protein/genomic RNA ratio leading to incomplete encapsidation. Protein kinase R (PKR) activation and IFN-β induction followed the kinetics of dsRNA accumulation. Interestingly, the C proteins did not appear to directly inhibit intracellular signaling involved in IFN-β induction; instead, their role in preventing IFN-β induction appeared to be in suppressing the formation of dsRNA. PKR activation contributed to IFN-β induction and also was associated with the reduction in the amount of viral proteins. Thus, the HPIV1 C proteins normally limit the accumulation of dsRNA and thereby limit activation of IRF3, NF-κB, and PKR. If C protein function is compromised, as in the case of F170S HPIV1, the

  14. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  15. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain. (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut


    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  16. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)


    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  17. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.


    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  18. Unveiling the pentagonal nature of perfectly aligned single-and double-strand Si nano-ribbons on Ag(110). (United States)

    Cerdá, Jorge I; Sławińska, Jagoda; Le Lay, Guy; Marele, Antonela C; Gómez-Rodríguez, José M; Dávila, María E


    Carbon and silicon pentagonal low-dimensional structures attract a great interest as they may lead to new exotic phenomena such as topologically protected phases or increased spin-orbit effects. However, no pure pentagonal phase has yet been realized for any of them. Here we unveil through extensive density functional theory calculations and scanning tunnelling microscope simulations, confronted to key experimental facts, the hidden pentagonal nature of single- and double-strand chiral Si nano-ribbons perfectly aligned on Ag(110) surfaces whose structure has remained elusive for over a decade. Our study reveals an unprecedented one-dimensional Si atomic arrangement solely comprising almost perfect alternating pentagons residing in the missing row troughs of the reconstructed surface. We additionally characterize the precursor structure of the nano-ribbons, which consists of a Si cluster (nano-dot) occupying a silver di-vacancy in a quasi-hexagonal configuration. The system thus materializes a paradigmatic shift from a silicene-like packing to a pentagonal one.

  19. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))


    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  20. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA. (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi


    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  1. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.


    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  2. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  3. Unveiling the pentagonal nature of perfectly aligned single-and double-strand Si nano-ribbons on Ag(110) (United States)

    Cerdá, Jorge I.; Sławińska, Jagoda; Le Lay, Guy; Marele, Antonela C.; Gómez-Rodríguez, José M.; Dávila, María E.


    Carbon and silicon pentagonal low-dimensional structures attract a great interest as they may lead to new exotic phenomena such as topologically protected phases or increased spin–orbit effects. However, no pure pentagonal phase has yet been realized for any of them. Here we unveil through extensive density functional theory calculations and scanning tunnelling microscope simulations, confronted to key experimental facts, the hidden pentagonal nature of single- and double-strand chiral Si nano-ribbons perfectly aligned on Ag(110) surfaces whose structure has remained elusive for over a decade. Our study reveals an unprecedented one-dimensional Si atomic arrangement solely comprising almost perfect alternating pentagons residing in the missing row troughs of the reconstructed surface. We additionally characterize the precursor structure of the nano-ribbons, which consists of a Si cluster (nano-dot) occupying a silver di-vacancy in a quasi-hexagonal configuration. The system thus materializes a paradigmatic shift from a silicene-like packing to a pentagonal one. PMID:27708263

  4. Molecular characterization of a bipartite double-stranded RNA virus and its satellite-like RNA co-infecting the phytopathogenic fungus Sclerotinia sclerotiorum

    Directory of Open Access Journals (Sweden)

    Lijiang eLiu


    Full Text Available A variety of mycoviruses have been found in Sclerotinia sclerotiorum. In this study, we report a novel mycovirus Sclerotinia sclerotiorum botybirnavirus 1 (SsBRV1 that was originally isolated from the hypovirulent strain SCH941 of S. sclerotiorum. SsBRV1 has rigid spherical virions that are ~38 nm in diameter, and three dsRNA segments (dsRNA1, 2 and 3 with lengths of 6.4, 6.0 and 1.7 kbp, respectively were packaged in the virions. dsRNA1 encodes a cap-pol fusion protein, and dsRNA2 encodes a polyprotein with unknown functions but contributes to the formation of virus particles. The dsRNA3 is dispensable and may be a satellite-like RNA (SatlRNA of SsBRV1. Although phylogenetic analysis of the RdRp domain demonstrated that SsBRV1 is related to Botrytis porri RNA virus 1 (BpRV1 and Ustilago maydis dsRNA virus-H1 (UmV-H1, the structure proteins of SsBRV1 do not have any significant sequence similarities with other known viral proteins with the exception of those of BpRV1. SsBRV1 carrying dsRNA3 seems to have no obvious effects on the colony morphology, but can significantly reduce the growth rate and virulence of S. sclerotiorum. Notably, a growth hormone receptor binding domain (GHBP, Pfam12772 is detected in ORF2-encoded protein of SsBRV1, which have not been reported in any other viruses. These findings provide new insights into the virus taxonomy, virus evolution and the interactions between SsBRV1 and the fungal hosts.

  5. Double-stranded RNA-induced activation of activating protein-1 promoter is differentially regulated by the non-structural protein 1 of avian influenza A viruses. (United States)

    Munir, Muhammad; Zohari, Siamak; Belák, Sándor; Berg, Mikael


    Non-structural protein 1 (NS1) of influenza A viruses is a multifunctional protein that antagonizes the host immune response by interfering with several host signaling pathways. Based on putative amino acid sequences, NS1 proteins are categorized into two gene pools, allele A and allele B. Here we identified that allele A NS1 proteins of H6N8 and H4N6 are able to inhibit double-stranded RNA (dsRNA)-induced activating protein-1 (AP-1) promoter in cultured cell lines (human A549 and mink lung cells). Allele B NS1 proteins from corresponding subtypes of influenza A viruses are weak in this inhibition, despite significant levels of expression of each NS1 protein in human A549 cells. Furthermore, the capability to inhibit AP-1 promoter was mapped in the effector domain, since RNA binding domain alone lost its ability to inhibit this promoter activation. Chimeric forms of NS1 protein, composed of either RNA binding domain of allele A or B and effector domain of allele A or B, showed comparable inhibition to that of their wild-type NS1 proteins, or to the effector domain of corresponding NS1 proteins. Both alleles A and B NS1 proteins of H6N8 and H4N6 were expressed to significant levels, and were localized predominantly in the nucleus of human A549 cells. These results underscore the importance of the effector domain in inhibiting AP-1 promoter activation, and the biological function of the effector domain in stabilizing the RNA binding domain. Further, we revealed the versatile nature of NS1 in inhibiting the AP-1 transcription factor, in a manner dependent on allele type. Comprehensive studies, focusing on the molecular mechanisms behind this differential inhibition, may facilitate exploration of the zoonotic and pathogenic potential of influenza A viruses.

  6. Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses. (United States)

    Cho, Hyelim; Proll, Sean C; Szretter, Kristy J; Katze, Michael G; Gale, Michael; Diamond, Michael S


    Although susceptibility of neurons in the brain to microbial infection is a major determinant of clinical outcome, little is known about the molecular factors governing this vulnerability. Here we show that two types of neurons from distinct brain regions showed differential permissivity to replication of several positive-stranded RNA viruses. Granule cell neurons of the cerebellum and cortical neurons from the cerebral cortex have unique innate immune programs that confer differential susceptibility to viral infection ex vivo and in vivo. By transducing cortical neurons with genes that were expressed more highly in granule cell neurons, we identified three interferon-stimulated genes (ISGs; Ifi27, Irg1 and Rsad2 (also known as Viperin)) that mediated the antiviral effects against different neurotropic viruses. Moreover, we found that the epigenetic state and microRNA (miRNA)-mediated regulation of ISGs correlates with enhanced antiviral response in granule cell neurons. Thus, neurons from evolutionarily distinct brain regions have unique innate immune signatures, which probably contribute to their relative permissiveness to infection.

  7. Plant-feeding insects harbor double-stranded RNA viruses encoding a novel proline-alanine rich protein and a polymerase distantly related to that of fungal viruses. (United States)

    Spear, Allyn; Sisterson, Mark S; Yokomi, Raymond; Stenger, Drake C


    Novel double-stranded RNAs (approximately 8 kbp) were isolated from threecornered alfalfa hopper (Spissistilus festinus) and beet leafhopper (Circulifer tenellus), two plant-feeding hemipteran insect pests. The two new viruses, designated Spissistilus festinus virus 1 (SpFV1) and Circulifer tenellus virus 1 (CiTV1), do not appear to be encapsidated in conventional virions and shared a genome organization similar to that of several unclassified fungal viruses. SpFV1 and CiTVl encode a proline-alanine rich protein (PArp) and an RNA-directed RNA polymerase (RdRp). Expression of the 3'-proximal RdRp ORF appears to result from -1 translational frameshifting of the PArp ORF. Phylogenetic analysis of the RdRp indicated that SpFV1 and CiTV1 were most closely related to each other and the unclassified plant virus Cucurbit yellows associated virus, and more distantly related to the unclassified fungal dsRNA viruses Phlebiopsis gigantea virus 2 and Fusarium graminearum virus 3. Published by Elsevier Inc.

  8. 15-lipoxygenase metabolites play an important role in the development of a T-helper type 1 allergic inflammation induced by double-stranded RNA. (United States)

    Jeon, S G; Moon, H-G; Kim, Y-S; Choi, J-P; Shin, T-S; Hong, S-W; Tae, Y-M; Kim, S-H; Zhu, Z; Gho, Y S; Kim, Y-K


    We recently demonstrated that the T-helper type 1 (Th1) immune response plays an important role in the development of non-eosinophilic inflammation induced by airway exposure of an allergen plus double-stranded RNA (dsRNA). However, the role of lipoxygenase (LO) metabolites in the development of Th1 inflammation is poorly understood. To evaluate the role of LO metabolites in the development of Th1 inflammation induced by sensitization with an allergen plus dsRNA. A Th2-allergic inflammation mouse model was created by an intraperitoneal injection of lipopolysaccharide-depleted ovalbumin (OVA, 75 microg) and alum (2 mg) twice, and the Th1 model was created by intranasal application of OVA (75 microg) and synthetic dsRNA [10 microg of poly(I : C)] four times, followed by an intranasal challenge with 50 microg of OVA four times. The role of LO metabolites was evaluated using two approaches: a transgenic approach using 5-LO(-/-) and 15-LO(-/-) mice, and a pharmacological approach using inhibitors of cysteinyl leucotriene receptor-1 (cysLTR1), LTB4 receptor (BLT1), and 15-LO. We found that the Th1-allergic inflammation induced by OVA+dsRNA sensitization was similar between 5-LO(-/-) and wild-type (WT) control mice, although Th2 inflammation induced by sensitization with OVA+alum was reduced in the former group. In addition, dsRNA-induced Th1 allergic inflammation, which is associated with down-regulation of 15-hydroxyeicosateraenoic acids production, was not affected by treatment with cysLTR1 or BLT1 inhibitors, whereas it was significantly lower in 12/15-LO(-/-) mice compared with WT control mice. Moreover, dsRNA-induced allergic inflammation and the recruitment of T cells following an allergen challenge were significantly inhibited by treatment with a specific 15-LO inhibitor (PD146176). 15-LO metabolites appear to be important mediators in the development of Th1-allergic inflammation induced by sensitization with an allergen plus dsRNA. Our findings suggest that the

  9. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control. (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A


    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Current sharing temperature of NbTi SULTAN samples compared to prediction using a single pinning mechanism parametrization for NbTi strand

    International Nuclear Information System (INIS)

    Pong, Ian; Vostner, Alexander; Devred, Arnaud; Bessette, Denis; Mitchell, Neil; Bordini, Bernardo; Bottura, Luca; Jewell, Matthew; Long Feng; Wu Yu


    NbTi strands to be used in four of the six ITER poloidal field (PF) coils, all the correction coils (CC) and all the superconducting feeder busbars are being produced in China. Short full-size qualification conductor (cabled and jacketed) samples have been developed at ASIPP and tested at CRPP. Single pinning mechanism parametrization for this Chinese strand (type S2) has been obtained using the Bottura scaling law. The determination of the scaling parameters using a Kramer-type regression method will be described. A comparison between the critical temperature at the operating current and field of a single strand as determined by the parametrization and the current sharing temperature (T CS ) of a few conductor samples tested at the SULTAN facility will be made. The validity and limitation of the estimation will be discussed. The estimated T CS dependence on various (superconducting critical as well as geometric and volumetric) parameters will be assessed using the modelled critical surface. Errors propagated from critical current (I c ) measurements of the strands and parameter fitting, and other uncertainties, will be quantified. (paper)

  11. Distinct genetic control of homologous recombination repair of Cas9-induced double-strand breaks, nicks and paired nicks

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Prakash, Rohit; Chen, Chun-Chin; Vanoli, Fabio; Cavallo, Francesca; Zhang, Yu; Jasin, Maria; Krawczyk, Przemek M.


    DNA double-strand breaks (DSBs) are known to be powerful inducers of homologous recombination (HR), but single-strand breaks (nicks) have also been shown to trigger HR. Both DSB- and nick-induced HR ((nick)HR) are exploited in advanced genome-engineering approaches based on the bacterial RNA-guided

  12. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  13. D-Isonucleotide (isoNA) incorporation around cleavage site of passenger strand promotes the vibration of Ago2-PAZ domain and enhances in vitro potency of siRNA. (United States)

    Huang, Ye; Tian, Miao; Zhang, Yichao; Sheng, Gang; Chen, Zhuo; Ma, Yuan; Chen, Yue; Peng, Yihong; Zhao, Yi-Lei; Wang, Yanli; Zhang, Lihe; Yang, Zhenjun


    It has been demonstrated that passenger strand cleavage is important for the activation of RNA-induced silencing complex (RISC), which is a crucial step for siRNA-mediated gene silencing. Herein, we report that isonucleotide (isoNA) modification around the cleavage site of the passenger strand would affect the in vitro potency of modified siRNAs by altering the motion pattern of the Ago2-PAZ domain. According to western blotting, q-PCR and antiviral test results, we proved that D-isonucleotide (isoNA) modification at the position 8 of the passenger strand (siMek1-S08D), which is adjacent to the cleavage site, markedly improved the in vitro potency of the modified siRNA, whereas siRNAs with D-isoNA incorporation at position 9 (siMek1-S09D) or L-isoNA incorporation at positions 8 and 9 (siMek1-S08L, siMek1-S09L) displayed lower activity compared to native siRNA. Kinetics evaluation of passenger strand cleavage induced by T. thermophilus Ago (Tt-Ago) showed that D-isoNA modification at position 8 of the passenger strand had no significant influence on the cleavage rate, but L-isoNA modification at position 8 slowed the cleavage rate markedly. Moreover, the results of molecular dynamics simulations showed that D-isoNA modification at position 8 affected the open-close motion of the PAZ domain in the Ago/siRNA complex, which may promote the loading of RISC and release of a passenger strand cleavage product, and consequently accelerate the activation of RISC and enhance silencing activity. However, D-isoNA modification at position 9 or L-isoNA modification at position 8 or 9 exerted opposite influences on the motion of the Ago-PAZ domain.

  14. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  15. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold. (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G


    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  16. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines. (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao


    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  17. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. (United States)

    Chomczynski, P; Sacchi, N


    A new method of total RNA isolation by a single extraction with an acid guanidinium thiocyanate-phenol-chloroform mixture is described. The method provides a pure preparation of undegraded RNA in high yield and can be completed within 4 h. It is particularly useful for processing large numbers of samples and for isolation of RNA from minute quantities of cells or tissue samples.

  18. PNPase autocontrols its expression by degrading a double-stranded structure in the pnp mRNA leader (United States)

    Jarrige, Anne-Charlotte; Mathy, Nathalie; Portier, Claude


    Polynucleotide phosphorylase synthesis is autocontrolled at a post-transcriptional level in an RNase III-dependent mechanism. RNase III cleaves a long stem–loop in the pnp leader, which triggers pnp mRNA instability, resulting in a decrease in the synthesis of polynucleotide phosphorylase. The staggered cleavage by RNase III removes the upper part of the stem–loop structure, creating a duplex with a short 3′ extension. Mutations or high temperatures, which destabilize the cleaved stem–loop, decrease expression of pnp, while mutations that stabilize the stem increase expression. We propose that the dangling 3′ end of the duplex created by RNase III constitutes a target for polynucleotide phosphorylase, which binds to and degrades the upstream half of this duplex, hence inducing pnp mRNA instability. Consistent with this interpretation, a pnp mRNA starting at the downstream RNase III processing site exhibits a very low level of expression, regardless of the presence of polynucleotide phosphorylase. Moreover, using an in vitro synthesized pnp leader transcript, it is shown that polynucleotide phosphorylase is able to digest the duplex formed after RNase III cleavage. PMID:11726520

  19. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single