WorldWideScience

Sample records for single strand hollow

  1. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  2. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  3. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  4. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  5. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  6. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  7. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  8. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  9. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  10. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  11. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  12. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  13. Monomer dynamics in single- and double-stranded DNA coils

    Science.gov (United States)

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2007-09-01

    In our paper (Tothova et al., Czech. J. Phys. 55, 221 (2005)), the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique (R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)) has been interpreted within the bead-spring theory. Optimizing the joint Rouse-Zimm model to the experimental data, the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dynamics have been determined. Recently, these data have been corrected (R. Shusterman et al., Phys. Rev. Lett. 98, 029901 (2007)). In the present work, the fits of the theory to the new data are given. The main conclusions of our preceding paper remain unchanged but some of the polymer parameters have changed. The new data allow a significantly better agreement with the theory than the previous ones. Our calculations confirm that dsDNA follows mainly the classical Zimm-type kinetics rather than the Rouse one as it was proposed by Shusterman et al. Single-stranded DNA also behaves predominantly as the Zimm polymer. To support these conclusions, we analyze the draining effects on the monomer dynamics and the applicability of simple “universal” laws, according to which the monomer mean square displacement scales with the time as t1/2 and t2/3 for the Rouse and Zimm polymers, respectively.

  14. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  15. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  16. Offset configurations for single- and double-strand DNA inside single-walled carbon nanotubes.

    Science.gov (United States)

    Alshehri, Mansoor H; Cox, Barry J; Hill, James M

    2014-01-01

    Nanotechnology is a rapidly expanding research area, and it is believed that the unique properties of molecules at the nano-scale will prove to be of substantial benefit to mankind, especially so in medicine and electronics. Here we use applied mathematical modelling exploiting the basic principles of mechanics and the 6-12 Lennard-Jones potential function together with the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities. We consider the equilibrium offset positions for both single-strand and double-strand DNA molecules inside a single-walled carbon nanotube, and we predict offset positions with reference to the cross-section of the carbon nanotube. For the double-strand DNA, the potential energy is determined for the general case for any helical phase angle ϕ, but we also consider a special case when ϕ = π, which leads to a substantial simplification in the analytical expression for the energy. As might be expected, our results confirm that the global minimum energy positions for a single-strand DNA molecule and a double-strand DNA molecule will lie off axis and they become closer to the tube wall as the radius of the tube increases.

  17. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  18. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  19. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  20. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  1. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  2. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  3. High energy nanosecond laser pulses delivered single-mode through hollow-core PBG fibers.

    Science.gov (United States)

    Shephard, Jonathan; Jones, J; Hand, D; Bouwmans, G; Knight, J; Russell, P; Mangan, B

    2004-02-23

    We report on the development of hollow-core photonic bandgap fibers for the delivery of high energy pulses for precision micromachining applications. Short pulses of (65ns pulse width) and energies of the order of 0.37mJ have been delivered in a single spatial mode through hollow-core photonic bandgap fibers at 1064nm using a high repetition rate (15kHz) Nd:YAG laser. The ultimate laser-induced damage threshold and practical limitations of current hollow-core fibers for the delivery of short optical pulses are discussed.

  4. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  5. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  6. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  7. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  8. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  9. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  10. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  12. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  13. Single slit interference made easy with a strand of hair and a laser

    Science.gov (United States)

    Messer, Rebecca

    2018-01-01

    Students can easily measure the width of a strand of their own hair with a monochromatic light source such as a laser. This inexpensive activity engages students in an application of single slit diffraction using Babinet's principle.

  14. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  15. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  16. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  17. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  18. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  19. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    NARCIS (Netherlands)

    A. Balestrini (Alessia); D. Ristic (Dejan); I. Dionne (Isabelle); X.Z. Liu (Xiao); C. Wyman (Claire); R.J. Wellinger (Raymund); J.H.J. Petrini (John)

    2013-01-01

    textabstractSingle-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the

  20. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  1. Understanding the similarity in thermophoresis between single- and double-stranded DNA or RNA

    Science.gov (United States)

    Reichl, Maren; Herzog, Mario; Greiss, Ferdinand; Wolff, Manuel; Braun, Dieter

    2015-06-01

    Thermophoresis is the movement of molecules in a temperature gradient. For aqueous solutions its microscopic basis is debated. Understanding thermophoresis for this case is, however, important since it proved very useful to detect the binding affinity of biomolecules and since thermophoresis could have played an important role in early molecular evolution. Here we discuss why the thermophoresis of single- and double-stranded oligonucleotides - DNA and RNA - is surprisingly similar. This finding is understood by comparing the spherical capacitor model for single-stranded species with the case of a rod-shaped model for double-stranded oligonucleotides. The approach describes thermophoresis of DNA and RNA with fitted effective charges consistent with electrophoresis measurements and explains the similarity between single- and double-stranded species. We could not confirm the sign change for the thermophoresis of single- versus double-stranded DNA in crowded solutions containing polyethylene glycol [Y. T. Maeda, T. Tlusty, and A. Libchaber, Proc. Natl. Acad. Sci. USA 109, 17972 (2012), 10.1073/pnas.1215764109], but find a salt-independent offset while the Debye length dependence still satisfies the capacitor model. Overall, the analysis documents the continuous progress in the microscopic understanding of thermophoresis.

  2. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  3. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  4. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  5. Laser ablation MC-ICPMS to study longitudinal stable isotopic variations in single human hair strands

    International Nuclear Information System (INIS)

    Santamaria-Fernandez, R.; Hearn, R.; Giner Martinez-Sierra, J.

    2009-01-01

    Full text: There is a need for novel approaches to measure stable isotopic variations in human tissues to provide information regarding the geographical origin and lifestyle of individuals. In this work, a method for the measurement of longitudinal sulfur isotopic variations in single hair strands has been developed. The method validation, uncertainty evaluation, in-house characterization of a horse hair sample and the potential of the method as a forensic tool to obtain information from single hair strands will be discussed. In addition, a new method for carbon isotope ratio measurements by MC-ICPMS has been developed and results will be presented. (author)

  6. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Petrov, S.I.

    1981-01-01

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  7. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  8. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  9. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  10. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  11. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  12. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  13. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  14. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  15. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  16. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  17. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  18. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  19. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  20. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  1. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  2. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  3. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  4. Multi-scale simulation of single crystal hollow turbine blade manufactured by liquid metal cooling process

    Directory of Open Access Journals (Sweden)

    Xuewei Yan

    2018-02-01

    Full Text Available Liquid metal cooling (LMC process as a powerful directional solidification (DS technique is prospectively used to manufacture single crystal (SC turbine blades. An understanding of the temperature distribution and microstructure evolution in LMC process is required in order to improve the properties of the blades. For this reason, a multi-scale model coupling with the temperature field, grain growth and solute diffusion was established. The temperature distribution and mushy zone evolution of the hollow blade was simulated and discussed. According to the simulation results, the mushy zone might be convex and ahead of the ceramic beads at a lower withdrawal rate, while it will be concave and laggard at a higher withdrawal rate, and a uniform and horizontal mushy zone will be formed at a medium withdrawal rate. Grain growth of the blade at different withdrawal rates was also investigated. Single crystal structures were all selected out at three different withdrawal rates. Moreover, mis-orientation of the grains at 8 mm/min reached ~30°, while it was ~5° and ~15° at 10 mm/min and 12 mm/min, respectively. The model for predicting dendritic morphology was verified by corresponding experiment. Large scale for 2D dendritic distribution in the whole sections was investigated by experiment and simulation, and they presented a well agreement with each other. Keywords: Hollow blade, Single crystal, Multi-scale simulation, Liquid metal cooling

  5. A microfluidic approach to fabricate monodisperse hollow or porous poly(HEMA-MMA) microspheres using single emulsions as templates.

    Science.gov (United States)

    Zhang, Hao; Ju, Xiao-Jie; Xie, Rui; Cheng, Chang-Jing; Ren, Ping-Wei; Chu, Liang-Yin

    2009-08-01

    We have successfully developed a novel and simple method to controllably prepare monodisperse poly(hydroxyethyl methacrylate-methyl methacrylate) (poly(HEMA-MMA)) microspheres with two distinct structures using single emulsions as templates. By employing a microfluidic emulsification approach to fabricate monomer-contained oil-in-water (O/W) emulsions as templates, and introducing proper initiators and different types of porogens, poly(HEMA-MMA) microspheres with hollow or porous structure are prepared in a controllable way. The shell thickness of hollow microspheres or the porosity of porous microspheres is controllably achieved by simply adjusting the porogen concentration. The prepared poly(HEMA-MMA) microspheres with controllable hollow or porous structures are favored for various potential applications. Furthermore, by using the simple preparation methodology proposed in this study, fabrication of monodisperse porous microspheres or hollow microcapsules with other materials can also be easily achieved.

  6. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  7. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  8. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  9. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  10. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  11. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  13. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  14. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  15. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  16. Developing single-molecule TPM experiments for direct observation of successful RecA-mediated strand exchange reaction.

    Science.gov (United States)

    Fan, Hsiu-Fang; Cox, Michael M; Li, Hung-Wen

    2011-01-01

    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5'-to-3' fashion, using a synapse segment with a wide and continuous size distribution.

  17. Intensity-gradient induced Sisyphus cooling of a single atom in a localized hollow-beam trap

    International Nuclear Information System (INIS)

    Yin, Yaling; Xia, Yong; Ren, Ruimin; Du, Xiangli; Yin, Jianping

    2015-01-01

    In order to realize a convenient and efficient laser cooling of a single atom, we propose a simple and promising scheme to cool a single neutral atom in a blue-detuned localized hollow-beam trap by intensity-gradient induced Sisyphus cooling, and study the dynamic process of the intensity-gradient cooling of a single 87 Rb atom in the localized hollow-beam trap by using Monte-Carlo simulations. Our study shows that a single 87 Rb atom with a temperature of 120 μK from a magneto-optical trap (MOT) can be directly cooled to a final temperature of 4.64 μK in our proposed scheme. We also investigate the dependences of the cooling results on the laser detuning δ of the localized hollow-beam, the power RP 0 of the re-pumping laser beam, the sizes of both the localized hollow-beam and the re-pumping beam, and find that there is a pair of optimal cooling parameters (δ and RP 0 ) for an expected lowest temperature, and the cooling results strongly depend on the size of the re-pumping beam, but weakly depend on the size of the localized hollow-beam. Finally, we further study the cooling potential of our localized hollow-beam trap for the initial temperature of a single atom, and find that a single 87 Rb atom with an initial temperature of higher than 1 mK can also be cooled directly to about 6.6 μK. (paper)

  18. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. High axial resolution Raman probe made of a single hollow optical fiber.

    Science.gov (United States)

    Katagiri, Takashi; Yamamoto, Yuko S; Ozaki, Yukihiro; Matsuura, Yuji; Sato, Hidetoshi

    2009-01-01

    A ball lens mounted hollow optical fiber Raman probe (BHRP) consisting of a single hollow optical fiber (HOF) and a micro-ball lens was developed for performing a high axial resolution and high-sensitivity remote Raman analysis of biomedical tissues. The total diameter of the probe head is 640 microm. The BHRP is useful in the measurement of thin-layered tissues that are in contact with the probe's surface because the probe has a limited depth-of-field optical property. An optical calculation study suggested that it is possible to vary the probe's working distance by selecting different materials and diameters for the ball lens. Empirical studies revealed that this probe has a higher axial resolution and a higher sensitivity than an HOF Raman probe without the ball lens. The spectrum of a mouse stomach measured with the BHRP had better quality and considerably lower noise than that measured with a conventional Raman microscope. These results strongly suggest that the BHRP can be used effectively in biomedical applications.

  20. Modelling and Characterization of Effective Thermal Conductivity of Single Hollow Glass Microsphere and Its Powder.

    Science.gov (United States)

    Liu, Bing; Wang, Hui; Qin, Qing-Hua

    2018-01-14

    Tiny hollow glass microsphere (HGM) can be applied for designing new light-weighted and thermal-insulated composites as high strength core, owing to its hollow structure. However, little work has been found for studying its own overall thermal conductivity independent of any matrix, which generally cannot be measured or evaluated directly. In this study, the overall thermal conductivity of HGM is investigated experimentally and numerically. The experimental investigation of thermal conductivity of HGM powder is performed by the transient plane source (TPS) technique to provide a reference to numerical results, which are obtained by a developed three-dimensional two-step hierarchical computational method. In the present method, three heterogeneous HGM stacking elements representing different distributions of HGMs in the powder are assumed. Each stacking element and its equivalent homogeneous solid counterpart are, respectively, embedded into a fictitious matrix material as fillers to form two equivalent composite systems at different levels, and then the overall thermal conductivity of each stacking element can be numerically determined through the equivalence of the two systems. The comparison of experimental and computational results indicates the present computational modeling can be used for effectively predicting the overall thermal conductivity of single HGM and its powder in a flexible way. Besides, it is necessary to note that the influence of thermal interfacial resistance cannot be removed from the experimental results in the TPS measurement.

  1. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  2. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  3. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  4. Radiobiological study on DNA strand breaks and repair using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Ikushima, Takaji

    1994-01-01

    Single cell gel electrophoresis (SCGE) provides a novel method to measure DNA damage in individual cells and more importantly, to assess heterogeneity in response within a mixed population of cells. Cells embedded in agarose are lysed, subjected to electrophoresis, stained with a fluorescent DNA-specific dye, and viewed under a fluorescence microscope. Damaged cells display 'comets', broken DNA migrating farther to the anode in the electric field. We have previously used this technique to quantify DNA damage induced by moderate doses of low and high LET radiations in cultured Chinese hamster cells. The assay has been optimized in terms of lysing and electrophoresis conditions, and applied to analyse the DNA strand breaks, their repair kinetics and heterogeneity in response in individual Chinese hamster cells exposed to gamma-rays, and to KUR thermal neutrons with and without 10 B or to KEK PF monochromatic soft X-rays as well as to a radio-mimetic agent, neocarzinostatin. The DNA double-strand breaks induced by boron-neutron captured reactions were repaired at a slower rate, but a heterogeneity in response might not contribute to the difference. The neocarzinostatin-induced DNA damage were efficiently repaired in a dose-dependent fashion. The initial amount of gamma-ray induced DNA double-strand breaks was not significantly altered in cells pre-exposed to very low adapting dose. (author)

  5. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  6. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  7. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  8. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  9. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  10. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. Synthesis of NaCl Single Crystals with Defined Morphologies as Templates for Fabricating Hollow Nano/micro-structures

    DEFF Research Database (Denmark)

    Wang, B.B.; Jin, P.; Yue, Yuanzheng

    2015-01-01

    Hollow nanostructures have a wide range of applications in nanotechnology. To accurately fabricate such nanostructures, the first and common key step is to synthesize high quality templates with controlled symmetry and geometry, ideally through a green, efficient, and economical approach. However....... These naturally abundant NaCl single crystal templates are water-soluble, environmentally-friendly and uniform in both geometry and size, and hence are ideal for preparing high quality hollow nano/micro structures. The new approach may have the potential to replace the conventional hard or soft template...

  13. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  14. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  15. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  16. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

    Science.gov (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

    2016-03-24

    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  18. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  19. The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks.

    Science.gov (United States)

    Balestrini, Alessia; Ristic, Dejan; Dionne, Isabelle; Liu, Xiao Z; Wyman, Claire; Wellinger, Raymund J; Petrini, John H J

    2013-06-27

    Single-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  20. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Alessia Balestrini

    2013-06-01

    Full Text Available Single-ended double-strand breaks (DSBs are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs.

  1. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  2. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  3. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  4. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  5. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  6. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  7. Fabrication of polymeric hollow nanospheres, hollow nanocubes and hollow plates

    Science.gov (United States)

    Cheng, Daming; Xia, Haibing; Chan, Hardy Sze On

    2006-03-01

    A facile strategy for fabricating polypyrrole-chitosan (PPy-CS) hollow nanostructures with different shapes (sphere, cube and plate) and a wide range of sizes (from 35 to 600 nm) is described. These hollow structures have been fabricated using silver bromide as a single template material for polymer nucleation and growth. PPy-CS hollow nanostructures are formed by reaction with an etching agent to remove the core. These hollow nanostructures have been extensively characterized using various techniques such as TEM, FT-IR, UV-vis, and XRD.

  8. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  9. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  10. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  11. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  12. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  13. Visualization of DNA Double-Strand Break Repair at the Single-Molecule Level

    Energy Technology Data Exchange (ETDEWEB)

    Dynan, William S.; Li, Shuyi; Mernaugh, Raymond; Wragg, Stephanie; Takeda, Yoshihiko

    2003-03-27

    Exposure to low doses of ionizing radiation is universal. The signature injury from ionizing radiation exposure is induction of DNA double-strand breaks (DSBs). The first line of defense against DSBs is direct ligation of broken DNA ends via the nonhomologous end-joining pathway. Because even a relatively high environmental exposure induces only a few DSBs per cell, our current understanding of the response to this exposure is limited by the ability to measure DSB repair events reliably in situ at a single-molecule level. To address this need, we have taken advantage of biological amplification, measuring relocalization of proteins and detection of protein phosphorylation as a surrogate for detection of broken ends themselves. We describe the use of specific antibodies to investigate the kinetics and mechanism of repair of very small numbers of DSBs in human cells by the nonhomologous end-joining pathway.

  14. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  15. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  16. Sound Absorption Properties Of Single-Hole Hollow Polyester Fiber Reinforced Hydrogenated Carboxyl Nitrile Rubber Composites

    Directory of Open Access Journals (Sweden)

    Jie Hong

    2017-09-01

    Full Text Available A series of single-hole hollow polyester fiber (SHHPF reinforced hydrogenated carboxyl nitrile rubber (HXNBR composites were fabricated. In this study, the sound absorption property of the HXNBR/SHHPF composite was tested in an impedance tube, the composite morphology was characterized by scanning electron microscope (SEM, and the tensile mechanical property was measured by strength tester. The results demonstrated that a remarkable change in sound absorption can be observed by increasing the SHHPF content from 0% to 40%. In the composite with 40% SHHPF in 1 mm thickness, the sound absorption coefficient reached 0.671 at 2,500 Hz; the effective bandwidth was 1,800-2,500 Hz for sound absorption coefficient larger than 0.2. But the sound absorption property of the composite deteriorated when the SHHPF content increased to 50% in 1 mm thickness. While with 20% SHHPF proportion, the sound absorption property was improved by increasing the thickness of composites from 1 to 5 mm. Compared with the pure HXNBR of the same thickness, the tensile mechanical property of the composite improved significantly by increasing the SHHPF proportion. As a lightweight composite with excellent sound absorption property, the HXNBR/SHHPF composite has potential practical application value in the fields of engineering.

  17. Facile and green fabrication of organic single-crystal hollow micro/nanostructures.

    Science.gov (United States)

    Yang, Jun; Chen, Yingzhi; Zhang, Xiujuan; Ou, Xuemei; Zhang, Xiaohong

    2011-07-15

    Under high humidity and appropriate temperature, tris (8-hydroxyquinoline) aluminum (Alq3) solid micro/nanostructures may be etched into hollow structures and still retain their crystalline structures and surface morphologies. The shapes and sizes of the hollow structures are easily adjusted by varying the experimental parameters. Throughout the entire process, water is introduced into the system instead of organic or corrosive solvents, making this method convenient and environmentally friendly; it can also be extended to application in other materials such as TCNQ.

  18. Identifying the Location of a Single Protein along the DNA Strand Using Solid-State Nanopores.

    Science.gov (United States)

    Yu, Jae-Seok; Lim, Min-Cheol; Huynh, Duyen Thi Ngoc; Kim, Hyung-Jun; Kim, Hyun-Mi; Kim, Young-Rok; Kim, Ki-Bum

    2015-05-26

    Solid-state nanopore has been widely studied as an effective tool to detect and analyze small biomolecules, such as DNA, RNA, and proteins, at a single molecule level. In this study, we demonstrate a rapid identification of the location of zinc finger protein (ZFP), which is bound to a specific locus along the length of a double-stranded DNA (dsDNA) to a single protein resolution using a low noise solid-state nanopore. When ZFP labeled DNAs were driven through a nanopore by an externally applied electric field, characteristic ionic current signals arising from the passage of the DNA/ZFP complex and bare DNA were detected, which enabled us to identify the locations of ZFP binding site. We examined two DNAs with ZFP binding sites at different positions and found that the location of the additional current drop derived from the DNA/ZFP complex is well-matched with a theoretical one along the length of the DNA molecule. These results suggest that the protein binding site on DNA can be mapped or that genetic information can be read at a single molecule level using solid-state nanopores.

  19. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  20. Characterization of the nanostructure of complexes formed by single- or double-stranded oligonucleotides with a cationic surfactant.

    Science.gov (United States)

    Liu, Xiaoyang; Abbott, Nicholas L

    2010-12-02

    We report the use of dynamic light scattering (DLS), small-angle neutron scattering (SANS), and small-angle X-ray scattering (SAXS) to characterize the nanostructure of complexes formed by either single- or double-stranded oligonucleotides with a cationic surfactant (cetyltrimethylammonium bromide, CTAB) in aqueous solution (1 mM Li(2)SO(4)). For single-stranded oligonucleotides 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', both the appearance of two Bragg peaks (at 0.14 and 0.28 Å(-1)) in SAXS spectra with a spacing of 1:2 and form factor fits to SANS spectra are consistent with the presence of multilamellar vesicles (with, on average, 6-9 layers with a periodicity of 45-48 Å). Some samples showed evidence of an additional Bragg peak (at 0.20 Å(-1)) associated with periodic packing (with a periodicity of 31 Å) of the oligonucleotides within the lamellae of the nanostructure. The nucleotide composition of the single-stranded oligonucleotides was also found to impact the number and size of the complexes formed with CTAB. In contrast to 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', 5'-T(20)-3' did not change the state of aggregation of CTAB (globular micelles) over a wide range of oligonucleotide:CTAB charge ratios. These results support the proposition that hydrophobic interactions, as well as electrostatics, play a central role in the formation of complexes between cationic amphiphiles and single-stranded oligonucleotides and thus give rise to nanostructures that depend on nucleotide composition. In contrast to the single-stranded oligonucleotides, for double-stranded oligonucleotides mixed with CTAB, three Bragg peaks (0.13, 0.23, and 0.25 Å(-1)) in SAXS spectra with a spacing ratio of 1:√3:√4 and characteristic changes in SANS spectra indicate formation of a hexagonal nanostructure. Also, the composition of the double-stranded oligonucleotides did not measurably impact the nanostructure of complexes formed with CTAB, suggesting that electrostatic

  1. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  2. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  3. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  4. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  5. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  6. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  7. Toward single-mode UV to near-IR guidance using hollow-core anti-resonant silica fiber

    DEFF Research Database (Denmark)

    Habib, Md Selim; Antonio-Lopez, Jose Enrique; Van Newkirk, Amy

    2017-01-01

    Hollow-core anti-resonant (HC-AR) fibers with a “negative-curvature” of the core-cladding boundary have been extensively studied over the past few years owing to their low loss and wide transmission bandwidths. The key unique feature of the HC-AR fiber is that the coupling between the core and cl...... a silica HC-AR fiber having a single ring of 7 non-touching capillaries, designed to have effectively single-mode operation and low loss from UV to near-IR....

  8. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  9. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  10. Single and double strand breaks induced by 3H incorporated in DNA of cultured human kidney cells

    International Nuclear Information System (INIS)

    Tisljar-Lentulis, G.; Henneberg, P.; Mielke, T.; Feinendegen, L.E.

    1978-01-01

    In the course of the investigations of the biological effects of radionuclides incorporated in DNA single (SSB) and double strand breaks (DSB) caused tritium-decay were measured and compared with respective data resulting from 125 I. Tritium bound to thymidine and iododeoxyuridine seems to be more effective than tritium bound to other DNA-precursors. On the basis of decay, methyl- 3 H thymidine appears to be more effective with regard to the production of strand breaks than 3 H in position 6 of the pyrimidine ring. Based on the numbers of strand-breaks per rad, position 6 is more effective in accordance with data obtained by F. Krasin et al. The ratio of SSBs to DSBs per tritium decay appears to be approximately 8 in mammlian cells. Not only SSBs but also DSBs induced by 3 H in mammalian cells are reapairable. (orig./AJ) [de

  11. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  12. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  14. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  15. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  16. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  17. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  18. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  19. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  20. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  1. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  2. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  3. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  4. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  5. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  6. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  8. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  9. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  10. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  11. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  12. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  13. Nonlinear optics at the single-photon level inside a hollow core fiber

    DEFF Research Database (Denmark)

    Hofferberth, Sebastian; Peyronel, Thibault; Liang, Qiyu

    2011-01-01

    Cold atoms inside a hollow core fiber provide an unique system for studying optical nonlinearities at the few-photon level. Confinement of both atoms and photons inside the fiber core to a diameter of just a few wavelengths results in high electric field intensity per photon and large optical...... depths with a relatively small number of atoms. We present our experimental apparatus and discuss results regarding all-optical switching at ultra-low light levels....

  14. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  15. Addendum to "Monomer motion in single- and double-stranded DNA coils" [arXiv: cond-mat/0509399

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2007-01-01

    In our work [J. Tothova et al., cond-mat/0509399] the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique [R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)] has been interpreted within the joint Rouse-Zimm theory. Optimizing the theory to the experimental data the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dy...

  16. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  17. Study of a steel strand tension sensor with difference single bypass excitation structure based on the magneto-elastic effect

    International Nuclear Information System (INIS)

    Tang Dedong; Huang Shanglian; Chen Weimin; Jiang Jianshan

    2008-01-01

    With many steel strands used in various important machines and architectural structures, health monitoring of strand tension becomes more and more important to ensure the equipment or structures' safety. Contrasted with the method of vibration frequency and strain gages, the method of measuring the steel strand tension based on the magneto-elastic effect is more capable of meeting the requirements of health monitoring. Yet the structure of the sensor is mainly a sleeve structure, and the steel strand to be measured serves as the core of primary and secondary solenoids. This structure is very difficult to fix and maintain. On the other hand, a change of temperature will strongly affect measurement results, and experiments prove that temperature error compensation by using a temperature compensation curve is not effective enough. Therefore in this paper the principle of a cable tension sensor based on the magneto-elastic effect is expounded, the theory of temperature influence is explored, a difference structure by single bypass excitation is devised, its magnetic loop is analyzed, an experiment is designed, and experiments on temperature compensation and pulling tension are carried out. The experiment results indicated that the structure of the sensor is feasible, temperature errors can be compensated for automatically, after which temperature errors become less than 0.012 MPa °C −1 , and repeating errors of tension are less than 0.15%, which meet the measurement requirements

  18. Study of a steel strand tension sensor with difference single bypass excitation structure based on the magneto-elastic effect

    Science.gov (United States)

    Tang, Dedong; Huang, Shanglian; Chen, Weimin; Jiang, Jianshan

    2008-04-01

    With many steel strands used in various important machines and architectural structures, health monitoring of strand tension becomes more and more important to ensure the equipment or structures' safety. Contrasted with the method of vibration frequency and strain gages, the method of measuring the steel strand tension based on the magneto-elastic effect is more capable of meeting the requirements of health monitoring. Yet the structure of the sensor is mainly a sleeve structure, and the steel strand to be measured serves as the core of primary and secondary solenoids. This structure is very difficult to fix and maintain. On the other hand, a change of temperature will strongly affect measurement results, and experiments prove that temperature error compensation by using a temperature compensation curve is not effective enough. Therefore in this paper the principle of a cable tension sensor based on the magneto-elastic effect is expounded, the theory of temperature influence is explored, a difference structure by single bypass excitation is devised, its magnetic loop is analyzed, an experiment is designed, and experiments on temperature compensation and pulling tension are carried out. The experiment results indicated that the structure of the sensor is feasible, temperature errors can be compensated for automatically, after which temperature errors become less than 0.012 MPa °C-1, and repeating errors of tension are less than 0.15%, which meet the measurement requirements.

  19. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  20. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  1. Effects of 3-Deoxyadenosine (Cordycepin) on the repair of X-ray-induced DNA single- and double-strand breaks in chinese hamster V79 cells

    International Nuclear Information System (INIS)

    Hiraoka, Wakako; Kuwabara, Mikinori; Sato, Fumiaki

    1990-01-01

    The ability of cordycepin to inhibit the repair of DNA strand breaks was examined with X-irradiated Chinese hamster V79 cells in log-phase culture. A filter elution technique revealed that 70 μM cordycepin did not inhibit the repair of single-strand breaks but inhibited the repair of double-strand breaks. These findings confirmed the fact that the increase in the lethality of cordycepin in X-irradiated cultured mammalian cells was attributable to unrepaired DNA double-strand breaks. (author)

  2. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  3. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  4. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  5. One-pot synthesis of uniform hollow cuprous oxide spheres fabricated by single-crystalline particles via a simple solvothermal route

    International Nuclear Information System (INIS)

    Li Shikuo; Li Chuanhao; Huang Fangzhi; Wang Yang; Shen Yuhua; Xie Anjian; Wu Qiong

    2011-01-01

    Uniform Cu 2 O hollow spheres fabricated by single-crystalline particles (smaller than 20 nm) are facile synthesized in ethylene glycol (EG) solution by a simple solvothermal route without using pre-fabricated templates and reductive agents. EG in this protocol is not only used as a solvent, complexing agent, and reducing agent, but also served as a structure-directing agent for the formation of hollow structure. By control of reaction conditions, such as reaction time, temperature, and the anions, the morphology and structure of the hollow spheres can be tuned. A coordination adsorption and oriented attachment and Ostwald ripening mechanism is proposed for explaining the formation process of hollow Cu 2 O spheres in EG solution; and importantly, the hollow Cu 2 O spheres exhibit an excellent property for the electro-catalytic oxidization of ascorbic acid in acetic acid buffer solution. Moreover, the hollow spherical Cu 2 O particles could be potentially applied in catalysis, sensor, and as model for fundamental research.

  6. Energy Efficient Aeration in a Single Low Pressure Hollow Sheet Membrane Filtration Module

    DEFF Research Database (Denmark)

    Bentzen, Thomas Ruby; Ratkovich, Nicolas Rios; Rasmussen, Michael R.

    2011-01-01

    The main drawback of membrane bioreactors (MBR) systems is the fouling of the membrane, which is decreased and/or prevented through gas sparging. However, this practice is based on rules of thumb or a trial-and-error approaches which are tedious, very time-consuming, do not necessarily provide...... optimal fouling control and they are not energy efficient. Therefore, dedicated experiments are needed to fully understand the hydrodynamics of it. A hollow sheet (HS) MBR was studied. Experimental velocity measurements were made using micro-propellers and compared to CFD results. A good agreement between...

  7. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  8. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  9. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  10. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  11. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  12. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  13. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  14. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  15. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Measurement of longitudinal sulfur isotopic variations by laser ablation MC-ICP-MS in single human hair strands.

    Science.gov (United States)

    Santamaria-Fernandez, Rebeca; Giner Martínez-Sierra, Justo; Marchante-Gayón, J M; García-Alonso, J Ignacio; Hearn, Ruth

    2009-05-01

    A new method for the measurement of longitudinal variations of sulfur isotope amount ratios in single hair strands using a laser ablation system coupled to a multicollector inductively coupled plasma mass spectrometer (LA-MC-ICP-MS) is reported here for the first time. Ablation parameters have been optimized for the measurement of sulfur isotope ratios in scalp human hair strands of 80-120-microm thickness and different washing procedures have been evaluated. The repeatability of the method has been tested and the ability to measure sulfur isotopic variations in 1,000-microm-long hair segments has been evaluated. A horse hair sample previously characterized for carbon and nitrogen isotope ratios in an interlaboratory study has been characterized by LA-MC-ICP-MS to be used as an in-house standard for the bracketing of human hair strands. (34)S/(32)S isotope amount ratios have been measured and corrected for instrumental mass bias adopting the external standardization approach using National Institute of Standards and Technology (NIST) RM8553 and full uncertainty budgets have been calculated using the Kragten approach. Results are reported as both (34)S/(32)S isotope amount ratios and deltaS(V-CDT) values (sulfur isotopic differences relative to a reference sample expressed in the Vienna Canyon Diablo Troilite (V-CDT) scale) calculated using NIST RM8553, NIST RM8554, and NIST RM8556 to anchor results to the V-CDT scale. The main advantage of the new method versus conventional gas source isotope ratio mass spectrometry measurements is that longitudinal variations in sulfur isotope amount ratios can be resolved. Proof of concept is shown with human scalp hair strands from three individuals, two UK residents and one traveler (long periods of time abroad). The method enables monitoring of longitudinal isotope ratio variations in single hair strands. Absolute ratios are reported and delta(34)S(V-CDT) values are plotted for comparison. Slight variations of 5 per thousand

  18. Generation of broadband mid-IR and UV light in gas-filled single-ring hollow-core PCF.

    Science.gov (United States)

    Cassataro, Marco; Novoa, David; Günendi, Mehmet C; Edavalath, Nitin N; Frosz, Michael H; Travers, John C; Russell, Philip St J

    2017-04-03

    We report generation of an ultrafast supercontinuum extending into the mid- infrared in gas-filled single-ring hollow-core photonic crystal fiber (SR-PCF) pumped by 1.7 µm light from an optical parametric amplifier. The simple fiber structure offers shallow dispersion and flat transmission in the near and mid-infrared, enabling the generation of broadband spectra extending from 270 nm to 3.1 µm, with a total energy of a few µJ. In addition, we demonstrate the emission of ultraviolet dispersive waves whose frequency can be tuned simply by adjusting the pump wavelength. SR-PCF thus constitutes an effective means of compressing and delivering tunable ultrafast pulses in the near and mid-infrared spectral regions.

  19. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  1. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  2. String-nets, single and double-stranded quantum loop gases for non-Abelian anyons

    OpenAIRE

    Velenich, Andrea; Chamon, Claudio; Wen, Xiao-Gang

    2009-01-01

    String-net condensation can give rise to non-Abelian anyons whereas loop condensation usually gives rise to Abelian anyons. It has been proposed that generalized quantum loop gases with non-orthogonal inner products can produce non-Abelian anyons. We detail an exact mapping between the string-net and the generalized loop models and explain how the non-orthogonal products arise. We also introduce a loop model of double-stranded nets where quantum loops with an orthogonal inner product and loca...

  3. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  4. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  5. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  6. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  8. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  9. Universal route to optimal few- to single-cycle pulse generation in hollow-core fiber compressors.

    Science.gov (United States)

    Conejero Jarque, E; San Roman, J; Silva, F; Romero, R; Holgado, W; Gonzalez-Galicia, M A; Alonso, B; Sola, I J; Crespo, H

    2018-02-02

    Gas-filled hollow-core fiber (HCF) pulse post-compressors generating few- to single-cycle pulses are a key enabling tool for attosecond science and ultrafast spectroscopy. Achieving optimum performance in this regime can be extremely challenging due to the ultra-broad bandwidth of the pulses and the need of an adequate temporal diagnostic. These difficulties have hindered the full exploitation of HCF post-compressors, namely the generation of stable and high-quality near-Fourier-transform-limited pulses. Here we show that, independently of conditions such as the type of gas or the laser system used, there is a universal route to obtain the shortest stable output pulse down to the single-cycle regime. Numerical simulations and experimental measurements performed with the dispersion-scan technique reveal that, in quite general conditions, post-compressed pulses exhibit a residual third-order dispersion intrinsic to optimum nonlinear propagation within the fiber, in agreement with measurements independently performed in several laboratories around the world. The understanding of this effect and its adequate correction, e.g. using simple transparent optical media, enables achieving high-quality post-compressed pulses with only minor changes in existing setups. These optimized sources have impact in many fields of science and technology and should enable new and exciting applications in the few- to single-cycle pulse regime.

  10. String-nets, single- and double-stranded quantum loop gases for non-Abelian anyons

    Energy Technology Data Exchange (ETDEWEB)

    Velenich, Andrea; Chamon, Claudio [Physics Department, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 (United States); Wen Xiaogang, E-mail: velenich@bu.ed [Department of Physics, Massachusetts Institute of Technology, Cambridge, MA 02215 (United States)

    2010-04-30

    String-nets and quantum loop gases are two prominent microscopic lattice models to describe topological phases. String-net condensation can give rise to both Abelian and non-Abelian anyons, whereas loop condensation usually produces Abelian anyons. It has been proposed, however, that generalized quantum loop gases with non-orthogonal inner products could support non-Abelian anyons. We detail an exact mapping between the string-net and these generalized loop models and explain how the non-orthogonal products arise. We also introduce an equivalent loop model of double-stranded nets where quantum loops with an orthogonal inner product and local interactions supports non-Abelian Fibonacci anyons. Finally, we emphasize the origin of the sign problem in systems with non-Abelian excitations and its consequences on the complexity of their ground state wavefunctions. (fast track communication)

  11. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  12. Self-consistent modeling of entangled network strands and linear dangling structures in a single-strand mean-field slip-link model

    DEFF Research Database (Denmark)

    Jensen, Mette Krog; Khaliullin, Renat; Schieber, Jay D.

    2012-01-01

    knowledge about the effect of dangling ends and soluble structures. To interpret our recent experimental results, we exploit a molecular model that can predict LVE data and non-linear stress–strain data. The slip-link model has proven to be a robust tool for both LVE and non-linear stress–strain predictions...... strands in the ensemble are attached to the network in both ends. Next we add dangling strands to the network representing the stoichiometric imbalance, or imperfections during curing. By considering monodisperse network strands without dangling ends, we find that the relative low-frequency plateau, G0/GN......0G0G0N, decreases linearly with the average number of entanglements. The decrease from GN0G0N to G 0 is a result of monomer fluctuations between entanglements, which is similar to “longitudinal modes” in tube theory. It is found that the slope of G′ is dependent on the fraction of network strands...

  13. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  14. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Directory of Open Access Journals (Sweden)

    Bray Clifford M

    2009-06-01

    Full Text Available Abstract Background DNA ligase enzymes catalyse the joining of adjacent polynucleotides and as such play important roles in DNA replication and repair pathways. Eukaryotes possess multiple DNA ligases with distinct roles in DNA metabolism, with clear differences in the functions of DNA ligase orthologues between animals, yeast and plants. DNA ligase 1, present in all eukaryotes, plays critical roles in both DNA repair and replication and is indispensable for cell viability. Results Knockout mutants of atlig1 are lethal. Therefore, RNAi lines with reduced levels of AtLIG1 were generated to allow the roles and importance of Arabidopsis DNA ligase 1 in DNA metabolism to be elucidated. Viable plants were fertile but displayed a severely stunted and stressed growth phenotype. Cell size was reduced in the silenced lines, whilst flow cytometry analysis revealed an increase of cells in S-phase in atlig1-RNAi lines relative to wild type plants. Comet assay analysis of isolated nuclei showed atlig1-RNAi lines displayed slower repair of single strand breaks (SSBs and also double strand breaks (DSBs, implicating AtLIG1 in repair of both these lesions. Conclusion Reduced levels of Arabidopsis DNA ligase 1 in the silenced lines are sufficient to support plant development but result in retarded growth and reduced cell size, which may reflect roles for AtLIG1 in both replication and repair. The finding that DNA ligase 1 plays an important role in DSB repair in addition to its known function in SSB repair, demonstrates the existence of a previously uncharacterised novel pathway, independent of the conserved NHEJ. These results indicate that DNA ligase 1 functions in both DNA replication and in repair of both ss and dsDNA strand breaks in higher plants.

  15. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  16. Three-dimensional oriented attachment growth of single-crystal pre-perovskite PbTiO3 hollowed fibers

    KAUST Repository

    Zhao, Ruoyu

    2017-12-11

    Hollowed single-crystal pre-perovskite PbTiO fibers (PP-PTF) were successfully synthesized via a polyvinyl alcohol (PVA) assisted hydrothermal process. The as-prepared PP-PTF were characterized to be 0.3-1 μm in diameter and tens of micrometers in length by adjusting the concentration of PVA to 0.8 g L. Microstructure characterization of the samples at different reaction times revealed that PP-PTF were formed via a three-dimensional (3D) hierarchical oriented attachment (OA) growth process. The initial growth units were determined to be single-crystal pre-perovskite PbTiO fibers with a diameter of 10-20 nm. Zeta potential measurement suggested that the main driving force of the OA process is the surface electrostatic force, which is induced by the incompletely bonded Pb and O atomic layers on the surface of the {110} plane. Moreover, molecular dynamics simulations have been employed to reveal a stable configuration of the initial pre-perovskite PbTiO growth units, agreeing well with the experimental results.

  17. A universal and label-free impedimetric biosensing platform for discrimination of single nucleotide substitutions in long nucleic acid strands.

    Science.gov (United States)

    Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y

    2018-06-30

    We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Accurate single nucleotide variant detection in viral populations by combining probabilistic clustering with a statistical test of strand bias

    Science.gov (United States)

    2013-01-01

    Background Deep sequencing is a powerful tool for assessing viral genetic diversity. Such experiments harness the high coverage afforded by next generation sequencing protocols by treating sequencing reads as a population sample. Distinguishing true single nucleotide variants (SNVs) from sequencing errors remains challenging, however. Current protocols are characterised by high false positive rates, with results requiring time consuming manual checking. Results By statistical modelling, we show that if multiple variant sites are considered at once, SNVs can be called reliably from high coverage viral deep sequencing data at frequencies lower than the error rate of the sequencing technology, and that SNV calling accuracy increases as true sequence diversity within a read length increases. We demonstrate these findings on two control data sets, showing that SNV detection is more reliable on a high diversity human immunodeficiency virus sample as compared to a moderate diversity sample of hepatitis C virus. Finally, we show that in situations where probabilistic clustering retains false positive SNVs (for instance due to insufficient sample diversity or systematic errors), applying a strand bias test based on a beta-binomial model of forward read distribution can improve precision, with negligible cost to true positive recall. Conclusions By combining probabilistic clustering (implemented in the program ShoRAH) with a statistical test of strand bias, SNVs may be called from deeply sequenced viral populations with high accuracy. PMID:23879730

  19. Single nucleotide-level mapping of DNA double-strand breaks in human HEK293T cells

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2017-03-01

    Full Text Available Constitutional biological processes involve the generation of DNA double-strand breaks (DSBs. The production of such breaks and their subsequent resolution are also highly relevant to neurodegenerative diseases and cancer, in which extensive DNA fragmentation has been described Stephens et al. (2011, Blondet et al. (2001. Tchurikov et al. Tchurikov et al. (2011, 2013 have reported previously that frequent sites of DSBs occur in chromosomal domains involved in the co-ordinated expression of genes. This group report that hot spots of DSBs in human HEK293T cells often coincide with H3K4me3 marks, associated with active transcription Kravatsky et al. (2015 and that frequent sites of DNA double-strand breakage are likely to be relevant to cancer genomics Tchurikov et al. (2013, 2016 . Recently, they applied a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended DSB sites and mapped these to the human genome within defined co-ordinate ‘windows’. In this paper, we re-analyse public RAFT data to derive sites of DSBs at the single-nucleotide level across the built genome for human HEK293T cells (https://figshare.com/s/35220b2b79eaaaf64ed8. This refined mapping, combined with accessory ENCODE data tracks and ribosomal DNA-related sequence annotations, will likely be of value for the design of clinically relevant targeted assays such as those for cancer susceptibility, diagnosis, treatment-matching and prognostication.

  20. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  1. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  2. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  3. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  4. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  5. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  6. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  7. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  8. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  9. Investigation on accordance of DNA double-strand break of blood between in vivo and in vitro irradiation using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Liu Qiang; Jiang Enhai; Li Jin; Tang Weisheng; Wang Zhiquan; Zhao Yongcheng; Fan Feiyue

    2006-01-01

    Objective: To observe the consistency of DNA double-strand break between in vivo and in vitro irradiation, as a prophase study in radiation biodosimetry using single cell gel electrophoresis (SCGE). Methods: Detect DNA double-strand break after whole-body and in vitro radiation in mice lymphocytes using neutral single cell gel electrophoresis. The comet images were processed by CASP software and all the data were analysed by SPSS12.0. Results: There is no difference between in vivo and in vitro irradiation group in HDNA%, TDNA%, CL, TL, TM and OTM. Conclusion: The result of neutral single cell gel electrophoresis shortly after in vitro irradiation can precisely reflect the DNA double-strand break of lymphocytes in whole-body irradiation. (authors)

  10. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  11. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  12. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  13. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  14. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  15. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  16. SiO2/ZnO Composite Hollow Sub-Micron Fibers: Fabrication from Facile Single Capillary Electrospinning and Their Photoluminescence Properties

    Directory of Open Access Journals (Sweden)

    Guanying Song

    2017-02-01

    Full Text Available In this work, SiO2/ZnO composite hollow sub-micron fibers were fabricated by a facile single capillary electrospinning technique followed by calcination, using tetraethyl orthosilicate (TEOS, polyvinylpyrrolidone (PVP and ZnO nanoparticles as raw materials. The characterization results of the scanning electron microscopy (SEM, transmission electron microscopy (TEM, X-ray diffraction (XRD and Fourier transform infrared spectroscopy (FT-IR spectra indicated that the asprepared composite hollow fibers consisted of amorphous SiO2 and hexagonal wurtzite ZnO. The products revealed uniform tubular structure with outer diameters of 400–500 nm and wall thickness of 50–60 nm. The gases generated and the directional escaped mechanism was proposed to illustrate the formation of SiO2/ZnO composite hollow sub-micron fibers. Furthermore, a broad blue emission band was observed in the photoluminescence (PL of SiO2/ZnO composite hollow sub-micron fibers, exhibiting great potential applications as blue light-emitting candidate materials.

  17. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  18. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  19. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  20. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  1. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  2. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  3. Abdominal Hollowing Reduces Lateral Trunk Displacement During Single-Leg Squats in Healthy Females But Does Not Affect Peak Hip Abduction Angle or Knee Abductio Angle/Moment.

    Science.gov (United States)

    Linde, Lukas D; Archibald, Jessica; Lampert, Eve C; Srbely, John Z

    2017-07-17

    Females suffer 4-6 times more non-contact anterior cruciate ligament (ACL) injuries than males due to neuromuscular control deficits of the hip musculature leading to increases in hip adduction angle, knee abduction angle, and knee abduction moment during dynamic tasks such as single-leg squats. Lateral trunk displacement has been further related to ACL injury risk in females, leading to the incorporation of core strength/stability exercises in ACL preventative training programs. However, the direct mechanism relating lateral trunk displacement and lower limb ACL risk factors is not well established. To assess the relationship between lateral trunk displacement and lower limb measures of ACL injury risk by altering trunk control through abdominal activation techniques during single-leg squats in healthy females. Interventional Study Setting: Movement and Posture Laboratory Participants: 13 healthy females (21.3±0.88y, 1.68±0.07m, 58.27±5.46kg) Intervention: Trunk position and lower limb kinematics were recorded using an optoelectric motion capture system during single-leg squats under differing conditions of abdominal muscle activation (abdominal hollowing, abdominal bracing, control), confirmed via surface electromyography. Lateral trunk displacement, peak hip adduction angle, peak knee abduction angle/moment, and average muscle activity from bilateral internal oblique, external oblique, and erector spinae muscles. No differences were observed for peak lateral trunk displacement, peak hip adduction angle or peak knee abduction angle/moment. Abdominal hollowing and bracing elicited greater muscle activation than the control condition, and bracing was greater than hollowing in four of six muscles recorded. The lack of reduction in trunk, hip, and knee measures of ACL injury risk during abdominal hollowing and bracing suggests that these techniques alone may provide minimal benefit in ACL injury prevention training.

  4. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  5. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  6. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  7. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  9. Organization of DNA partners and strand exchange mechanisms during Flp site-specific recombination analyzed by difference topology, single molecule FRET and single molecule TPM.

    Science.gov (United States)

    Ma, Chien-Hui; Liu, Yen-Ting; Savva, Christos G; Rowley, Paul A; Cannon, Brian; Fan, Hsiu-Fang; Russell, Rick; Holzenburg, Andreas; Jayaram, Makkuni

    2014-02-20

    Flp site-specific recombination between two target sites (FRTs) harboring non-homology within the strand exchange region does not yield stable recombinant products. In negatively supercoiled plasmids containing head-to-tail sites, the reaction produces a series of knots with odd-numbered crossings. When the sites are in head-to-head orientation, the knot products contain even-numbered crossings. Both types of knots retain parental DNA configuration. By carrying out Flp recombination after first assembling the topologically well defined Tn3 resolvase synapse, it is possible to determine whether these knots arise by a processive or a dissociative mechanism. The nearly exclusive products from head-to-head and head-to-tail oriented "non-homologous" FRT partners are a 4-noded knot and a 5-noded knot, respectively. The corresponding products from a pair of native (homologous) FRT sites are a 3-noded knot and a 4-noded catenane, respectively. These results are consistent with non-homology-induced two rounds of dissociative recombination by Flp, the first to generate reciprocal recombinants containing non-complementary base pairs and the second to produce parental molecules with restored base pairing. Single molecule fluorescence resonance energy transfer (smFRET) analysis of geometrically restricted FRTs, together with single molecule tethered particle motion (smTPM) assays of unconstrained FRTs, suggests that the sites are preferentially synapsed in an anti-parallel fashion. This selectivity in synapse geometry occurs prior to the chemical steps of recombination, signifying early commitment to a productive reaction path. The cumulative topological, smFRET and smTPM results have implications for the relative orientation of DNA partners and the directionality of strand exchange during recombination mediated by tyrosine site-specific recombinases. Copyright © 2013. Published by Elsevier Ltd.

  10. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  11. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  12. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  13. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  14. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  15. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  16. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  17. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  19. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  20. Unveiling the pentagonal nature of perfectly aligned single-and double-strand Si nano-ribbons on Ag(110).

    Science.gov (United States)

    Cerdá, Jorge I; Sławińska, Jagoda; Le Lay, Guy; Marele, Antonela C; Gómez-Rodríguez, José M; Dávila, María E

    2016-10-06

    Carbon and silicon pentagonal low-dimensional structures attract a great interest as they may lead to new exotic phenomena such as topologically protected phases or increased spin-orbit effects. However, no pure pentagonal phase has yet been realized for any of them. Here we unveil through extensive density functional theory calculations and scanning tunnelling microscope simulations, confronted to key experimental facts, the hidden pentagonal nature of single- and double-strand chiral Si nano-ribbons perfectly aligned on Ag(110) surfaces whose structure has remained elusive for over a decade. Our study reveals an unprecedented one-dimensional Si atomic arrangement solely comprising almost perfect alternating pentagons residing in the missing row troughs of the reconstructed surface. We additionally characterize the precursor structure of the nano-ribbons, which consists of a Si cluster (nano-dot) occupying a silver di-vacancy in a quasi-hexagonal configuration. The system thus materializes a paradigmatic shift from a silicene-like packing to a pentagonal one.

  1. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  2. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  3. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  4. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  5. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  6. Unveiling the pentagonal nature of perfectly aligned single-and double-strand Si nano-ribbons on Ag(110)

    Science.gov (United States)

    Cerdá, Jorge I.; Sławińska, Jagoda; Le Lay, Guy; Marele, Antonela C.; Gómez-Rodríguez, José M.; Dávila, María E.

    2016-01-01

    Carbon and silicon pentagonal low-dimensional structures attract a great interest as they may lead to new exotic phenomena such as topologically protected phases or increased spin–orbit effects. However, no pure pentagonal phase has yet been realized for any of them. Here we unveil through extensive density functional theory calculations and scanning tunnelling microscope simulations, confronted to key experimental facts, the hidden pentagonal nature of single- and double-strand chiral Si nano-ribbons perfectly aligned on Ag(110) surfaces whose structure has remained elusive for over a decade. Our study reveals an unprecedented one-dimensional Si atomic arrangement solely comprising almost perfect alternating pentagons residing in the missing row troughs of the reconstructed surface. We additionally characterize the precursor structure of the nano-ribbons, which consists of a Si cluster (nano-dot) occupying a silver di-vacancy in a quasi-hexagonal configuration. The system thus materializes a paradigmatic shift from a silicene-like packing to a pentagonal one. PMID:27708263

  7. Current sharing temperature of NbTi SULTAN samples compared to prediction using a single pinning mechanism parametrization for NbTi strand

    International Nuclear Information System (INIS)

    Pong, Ian; Vostner, Alexander; Devred, Arnaud; Bessette, Denis; Mitchell, Neil; Bordini, Bernardo; Bottura, Luca; Jewell, Matthew; Long Feng; Wu Yu

    2012-01-01

    NbTi strands to be used in four of the six ITER poloidal field (PF) coils, all the correction coils (CC) and all the superconducting feeder busbars are being produced in China. Short full-size qualification conductor (cabled and jacketed) samples have been developed at ASIPP and tested at CRPP. Single pinning mechanism parametrization for this Chinese strand (type S2) has been obtained using the Bottura scaling law. The determination of the scaling parameters using a Kramer-type regression method will be described. A comparison between the critical temperature at the operating current and field of a single strand as determined by the parametrization and the current sharing temperature (T CS ) of a few conductor samples tested at the SULTAN facility will be made. The validity and limitation of the estimation will be discussed. The estimated T CS dependence on various (superconducting critical as well as geometric and volumetric) parameters will be assessed using the modelled critical surface. Errors propagated from critical current (I c ) measurements of the strands and parameter fitting, and other uncertainties, will be quantified. (paper)

  8. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  9. Production of high-titer human influenza A virus with adherent and suspension MDCK cells cultured in a single-use hollow fiber bioreactor.

    Science.gov (United States)

    Tapia, Felipe; Vogel, Thomas; Genzel, Yvonne; Behrendt, Ilona; Hirschel, Mark; Gangemi, J David; Reichl, Udo

    2014-02-12

    Hollow fiber bioreactors (HFBRs) have been widely described as capable of supporting the production of highly concentrated monoclonal antibodies and recombinant proteins. Only recently HFBRs have been proposed as new single-use platforms for production of high-titer influenza A virus. These bioreactors contain multiple hollow fiber capillary tubes that separate the bioreactor in an intra- and an extra-capillary space. Cells are usually cultured in the extra-capillary space and can grow to a very high cell concentration. This work describes the evaluation of the single-use hollow fiber bioreactor PRIMER HF (Biovest International Inc., USA) for production of influenza A virus. The process was setup, characterized and optimized by running a total of 15 cultivations. The HFBRs were seeded with either adherent or suspension MDCK cells, and infected with influenza virus A/PR/8/34 (H1N1), and the pandemic strain A/Mexico/4108/2009 (H1N1). High HA titers and TCID₅₀ of up to 3.87 log₁₀(HA units/100 μL) and 1.8 × 10(10)virions/mL, respectively, were obtained for A/PR/8/34 influenza strain. Influenza virus was collected by performing multiple harvests of the extra-capillary space during a virus production time of up to 12 days. Cell-specific virus yields between 2,000 and 8,000 virions/cell were estimated for adherent MDCK cells, and between 11,000 and 19,000 virions/cell for suspension MDCK.SUS2 cells. These results do not only coincide with the cell-specific virus yields obtained with cultivations in stirred tank bioreactors and other high cell density systems, but also demonstrate that HFBRs are promising and competitive single-use platforms that can be considered for commercial production of influenza virus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  11. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  12. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  13. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  14. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  15. Assembly of three-dimensional hetero-epitaxial ZnO/ZnS core/shell nanorod and single crystalline hollow ZnS nanotube arrays.

    Science.gov (United States)

    Huang, Xing; Wang, Meng; Willinger, Marc-Georg; Shao, Lidong; Su, Dang Sheng; Meng, Xiang-Min

    2012-08-28

    Hetero-epitaxial growth along three-dimensional (3D) interfaces from materials with an intrinsic large lattice mismatch is a key challenge today. In this work we report, for the first time, the controlled synthesis of vertically aligned ZnO/ZnS core/shell nanorod arrays composed of single crystalline wurtzite (WZ) ZnS conformally grown on ZnO rods along 3D interfaces through a simple two-step thermal evaporation method. Structural characterization reveals a "(01-10)(ZnO)//(01-10)(ZnS) and [0001](ZnO)//[0001](ZnS)" epitaxial relationship between the ZnO core and the ZnS shell. It is exciting that arrays of single crystalline hollow ZnS nanotubes are also innovatively obtained by simply etching away the inner ZnO cores. On the basis of systematic structural analysis, a rational growth mechanism for the formation of hetero-epitaxial core/shell nanorods is proposed. Optical properties are also investigated via cathodoluminescence and photoluminescence measurements. Remarkably, the synthesized ZnO/ZnS core/shell heterostructures exhibit a greatly reduced ultraviolet emission and dramatically enhanced green emission compared to the pure ZnO nanorods. The present single-crystalline heterostructure and hollow nanotube arrays are envisaged to be highly promising for applications in novel nanoscale optoelectronic devices, such as UV-A photodetectors, lasers, solar cells, and nanogenerators.

  16. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  18. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  19. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  20. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Sharan, R.N.

    2013-01-01

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  1. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  2. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  3. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  4. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  5. Differentially expressed genes from RNA-Seq and functional enrichment results are affected by the choice of single-end versus paired-end reads and stranded versus non-stranded protocols.

    Science.gov (United States)

    Corley, Susan M; MacKenzie, Karen L; Beverdam, Annemiek; Roddam, Louise F; Wilkins, Marc R

    2017-05-23

    RNA-Seq is now widely used as a research tool. Choices must be made whether to use paired-end (PE) or single-end (SE) sequencing, and whether to use strand-specific or non-specific (NS) library preparation kits. To date there has been no analysis of the effect of these choices on identifying differentially expressed genes (DEGs) between controls and treated samples and on downstream functional analysis. We undertook four mammalian transcriptomics experiments to compare the effect of SE and PE protocols on read mapping, feature counting, identification of DEGs and functional analysis. For three of these experiments we also compared a non-stranded (NS) and a strand-specific approach to mapping the paired-end data. SE mapping resulted in a reduced number of reads mapped to features, in all four experiments, and lower read count per gene. Up to 4.3% of genes in the SE data and up to 12.3% of genes in the NS data had read counts which were significantly different compared to the PE data. Comparison of DEGs showed the presence of false positives (average 5%, using voom) and false negatives (average 5%, using voom) using the SE reads. These increased further, by one or two percentage points, with the NS data. Gene ontology functional enrichment (GO) of the DEGs arising from SE or NS approaches, revealed striking differences in the top 20 GO terms, with as little as 40% concordance with PE results. Caution is therefore advised in the interpretation of such results. By comparison, there was overall consistency in gene set enrichment analysis results. A strand-specific protocol should be used in library preparation to generate the most reliable and accurate profile of expression. Ideally PE reads are also recommended particularly for transcriptome assembly. Whilst SE reads produce a DEG list with around 5% of false positives and false negatives, this method can substantially reduce sequencing cost and this saving could be used to increase the number of biological replicates

  6. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)

    2005-01-01

    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  7. Mechanism of adsorption of single and double stranded DNA on gold and silver nanoparticles: Investigating some important parameters in bio-sensing applications.

    Science.gov (United States)

    Farkhari, Nahid; Abbasian, Sara; Moshaii, Ahmad; Nikkhah, Maryam

    2016-12-01

    The mechanism of adsorption of single and double stranded DNAs on colloidal gold and silver nanoparticles has been studied by measuring the resistance of the nanoparticles, surrounded by various oligonucleotides, against salt induced aggregation. It is shown that both single and double stranded DNAs can be adsorbed on the metal nanoparticles and the adsorption strength is determined by the interaction between various bases of DNA and the nanoparticles. By changing the salt concentration, the difference between adsorption of various DNA strands on the nanoparticles can be specified. The results indicate that a key parameter in success of a sensing assay of DNA hybridization is the salt concentration which should be greater than a minimum threshold depending on the nanoparticles characteristics. We have also investigated the interaction mechanism between various DNA bases with the metal nanoparticles. For both gold and silver nanoparticles, adenine has the highest and thymine has the lowest attachment to the nanoparticles. From surface enhanced Raman spectroscopy (SERS) data of various bases in the presence of gold nanoparticles, the probable interaction points in the bases with the nanoparticles have been determined, which are mainly the nitrogen sites of these oligonucleotides. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  9. Marine mammal strandings in the New Caledonia region, Southwest Pacific.

    Science.gov (United States)

    Borsa, Philippe

    2006-04-01

    Four hundred twenty three marine mammals, in 72 stranding events, were recorded between 1877 and 2005 in New Caledonia, the Loyalty Islands, and Vanuatu in the southwest Pacific. Sixteen species were represented in this count, including: minke whale, Balaenoptera acutorostrata (1 single stranding), sei whale, B. borealis (1 single stranding), blue whale, B. musculus (1 single stranding), humpback whale, Megaptera novaeangliae (2 single strandings), giant sperm whale, Physeter macrocephalus (18 single strandings, 2 pair strandings), pygmy sperm whale, Kogia breviceps (5 single strandings), dwarf sperm whale, K. sima (2 single strandings, 1 triple stranding), Blainville's beaked whale, Mesoplodon densirostris (2 single strandings), short-finned pilot whale, Globicephala macrorhynchus (4 strandings, 56 individuals), melon-headed whale, Peponocephala electra (1 single stranding and 2 mass strandings totalling 231 individuals), common dolphin, Delphinus delphis (1 single stranding), spinner dolphin, Stenella longirostris (1 pair stranding and 2 mass strandings of groups of approximately 30 individuals each), Indian Ocean bottlenose dolphin, Tursiops aduncus (2 single strandings), dugong, Dugong dugon (14 single strandings), and New Zealand fur seal, Arctocephalus forsteri (3 single strandings). A stranded rorqual identified as an Antarctic minke whale (B. bonaerensis), with coloration patterns that did not match known descriptions, was also reported. Sei whale was recorded for the first time in the tropical Southwest Pacific region and Antarctic minke whale, melon-headed whale, and Indian Ocean bottlenose dolphin were recorded for the first time in New Caledonia. Strandings of sperm whales were most frequent in the spring, but also occurred in autumn months, suggesting a seasonal pattern of occurrence possibly related to seasonal migration. One stranded humpback whale bore the scars of a killer whale's attack and one dugong was injured by a shark. Scars left by

  10. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  11. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  12. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  13. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  14. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  15. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  16. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.

    OpenAIRE

    Esteban, R; Fujimura, T; Wickner, R B

    1988-01-01

    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  17. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  18. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    Science.gov (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.

    2015-02-01

    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  19. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  20. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  2. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  3. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  4. FAST TRACK COMMUNICATION: String-nets, single- and double-stranded quantum loop gases for non-Abelian anyons

    Science.gov (United States)

    Velenich, Andrea; Chamon, Claudio; Wen, Xiao-Gang

    2010-04-01

    String-nets and quantum loop gases are two prominent microscopic lattice models to describe topological phases. String-net condensation can give rise to both Abelian and non-Abelian anyons, whereas loop condensation usually produces Abelian anyons. It has been proposed, however, that generalized quantum loop gases with non-orthogonal inner products could support non-Abelian anyons. We detail an exact mapping between the string-net and these generalized loop models and explain how the non-orthogonal products arise. We also introduce an equivalent loop model of double-stranded nets where quantum loops with an orthogonal inner product and local interactions supports non-Abelian Fibonacci anyons. Finally, we emphasize the origin of the sign problem in systems with non-Abelian excitations and its consequences on the complexity of their ground state wavefunctions.

  5. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  6. To Nick or Not to Nick: Comparison of I-SceI Single- and Double-Strand Break-Induced Recombination in Yeast and Human Cells

    Science.gov (United States)

    Katz, Samantha S.; Gimble, Frederick S.; Storici, Francesca

    2014-01-01

    Genetic modification of a chromosomal locus to replace an existing dysfunctional allele with a corrected sequence can be accomplished through targeted gene correction using the cell's homologous recombination (HR) machinery. Gene targeting is stimulated by generation of a DNA double-strand break (DSB) at or near the site of correction, but repair of the break via non-homologous end-joining without using the homologous template can lead to deleterious genomic changes such as in/del mutations, or chromosomal rearrangements. By contrast, generation of a DNA single-strand break (SSB), or nick, can stimulate gene correction without the problems of DSB repair because the uncut DNA strand acts as a template to permit healing without alteration of genetic material. Here, we examine the ability of a nicking variant of the I-SceI endonuclease (K223I I-SceI) to stimulate gene targeting in yeast Saccharomyces cerevisiae and in human embryonic kidney (HEK-293) cells. K223I I-SceI is proficient in both yeast and human cells and promotes gene correction up to 12-fold. We show that K223I I-SceI-driven recombination follows a different mechanism than wild-type I-SceI-driven recombination, thus indicating that the initial DNA break that stimulates recombination is not a low-level DSB but a nick. We also demonstrate that K223I I-SceI efficiently elevates gene targeting at loci distant from the break site in yeast cells. These findings establish the capability of the I-SceI nickase to enhance recombination in yeast and human cells, strengthening the notion that nicking enzymes could be effective tools in gene correction strategies for applications in molecular biology, biotechnology, and gene therapy. PMID:24558436

  7. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. DNA single- and double-strand breaks by alkaline- and immuno-comet assay in lymphocytes of workers exposed to styrene.

    Science.gov (United States)

    Fracasso, Maria Enrica; Doria, Denise; Carrieri, Mariella; Bartolucci, Giovanni Battista; Quintavalle, Sonia; De Rosa, Edoardo

    2009-02-25

    Occupational exposure to styrene was studied in 34 workers employed in the production of fiberglass-reinforced plastic sheets and compared to 29 unexposed healthy controls. We evaluated genotoxic effects induced by occupational styrene exposure in lymphocytes by alkaline version of the comet assay to detect single-strand breaks (SSBs), DNA oxidation products (formamido pyrimidine glycosilase (Fpg)- and endonuclease (Endo III)-sensitive sites) and DNA repair kinetics studies, as well as the neutral version of comet assay for DNA double-strand breaks (DSBs). An innovative aspect of this study was the use of immuno-comet assay, a new technique that recognizes DSBs with specific antibody by DAPI/FITC method. The battery of parameters included markers of external and internal exposure. Exposed workers showed significant high levels of SSBs (p<0.0001) and DSBs (p<0.0001) in neutral- and immuno-comet assay. A drastic decrease in DNA repair activity as compared to controls was observed (180 min vs. 35 min). Styrene workplace concentration significantly correlated with alkaline comet parameters (TM, p=0.013; TI, p=0.008), in negative with TL (p=0.022), and with DNA-base oxidation (TM Endo III, p=0.048 and TI Endo III, p=0.028). There was a significant negative correlation between urinary metabolites (MA+PGA) and TM Endo III (p=0.032) and TI Endo III (p=0.017).

  9. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  10. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  11. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  13. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  14. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  15. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  16. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  17. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  18. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  19. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  20. Single crystalline wurtzite ZnO/zinc blende ZnS coaxial heterojunctions and hollow zinc blende ZnS nanotubes: synthesis, structural characterization and optical properties.

    Science.gov (United States)

    Huang, Xing; Willinger, Marc-Georg; Fan, Hua; Xie, Zai-lai; Wang, Lei; Klein-Hoffmann, Achim; Girgsdies, Frank; Lee, Chun-Sing; Meng, Xiang-Min

    2014-08-07

    Synthesis of ZnO/ZnS heterostructures under thermodynamic conditions generally results in the wurtzite (WZ) structure of the ZnS component because its WZ phase is thermodynamically more stable than its zinc blende (ZB) phase. In this report, we demonstrate for the first time the preparation of ZnO/ZnS coaxial nanocables composed of single crystalline ZB structured ZnS epitaxially grown on WZ ZnO via a two-step thermal evaporation method. The deposition temperature is believed to play a crucial role in determining the crystalline phase of ZnS. Through a systematic structural analysis, the ZnO core and the ZnS shell are found to have an orientation relationship of (0002)ZnO(WZ)//(002)ZnS(ZB) and [01-10]ZnO(WZ)//[2-20]ZnS(ZB). Observation of the coaxial nanocables in cross-section reveals the formation of voids between the ZnO core and the ZnS shell during the coating process, which is probably associated with the nanoscale Kirkendall effect known to result in porosity. Furthermore, by immersing the ZnO/ZnS nanocable heterojunctions in an acetic acid solution to etch away the inner ZnO cores, single crystalline ZnS nanotubes orientated along the [001] direction of the ZB structure were also achieved for the first time. Finally, optical properties of the hollow ZnS tubes were investigated and discussed in detail. We believe that our study could provide some insights into the controlled fabrication of one dimensional (1D) semiconductors with desired morphology, structure and composition at the nanoscale, and the synthesized WZ ZnO/ZB ZnS nanocables as well as ZB ZnS nanotubes could be ideal candidates for the study of optoelectronics based on II-VI semiconductors.

  1. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Kinetics of DNA strand breaks and protection by antioxidants in UVA- or UVB-irradiated HaCaT keratinocytes using the single cell gel electrophoresis assay.

    Science.gov (United States)

    Lehmann, J; Pollet, D; Peker, S; Steinkraus, V; Hoppe, U

    1998-03-01

    The aim of this study was to characterize the genotoxic action of UVA and UVB in human keratinocytes by application of the single cell gel electrophoresis assay (SCGE assay). Dose dependence of DNA damage, the time course of its repair, and the influence of cellular antioxidant status were assessed. Irradiation with UVA or UVB both resulted in a dose-dependent increase in the level of DNA damage. A time course study to evaluate the repair kinetics in keratinocytes irradiated with 5 J/cm2 UVA revealed an immediate occurrence of DNA effects which subsequently disappeared within about 1 h, indicating removal of DNA lesions. This rapid repair of DNA damage is consistent with the observation that 5 J/cm2 UVA did not impair cellular viability. In contrast, exposure to 15 mJ/cm2 UVB resulted in a prolonged repair of DNA damage which lasted about 25 h. Thus, the repair kinetics of UVA- and UVB-induced DNA damage clearly differed from each other, implicating the induction of different types of DNA lesions by UVA and UVB. Neither a pretreatment with Mg-ascorbyl phosphate or D,L-alpha-tocopherol, nor depletion of endogenous glutathione altered cellular sensitivity to UVB. In contrast, the DNA damaging effects of UVA could be counteracted by a pretreatment with these antioxidants. These observations confirm that the UVA-induced effects on DNA are related to radical mediated strand breaks and DNA lesions forming alkali-labile sites. The UVB-induced effects mainly occur as a consequence of excision repair-related strand breaks. The observed repair kinetics of DNA lesions and the influence of cellular antioxidant status may help to elucidate protective mechanisms against the carcinogenic effects of UV radiation present in sunlight.

  3. Switching a Nanocluster Core from Hollow to Non-hollow

    KAUST Repository

    Bootharaju, Megalamane Siddaramappa

    2016-03-24

    Modulating the structure-property relationship in atomically precise nanoclusters (NCs) is vital for developing novel NC materials and advancing their applications. While promising biphasic ligand-exchange (LE) strategies have been developed primarily to attain novel NCs, understanding the mechanistic aspects involved in tuning the core and the ligand-shell of NCs in such biphasic processes is challenging. Here, we design a single phase LE process that enabled us to elucidate the mechanism of how a hollow NC (e.g., [Ag44(SR)30]4-, -SR: thiolate) converts into a non-hollow NC (e.g., [Ag25(SR)18]-), and vice versa. Our study reveals that the complete LE of the hollow [Ag44(SPhF)30]4- NCs (–SPhF: 4-fluorobenzenethiolate) with incoming 2,4-dimethylbenzenethiol (HSPhMe2) induced distortions in the Ag44 structure forming the non-hollow [Ag25(SPhMe2)18]- by a disproportionation mechanism. While the reverse reaction of [Ag25(SPhMe2)18]- with HSPhF prompted an unusual dimerization of Ag25, followed by a rearrangement step that reproduces the original [Ag44(SPhF)30]4-. Remarkably, both the forward and the backward reactions proceed through similar size intermediates that seem to be governed by the boundary conditions set by the thermodynamic and electronic stability of the hollow and non-hollow metal cores. Furthermore, the resizing of NCs highlights the surprisingly long-range effect of the ligands which are felt by atoms far deep in the metal core, thus opening a new path for controlling the structural evolution of nanoparticles.

  4. Radiobiology of DNA strand breakage

    International Nuclear Information System (INIS)

    Johansen, I.

    1975-01-01

    The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls

  5. Evolution of nickel sulfide hollow spheres through topotactic transformation

    Science.gov (United States)

    Wei, Chengzhen; Lu, Qingyi; Sun, Jing; Gao, Feng

    2013-11-01

    In this study, a topotactic transformation route was proposed to synthesize single-crystalline β-NiS hollow spheres with uniform phase and morphology evolving from polycrystalline α-NiS hollow spheres. Uniform polycrystalline α-NiS hollow spheres were firstly prepared with thiourea and glutathione as sulfur sources under hydrothermal conditions through the Kirkendall effect. By increasing the reaction temperature the polycrystalline α-NiS hollow spheres were transformed to uniform β-NiS hollow spheres. The β-NiS crystals obtained through the topotactic transformation route not only have unchanged morphology of hollow spheres but are also single-crystalline in nature. The as-prepared NiS hollow spheres display a good ability to remove the organic pollutant Congo red from water, which makes them have application potential in water treatment.In this study, a topotactic transformation route was proposed to synthesize single-crystalline β-NiS hollow spheres with uniform phase and morphology evolving from polycrystalline α-NiS hollow spheres. Uniform polycrystalline α-NiS hollow spheres were firstly prepared with thiourea and glutathione as sulfur sources under hydrothermal conditions through the Kirkendall effect. By increasing the reaction temperature the polycrystalline α-NiS hollow spheres were transformed to uniform β-NiS hollow spheres. The β-NiS crystals obtained through the topotactic transformation route not only have unchanged morphology of hollow spheres but are also single-crystalline in nature. The as-prepared NiS hollow spheres display a good ability to remove the organic pollutant Congo red from water, which makes them have application potential in water treatment. Electronic supplementary information (ESI) available: XRD patterns; SEM images and TEM images. See DOI: 10.1039/c3nr03371f

  6. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  7. Conversion of a beta-strand to an alpha-helix induced by a single-site mutation observed in the crystal structure of Fis mutant Pro26Ala.

    OpenAIRE

    Yang, W. Z.; Ko, T. P.; Corselli, L.; Johnson, R. C.; Yuan, H. S.

    1998-01-01

    The conversion from an alpha-helix to a beta-strand has received extensive attention since this structural change may induce many amyloidogenic proteins to self-assemble into fibrils and cause fatal diseases. Here we report the conversion of a peptide segment from a beta-strand to an alpha-helix by a single-site mutation as observed in the crystal structure of Fis mutant Pro26Ala determined at 2.0 A resolution. Pro26 in Fis occurs at the point where a flexible extended beta-hairpin arm leaves...

  8. Comparison of the effect of radiation exposure from dual-energy CT versus single-energy CT on double-strand breaks at CT pulmonary angiography.

    Science.gov (United States)

    Tao, Shu Min; Li, Xie; Schoepf, U Joseph; Nance, John W; Jacobs, Brian E; Zhou, Chang Sheng; Gu, Hai Feng; Lu, Meng Jie; Lu, Guang Ming; Zhang, Long Jiang

    2018-04-01

    To compare the effect of dual-source dual-energy CT versus single-energy CT on DNA double-strand breaks (DSBs) in blood lymphocytes at CT pulmonary angiography (CTPA). Sixty-two patients underwent either dual-energy CTPA (Group 1: n = 21, 80/Sn140 kVp, 89/38 mAs; Group 2: n = 20, 100/Sn140 kVp, 89/76 mAs) or single-energy CTPA (Group 3: n = 21, 120 kVp, 110 mAs). Blood samples were obtained before and 5 min after CTPA. DSBs were assessed with fluorescence microscopy and Kruskal-Walls tests were used to compare DSBs levels among groups. Volume CT dose index (CTDIvol), dose length product (DLP) and organ radiation dose were compared using ANOVA. There were increased excess DSB foci per lymphocyte 5 min after CTPA examinations in three groups (Group 1: P = .001; Group 2: P = .001; Group 3: P = .006). There were no differences among groups regarding excess DSB foci/cell and percentage of excess DSBs (Group 1, 23%; Group 2, 24%; Group 3, 20%; P = .932). CTDIvol, DLP and organ radiation dose in Group 1 were the lowest among the groups (all P dual-source and single-source CTPA, while dual-source dual-energy CT protocols do not increase the estimated radiation dose and also do not result in a higher incidence of DNA DSBs in patients undergoing CTPA. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  10. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  11. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  12. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  13. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  14. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  15. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  16. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  17. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  18. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  20. Shear and Anchorage Behaviour of Fire Exposed Hollow Core Slabs

    NARCIS (Netherlands)

    Fellinger, J.H.H.

    2004-01-01

    Hollow core (HC) slabs are made of precast concrete with pretensioned strands. These slabs are popular as floor structures in offices and housing. At ambient conditions, the load bearing capacity can be dominated by four different failure modes, i.e. flexure, anchorage, shear compression and shear

  1. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  2. Single and repeated moderate consumption of native or dealcoholized red wine show different effects on antioxidant parameters in blood and DNA strand breaks in peripheral leukocytes in healthy volunteers: a randomized controlled trial [ISRCTN68505294

    Directory of Open Access Journals (Sweden)

    Spengler Ulrich

    2005-11-01

    Full Text Available Abstract Background Red wine (RW is rich in antioxidant polyphenols that might protect from oxidative stress related diseases, such as cardiovascular disease and cancer. Antioxidant effects after single ingestion of RW or dealcoholized RW (DRW have been observed in several studies, but results after regular consumption are contradictory. Thus, we examined if single or repeated consumption of moderate amounts of RW or DRW exert antioxidant activity in vivo. Methods Total phenolic content and concentration of other antioxidants in plasma/serum, total antioxidant capacity (TEAC in plasma as well as DNA strand breaks in peripheral leukocytes were measured in healthy non-smokers A before, 90 and 360 min after ingestion of one glass of RW, DRW or water; B before and after consumption of one glass of RW or DRW daily for 6 weeks. DNA strand breaks (SB were determined by single cell gel electrophoresis (Comet Assay in untreated cells and after induction of oxidative stress ex vivo with H2O2 (300 μM, 20 min. Results Both RW and DRW transiently increased total phenolic content in plasma after single consumption, but only RW lead to a sustained increase if consumed regularly. Plasma antioxidant capacity was not affected by single or regular consumption of RW or DRW. Effects of RW and DRW on DNA SB were conflicting. DNA strand breaks in untreated cells increased after a single dose of RW and DRW, whereas H2O2 induced SB were reduced after DRW. In contrast, regular RW consumption reduced SB in untreated cells but did not affect H2O2 induced SB. Conclusion The results suggest that consumption of both RW and DRW leads to an accumulation of phenolic compounds in plasma without increasing plasma antioxidant capacity. Red wine and DRW seem to affect the occurrence of DNA strand breaks, but this cannot be referred to antioxidant effects.

  3. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  4. Calculation of shear strength of prestressed hollow core slabs by use of plastic theory

    DEFF Research Database (Denmark)

    Hoang, Linh Cao; Jørgensen, Henrik Brøner; Nielsen, Mogens Peter

    2014-01-01

    This paper deals with calculations of the shear capacity of precast, prestressed hollow core slabs. Such slabs are often used as floor systems in Building structures. A common way to produce hollow core slabs is to use the extrusion technique where long strips of slabs are extruded and thereafter...... saw-cut into units with the desirable length. For this reason, hollow core slabs are usually not shear reinforced and anchorage of the prestressing strands has to be established by bond. Hollow core slabs may therefore be more critical to shear and Anchorage failure than ordinary two-way spanning...... reinforced concrete slabs....

  5. Calculation of shear strength of prestressed hollow core slabs by use of plastic theory

    DEFF Research Database (Denmark)

    Hoang, Linh Cao; Jørgensen, H.G.; Nielsen, Mogens Peter

    2014-01-01

    Th is paper deals with calculations of the shear capacity of precast, prestressed hollow core slabs. Such slabs are often used as floor systems in building structures. A common way to produce hollow core slabs is to use the extrusion technique where long strips of slabs are extruded and thereafter...... saw-cut into units with the desirable length. For this reason, hollow core slabs are usually not shear reinforced and anchorage of the prestressing strands has to be established by bond. Hollow core slabs may therefore be more critical to shear and anchorage failure than ordinary two-way spanning...... reinforced concrete slabs....

  6. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  7. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  8. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  9. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  10. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  11. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  12. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  13. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  14. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Fair Exchange in Strand Spaces

    Directory of Open Access Journals (Sweden)

    Joshua D. Guttman

    2009-10-01

    Full Text Available Many cryptographic protocols are intended to coordinate state changes among principals. Exchange protocols coordinate delivery of new values to the participants, e.g. additions to the set of values they possess. An exchange protocol is fair if it ensures that delivery of new values is balanced: If one participant obtains a new possession via the protocol, then all other participants will, too. Fair exchange requires progress assumptions, unlike some other protocol properties. The strand space model is a framework for design and verification of cryptographic protocols. A strand is a local behavior of a single principal in a single session of a protocol. A bundle is a partially ordered global execution built from protocol strands and adversary activities. The strand space model needs two additions for fair exchange protocols. First, we regard the state as a multiset of facts, and we allow strands to cause changes in this state via multiset rewriting. Second, progress assumptions stipulate that some channels are resilient-and guaranteed to deliver messages-and some principals are assumed not to stop at certain critical steps. This method leads to proofs of correctness that cleanly separate protocol properties, such as authentication and confidentiality, from invariants governing state evolution. G. Wang's recent fair exchange protocol illustrates the approach.

  16. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  17. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  18. Hollow Nano- and Microstructures as Catalysts.

    Science.gov (United States)

    Prieto, Gonzalo; Tüysüz, Harun; Duyckaerts, Nicolas; Knossalla, Johannes; Wang, Guang-Hui; Schüth, Ferdi

    2016-11-23

    Catalysis is at the core of almost every established and emerging chemical process and also plays a central role in the quest for novel technologies for the sustainable production and conversion of energy. Particularly since the early 2000s, a great surge of interest exists in the design and application of micro- and nanometer-sized materials with hollow interiors as solid catalysts. This review provides an updated and critical survey of the ever-expanding material architectures and applications of hollow structures in all branches of catalysis, including bio-, electro-, and photocatalysis. First, the main synthesis strategies toward hollow materials are succinctly summarized, with emphasis on the (regioselective) incorporation of various types of catalytic functionalities within their different subunits. The principles underlying the scientific and technological interest in hollow materials as solid catalysts, or catalyst carriers, are then comprehensively reviewed. Aspects covered include the stabilization of catalysts by encapsulation, the introduction of molecular sieving or stimuli-responsive "auxiliary" functionalities, as well as the single-particle, spatial compartmentalization of various catalytic functions to create multifunctional (bio)catalysts. Examples are also given on the applications which hollow structures find in the emerging fields of electro- and photocatalysis, particularly in the context of the sustainable production of chemical energy carriers. Finally, a critical perspective is provided on the plausible evolution lines for this thriving scientific field, as well as the main practical challenges relevant to the reproducible and scalable synthesis and utilization of hollow micro- and nanostructures as solid catalysts.

  19. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  20. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  1. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  2. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  3. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  4. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    assembled liquid crystals and three-dimensional hydrogels of graphene oxidewith double-stranded DNA by simple mixing in an aqueous buffer media without unwinding double-strandedDNA to single-stranded DNA. The GO/dsDNA hydrogels have ...

  5. Single-crystalline EuF3 hollow hexagonal microdisks: synthesis and application as a background-free matrix for MALDI-TOF-MS analysis of small molecules and polyethylene glycols.

    Science.gov (United States)

    Chen, Zhiming; Geng, Zhirong; Shao, Dalin; Mei, Yuhua; Wang, Zhilin

    2009-09-15

    Single-crystalline EuF(3) hexagonal microdisks with hollow interior were fabricated to serve as a background-free matrix for analysis of small molecules and polyethylene glycols (PEGs) by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS). The long-lived excited state of europium ions can transfer energy to high-energy vibrations of organic molecules, which provides the potential technological application in MALDI-TOF-MS analysis of small molecules and PEGs. The efficiency of the hollow microdisks as a novel matrix of low molecular weight compounds was verified by analysis of small peptide, amino acid, organic compounds, and hydroxypropyl beta-cyclodextrin (HP-beta-CD). The advantage of this matrix in comparison with alpha-cyano-4-hydroxycinnamic acid (CHCA) and 2,5-dihydroxybenzoic acid (DHB) was demonstrated by MALDI-TOF-MS analysis of an amino acid mixture and a peptide mixture. This matrix is successfully used for analysis of PEGs (PEG 2000, PEG 4000, PEG 8000, PEG 15000, and PEG 30000), suggesting a potential for monitoring reactions and for synthetic polymer quality control. The upper limit of detectable mass range was approximately 35,000 Da (PEG 30000). It is believed that this work will not only offer a new technique for high-speed analysis of small molecules and PEGs but also open a new field for applications of rare earth fluorides.

  6. Replication of the plasmid pBR322 under the control of a cloned replication origin from the single-stranded DNA phage M13.

    OpenAIRE

    Cleary, J M; Ray, D S

    1980-01-01

    The replication origins of viral and complementary strands of bacteriophage M13 DNA are contained within a 507-nucleotide intergenic region of the viral genome. Chimeric plasmids have been constructed by inserting restriction endonuclease fragments of the M13 intergenic region into the plasmid pBR322. Replication of these hybrid plasmids, under conditions not permissive for the plasmid replicon, depends on specific segments of the M13 origin region and on the presence of M13 helper virus. Thu...

  7. Fabrication of Closed Hollow Bulb Obturator Using Thermoplastic Resin Material

    Directory of Open Access Journals (Sweden)

    Bidhan Shrestha

    2015-01-01

    Full Text Available Purpose. Closed hollow bulb obturators are used for the rehabilitation of postmaxillectomy patients. However, the time consuming process, complexity of fabrication, water leakage, and discoloration are notable disadvantages of this technique. This paper describes a clinical report of fabricating closed hollow bulb obturator using a single flask and one time processing method for an acquired maxillary defect. Hard thermoplastic resin sheet has been used for the fabrication of hollow bulb part of the obturator. Method. After fabrication of master cast conventionally, bulb and lid part of the defect were formed separately and joined by autopolymerizing acrylic resin to form one sized smaller hollow body. During packing procedure, the defect area was loaded with heat polymerizing acrylic resin and then previously fabricated smaller hollow body was adapted over it. The whole area was then loaded with heat cure acrylic. Further processes were carried out conventionally. Conclusion. This technique uses single flask which reduces laboratory time and makes the procedure simple. The thickness of hollow bulb can be controlled and light weight closed hollow bulb prosthesis can be fabricated. It also minimizes the disadvantages of closed hollow bulb obturator such as water leakage, bacterial infection, and discoloration.

  8. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  9. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  10. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  11. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  12. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

    2016-09-15

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  13. Conformational Thermodynamics of DNA Strands in Hydrophilic Nanopores.

    Science.gov (United States)

    Cruz, Fernando J A L; Mota, Jose P B

    2016-08-18

    Enhanced sampling techniques spanning a sub-microsecond timescale reveal that a double-stranded DNA dodecamer can be spontaneously encapsulated into (51,0) and (40,0) single-walled carbon nanotubes under the influence of an electric field, leading to hybrids with a 40 kJ/mol enhanced free-energy. The confinement mechanism allows the nucleic acid to retain its mobility, diffusing anisotropically along the endohedral volume, visiting regions of space determined by entropic factors (diameter, free-volume) and linked by a thermodynamical highway. In spite of the energetic similarities between both topologies (4.1× 103 kJ/mol), the biomolecule favours positioning either parallel to the nanopore central axis, (40,0), or in close contact with the solid walls, (51,0), in the latter encasing a hollow cylindrical domain of diameter 1 - 1.5 nm. Precise physiological conditions allow the extrapolation of results to in vivo systems and constitute a novel and thorough contribution to nanotube technology in the areas of nucleic acid encapsulation/delivery and personalized therapeutics.

  14. Hollow-Core Fiber Lamp

    Science.gov (United States)

    Yi, Lin (Inventor); Tjoelker, Robert L. (Inventor); Burt, Eric A. (Inventor); Huang, Shouhua (Inventor)

    2016-01-01

    Hollow-core capillary discharge lamps on the millimeter or sub-millimeter scale are provided. The hollow-core capillary discharge lamps achieve an increased light intensity ratio between 194 millimeters (useful) and 254 millimeters (useless) light than conventional lamps. The capillary discharge lamps may include a cone to increase light output. Hollow-core photonic crystal fiber (HCPCF) may also be used.

  15. Mesoscale cavities in hollow-core waveguides for quantum optics with atomic ensembles

    Directory of Open Access Journals (Sweden)

    Haapamaki C.M.

    2016-08-01

    Full Text Available Single-mode hollow-core waveguides loaded with atomic ensembles offer an excellent platform for light–matter interactions and nonlinear optics at low photon levels. We review and discuss possible approaches for incorporating mirrors, cavities, and Bragg gratings into these waveguides without obstructing their hollow cores. With these additional features controlling the light propagation in the hollow-core waveguides, one could potentially achieve optical nonlinearities controllable by single photons in systems with small footprints that can be integrated on a chip. We propose possible applications such as single-photon transistors and superradiant lasers that could be implemented in these enhanced hollow-core waveguides.

  16. How do Colluvial Hollows Fill?

    Science.gov (United States)

    Hales, T. C.; Parker, R.; Mudd, S. M.; Grieve, S. W. D.

    2016-12-01

    In humid, soil-mantled mountains shallow landslides commonly initiate in colluvial hollows, areas where convergent topography can lead to high pore pressures during storms. Immediately post-landslide initiation, a thin veneer of colluvial material accumulates by small-scale slumping from landslide headscarps. Thereafter colluvium accumulates in hollows primarily through creep-dominated processes like tree throw and animal burrowing, recording the hillslope sediment flux since the last landslide event. We measured the post-landslide hillslope sediment flux in 30 colluvial hollows in the southern Appalachians using radiocarbon measurements collected from soil pits excavated at the centre of steep, landslide-prone hollows. We collected material from the soil-saprolite/bedrock boundary at each location for radiocarbon dating and dated different chemical fractions of the soil (humic acid, humin, charcoal) in an attempt to bracket the "true" age of the soil. We calculated infilling rates of each hollow by measuring soil depths in cross-hollow transects and dividing this by the age of the hollow. The interquartile range of hollow basal ages is 2278-8184 cal. yrs B.P., demonstrating the long return period of landslides in most colluvial hollows. Hillslope erosion rates calculated assuming a linear diffusion transport law show that the transport coefficient (diffusivity) of the hollows varied by 4 orders of magnitude 10-5 to 10-1 m2 yr-1, despite the hollows being formed in regionally consistent geology and vegetation. Uncertainty in the dating and hollow geometry measurements can, at most, account for an order of magnitude of that variability. Our results show that hollows have a phase of rapid infilling that slows through time, consistent with previous observations. Despite this, the oldest hollows show several orders of magnitude variation in the transport coefficient, suggesting local, hollow scale variations in process significantly affect hillslope erosion rates.

  17. Structure of the replicative form of bacteriophage φX174 : VI. Studies on alkali-denatured double-stranded φX DNA

    NARCIS (Netherlands)

    Pouwels, P.H.; Knijnenburg, C.M.; Rotterdam, J. van; Cohen, J.A.; Jansz, H.S.

    1968-01-01

    Double-stranded φX DNA which accumulates after infection with bacteriophage φX174 in the presence of chloramphenicol consists mainly of twisted circular double-stranded DNA with no single-strand breaks (component I) and of circular double-stranded DNA, in which single-strand breaks are present

  18. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  19. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  20. Elimination of double strand nuclease activity from S1 nuclease prepared from crude alpha amylase.

    Science.gov (United States)

    Hahn, W E; Van Ness, J

    1976-01-01

    Single strand-specific s1 nuclease prepared as previously described from crude alpha amylase by DEAE-cellulose chromatography also contains nuclease which degrades double strand nucleic acid. The double strand activity can be removed by repeating the DEAE-cellulose chromatography procedure at least two additional times. S1 nuclease prepared by this procedure does not degrade double strand sheared DNA as measured by Sephadex chromatography. Under the same conditions single strand DNA is completely degraded. Thus, S1 nuclease prepared by this procedure is suitable for use in removing single strand regions in DNA/DNA duplexes and DNA/RNA hybrids. PMID:940774

  1. Hollow Force, Hollow Metaphor: Assessing the Current Defense Drawdown

    Science.gov (United States)

    2016-04-04

    testimony to Congress, the Army’s Chief of Staff, General Edward Meyer, used the phrase “hollow Army” to articulate his perception of an undermanned...drawdown. Background: General Meyer and the Birth of a Powerful Metaphor In 1980, the Army Chief of Staff, General Edward Meyer, used the “hollow Army...5 Meyer stated during a House Arms Senate sub-committee meeting, “Right now, as I have said before, we have a hollow

  2. Hollow Microporous Organic Capsules

    Science.gov (United States)

    Li, Buyi; Yang, Xinjia; Xia, Lingling; Majeed, Muhammad Irfan; Tan, Bien

    2013-01-01

    Fabrication of hollow microporous organic capsules (HMOCs) could be very useful because of their hollow and porous morphology, which combines the advantages of both microporous organic polymers and non-porous nanocapsules. They can be used as storage materials or reaction chambers while supplying the necessary path for the design of controlled uptake/release systems. Herein, the synthesis of HMOCs with high surface area through facile emulsion polymerization and hypercrosslinking reactions, is described. Due to their tailored porous structure, these capsules possessed high drug loading efficiency, zero-order drug release kinetics and are also demonstrated to be used as nanoscale reactors for the prepareation of nanoparticles (NPs) without any external stabilizer. Moreover, owing to their intrinsic biocompatibility and fluorescence, these capsules exhibit promising prospect for biomedical applications. PMID:23820511

  3. Hollow bunches production

    CERN Document Server

    Hancock, S

    2017-01-01

    Hollow bunches address the issue of high-brightnessbeams suffering from transverse emittance growth in a strongspace charge regime. During the Proton Synchrotron (PS)injection plateau, the negative space charge tune shift canpush the beam onto theQy=6integer resonance. Modify-ing the longitudinal bunch profile in order to reduce the peakline charge density alleviates the detrimental impact of spacecharge. To this end we first produce longitudinally hollowphase space distributions in the PS Booster by exciting aparametric resonance with the phase loop feedback system.These inherently flat bunches are then transferred to the PS,where the beam becomes less prone to the emittance growthcaused by the integer resonance.During the late 2016 machine development sessions inthe PS Booster we profited from solved issues from 2015and managed to reliably extract hollow bunches of1.3eVsmatched longitudinal area. Furthermore, first results to cre-ate hollow bunches with larger longitudinal emittances to-wards the LHC Inject...

  4. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  5. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  6. Single crystalline wurtzite ZnO/zinc blende ZnS coaxial heterojunctions and hollow zinc blende ZnS nanotubes: synthesis, structural characterization and optical properties

    OpenAIRE

    Huang, X.; Willinger, M.; Fan, H.; Xie, Z.; Wang , L.; Klein-Hoffmann, A.; Girgsdies, F.; Lee, C.; Meng, X.

    2014-01-01

    Synthesis of ZnO/ZnS heterostructures under thermodynamic conditions generally results in the wurtzite (WZ) structure of the ZnS component because its WZ phase is thermodynamically more stable than its zinc blende (ZB) phase. In this report, we demonstrate for the first time the preparation of ZnO/ZnS coaxial nanocables composed of single crystalline ZB structured ZnS epitaxially grown on WZ ZnO via a two-step thermal evaporation method. The deposition temperature is believed to play a crucia...

  7. LHC superconducting strand

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    This cross-section through a strand of superconducting matieral as used in the LHC shows the 8000 Niobium-Titanium filaments embedded like a honeycomb in copper. When cooled to 1.9 degrees above absolute zero in the LHC accelerator, these filaments will have zero resistance and so will carry a high electric current with no energy loss.

  8. Strand SPA & Konverentsikeskus

    Index Scriptorium Estoniae

    2008-01-01

    Strand SPA & Konverentsikeskus on Pärnu suurim äri- ja konverentsiklientidele suunatud hotell, mis klientide seas on hinnatud just selle kompleksuse tõttu, kuna kõik, mida külaline vajab ja soovib, on olemas ühe katuse all

  9. One-step fabrication of single-crystalline ZnS nanotubes with a novel hollow structure and large surface area for photodetector devices

    Science.gov (United States)

    An, Qinwei; Meng, Xianquan; Xiong, Ke; Qiu, Yunlei; Lin, Weihua

    2017-03-01

    ZnS nanotubes (NTs) were successfully prepared via a one-step thermal evaporation process without using any templates. The resulting NTs were single crystalline and structurally uniform. Based on experimental analysis, a tube-growth vapor-liquid-solid process was proposed as the growth mechanism of ZnS NTs. A metal-semiconductor-metal full-nanostructured ultraviolet (UV) photodetector with ZnS NTs as the active layer, and Ag nanowires of low resistivity and high transmissivity as electrodes, was fabricated and characterized. The ZnS NT-based device displayed a high I on/I off ratio of up to ˜1.56 × 105 with a high response to UV incident light at low operation voltage. This work is a meaningful exploration for preparing other one-dimensional semiconductor NTs, and developing a high-performance and power-saving UV sensor.

  10. Synthesis of barium-strontium titanate hollow tubes using Kirkendall effect

    Science.gov (United States)

    Chen, Xuncai; Im, SangHyuk; Kim, Jinsoo; Kim, Woo-Sik

    2018-02-01

    (BaSr)TiO3 hexagonal hollow tubes was fabricated by a solid-state interfacial reaction including a Kirkendall diffusion. Using a co-precipitation and sol-gel process, a core@shell structure of (BaSr)CO3@TiO2 rods were prepared, and then converted to (BaSr)TiO3 hollow tubes at 750 °C. This was a first achievement of single-phase crystal hollow tube. Here, the inner diameter and wall thickness of hollow tube were about 700 nm and 130 nm, respectively. The fabrication of (BaSr)TiO3 hollow tubes was monitored with scanning electron microscopy (SEM), energy-dispersive spectrometry (EDS), transmission electron microscopy (TEM), and X-ray diffraction (XRD) to investigate their formation mechanism. The present synthetic approach would provide a new insight into the design and fabrication of hollow architectures of many perovskite oxides.

  11. Sea Turtle Stranding Network Reports

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Sea Turtle Stranding and Salvage Network (STSSN) was formally established in 1980 to collect information on and document the stranding of marine turtles along...

  12. Low-Loss Hollow-Core Anti-Resonant Fibers With Semi-Circular Nested Tubes

    DEFF Research Database (Denmark)

    Habib, Selim; Bang, Ole; Bache, Morten

    2016-01-01

    Hollow-core fibers with a single ring of circular antiresonant tubes as the cladding provide a simple way of getting a negative-curvature hollow core, resulting in broadband low-loss transmission with little power overlap in the glass. These fibers show a significant improvement in loss performance...

  13. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  14. DNA strand breaks, repair, and survival in x-irradiated mammalian cells

    International Nuclear Information System (INIS)

    Dugle, D.L.; Gillespie, C.J.; Chapman, J.D.

    1976-01-01

    The yields of unrepairable single- and double-strand breaks in the DNA of x-irradiated Chinese hamster cells were measured by low-speed neutral and alkaline sucrose density gradient sedimentation in order to investigate the relation between these lesions and reproductive death. After maximal single-strand rejoining, at all doses, the number of residual single-strand breaks was twice the number of residual double-strand breaks. Both double-strand and unrepairable single-strand breaks were proportional to the square of absorbed dose, in the range 10-50 krad. No rejoining of double-strand breaks was observed. These observations suggest that, in mammalian cells, most double-strand breaks are not repairable, while all single-strand breaks are repaired except those that are sufficiently close on complementary strands to constitute double-strand breaks. Comparison with cell survival measurements at much lower doses suggests that loss of reproductive capacity corresponds to induction of approximately one double-strand break

  15. Cable degration of SSC strand

    International Nuclear Information System (INIS)

    Warnes, W.H.; Dai, W.; Seuntjens, J.; Capone, D.W. II

    1992-01-01

    Cable degradation of a SSC 40mm cable was studied by comparing the virgin strand and extracted strand measurements of critical current for all thirty strands. Typical degradation values of a few percent are observed in these materials. Image analysis performed on the strand cross sections found the filament deformation to be commensurate with the measured degradation in critical current. A simple model for current sharing in cables with edge damage reduction of Ic was developed and described below. Suggestions for measurements of cable critical current using extracted strands are also presented

  16. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  18. Birefringent hollow core fibers

    DEFF Research Database (Denmark)

    Roberts, John

    2007-01-01

    Hollow core photonic crystal fiber (HC-PCF), fabricated according to a nominally non-birefringent design, shows a degree of un-controlled birefringence or polarization mode dispersion far in excess of conventional non polarization maintaining fibers. This can degrade the output pulse in many...... applications, and places emphasis on the development of polarization maintaining (PM) HC-PCF. The polarization cross-coupling characteristics of PM HC-PCF are very different from those of conventional PM fibers. The former fibers have the advantage of suffering far less from stress-field fluctuations...... and an increased overlap between the polarization modes at the glass interfaces. The interplay between these effects leads to a wavelength for optimum polarization maintenance, lambda(PM), which is detuned from the wavelength of highest birefringence. By a suitable fiber design involving antiresonance of the core...

  19. Direct and Auger Electron-Induced, Single- and Double-Strand Breaks on Plasmid DNA Caused by 99mTc-Labeled Pyrene Derivatives and the Effect of Bonding Distance.

    Directory of Open Access Journals (Sweden)

    Falco Reissig

    Full Text Available It is evident that 99mTc causes radical-mediated DNA damage due to Auger electrons, which were emitted simultaneously with the known γ-emission of 99mTc. We have synthesized a series of new 99mTc-labeled pyrene derivatives with varied distances between the pyrene moiety and the radionuclide. The pyrene motif is a common DNA intercalator and allowed us to test the influence of the radionuclide distance on damages of the DNA helix. In general, pUC 19 plasmid DNA enables the investigation of the unprotected interactions between the radiotracers and DNA that results in single-strand breaks (SSB or double-strand breaks (DSB. The resulting DNA fragments were separated by gel electrophoresis and quantified by fluorescent staining. Direct DNA damage and radical-induced indirect DNA damage by radiolysis products of water were evaluated in the presence or absence of the radical scavenger DMSO. We demonstrated that Auger electrons directly induced both SSB and DSB in high efficiency when 99mTc was tightly bound to the plasmid DNA and this damage could not be completely prevented by DMSO, a free radical scavenger. For the first time, we were able to minimize this effect by increasing the carbon chain lengths between the pyrene moiety and the 99mTc nuclide. However, a critical distance between the 99mTc atom and the DNA helix could not be determined due to the significantly lowered DSB generation resulting from the interaction which is dependent on the type of the 99mTc binding motif. The effect of variable DNA damage caused by the different chain length between the pyrene residue and the Tc-core as well as the possible conformations of the applied Tc-complexes was supplemented with molecular dynamics (MD calculations. The effectiveness of the DNA-binding 99mTc-labeled pyrene derivatives was demonstrated by comparison to non-DNA-binding 99mTcO4-, since nearly all DNA damage caused by 99mTcO4- was prevented by incubating with DMSO.

  20. Comparison of repair of DNA double-strand breaks in identical sequences in primary human fibroblast and immortal hamster-human hybrid cells harboring a single copy of human chromosome 11

    Science.gov (United States)

    Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    2000-01-01

    We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.

  1. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  2. Method for sizing hollow microspheres

    Science.gov (United States)

    Farnum, E.H.; Fries, R.J.

    1975-10-29

    Hollow Microspheres may be effectively sized by placing them beneath a screen stack completely immersed in an ultrasonic bath containing a liquid having a density at which the microspheres float and ultrasonically agitating the bath.

  3. Stranded costs and exit fees

    International Nuclear Information System (INIS)

    2002-01-01

    The New Brunswick Market Design Committee has been directed to examine the issue of stranded costs since it is a major component of restructuring within the electricity sector. When regulated monopolies are faced with competition, they could find that some of their embedded costs cannot be recovered. These costs are referred to as stranded costs. Common sources include large capital investments in uneconomic plants or expensive power purchase contracts or fuel supply contracts. In general, stranded costs do not include gains or losses associated with normal business risks experienced by regulated utilities. This report presents recommendations for mitigation of stranded costs, valuation methodologies and cost-recovery mechanisms. It also presents a summary of experience with stranded costs in other jurisdictions such as California, Rhode Island, Pennsylvania and Ontario. Stranded costs are often recovered through an obligatory charge on all customers, particularly in jurisdictions where retail competition exists. In the New Brunswick market, however, the only customers who can create stranded costs are those eligible to choose their own suppliers. It is argued that since most customers will not have a choice of electricity suppliers, they cannot generate stranded costs and therefore, should not have to pay costs stranded by others. A method to quantify stranded costs is presented, along with a review of transmission-related stranded costs in New Brunswick. Expansion of self-generation in New Brunswick could strand transmission assets. Currently, self-generators only contribute a small amount to fixed charges of the transmission system. However, under new recommended tariffs, the amount could increase. It is likely that the net amount of stranded transmission costs will not be large. 2 refs., 1 fig

  4. Antiresonant hollow core fiber with seven nested capillaries

    DEFF Research Database (Denmark)

    Antonio-Lopez, Jose E.; Habib, Selim; Van Newkirk, Amy

    2016-01-01

    We report an antiresonant hollow core fiber formed of 7 non-touching capillaries with inner tubes. The fiber has a core diameter of ∼33μm and a core wall of ∼780nm of thickness. We demonstrate robust single mode operation at 1064nm and broad transmission bandwidth....

  5. Magnetized jet creation using a hollow ring of laser beams

    Science.gov (United States)

    Lu, Yingchao; Liang, Edison; Han, Lily; Gao, Lan; Ji, Hantao; Li, Chi Kiang; Petrasso, Richard; Froula, Dustin; Follett, Russ; Tzeferacos, Petros; Lamb, Don

    2016-10-01

    We report results of magnetized jet creation experiment using the Omega laser. Using 20 Omega beams to irradiate a flat plastic target in a hollow ring pattern, we demonstrated that the on-axis electron and ion density, temperature and velocity are higher than when all beams are focused onto a single spot. The jet created by the hollow ring laser is also more collimated. Proton radiography was used to probe the magnetic field in the jet. Proton images show ordered quasi-linear filaments whose divergence decreases with increasing ring radius. Proton density contrasts are consistent with filamentary field bundles with peak values in the tens of Teslas. These results demonstrate that magnetized jets created by a hollow ring of laser beams can become a versatile new platform for laboratory astrophysics.

  6. Pulsar average waveforms and hollow cone beam models

    Science.gov (United States)

    Backer, D. C.

    1975-01-01

    An analysis of pulsar average waveforms at radio frequencies from 40 MHz to 15 GHz is presented. The analysis is based on the hypothesis that the observer sees one cut of a hollow-cone beam pattern and that stationary properties of the emission vary over the cone. The distributions of apparent cone widths for different observed forms of the average pulse profiles (single, double/unresolved, double/resolved, triple and multiple) are in modest agreement with a model of a circular hollow-cone beam with random observer-spin axis orientation, a random cone axis-spin axis alignment, and a small range of physical hollow-cone parameters for all objects.

  7. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  8. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  9. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  10. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  11. Dual layer hollow fiber sorbents for trace H2S removal from gas streams

    KAUST Repository

    Bhandari, Dhaval A.

    2013-05-01

    Hollow fiber sorbents are pseudo monolithic materials with potential use in various adsorption based applications. Dual layer hollow fiber sorbents have the potential to allow thermal regeneration without direct contact of the regeneration fluid with the sorbent particles. This paper considers the application of dual layer hollow fiber sorbents for a case involving trace amounts of H2S removal from a simulated gas stream and offers a comparison with single layer hollow fiber sorbents. The effect of spin dope composition and core layer zeolite loading on the gas flux, H2S transient sorption capacity and pore structure are also studied. This work can be used as a guide to develop and optimize dual layer hollow fiber sorbent properties beyond the specific example considered here. © 2013 Elsevier Ltd.

  12. Deficiency of double-strand DNA break repair does not impair Mycobacterium tuberculosis virulence in multiple animal models of infection.

    Science.gov (United States)

    Heaton, Brook E; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C; Glickman, Michael S

    2014-08-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA breaks are the most cytotoxic form of DNA damage and must be repaired for chromosome replication to proceed. M. tuberculosis elaborates three genetically distinct DSB repair systems: homologous recombination (HR), nonhomologous end joining (NHEJ), and single-strand annealing (SSA). NHEJ, which repairs DSBs in quiescent cells, may be particularly relevant to M. tuberculosis latency. However, very little information is available about the phenotype of DSB repair-deficient M. tuberculosis in animal models of infection. Here we tested M. tuberculosis strains lacking NHEJ (a Δku ΔligD strain), HR (a ΔrecA strain), or both (a ΔrecA Δku strain) in C57BL/6J mice, C3HeB/FeJ mice, guinea pigs, and a mouse hollow-fiber model of infection. We found no difference in bacterial load, histopathology, or host mortality between wild-type and DSB repair mutant strains in any model of infection. These results suggest that the animal models tested do not inflict DSBs on the mycobacterial chromosome, that other repair pathways can compensate for the loss of NHEJ and HR, or that DSB repair is not required for M. tuberculosis pathogenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Hollow glass waveguides: New variations

    Science.gov (United States)

    Gibson, Daniel Joseph

    This study is an effort to develop new variations on the infrared silver-silver iodide hollow glass waveguide (HGW) with application specific properties. Four variations are presented: a HGW with a long, gradual taper, a HGW with a rectangular cross-section, curved HGW tips and a new all-dielectric hollow waveguide based on photonic bandgap guidance principles. A hollow glass waveguide tapered over its entire length offers ease of coupling at the proximal end and excellent flexibility at the distal end. Waveguides tapered from 1000 to 500 mum and 700 to 500 mum over 1.5 m were fabricated in this study. Compared to similarly sized non-tapered waveguides, laser losses for the tapered guides were high but decreased when bent. This behavior is contrary to that of non-tapered guides and an iterative ray tracing model was also developed to explain the observed loss characteristics of tapered hollow waveguides. Hollow glass waveguides with round profiles do not maintain the polarization state of the delivered radiation to any appreciable degree. HGWs with large- and small-aspect ratio rectangular cross sections were developed and shown to preserve polarization up to 96%, even when bent. The large aspect ratio guide was able to effectively rotate the transmitted polarization when twisted along its axis. Curved distal tips for medical and dental laser applications were developed by removing the low-OH silica fiber from commercially available stainless steel dental tips, and inserting HGWs of various sizes. The optical performances and heating profiles of the various configurations indicate the tips are suitable for certain medical applications, but the minimum bending radius is limited by the mechanical properties of the glass substrate. A small radii bending loss study confirms that propagating modes periodically couple as the radius of curvature is reduced. Through the application of the photonic bandgap (PBG) guidance, hollow waveguides can be made entirely from

  14. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    Energy Technology Data Exchange (ETDEWEB)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.; Mitra, S.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNA when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.

  15. Investigations of radiation-induced strand breaks of poly(U) in aqueous solutions

    International Nuclear Information System (INIS)

    Lemaire, D.G.E.

    1984-01-01

    DNA strand breaks induced by γ irradiation were studied in polyuridylic acid (Poly(U)), a single-strand model substance with a single base. Poly(U) in diluted, aqueous solution was irradiated in a Co-γ source, and the 100 eV yields of strand breaks (Cr values) were determined on the basis of the loss of molecular weight. The molecular weight was determined by small-angle laser light scattering. (orig./PW) [de

  16. Hollow fiber liquid supported membranes

    International Nuclear Information System (INIS)

    Violante, V.

    1987-01-01

    The hollow fiber system are well known and developed in the scientific literature because of their applicability in the process separation units. The authors approach to a mathematical model for a particular hollow fiber system, usin liquid membranes. The model has been developed in order to obtain a suitable tool for a sensitivy analysis and for a scaling-up. This kind of investigation is very usefull from an engineering point of view, to get a spread range of information to build up a pilot plant from the laboratory scale

  17. Quartz antenna with hollow conductor

    Science.gov (United States)

    Leung, Ka-Ngo; Benabou, Elie

    2002-01-01

    A radio frequency (RF) antenna for plasma ion sources is formed of a hollow metal conductor tube disposed within a glass tube. The hollow metal tubular conductor has an internal flow channel so that there will be no coolant leakage if the outer glass tube of the antenna breaks. A portion of the RF antenna is formed into a coil; the antenna is used for inductively coupling RF power to a plasma in an ion source chamber. The antenna is made by first inserting the metal tube inside the glass tube, and then forming the glass/metal composite tube into the desired coil shape.

  18. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  19. Correlation of Free Radical Yields with Strand Break Yields Produced in Plasmid DNA by the Direct Effect of Ionizing Radiation

    OpenAIRE

    Purkayastha, Shubhadeep; Milligan, Jamie R.; Bernhard, William A.

    2005-01-01

    The purpose of this study was to determine how free radical formation (fr) correlates with single strand break (ssb) and double strand break (dsb) formation in DNA exposed to the direct effects of ionizing radiation. Chemical yields have been determined of (i) total radicals trapped on DNA at 4 K, G(∑fr), (ii) radicals trapped on the DNA sugar, Gsugar(fr), (iii) prompt single strand breaks, Gprompt(ssb), (iv) total single strand breaks, Gtotal(ssb), and (v) double strand breaks, G(dsb). These...

  20. Microstructured hollow fibers for ultrafiltration

    NARCIS (Netherlands)

    Culfaz, Pmar Zeynep; Culfaz, P.Z.; Rolevink, Hendrikus H.M.; van Rijn, C.J.M.; Lammertink, Rob G.H.; Wessling, Matthias

    2010-01-01

    Hollow fiber ultrafiltration membranes with a corrugated outer microstructure were prepared from a PES/PVP blend. The effect of spinning parameters such as air gap, take-up speed, polymer dope viscosity and coagulation value on the microstructure and membrane characteristics was investigated. Fibers

  1. Hollow waveguide cavity ringdown spectroscopy

    Science.gov (United States)

    Dreyer, Chris (Inventor); Mungas, Greg S. (Inventor)

    2012-01-01

    Laser light is confined in a hollow waveguide between two highly reflective mirrors. This waveguide cavity is used to conduct Cavity Ringdown Absorption Spectroscopy of loss mechanisms in the cavity including absorption or scattering by gases, liquid, solids, and/or optical elements.

  2. Genetic and environmental influence on DNA strand break repair

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single-strand...... breaks), and some of the most hazardous lesions (DNA double-strand breaks). DNA damage signaling response (Gamma-H2AX signaling), relative amount of endogenous damage, and DNA-strand break repair capacities were studied in peripheral blood mononuclear cells from 198 twins (94 monozygotic and 104...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study. Environ. Mol. Mutagen., 2013. © 2013 Wiley Periodicals, Inc....

  3. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Poeschla, Eric, E-mail: poeschla.eric@mayo.edu

    2013-06-20

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import.

  4. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    International Nuclear Information System (INIS)

    Poeschla, Eric

    2013-01-01

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import

  5. Viable deletions of the M13 complementary strand origin

    OpenAIRE

    Kim, Myoung Hee; Hines, Jane C.; Ray, Dan S.

    1981-01-01

    The single-stranded DNA of bacteriophage M13 is converted to a duplex replicative form by a mechanism involving RNA-primed initiation at a single unique site on the viral DNA. The DNA sequence that specifies the RNA primer is contained largely within one of two adjacent hairpin structures protected from DNase degradation by RNA polymerase. We have used in vitro techniques to construct a series of M13 mutants having deletions in the region of the complementary strand origin. Deletions of the d...

  6. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts

    Science.gov (United States)

    Grant, Rachel A.; Savirina, Anna

    2018-01-01

    Simple Summary Marine mammals stranding on coastal beaches is not unusual. However, there appears to be no single cause for this, with several causes being probable, such as starvation, contact with humans (for example boat strike or entanglement with fishing gear), disease, and parasitism. We evaluated marine mammal stranding off the Washington and Oregon coasts and looked at offshore earthquakes as a possible contributing factor. Our analysis showed that offshore earthquakes did not make marine mammals more likely to strand. We also analysed a subset of data from the north of Washington State and found that non-adult animals made up a large proportion of stranded animals, and for dead animals the commonest cause of death was disease, traumatic injury, or starvation. Abstract The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or

  7. The Effect of Basepair Mismatch on DNA Strand Displacement.

    Science.gov (United States)

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  8. Fabrication of Metallic Hollow Nanoparticles

    Science.gov (United States)

    Kim, Jae-Woo (Inventor); Choi, Sr., Sang H. (Inventor); Lillehei, Peter T. (Inventor); Chu, Sang-Hyon (Inventor); Park, Yeonjoon (Inventor); King, Glen C. (Inventor); Elliott, James R. (Inventor)

    2016-01-01

    Metal and semiconductor nanoshells, particularly transition metal nanoshells, are fabricated using dendrimer molecules. Metallic colloids, metallic ions or semiconductors are attached to amine groups on the dendrimer surface in stabilized solution for the surface seeding method and the surface seedless method, respectively. Subsequently, the process is repeated with additional metallic ions or semiconductor, a stabilizer, and NaBH.sub.4 to increase the wall thickness of the metallic or semiconductor lining on the dendrimer surface. Metallic or semiconductor ions are automatically reduced on the metallic or semiconductor nanoparticles causing the formation of hollow metallic or semiconductor nanoparticles. The void size of the formed hollow nanoparticles depends on the dendrimer generation. The thickness of the metallic or semiconductor thin film around the dendrimer depends on the repetition times and the size of initial metallic or semiconductor seeds.

  9. Room-temperature I-V characteristics of a single hollow La{sub 2/3}Ca{sub 1/3}MnO{sub 3} microparticle

    Energy Technology Data Exchange (ETDEWEB)

    Saleta, M E; Granada, M; Curiale, J; Benavides, R; Troiani, H E; Sanchez, R D, E-mail: rodo@cab.cnea.gov.ar [Centro Atomico Bariloche, Comision Nacional de Energia Atomica, Avenida Bustillo 9500, 8400 S.C. de Bariloche, RN (Argentina)

    2011-07-13

    In this work we present an electrical characterization of La{sub 2/3}Ca{sub 1/3}MnO{sub 3} particles obtained by spray pyrolysis. We optimized the synthesis conditions to obtain the desired compound with the expected structure and the ferromagnetic transition at the same temperature as the bulk material. We found that a post-deposition thermal treatment enhances the magnetic properties of the samples. The study of structural, morphological and magnetic properties shows that the walls of the hollow spheres are constituted by grains on the nanometer scale. The I-V characterization shows typical signatures of tunneling transport. This behavior can be associated with the grain boundaries within the microparticle's wall acting as tunnel barriers.

  10. The N-terminal strand modulates immunoglobulin light chain fibrillogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Pozo-Yauner, Luis del, E-mail: ldelpozo@inmegen.gob.mx [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); Wall, Jonathan S. [Departments of Radiology and Medicine, The University of Tennessee Medical Center, 1924 Alcoa Highway, Knoxville, TN (United States); González Andrade, Martín [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); Sánchez-López, Rosana [Instituto de Biotecnología, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa Cuernavaca, Morelos C.P. 62210 (Mexico); Rodríguez-Ambriz, Sandra L. [Centro de Desarrollo de Productos Bióticos, Instituto Politécnico Nacional, Calle CEPROBI No. 8, Col. San Isidro, Yautepec, Morelos C.P. 62731 (Mexico); Pérez Carreón, Julio I. [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); and others

    2014-01-10

    Highlights: •We evaluated the impact of mutations in the N-terminal strand of 6aJL2 protein. •Mutations destabilized the protein in a position-dependent manner. •Destabilizing mutations accelerated the fibrillogenesis by shortening the lag time. •The effect on the kinetic of fibril elongation by seeding was of different nature. •The N-terminal strand is buried in the fibrillar state of 6aJL2 protein. -- Abstract: It has been suggested that the N-terminal strand of the light chain variable domain (V{sub L}) protects the molecule from aggregation by hindering spurious intermolecular contacts. We evaluated the impact of mutations in the N-terminal strand on the thermodynamic stability and kinetic of fibrillogenesis of the V{sub L} protein 6aJL2. Mutations in this strand destabilized the protein in a position-dependent manner, accelerating the fibrillogenesis by shortening the lag time; an effect that correlated with the extent of destabilization. In contrast, the effect on the kinetics of fibril elongation, as assessed in seeding experiments was of different nature, as it was not directly dependant on the degree of destabilization. This finding suggests different factors drive the nucleation-dependent and elongation phases of light chain fibrillogenesis. Finally, taking advantage of the dependence of the Trp fluorescence upon environment, four single Trp substitutions were made in the N-terminal strand, and changes in solvent exposure during aggregation were evaluated by acrylamide-quenching. The results suggest that the N-terminal strand is buried in the fibrillar state of 6aJL2 protein. This finding suggest a possible explanation for the modulating effect exerted by the mutations in this strand on the aggregation behavior of 6aJL2 protein.

  11. Space Charge Mitigation With Longitudinally Hollow Bunches

    CERN Multimedia

    Oeftiger, Adrian; Rumolo, Giovanni

    2016-01-01

    Hollow longitudinal phase space distributions have a flat profile and hence reduce the impact of transverse space charge. Dipolar parametric excitation with the phase loop feedback systems provides such hollow distributions under reproducible conditions. We present a procedure to create hollow bunches during the acceleration ramp of CERN’s PS Booster machine with minimal changes to the operational cycle. The improvements during the injection plateau of the downstream Proton Synchrotron are assessed in comparison to standard parabolic bunches.

  12. Method to fabricate hollow microneedle arrays

    Energy Technology Data Exchange (ETDEWEB)

    Kravitz, Stanley H [Placitas, NM; Ingersoll, David [Albuquerque, NM; Schmidt, Carrie [Los Lunas, NM; Flemming, Jeb [Albuquerque, NM

    2006-11-07

    An inexpensive and rapid method for fabricating arrays of hollow microneedles uses a photoetchable glass. Furthermore, the glass hollow microneedle array can be used to form a negative mold for replicating microneedles in biocompatible polymers or metals. These microneedle arrays can be used to extract fluids from plants or animals. Glucose transport through these hollow microneedles arrays has been found to be orders of magnitude more rapid than natural diffusion.

  13. Space charge mitigation with longitudinally hollow bunches

    CERN Document Server

    AUTHOR|(CDS)2088716; Hancock, Steven; Rumolo, Giovanni; CERN. Geneva. ATS Department

    2016-01-01

    Suitably, hollow longitudinal phase space distributions have a flat profile and hence reduce the impact of transverse space charge. Dipolar parametric excitation with the phase loop feedback systems provides such hollow distributions under reproducible conditions. We present a procedure to create hollow bunches during the acceleration ramp of CERN’s PS Booster machine with minimal changes to the operational cycle. The improvements during the injection plateau of the downstream Proton Synchrotron are assessed in comparison to standard parabolic bunches.

  14. Improved Rare-Earth Emitter Hollow Cathode

    Science.gov (United States)

    Goebel, Dan M.

    2011-01-01

    An improvement has been made to the design of the hollow cathode geometry that was created for the rare-earth electron emitter described in Compact Rare Earth Emitter Hollow Cathode (NPO-44923), NASA Tech Briefs, Vol. 34, No. 3 (March 2010), p. 52. The original interior assembly was made entirely of graphite in order to be compatible with the LaB6 material, which cannot be touched by metals during operation due to boron diffusion causing embrittlement issues in high-temperature refractory materials. Also, the graphite tube was difficult to machine and was subject to vibration-induced fracturing. This innovation replaces the graphite tube with one made out of refractory metal that is relatively easy to manufacture. The cathode support tube is made of molybdenum or molybdenum-rhenium. This material is easily gun-bored to near the tolerances required, and finish machined with steps at each end that capture the orifice plate and the mounting flange. This provides the manufacturability and robustness needed for flight applications, and eliminates the need for expensive e-beam welding used in prior cathodes. The LaB6 insert is protected from direct contact with the refractory metal tube by thin, graphite sleeves in a cup-arrangement around the ends of the insert. The sleeves, insert, and orifice plate are held in place by a ceramic spacer and tungsten spring inserted inside the tube. To heat the cathode, an insulating tube is slipped around the refractory metal hollow tube, which can be made of high-temperature materials like boron nitride or aluminum nitride. A screw-shaped slot, or series of slots, is machined in the outside of the ceramic tube to constrain a refractory metal wire wound inside the slot that is used as the heater. The screw slot can hold a single heater wire that is then connected to the front of the cathode tube by tack-welding to complete the electrical circuit, or it can be a double slot that takes a bifilar wound heater with both leads coming out

  15. Short Communication A near mass stranding of cetaceans in St ...

    African Journals Online (AJOL)

    A group of 70 false killer whales Pseudorca crassidens and 124 bottlenose dolphins Tursiops sp., and a separate group of 13 Risso's dolphins Grampus griseus, assembled close inshore off a known mass-stranding site in St Helena Bay, South Africa, in October 2003. However, only a single Risso's dolphin attempted to ...

  16. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    DNA to single-stranded DNA. The GO/dsDNA hydrogels have shown controlled porosity by changing the concentration of the components. The strong binding between dsDNA and graphene is proved by Raman spectroscopy. Keywords. Graphene oxide; DNA; hydrogels; liquid crystals; self-assembly. 1. Introduction.

  17. Nick-initiated homologous recombination: Protecting the genome, one strand at a time

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Krawczyk, Przemek M.

    2017-01-01

    Homologous recombination (HR) is an essential, widely conserved mechanism that utilizes a template for accurate repair of DNA breaks. Some early HR models, developed over five decades ago, anticipated single-strand breaks (nicks) as initiating lesions. Subsequent studies favored a more double-strand

  18. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections...

  19. Interactions between Cytochrome c and DNA Strands Self-Assembled at Gold Electrode

    Science.gov (United States)

    Lao, Ruojun; Wang, Lihua; Wan, Ying; Zhang, Jiong; Song, Shiping; Zhang, Zhizhou; Fan, Chunhai; He, Lin

    2007-01-01

    In this work, we reported the investigation on the interaction between DNA strands self-assembled at gold electrodes and an electron transfer protein, cytochrome c. We observed that cytochrome c exhibited well-defined electrochemistry in both double-stranded and single-stranded DNA films. This suggested that the electron transfer reaction of cytochrome c arose possibly due to the electron hopping along DNA strands rather than wiring along the double helix. We also compared the heterogeneous electron transfer rate of cytochrome c with that of a ruthenium complex, which further confirmed this mechanism.

  20. Block copolymer/homopolymer dual-layer hollow fiber membranes

    KAUST Repository

    Hilke, Roland

    2014-12-01

    We manufactured the first time block copolymer dual-layer hollow fiber membranes and dual layer flat sheet membranes manufactured by double solution casting and phase inversion in water. The support porous layer was based on polystyrene and the selective layer with isopores was formed by micelle assembly of polystyrene-. b-poly-4-vinyl pyridine. The dual layers had an excellent interfacial adhesion and pore interconnectivity. The dual membranes showed pH response behavior like single layer block copolymer membranes with a low flux for pH values less than 3, a fast increase between pH4 and pH6 and a constant high flux level for pH values above 7. The dry/wet spinning process was optimized to produce dual layer hollow fiber membranes with polystyrene internal support layer and a shell block copolymer selective layer.

  1. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts.

    Science.gov (United States)

    Grant, Rachel A; Savirina, Anna; Hoppitt, Will

    2018-01-26

    The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  2. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    Science.gov (United States)

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis.

  3. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts

    Directory of Open Access Journals (Sweden)

    Rachel A. Grant

    2018-01-01

    Full Text Available The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  4. Hollow nanocrystals and method of making

    Science.gov (United States)

    Alivisatos, A Paul [Oakland, CA; Yin, Yadong [Moreno Valley, CA; Erdonmez, Can Kerem [Berkeley, CA

    2011-07-05

    Described herein are hollow nanocrystals having various shapes that can be produced by a simple chemical process. The hollow nanocrystals described herein may have a shell as thin as 0.5 nm and outside diameters that can be controlled by the process of making.

  5. Genetic transformation of Neisseria gonorrhoeae shows a strand preference

    OpenAIRE

    Duffin, Paul M.; Seifert, H. Steven

    2012-01-01

    Natural transformation is the main means of horizontal genetic exchange in the obligate human pathogen Neisseria gonorrhoeae. Neisseria spp. have been shown to preferentially take up and transform their own DNA by recognizing a non-palindromic 10 or 12 nucleotide DNA uptake sequence (DUS10 or DUS12). We investigated the ability of the DUS12 to enhance single-stranded DNA (ssDNA) transformation. Given the non-palindromic nature of the DUS12, we tested whether both strands of the DUS equally en...

  6. Theoretical studies of hollow electron temperature profiles

    International Nuclear Information System (INIS)

    Werkoff, F.; Mercier, C.; Cissoko, G.

    1978-06-01

    The basic mechanisms of experimentally obtained hollow profiles of electron temperature have been investigated. These hollow profiles are obviously related to radiative losses at the center of the plasma, losses that are greater than Joule heating. Hollow profiles were numerically and analytically shown to be instable of the MHD point of view, when the heat diffusion coefficient of electrons is too small. Taking Ksub(e) high enough to satisfy the stability criterion, steady states were obtained in agreement with experimental results. The impurities at the center of the plasma were also shown to be far from the coronal equilibrium. Accoding to neo-classical laws, this discrepancy entails the impurity accumulation at the plasma center, in correlation with an adequately hollow Tsub(e) profile. It was also proved that, at least in a certain range of parameters, the initial conditions can be chosen so as to obtain either a steady peaked state or a steady hollow state [fr

  7. Electro-magnetic properties of composites with aligned Fe-Co hollow fibers

    Directory of Open Access Journals (Sweden)

    Seungchan Cho

    2016-05-01

    Full Text Available A novel Fe-Co binary hollow fiber was synthesized by electroless plating using hydrolyzed polyester fiber and its anisotropy characteristic was investigated for electromagnetic wave absorbing materials. The hollow fibers in parallel with magnetic field show higher saturated magnetization of 202 emu/g at the applied magnetic field of 10 kOe and lower coercivity (27.658 Oe, compared with the random and vertical oriented hollow fibers. From complex permittivity measurement, the Fe-Co hollow fiber composites clearly display a single dielectric resonance, located at ∼14 GHz. The Fe-Co hollow fibers not only provide excellent EM properties in GHz frequency ranges, resulting mainly from the strong resonance, but also adjust the soft magnetic properties through fiber alignments. The cavitary structure of the Fe-Co hollow fibers, not only giving rise to a dielectric loss resonance and also adjusting its peak frequency, may be a pathway to useful EM wave absorptive devices in GHz frequency ranges.

  8. Methodology for construction of hollow spheres for use in physical phantoms

    International Nuclear Information System (INIS)

    Oliveira, A.C.H.; Lima, F.R.A.; Oliveira, F.; Vieira, J.W.

    2015-01-01

    In positron emission tomography (PET), quantitative evaluation of spatial resolution/object size, attenuation and scatter effects is often performed using phantoms with hollow spheres. Fillable, plastic-walled spheres are commercially available in several sizes. Radioactive solutions in any concentration can be injected into the spheres. Hollow spheres have several desirable traits, including repeatable, consistent use, and standardization across measurements at different institutions, since identical items are distributed by a single manufacturer. The objective of this work is to describe a methodology for construction of hollow spheres using rapid prototyping. It was used the software SolidWork (2014) to create five 3D models of the hollow spheres with inner diameters of 10 mm, 13 mm, 17 mm, 22 mm, and 28 mm. These models were based on hollow spheres of NEMA/IEC PET body phantom. It was used a Cubex Duo 3D printer (3D Systems) to build the hollow spheres. The material used was the ABS (acrylonitrile butadiene styrene) resin. (authors)

  9. Construction of anatase/rutile TiO2 hollow boxes for highly efficient photocatalytic performance

    Science.gov (United States)

    Jia, Changchao; Zhang, Xiao; Yang, Ping

    2018-02-01

    Hollow TiO2 hierarchical boxes with suitable anatase and rutile ratios were designed for photocatalysis. The unique hierarchical structure was fabricated via a Topotactic synthetic method. CaTiO3 cubes were acted as the sacrificial templates to create TiO2 hollow hierarchical boxes with well-defined phase distribution. The phase composition of the hollow TiO2 hierarchical boxes is similar to that of TiO2 P25 nanoparticles (∼80% anatase, and 20% rutile). Compared with nanaoparticles, TiO2 hollow boxes with hierarchical structures exhibited an excellent performance in the photocatalytic degradation of methylene blue organic pollutant. Quantificationally, the degradation rate of the hollow boxes is higher than that of TiO2 P25 nanoparticles by a factor of 2.7. This is ascribed that hollow structure provide an opportunity for using incident light more efficiently. The surface hierarchical and well-organized porous structures are beneficial to supply more active sites and enough transport channels for reactant molecules. The boxes consist of single crystal anatase and rutile combined well with each other, which gives photon-generated carriers transfer efficiently.

  10. DNA turnover and strand breaks in Escherichia coli

    International Nuclear Information System (INIS)

    Hanawalt, P.; Grivell, A.; Nakayama, H.

    1975-01-01

    The extent of DNA turnover has been measured in a dnaB mutant of Escherichia coli, temperature sensitive for semiconservative DNA replication. At the nonpermissive temperature about 0.02 percent of the deoxynucleotides in DNA are exchanged per generation period. This turnover rate is markedly depressed in the presence of rifampicin. During thymine starvation strand breaks accumulate in the DNA of E. coli strains that are susceptible to thymineless death. Rifampicin suppresses the appearance of these breaks, consistent with our hypothesis that transcription may be accompanied by repairable single-strand breaks in DNA. DNA turnover is enhanced severalfold in strands containing 5-bromodeoxyuridine in place of thymidine, possibly because the analog (or the deoxyuridine, following debromination) is sometimes recognized and excised

  11. Comparison of the electrophoretic method with the sedimentation method for the analysis of DNA strand breaks

    International Nuclear Information System (INIS)

    Yamamoto, Osamu; Ogawa, Masaaki; Hoshi, Masaharu

    1982-01-01

    Application of electrophoresis to the analysis of DNA strand breaks was studied comparing with the sedimentation analysis. A BRL gel electrophoresis system (Type V16) was used for this study. Calf thymus DNA (1 mg/ml) irradiated with 60 Co gamma-rays in SSC solution was applied to both the electrophoretic analysis and the sedimentation analysis. Lamda phage DNA and its fragments were employed as the standard size molecules. In a range from 1 k base pairs to 6 k base pairs in length for double stranded DNA or from 2 k bases to 12 k bases for single stranded DNA, the calculated average molecular weight from the electrophoresis coincided with that from the sedimentation. Number of single strand breaks and double strand breaks were 1.34 x 10 11 breaks/mg/rad (G = 0.215) and 0.48 x 10 5 breaks/mg/rad 2 , respectively. (author)

  12. Breaking the glass ceiling: hollow OmniGuide fibers

    Science.gov (United States)

    Johnson, Steven G.; Ibanescu, Mihai; Skorobogatiy, Maksim A.; Weisberg, Ori; Engeness, Torkel D.; Soljacic, Marin; Jacobs, Steven A.; Joannopoulos, John D.; Fink, Yoel

    2002-04-01

    We argue that OmniGuide fibers, which guide light within a hollow core by concentric multilayer films having the property of omnidirectional reflection, have the potential to lift several physical limitations of silica fibers. We show how the strong confinement in OmniGuide fibers greatly suppresses the properties of the cladding materials: even if highly lossy and nonlinear materials are employed, both the intrinsic losses and nonlinearities of silica fibers can be surpassed by orders of magnitude. This feat, impossible to duplicate in an index-guided fiber with existing materials, would open up new regimes for long-distance propagation and dense wavelength-division multiplexing (DWDM). The OmniGuide-fiber modes bear a strong analogy to those of hollow metallic waveguides; from this analogy, we are able to derive several general scaling laws with core radius. Moreover, there is strong loss discrimination between guided modes, depending upon their degree of confinement in the hollow core: this allows large, ostensibly multi-mode cores to be used, with the lowest-loss TE01 mode propagating in an effectively single-mode fashion. Finally, because this TE01 mode is a cylindrically symmetrical ('azimuthally' polarized) singlet state, it is immune to polarization-mode dispersion (PMD), unlike the doubly-degenerate linearly-polarized modes in silica fibers that are vulnerable to birefringence.

  13. Hollow Micro-/Nanostructures: Synthesis and Applications

    KAUST Repository

    Lou, Xiong Wen (David)

    2008-11-03

    Hollow micro-nanostructures are of great interest in many current and emerging areas of technology. Perhaps the best-known example of the former is the use of fly-ash hollow particles generated from coal power plants as partial replacement for Portland cement, to produce concrete with enhanced strength and durability. This review is devoted to the progress made in the last decade in synthesis and applications of hollow micro-nanostructures. We present a comprehensive overview of synthetic strategies for hollow structures. These strategies are broadly categorized into four themes, which include well-established approaches, such as conventional hard-templating and soft-templating methods, as well as newly emerging methods based on sacrificial templating and template-free synthesis. Success in each has inspired multiple variations that continue to drive the rapid evolution of the field. The Review therefore focuses on the fundamentals of each process, pointing out advantages and disadvantages where appropriate. Strategies for generating more complex hollow structures, such as rattle-type and nonspherical hollow structures, are also discussed. Applications of hollow structures in lithium batteries, catalysis and sensing, and biomedical applications are reviewed. © 2008 WILEY-VCH Verlag GmbH & Co. KGaA,.

  14. Radioresistance of GGG sequences to prompt strand break formation from direct-type radiation damage.

    Science.gov (United States)

    Black, Paul J; Miller, Adam S; Hayes, Jeffrey J

    2016-11-01

    As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work, we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single-strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation.

  15. Method for producing small hollow spheres

    International Nuclear Information System (INIS)

    Hendricks, C.D.

    1979-01-01

    A method is described for producing small hollow spheres of glass, metal or plastic, wherein the sphere material is mixed with or contains as part of the composition a blowing agent which decomposes at high temperature (T >approx. 600 0 C). As the temperature is quickly raised, the blowing agent decomposes and the resulting gas expands from within, thus forming a hollow sphere of controllable thickness. The thus produced hollow spheres (20 to 10 3 μm) have a variety of application, and are particularly useful in the fabrication of targets for laser implosion such as neutron sources, laser fusion physics studies, and laser initiated fusion power plants

  16. Double-Strand DNA Break Repair in Mycobacteria.

    Science.gov (United States)

    Glickman, Michael S

    2014-10-01

    Discontinuity of both strands of the chromosome is a lethal event in all living organisms because it compromises chromosome replication. As such, a diversity of DNA repair systems has evolved to repair double-strand DNA breaks (DSBs). In part, this diversity of DSB repair systems has evolved to repair breaks that arise in diverse physiologic circumstances or sequence contexts, including cellular states of nonreplication or breaks that arise between repeats. Mycobacteria elaborate a set of three genetically distinct DNA repair pathways: homologous recombination, nonhomologous end joining, and single-strand annealing. As such, mycobacterial DSB repair diverges substantially from the standard model of prokaryotic DSB repair and represents an attractive new model system. In addition, the presence in mycobacteria of a DSB repair system that can repair DSBs in nonreplicating cells (nonhomologous end joining) or when DSBs arise between repeats (single-strand annealing) has clear potential relevance to Mycobacterium tuberculosis pathogenesis, although the exact role of these systems in M. tuberculosis pathogenesis is still being elucidated. In this article we will review the genetics of mycobacterial DSB repair systems, focusing on recent insights.

  17. Metallic double shell hollow nanocages: the challenges of their synthetic techniques.

    Science.gov (United States)

    Mahmoud, M A; El-Sayed, M A

    2012-03-06

    Hollow metallic nanoparticles have been attracting the attention of many researchers in the past five years due to their new properties and potential applications. The unique structure of the hollow nanoparticles; presence of two surfaces (internal and external), and the presence of both cavities and pores in the wall surfaces of these nanoparticles are responsible for their unique properties and applications. Here the galvanic replacement technique is used to prepare nanocages made of gold, platinum, and palladium. In addition, hollow double shell nanoparticles are made of two metal shells like Au-Pt, Pt-Au, Au-Pd, Pd-Au, Pd-Pt, and Pt-Pd. Silver nanocubes are used as templates during the synthesis of hollow nanoparticles with single metal shell or double shell nanocages. Most of the problems that could affect the synthesis of solid Silver nanocubes used as template as well as the double shell nanocages and their possible solutions are discussed in a detail. The sizes and shapes of the single-shell and double-shell nanocages were characterized by a regular and high-resolution TEM. A SEM mapping technique is also used to image the surface atoms for the double shell hollow nanoparticles in order to determine the thickness of the two metal shells. In addition, optical studies are used to monitor the effect of the dielectric properties of the other metals on the plasmonic properties of the gold nanoshell in these mixed nanoparticles.

  18. optimizing compressive strength characteristics of hollow building

    African Journals Online (AJOL)

    eobe

    mm2. ... is suggested therefore, that the optimum replacement of sand with granite quarry dust as fine aggregates should be. 15% of the ... Keywords: Keywords: hollow building Blocks, granite dust, sand, partial replacement, compressive strength.

  19. Hydrometallurgical minor actinide separation in hollow fiber modules

    International Nuclear Information System (INIS)

    Geist, A.; Weigl, M.; Gompper, K.

    2004-01-01

    Hollow fiber modules (HFM) were used as phase contacting devices for hydrometallurgical minor actinide separation in the Partitioning and Transmutation context. Two single-HFM setups, one using commercially available HFM, the other one using miniature HFM, have been developed and manufactured. Several very successful DIAMEX and SANEX once-through tests were performed. The major advantage of the new miniature HFM is their size drastically reducing chemicals consumption: only several 10 mL of feed phases are required for a test. (authors)

  20. Physics of hollow Bose-Einstein condensates

    OpenAIRE

    Padavić, Karmela; Sun, Kuei; Lannert, Courtney; Vishveshwara, Smitha

    2016-01-01

    Bose-Einstein condensate shells, while occurring in ultracold systems of coexisting phases and potentially within neutron stars, have yet to be realized in isolation on Earth due to the experimental challenge of overcoming gravitational sag. Motivated by the expected realization of hollow condensates by the space-based Cold Atomic Laboratory in microgravity conditions, we study a spherical condensate undergoing a topological change from a filled sphere to a hollow shell. We argue that the col...

  1. Adiabatic Rearrangement of Hollow PV Towers

    OpenAIRE

    Eric A Hendricks; Wayne H Schubert

    2010-01-01

    Diabatic heating from deep moist convection in the hurricane eyewall produces a towering annular structure of elevated potential vorticity (PV). This structure has been referred to as a hollow PV tower. The sign reversal of the radial gradient of PV satisfies the Charney-Stern necessary condition for combined barotropic-baroclinic instability. For thin enough annular structures, small perturbations grow exponentially, extract energy from the mean flow, and lead to hollow tower breakdown, with...

  2. Magnetization Losses of Roebel Cable Samples with 2G YBCO Coated Conductor Strands

    CERN Document Server

    Yang, Y.; Falorio, I.; Young, E.A.; Kario, A.; Goldacker, W.; Dhallé, M. M. J.; van Nugteren, J.; Kirby, G.; Bottura, L.; Ballarino, A.

    2016-01-01

    Roebel cable with 2G YBCO strands is one of the promising HTS solutions of fully transposed high current conductors for high field accelerator magnets. Following the considerable research effort on the manufacturing of Roebel cables in recent years, sample conductors are now available in useful lengths with reproducible performances to allow detailed characterizations beyond the standard critical current measurements. The ac loss and strands coupling are of significant interest for the field quality of the accelerator magnets. We report a set of systematic ac loss measurements on two different Roebel cable samples prepared for the EuCARD2 collaboration. The measurements were performed over a wide range of temperature between 5 K and 90 K and the results were analyzed in the context of strands architecture and coupling. The results show that the transposed bundles are partially decoupled and the strands in transposition sections behave as an isolated single tape if the strands are insulated.

  3. Synthesis of highly monodispersed Ga-soc-MOF hollow cubes, colloidosomes and nanocomposites

    KAUST Repository

    Cai, Xuechao

    2016-07-06

    Ga-soc-MOF hollow cubes with an average size of about 300 nm were prepared by a polyvinylpyrrolidone (PVP) assisted acid etching process. Colloidosomes with sizes of around 5-10 mu m composed of single-layer tetrakaidecahedron building blocks (BBs) were synthesized for the first time. Au@Ga-soc-MOF nanocomposites with excellent catalytic properties were obtained.

  4. Air gap membrane distillation. 2. Model validation and hollow fibre module performance analysis

    NARCIS (Netherlands)

    Guijt, C.M.; Meindersma, G.W.; Reith, T.; de Haan, A.B.

    2005-01-01

    In this paper the experimental results of counter current flow air gap membrane distillation experiments are presented and compared with predictive model calculations. Measurements were carried out with a cylindrical test module containing a single hollow fibre membrane in the centre and a

  5. Marine Mammals Ashore: A Field Guide for Strandings. Second Edition

    Science.gov (United States)

    2005-01-01

    particularly gillnets, has driven the vaquita to critically low numbers and is a serious threat to other porpoise species throughout their range~ ...... For the... vaquita , as well as all baleen whales except minke, Bryde’s, and gray whales, are also listed under the Endangered Species Act. Stranding response to...Habits: Coastal in bays, estuaries and rivers; frequent offshore banks; weaning at 8-12 months; occur singly, in pairs, or in small groups. Vaquita

  6. Hollow Au-Ag Nanoparticles Labeled Immunochromatography Strip for Highly Sensitive Detection of Clenbuterol

    Science.gov (United States)

    Wang, Jingyun; Zhang, Lei; Huang, Youju; Dandapat, Anirban; Dai, Liwei; Zhang, Ganggang; Lu, Xuefei; Zhang, Jiawei; Lai, Weihua; Chen, Tao

    2017-01-01

    The probe materials play a significant role in improving the detection efficiency and sensitivity of lateral-flow immunochromatographic test strip (ICTS). Unlike conventional ICTS assay usually uses single-component, solid gold nanoparticles as labeled probes, in our present study, a bimetallic, hollow Au-Ag nanoparticles (NPs) labeled ICTS was successfully developed for the detection of clenbuterol (CLE). The hollow Au-Ag NPs with different Au/Ag mole ratio and tunable size were synthesized by varying the volume ratio of [HAuCl4]:[Ag NPs] via the galvanic replacement reaction. The surface of hollow Ag-Au NPs was functionalized with 11-mercaptoundecanoic acid (MUA) for further covalently bonded with anti-CLE monoclonal antibody. Overall size of the Au-Ag NPs, size of the holes within individual NPs and also Au/Ag mole ratio have been systematically optimized to amplify both the visual inspection signals and the quantitative data. The sensitivity of optimized hollow Au-Ag NPs probes has been achieved even as low as 2 ppb in a short time (within 15 min), which is superior over the detection performance of conventional test strip using Au NPs. The optimized hollow Au-Ag NPs labeled test strip can be used as an ideal candidate for the rapid screening of CLE in food samples.

  7. Multifunctional PNIPAM/Fe3O4-ZnS hybrid hollow spheres: synthesis, characterization, and properties.

    Science.gov (United States)

    Liu, Ge; Hu, Dan; Chen, Min; Wang, Changchun; Wu, Limin

    2013-05-01

    Multifunctional PNIPAM/Fe3O4-ZnS hybrid hollow spheres integrating magnetism, luminescence, and temperature responses into one single entity have been successfully fabricated via a facile method. First, the cross-linked Poly (N-isopropylacrylamide) (PNIPAM) hollow spheres were synthesized via a classical method, named one-pot "self-removing" process. Then, Fe3O4 and ZnS nanoparticles were in situ precipitated on the surface of the PNIPAM hollow spheres. The PNIPAM/Fe3O4-ZnS hybrid hollow spheres exhibit magnetic property, which indicates the potential application in drug targeting. In addition, ZnS nanoparticles in the shell play an important role as a luminescent label for tracking the drug delivery. Meanwhile, the existence of PNIPAM provides a thermosensitive property. All these results indicate that the obtained composite can be expected to be used as a smart drug delivery material. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Hollow Nanotubes of N-Doped Carbon on CoS.

    Science.gov (United States)

    Chen, Yuming; Li, Xiaoyan; Park, Kyusung; Zhou, Limin; Huang, Haitao; Mai, Yiu-Wing; Goodenough, John B

    2016-12-19

    Low-cost, single-step synthesis of hollow nanotubes of N-doped carbon deposited on CoS is enabled by the simultaneous use of three functionalities of polyacrylonitrite (PAN) nanofibers: 1) a substrate for loading active materials, 2) a sacrificial template for creating hollow tubular structures, and 3) a precursor for in situ nitrogen doping. The N-doped carbon in hollow tubes of CoS provides a high-capacity anode of long cycle life for a rechargeable Li-ion or Na-ion battery cell that undergoes the conversion reaction 2 A + +2 e - +CoS →Co+A 2 S with A=Li or Na. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. NiPt hollow nanocatalyst: Green synthesis, size control and electrocatalysis

    Directory of Open Access Journals (Sweden)

    Aixian Shan

    2014-04-01

    Full Text Available Nearly monodispersed hollow nanospheres of bimetallic NiPt have been synthesized by a one-pot wet chemical method at room temperature with a precursor Ni nanocompound as a sacrificial template. The size control is carried out via the sacrificial template, from about 35 nm to nearly 100 nm in diameter. The shell thickness of the NiPt hollow sphere reaches down to as thin as 2–3 nm slightly larger than a single layer of alloyed NiPt nanocrystallites. The product with the citric acid as surfactant exhibits enhanced oxygen reduction activities compared to a commercial Pt/C catalyst and the hollow nanospheres coated with PVP. It has potential applications in fuel cells, biotechnology and environmental chemistry with the facile synthesis, low cost and excellent electrocatalytic activity.

  10. Kerr Hollow Quarry Remediation Project

    International Nuclear Information System (INIS)

    Walker, K.L.

    1993-01-01

    The Kerr Hollow Quarry is a 3-acre flooded limestone quarry located near the Y-12 Facility on the Oak Ridge Reservation. The quarry was used in the 1940s as a source of construction material for the Department of Energy in Oak Ridge, Tennessee. Its use was discontinued in the early 1950s, and it was allowed to flood with water. The quarry presently has a maximum water depth of approximately 55 ft. During the period between the early 1950s until about 1988, the quarry was used for the treatment and disposal of a variety of materials including water-reactive, alkali metals, shock-sensitive chemicals, and compressed gas cylinders. For some of these materials, the treatment consisted of dropping the vessels containing the materials into the quarry from a high bluff located on one side of the quarry. The vessels were then punctured by gun shot, and the materials were allowed to react with the water and sink to the bottom of the quarry. Very few disposal records exist for the period from 1952 to 1962. The records after that time, from 1962 until 1988, indicate some 50 t of hazardous and nonhazardous materials were disposed of in the quarry. This report documents remediation efforts that have taken place at the quarry beginning in September 1990

  11. THE THREE-STRANDED CORD

    Directory of Open Access Journals (Sweden)

    Walter Redmond

    2013-11-01

    Full Text Available The Schoolmen did much of their most interesting and original philosophizing in theology. An example is the dilemma in Renaissance Scholasticism on free will: how can we act freely if God causes and knows our actions? Basic issues are involved here: the antinomy between freedom and determination, modal semantics, tense logic, the logical status of counterfacts. Mexican Jesuits Matías Blanco (d. 1734 and Antonio Peralta (d. 1736 wrote books on the subject. We describe here the “disjunctive” solution that Blanco advanced in his Funiculus triplex (The Three-Stranded Cord, published posthumously in Mexico in 1746. When someone is faced with choosing between B and C, conjectures Blanco, God does not actualize either, but rather their disjunction B-or-C. Blanco calls for a truce in the “war” among the contending schools so that they may consider his solution–for he thinks it may indeed be acceptable to all.

  12. Control of contact resistance by strand surface coating in 36-strands NbTi CICC's

    NARCIS (Netherlands)

    Nijhuis, Arend; ten Kate, Herman H.J.; Duchateau, Jean-Luc; Decool, Patrick

    2001-01-01

    The stability and AC loss of NbTi cable-in-conduit conductors (CICCs) is largely determined by the interstrand contact resistance (Rc). Rc is predominantly established by the strand surface properties. Five 36-strand CICCs, fully identical except for the plating of the strand surface or the presence

  13. Enzymatic quantification of strand breaks of DNA induced by vacuum-UV radiation

    International Nuclear Information System (INIS)

    Ito, Takashi

    1986-01-01

    Hind3 digested plasmid DNA dried on an aluminum plate was irradiated by vacuum-UV at 160 and 195 nm using a synchrotron irradiation system. A change induced in the DNA, presumably a single strand break, was quantified by the aid of the strand break-derived stimulation of poly(ADP-ribose) synthetase activity. The end group of strand breaks so induced was recognized by the enzyme as effectively as that by DNase 1 treatment, suggesting a nicking as the major lesion inflicted on the DNA. The fluence (UV) dependent stimulation of poly(ADP-ribose) synthetase activity was much higher upon 160 nm irradiation than upon 195 nm irradiation. (Auth.)

  14. Physics of hollow Bose-Einstein condensates

    Science.gov (United States)

    Padavić, Karmela; Sun, Kuei; Lannert, Courtney; Vishveshwara, Smitha

    2017-10-01

    Bose-Einstein condensate shells, while occurring in ultracold systems of coexisting phases and potentially within neutron stars, have yet to be realized in isolation on Earth due to the experimental challenge of overcoming gravitational sag. Motivated by the expected realization of hollow condensates by the space-based Cold Atomic Laboratory in microgravity conditions, we study a spherical condensate undergoing a topological change from a filled sphere to a hollow shell. We argue that the collective modes of the system show marked and robust signatures of this hollowing transition accompanied by the appearance of a new boundary. In particular, we demonstrate that the frequency spectrum of the breathing modes shows a pronounced depression as it evolves from the filled-sphere limit to the hollowing transition. Furthermore, when the center of the system becomes hollow surface modes show a global restructuring of their spectrum due to the availability of a new, inner, surface for supporting density distortions. We pinpoint universal features of this topological transition as well as analyse the spectral evolution of collective modes in the experimentally relevant case of a bubble-trap.

  15. Distinct genetic control of homologous recombination repair of Cas9-induced double-strand breaks, nicks and paired nicks

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Prakash, Rohit; Chen, Chun-Chin; Vanoli, Fabio; Cavallo, Francesca; Zhang, Yu; Jasin, Maria; Krawczyk, Przemek M.

    2016-01-01

    DNA double-strand breaks (DSBs) are known to be powerful inducers of homologous recombination (HR), but single-strand breaks (nicks) have also been shown to trigger HR. Both DSB- and nick-induced HR ((nick)HR) are exploited in advanced genome-engineering approaches based on the bacterial RNA-guided

  16. Unraveling the strands of Saturn's F ring

    Science.gov (United States)

    Murray, C.D.; Gordon, M.K.; Giuliatti, Winter S.M.

    1997-01-01

    Several high-resolution Voyager 2 images of Saturn's F ring show that it is composed of at least four separate, non-intersecting strands extending ~45?? in longitude. Voyager 1 images show that the two brightest strands appear to intersect, giving rise to a "braided" morphology. From a study of all available Voyager images the detectable radial structure is cataloged and reviewed. Previous indications that there is fine material interior to the orbit of the F ring are confirmed. Evidence is presented that a model of four strands with comparable eccentricities and nearly aligned perichrones is consistent with all the Voyager observations. The observed perichrone offset of the two brightest strands suggests a minimum radial separation of ~20 km, which implies intersection of these strands when their finite radial widths are taken into account. The longitude range of such an intersection includes that observed in the Voyager 1 "braid" images. The proximity of these two strands at some longitudes may account for the apparent differences in the ring between the Voyager encounters, as well as provide a source for the short-lived features detected in the Hubble Space Telescope images of the F ring. There is no evidence that the locations of the individual strands are determined by resonant perturbations with known satellites. It is proposed that the radial structure is formed by the localized action of small satellites orbiting within the strand region. ?? 1997 Academic Press.

  17. Breaking DNA strands by extreme-ultraviolet laser pulses in vacuum

    Czech Academy of Sciences Publication Activity Database

    Nováková, Eva; Vyšín, Luděk; Burian, Tomáš; Juha, Libor; Davídková, Marie; Múčka, V.; Čuba, V.; Grisham, M. E.; Heinbuch, S.; Rocca, J.J.

    2015-01-01

    Roč. 91, č. 4 (2015), "042718-1"-"042718-8" ISSN 1539-3755 R&D Projects: GA ČR(CZ) GBP108/12/G108; GA ČR GA13-28721S Institutional support: RVO:68378271 ; RVO:61389005 Keywords : XUV * DNA damages * single- strand breaks (SSBs) * double- strand breaks (DSBs) Subject RIV: BO - Biophysics Impact factor: 2.288, year: 2014

  18. Transmission properties of hollow-core photonic bandgap fibers

    DEFF Research Database (Denmark)

    Falk, Charlotte Ijeoma; Hald, Jan; Petersen, Jan C.

    2010-01-01

    Variations in optical transmission of four types of hollow-core photonic bandgap fibers are measured as a function of laser frequency. These variations influence the potential accuracy of gas sensors based on molecular spectroscopy in hollow-core fibers.......Variations in optical transmission of four types of hollow-core photonic bandgap fibers are measured as a function of laser frequency. These variations influence the potential accuracy of gas sensors based on molecular spectroscopy in hollow-core fibers....

  19. Adiabatic Rearrangement of Hollow PV Towers

    Directory of Open Access Journals (Sweden)

    Eric A Hendricks

    2010-10-01

    Full Text Available Diabatic heating from deep moist convection in the hurricane eyewall produces a towering annular structure of elevated potential vorticity (PV. This structure has been referred to as a hollow PV tower. The sign reversal of the radial gradient of PV satisfies the Charney-Stern necessary condition for combined barotropic-baroclinic instability. For thin enough annular structures, small perturbations grow exponentially, extract energy from the mean flow, and lead to hollow tower breakdown, with significant vortex structural and intensity change. The three-dimensional adiabatic rearrangements of two prototypical hurricane-like hollow PV towers (one thick and one thin are examined in an idealized framework. For both hollow towers, dynamic instability causes air parcels with high PV to be mixed into the eye preferentially at lower levels, where unstable PV wave growth rates are the largest. Little or no mixing is found to occur at upper levels. The mixing at lower and middle levels is most rapid for the breakdown of the thin hollow tower, consistent with previous barotropic results. For both hollow towers, this advective rearrangement of PV affects the tropical cyclone structure and intensity in a number of ways. First, the minimum central pressure and maximum azimuthal mean velocity simultaneously decrease, consistent with previous barotropic results. Secondly, isosurfaces of absolute angular momentum preferentially shift inward at low levels, implying an adiabatic mechanism by which hurricane eyewall tilt can form. Thirdly, a PV bridge, similar to that previously found in full-physics hurricane simulations, develops as a result of mixing at the isentropic levels where unstable PV waves grow most rapidly. Finally, the balanced mass field resulting from the PV rearrangement is warmer in the eye between 900 and 700 hPa. The location of this warming is consistent with observed warm anomalies in the eye, indicating that in certain instances the hurricane

  20. Relation between sedimentation behaviour of DNA-membrane complexes and DNA single- and double-strand breaks after irradiation with gamma-rays, pulse neutrons and 12C ions

    International Nuclear Information System (INIS)

    Erzgraber, G.; Lapidus, I.L.

    1985-01-01

    The experimental data on sedimentation behaviour of DNA-membrane complexes at radiation of the Chinese hamster cells (V79-4) in a wide dose range of 127 Cs γ-rays, pulse neutrons (reactor IBR-2, Laboratory of Neutron Physics, JINR, Dubna) are accelerated 12 C ions (cyclotron U-200, Laboratory of Nuclear Reactions, JINR, Dubna) are presented An assumption on the role of DNA single- and double-strend breaks in changing the sedimentation properties of DNA-membrane complexes has been confirmed by the experiments with radiation of different quality. The possibility of estimating induction and repair of DNA breaks on the basis of dependence of the relative sedimentation velocity of complexes on the irradiation does is discussed

  1. DNA strand breakage by 125I-decay in oligoDNA

    International Nuclear Information System (INIS)

    Lobachevsky, P.; Martin, R.F.

    1996-01-01

    Full text: A double-stranded oligodeoxynucleotide containing 125 I-dC in a defined location, with 5'- or 3'- 32 P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125 I decay. Samples of the 32 P-end-labelled and 125 I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32 P-end-labelled DNA fragments produced by 125 I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125 I decay event produces at least one break in the 125 I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125 I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125 I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125 I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125 I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25 I-decay, and may provide new mechanistic insights

  2. Hollow needle used to cut metal honeycomb structures

    Science.gov (United States)

    Gregg, E. A.

    1966-01-01

    Hollow needle tool cuts metal honeycomb structures without damaging adjacent material. The hollow needle combines an electrostatic discharge and a stream of oxygen at a common point to effect rapid, accurate metal cutting. The tool design can be varied to use the hollow needle principle for cutting a variety of shapes.

  3. Scaffold Characteristics for Functional Hollow Organ Regeneration

    Directory of Open Access Journals (Sweden)

    Daniel Eberli

    2010-01-01

    Full Text Available Many medical conditions require surgical reconstruction of hollow organs. Tissue engineering of organs and tissues is a promising new technique without harvest site morbidity. An ideal biomaterial should be biocompatible, support tissue formation and provide adequate structural support. It should degrade gradually and provide an environment allowing for cell-cell interaction, adhesion, proliferation, migration, and differentiation. Although tissue formation is feasible, functionality has never been demonstrated. Mainly the lack of proper innervation and vascularisation are hindering contractility and normal function. In this chapter we critically review the current state of engineering hollow organs with a special focus on innervation and vascularisation.

  4. Computational predictions of zinc oxide hollow structures

    Science.gov (United States)

    Tuoc, Vu Ngoc; Huan, Tran Doan; Thao, Nguyen Thi

    2018-03-01

    Nanoporous materials are emerging as potential candidates for a wide range of technological applications in environment, electronic, and optoelectronics, to name just a few. Within this active research area, experimental works are predominant while theoretical/computational prediction and study of these materials face some intrinsic challenges, one of them is how to predict porous structures. We propose a computationally and technically feasible approach for predicting zinc oxide structures with hollows at the nano scale. The designed zinc oxide hollow structures are studied with computations using the density functional tight binding and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications.

  5. Microfabricated hollow microneedle array using ICP etcher

    Science.gov (United States)

    Ji, Jing; Tay, Francis E. H.; Miao, Jianmin

    2006-04-01

    This paper presents a developed process for fabrication of hollow silicon microneedle arrays. The inner hollow hole and the fluidic reservoir are fabricated in deep reactive ion etching. The profile of outside needles is achieved by the developed fabrication process, which combined isotropic etching and anisotropic etching with inductively coupled plasma (ICP) etcher. Using the combination of SF6/O2 isotropic etching chemistry and Bosch process, the high aspect ratio 3D and high density microneedle arrays are fabricated. The generated needle external geometry can be controlled by etching variables in the isotropic and anisotropic cases.

  6. Microfabricated hollow microneedle array using ICP etcher

    International Nuclear Information System (INIS)

    Ji Jing; Tay, Francis E H; Miao Jianmin

    2006-01-01

    This paper presents a developed process for fabrication of hollow silicon microneedle arrays. The inner hollow hole and the fluidic reservoir are fabricated in deep reactive ion etching. The profile of outside needles is achieved by the developed fabrication process, which combined isotropic etching and anisotropic etching with inductively coupled plasma (ICP) etcher. Using the combination of SF 6 /O 2 isotropic etching chemistry and Bosch process, the high aspect ratio 3D and high density microneedle arrays are fabricated. The generated needle external geometry can be controlled by etching variables in the isotropic and anisotropic cases

  7. Microfabricated hollow microneedle array using ICP etcher

    Energy Technology Data Exchange (ETDEWEB)

    Ji Jing [Mechanical Engineering National University of Singapore, 119260, Singapore (Singapore); Tay, Francis E H [Mechanical Engineering National University of Singapore, 119260, Singapore (Singapore); Miao Jianmin [MicroMachines Center, School of Mechanical and Aerospace Engineering, Nanyang Technological University, 50 Nanyang Avenue, 639798 (Singapore)

    2006-04-01

    This paper presents a developed process for fabrication of hollow silicon microneedle arrays. The inner hollow hole and the fluidic reservoir are fabricated in deep reactive ion etching. The profile of outside needles is achieved by the developed fabrication process, which combined isotropic etching and anisotropic etching with inductively coupled plasma (ICP) etcher. Using the combination of SF{sub 6}/O{sub 2} isotropic etching chemistry and Bosch process, the high aspect ratio 3D and high density microneedle arrays are fabricated. The generated needle external geometry can be controlled by etching variables in the isotropic and anisotropic cases.

  8. Mass balancing of hollow fan blades

    Science.gov (United States)

    Kielb, R. E.

    1986-01-01

    A typical section model is used to analytically investigate the effect of mass balancing as applied to hollow, supersonic fan blades. A procedure to determine the best configuration of an internal balancing mass to provide flutter alleviation is developed. This procedure is applied to a typical supersonic shroudless fan blade which is unstable in both the solid configuration and when it is hollow with no balancing mass. The addition of an optimized balancing mass is shown to stabilize the blade at the design condition.

  9. Single-nucleotide polymorphisms in base excision repair, nucleotide excision repair, and double strand break genes as markers for response to radiotherapy in patients with Stage I to II head-and-neck cancer

    International Nuclear Information System (INIS)

    Carles, Joan; Monzo, Mariano; Amat, Marta; Jansa, Sonia; Artells, Rosa; Navarro, Alfons; Foro, Palmira; Alameda, Francesc; Gayete, Angel; Gel, Bernat; Miguel, Maribel; Albanell, Joan; Fabregat, Xavier

    2006-01-01

    Purpose: Polymorphisms in DNA repair genes can influence response to radiotherapy. We analyzed single-nucleotide polymorphisms (SNP) in nine DNA repair genes in 108 patients with head-and-neck cancer (HNSCC) who had received radiotherapy only. Methods and Materials: From May 1993 to December 2004, patients with Stage I and II histopathologically confirmed HNSCC underwent radiotherapy. DNA was obtained from paraffin-embedded tissue, and SNP analysis was performed using a real-time polymerase chain reaction allelic discrimination TaqMan assay with minor modifications. Results: Patients were 101 men (93.5%) and 7 (6.5%) women, with a median age of 64 years (range, 40 to 89 years). Of the patients, 76 (70.4%) patients were Stage I and 32 (29.6%) were Stage II. The XPF/ERCC1 SNP at codon 259 and XPG/ERCC5 at codon 46 emerged as significant predictors of progression (p 0.00005 and 0.049, respectively) and survival (p = 0.0089 and 0.0066, respectively). Similarly, when variant alleles of XPF/ERCC1, XPG/ERCC5 and XPA were examined in combination, a greater number of variant alleles was associated with shorter time to progression (p = 0.0003) and survival (p 0.0002). Conclusions: Genetic polymorphisms in XPF/ERCC1, XPG/ERCC5, and XPA may significantly influence response to radiotherapy; large studies are warranted to confirm their role in HNSCC

  10. 78 FR 60271 - Hollow Dam Power Company; Ampersand Hollow Dam Hydro, LLC; Notice of Application for Transfer of...

    Science.gov (United States)

    2013-10-01

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Project No. 6972-032] Hollow Dam Power Company; Ampersand Hollow Dam Hydro, LLC; Notice of Application for Transfer of License, and Soliciting Comments and Motions To Intervene On September 10, 2013, Hollow Dam Power Company (transferor) and...

  11. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    DEFF Research Database (Denmark)

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

    2016-01-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split......The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts...

  12. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.

    1983-01-01

    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  13. Radiation induced strand breaks and time scale for repair of broken strands in superinfecting phage lambda DNA in Escherichia coli lysogenic for lambda

    International Nuclear Information System (INIS)

    Johansen, I.; Boye, E.; Brustad, T.

    1975-01-01

    The production of the first radiation induced break in covalent lambda DNA molecules in pol + and pol A 1 lysogenic host cells was measured after exposure to electrons from a linear accelerator and transfer to alkaline detergent within 100 ms from the onset of irradiation. The results revealed the presence of an oxygen effect in DNA strand breakage. In both pol + and pol A 1 host cells the rate of production in nitrogen was 1.2x10 -12 DNA single strand breaks per rad per dalton as compared to 5x10 -12 in oxygen. The yields of strand breaks in lambda DNA in pol + host cells under oxygenated or anoxic conditions are independent of whether the cells are irradiated in buffer at room temperature, in buffer at ice temperature, or in growth medium at 37 0 C. These results indicate that enzymic repair of DNA strand breaks before analysis is insignificant in these experiments. The presence of an oxygen effect in DNA strand breakage under these conditions suggest that an actual difference exists between initial number of breaks produced in nitrogen and in oxygen. The kinetics of rejoining of broken molecules under optimal growth conditions was measured by incubating the irradiated host cells prior to lysis. In pol + host cells 50% of the lambda DNA molecules broken in presence of oxygen are rejoined within 10 to 20 seconds of incubation. A significantly lower recovery is seen in pol + host cells after irradiation in nitrogen. The rejoining of broken lambda DNA strands in pol A 1 host cells is impaired after irradiation in presence of oxygen as well as under anoxia. These results show that DNA polymerase I is needed for the rapid rejoining of radiation induced strand breaks in the DNA, and that oxygen promoted strand breaks are more easily rejoined than are those produced in nitrogen. (author)

  14. The Hollow Men: A Cautionary Tale.

    Science.gov (United States)

    Fruman, Norman

    1991-01-01

    A review of Charles Sykes' book "The Hollow Men: Politics and Corruption in Higher Education" focuses on the portion that chronicles the political history of Dartmouth College (New Hampshire) from 1769. It is found to be a comprehensive analysis of the college's decline resulting from a "radically politicized and…

  15. hollow fibre supported liquid membrane extraction of ...

    African Journals Online (AJOL)

    Preferred Customer

    ABSTRACT. ABSTRACT. A simple sample pre-treatment method utilizing hollow fibre supported liquid membrane. (HFSLM) was carried out on pharmaceuticals samples comprising of cough syrups (CS1 and CS2) and an anti- inflammatory product (AI). The active ingredients targeted in the extraction process were ...

  16. Electromagnetic and microwave absorbing properties of hollow ...

    Indian Academy of Sciences (India)

    Abstract. A mass of hollow carbon nanospheres (HCNSs) was fabricated by chemical vapour deposition of methane over Ni/Al2O3 catalyst at 600 ◦C. The products were characterized with high-resolution transmission elec- tron microscope images, and the results showed that the external diameter of the HCNSs was ...

  17. Hollow fibre supported liquid membrane extraction of ...

    African Journals Online (AJOL)

    A simple sample pre-treatment method utilizing hollow fibre supported liquid membrane (HFSLM) was carried out on pharmaceuticals samples comprising of cough syrups (CS1 and CS2) and an anti-inflammatory product (AI). The active ingredients targeted in the extraction process were diphenylhydramine (DPH), ...

  18. The Riddle of the Apparently Hollow Himalaya

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 3; Issue 1. The Riddle of the Apparently Hollow Himalaya. Ramesh Chander. General Article Volume 3 Issue 1 January 1998 pp 21- ... Author Affiliations. Ramesh Chander1. Department of Earth Sciences, University of Roorkee, Roorkee 247 667, India.

  19. Novel hollow all-carbon structures.

    Science.gov (United States)

    Sundholm, Dage; Wirz, Lukas N; Schwerdtfeger, Peter

    2015-10-14

    A new family of cavernous all-carbon structures is proposed. These molecular cage structures are constructed by edge subdivisions and leapfrog transformations from cubic polyhedra or their duals. The obtained structures were then optimized at the density functional level. These hollow carbon structures represent a new class of carbon allotropes which could lead to many interesting applications.

  20. Breaking DNA strands by extreme-ultraviolet laser pulses in vacuum

    Science.gov (United States)

    Nováková, Eva; Vyšín, Luděk; Burian, Tomáš; Juha, Libor; Davídková, Marie; Múčka, Viliam; Čuba, Václav; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.

    2015-04-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugars, and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. We have studied the nature of DNA damage induced directly by the pulsed 46.9-nm (26.5 eV) radiation provided by an extreme ultraviolet (XUV) capillary-discharge Ne-like Ar laser (CDL). Doses up to 45 kGy were delivered with a repetition rate of 3 Hz. We studied the dependence of the yield of SSBs and DSBs of a simple model of DNA molecule (pBR322) on the CDL pulse fluence. Agarose gel electrophoresis method was used for determination of both SSB and DSB yields. The action cross sections of the single- and double-strand breaks of pBR322 plasmid DNA in solid state were determined. We observed an increase in the efficiency of strand-break induction in the supercoiled DNA as a function of laser pulse fluence. Results are compared to those acquired at synchrotron radiation facilities and other sources of extreme-ultraviolet and soft x-ray radiation.

  1. Breaking DNA strands by extreme-ultraviolet laser pulses in vacuum.

    Science.gov (United States)

    Nováková, Eva; Vyšín, Luděk; Burian, Tomáš; Juha, Libor; Davídková, Marie; Múčka, Viliam; Čuba, Václav; Grisham, Michael E; Heinbuch, Scott; Rocca, Jorge J

    2015-04-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugars, and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. We have studied the nature of DNA damage induced directly by the pulsed 46.9-nm (26.5 eV) radiation provided by an extreme ultraviolet (XUV) capillary-discharge Ne-like Ar laser (CDL). Doses up to 45 kGy were delivered with a repetition rate of 3 Hz. We studied the dependence of the yield of SSBs and DSBs of a simple model of DNA molecule (pBR322) on the CDL pulse fluence. Agarose gel electrophoresis method was used for determination of both SSB and DSB yields. The action cross sections of the single- and double-strand breaks of pBR322 plasmid DNA in solid state were determined. We observed an increase in the efficiency of strand-break induction in the supercoiled DNA as a function of laser pulse fluence. Results are compared to those acquired at synchrotron radiation facilities and other sources of extreme-ultraviolet and soft x-ray radiation.

  2. Structure and development of Nostoc strands in Leiosporoceros dussii (Anthocerotophyta): a novel symbiosis in land plants.

    Science.gov (United States)

    Villarreal A, Juan Carlos; Renzaglia, Karen Sue

    2006-05-01

    The presence of Nostoc in longitudinally oriented schizogenous canals is a feature that separates Leiosporoceros from all other hornworts and represents a novel symbiotic arrangement in land plants. In surface view, Nostoc canals are visible as elongated, dichotomously branched blue-green strands. All other hornworts develop numerous discrete globose colonies through continuous production of mucilage clefts as avenues for multiple invasions within a single thallus. To elucidate the anatomy and development of the unusual Nostoc strands in Leiosporoceros, we examined sporeling development in culture and the structure of strands in field-collected plants using light and electron microscopy. Rosette-like sporelings have mucilage clefts scattered along swollen apices. All field specimens were strap-shaped, contained Nostoc, and lacked mucilage clefts. Nostoc strands are located in the center of the thallus and develop behind the apical cell by separation of the middle lamella between apical derivatives. Strands elongate and branch in synchrony with apical growth, and thus only a single invasion is required for strand production. Two distinct ultrastructural morphotypes in the collections suggest nonspecificity of Nostoc. We speculate that Nostoc enters the thallus in the sporeling stage through mucilage clefts, and once colonies are established, cleft production ceases.

  3. Broadband micro-Michelson interferometer with multi-optical-path beating using a sphered-end hollow fiber.

    Science.gov (United States)

    Chen, Nan-Kuang; Lu, Kuan-Yi; Shy, Jow-Tsong; Lin, Chinlon

    2011-06-01

    We demonstrate a high-sensitivity broadband (1250-1650 nm) fiber micro-Michelson interferometer using a single-mode fiber end-spliced with a sphered-end hollow-core fiber. The hollow core is slightly smaller than the solid core of a single-mode fiber, so the fractional power of the core mode is converted into cladding modes. The excited cladding modes propagate at distinct optical paths along the hollow-core fiber and have individual foci outside the spherical lens. The reflected core mode, generated at the solid core-air interface, and the reflected cladding modes, generated at external material, interfere with each other to produce beating in the interference signals. © 2011 Optical Society of America

  4. Acute hypoxia and hypoxic exercise induce DNA strand breaks and oxidative DNA damage in humans

    DEFF Research Database (Denmark)

    Møller, P; Loft, S; Lundby, C

    2001-01-01

    The present study investigated the effect of a single bout of exhaustive exercise on the generation of DNA strand breaks and oxidative DNA damage under normal conditions and at high-altitude hypoxia (4559 meters for 3 days). Twelve healthy subjects performed a maximal bicycle exercise test...... exercise in altitude hypoxia. Exercise-induced generation of DNA strand breaks was not seen at sea level. In both environments, the level of FPG and endonuclease III-sensitive sites remained unchanged immediately after exercise. DNA strand breaks and oxidative DNA damage are probably produced by reactive...... oxygen species, generated by leakage of the mitochondrial respiration or during a hypoxia-induced inflammation. Furthermore, the presence of DNA strand breaks may play an important role in maintaining hypoxia-induced inflammation processes. Hypoxia seems to deplete the antioxidant system of its capacity...

  5. The stranding anomaly as population indicator

    DEFF Research Database (Denmark)

    Peltier, Helene; Baagøe, Hans J.; Camphuysen, Kees C. J.

    2013-01-01

    Ecological indicators for monitoring strategies are expected to combine three major characteristics: ecological significance, statistical credibility, and cost-effectiveness. Strategies based on stranding networks rank highly in cost-effectiveness, but their ecological significance and statistica...

  6. A novel protein that recognizes DNA strand break

    Energy Technology Data Exchange (ETDEWEB)

    Narumi, Issay; Satoh, Katsuya; Kikuchi, Masahiro [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

    2002-03-01

    By analyzing a DNA damage-sensitive mutant of the radioresistant bacterium Deinococcus radiodurans, we discovered that a novel protein participates in the extreme radiation resistance of this bacterium. The protein (designated PprA for promoting prominent repair) can recognize DNA strand breaks. PprA could bind to double-stranded DNA (dsDNA) in the open circular form and to linear dsDNA, but could not bind to either dsDNA in the closed circular form or single-stranded DNA (ssDNA). Further, under conditions where a substantial amount of degradation of naked DNA fragments would normally result from the activity of E. coli exonuclease III, no DNA degradation was observed when the DNA fragments were preincubated with PprA. These suggest that PprA would protect irradiation-damaged DNA from exonuclease-mediated degradation and consequent DNA repair processes could function. Beside DNA-binding ability, PprA could promote the activities of DNA repair enzymes such as DNA ligase and RecA, suggesting that PprA functions as a DNA repair-promoting protein to potentiate the effectiveness of DNA repair. These properties enable PprA to use the widespread application in vivo and in vitro. (author)

  7. Evaluation of the neutral comet assay for detection of alpha-particle induced DNA-double-strand-breaks

    International Nuclear Information System (INIS)

    Hofbauer, Daniela

    2010-01-01

    Aim of this study was to differentiate DNA-double-strand-breaks from DNA-single-strand-breaks on a single cell level, using the comet assay after α- and γ-irradiation. Americium-241 was used as a alpha-irradiation-source, Caesium-137 was used for γ-irradiation. Because of technical problems with both the neutral and alkaline comet assay after irradiation of gastric cancer cells and human lymphocytes, no definite differentiation of DNA-damage was possible.

  8. Bubbles in live-stranded dolphins.

    Science.gov (United States)

    Dennison, S; Moore, M J; Fahlman, A; Moore, K; Sharp, S; Harry, C T; Hoppe, J; Niemeyer, M; Lentell, B; Wells, R S

    2012-04-07

    Bubbles in supersaturated tissues and blood occur in beaked whales stranded near sonar exercises, and post-mortem in dolphins bycaught at depth and then hauled to the surface. To evaluate live dolphins for bubbles, liver, kidneys, eyes and blubber-muscle interface of live-stranded and capture-release dolphins were scanned with B-mode ultrasound. Gas was identified in kidneys of 21 of 22 live-stranded dolphins and in the hepatic portal vasculature of 2 of 22. Nine then died or were euthanized and bubble presence corroborated by computer tomography and necropsy, 13 were released of which all but two did not re-strand. Bubbles were not detected in 20 live wild dolphins examined during health assessments in shallow water. Off-gassing of supersaturated blood and tissues was the most probable origin for the gas bubbles. In contrast to marine mammals repeatedly diving in the wild, stranded animals are unable to recompress by diving, and thus may retain bubbles. Since the majority of beached dolphins released did not re-strand it also suggests that minor bubble formation is tolerated and will not lead to clinically significant decompression sickness.

  9. Optofluidic in-fiber interferometer based on hollow optical fiber with two cores.

    Science.gov (United States)

    Yuan, Tingting; Yang, Xinghua; Liu, Zhihai; Yang, Jun; Li, Song; Kong, Depeng; Qi, Xiuxiu; Yu, Wenting; Long, Qunlong; Yuan, Libo

    2017-07-24

    We demonstrate a novel integrated optical fiber interferometer for in-fiber optofluidic detection. It is composed of a specially designed hollow optical fiber with a micro-channel and two cores. One core on the inner surface of the micro-channel is served as sensing arm and the other core in the annular cladding is served as reference arm. Fusion-and-tapering method is employed to couple light from a single mode fiber to the hollow optical fiber in this device. Sampling is realized by side opening a microhole on the surface of the hollow optical fiber. Under differential pressure between the end of the hollow fiber and the microhole, the liquids can form steady microflows in the micro-channel. Simultaneously, the interference spectrum of the interferometer device shifts with the variation of the concentration of the microfluid in the channel. The optofluidic in-fiber interferometer has a sensitivity of refractive index around 2508 nm/RIU for NaCl. For medicine concentration detection, its sensitivity is 0.076 nm/mmolL -1 for ascorbic acid. Significantly, this work presents a compact microfluidic in-fiber interferometer with a micro-channel which can be integrated with chip devices without spatial optical coupling and without complex manufacturing procedure of the waveguide on the chips.

  10. Hollow metal nanostructures for enhanced plasmonics: synthesis, local plasmonic properties and applications

    Directory of Open Access Journals (Sweden)

    Genç Aziz

    2016-09-01

    Full Text Available Metallic nanostructures have received great attention due to their ability to generate surface plasmon resonances, which are collective oscillations of conduction electrons of a material excited by an electromagnetic wave. Plasmonic metal nanostructures are able to localize and manipulate the light at the nanoscale and, therefore, are attractive building blocks for various emerging applications. In particular, hollow nanostructures are promising plasmonic materials as cavities are known to have better plasmonic properties than their solid counterparts thanks to the plasmon hybridization mechanism. The hybridization of the plasmons results in the enhancement of the plasmon fields along with more homogeneous distribution as well as the reduction of localized surface plasmon resonance (LSPR quenching due to absorption. In this review, we summarize the efforts on the synthesis of hollow metal nanostructures with an emphasis on the galvanic replacement reaction. In the second part of this review, we discuss the advancements on the characterization of plasmonic properties of hollow nanostructures, covering the single nanoparticle experiments, nanoscale characterization via electron energy-loss spectroscopy and modeling and simulation studies. Examples of the applications, i.e. sensing, surface enhanced Raman spectroscopy, photothermal ablation therapy of cancer, drug delivery or catalysis among others, where hollow nanostructures perform better than their solid counterparts, are also evaluated.

  11. Low-temperature solvothermal synthesis of EuS hollow microspheres

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Yong; Wang, Hong; Li, Peng; Fu, Yao, E-mail: fuyaozn@126.com; Xing, Mingming; Jiang, Tao; Luo, Xixian, E-mail: luoxixiandl@126.com

    2014-09-15

    Graphical abstract: Synthesis of EuS hollow microspheres at low-temperature via solvothermal method for the first time. - Highlights: • We adopt an improved method to synthesise the (Phen)Eu(Et{sub 2}CNS{sub 2}){sub 3} in deionized water. • We have successfully synthesised the EuS hollow microsphere at 230 °C in acetonitrile. • The price of acetonitrile is more inexpensive, so the price of preparation was reduced. - Abstract: EuS crystals are synthesized by low-temperature solvothermal decomposition of the single source precursor complex (Phen)Eu(Et{sub 2}CNS{sub 2}){sub 3} in acetonitrile. X-ray powder diffraction, scanning electron microscopy, granulocyte diameter statistical analysis, surface energy-dispersive X-ray spectroscopy analysis, and UV–vis absorption spectroscopy are used to characterize the structure and properties of the obtained EuS crystals. The results show that the formed EuS crystals are uniform hollow microspheres with a typical cubic phase structure of rock salt and the average particle size of 2.01 μm. The mechanisms for the thermal decomposition of the precursor complex and the formation of the EuS hollow microspheres are postulated based on the experimental observations and previous reports.

  12. Hollow core photonic crystal fiber as a reusable Raman biosensor.

    Science.gov (United States)

    Khetani, Altaf; Riordon, Jason; Tiwari, Vidhu; Momenpour, Ali; Godin, Michel; Anis, Hanan

    2013-05-20

    We report that a single hollow core photonic crystal fiber (HC-PCF) can be used for repetitive characterization of multiple samples by Raman spectroscopy. This was achieved by integrating the HC-PCF to a differential pressure system that allowed effective filling, draining and re-filling of samples into a HC-PCF under identical optical conditions. Consequently, high-quality and reliable spectral data could be obtained which were suitable for multivariate analysis (partial least squares). With the present scheme, we were able to accurately predict different concentrations of heparin and adenosine in serum. Thus the detection scheme as presented here paves a path for the inclusion of HC-PCFs in point-of-care technologies and environmental monitoring where rapid sample characterization is of utmost importance.

  13. Analysis of DNA strand break induction and repair in plants from the vicinity of Chernobyl

    International Nuclear Information System (INIS)

    Syomov, A.B.; Ptitsyna, S.N.; Sergeeva, S.A.

    1992-01-01

    For 3 years following the Chernobyl accident DNA repair efficiency was studied in irradiated and control populations of various plan species. Compared with the control populations, some irradiated populations exhibited increases in the yield of DNA single-strand breaks per unit dose of challenge radiation. The effect was registered in low-dose-rate alpha-irradiated populations, but was absent in plant populations growing in conditions of low-dose-rate beta-irradiation. The efficiency of single-strand DNA repair was identical in control and irradiated populations and approximated 100%. (author). 12 refs.; 1 fig.; 2 tabs

  14. Efficient all-optical switching using slow light within a hollow fiber

    DEFF Research Database (Denmark)

    Bajcsy, Michal; Hofferberth, S.; Balic, Vlatko

    2009-01-01

    We demonstrate a fiber-optical switch that is activated at tiny energies corresponding to a few hundred optical photons per pulse. This is achieved by simultaneously confining both photons and a small laser-cooled ensemble of atoms inside the microscopic hollow core of a single-mode photonic......-crystal fiber and using quantum optical techniques for generating slow light propagation and large nonlinear interaction between light beams....

  15. Field performance of timber bridges. 12, Christian Hollow stress-laminated box-beam bridge

    Science.gov (United States)

    J. P. Wacker; S. C. Catherman; R. G. Winnett

    In January 1992, the Christian Hollow bridge was constructed in Steuben County, New York. The bridge is a single-span, stress-laminated box-beam superstructure that is 9.1 m long, 9.8 m wide, and 502 mm deep (30 ft long, 32 ft wide, and 19-3/4 in. deep). The performance of the bridge was continuously monitored for 28 months, beginning shortly after installation....

  16. Isolation of Cryptococcus gattii from a Castanopsis argyrophylla tree hollow (Mai-Kaw), Chiang Mai, Thailand.

    Science.gov (United States)

    Khayhan, Kantarawee; Hagen, Ferry; Norkaew, Treepradab; Puengchan, Tanpalang; Boekhout, Teun; Sriburee, Pojana

    2017-04-01

    The pathogenic yeast Cryptococcus gattii was isolated from a tree hollow of a Castanopsis argyrophylla King ex Hook.f. (Fagaceae) in Chiang Mai, Thailand. Molecular characterization with amplified fragment length polymorphism analysis and multi-locus sequence typing showed that this isolate belonged to genotype AFLP4/VGI representing C. gattii sensu stricto. Subsequent comparison of the environmental isolate with those from clinical samples from Thailand showed that they grouped closely together in a single cluster.

  17. Surface functionalized hollow silica particles and composites

    KAUST Repository

    Rodionov, Valentin

    2017-05-26

    Composition comprising hollow spherical silica particles having outside particle walls and inside particle walls, wherein the particles have an average particle size of about 10 nm to about 500 nm and an average wall thickness of about 10 nm to about 50 nm; and wherein the particles are functionalized with at least one organic functional group on the outside particle wall, on the inside particle wall, or on both the outside and inside particle walls, wherein the organic functional group is in a reacted or unreacted form. The organic functional group can be epoxy. The particles can be mixed with polymer precursor or a polymer material such as epoxy to form a prepreg or a nanocomposite. Lightweight but strong materials can be formed. Low loadings of hollow particles can be used.

  18. Nanofilms on a hollow core fiber

    Science.gov (United States)

    Matias, Ignacio R.; Bravo, Javier; Arregui, Francisco J.; Corres, Jesús M.

    2006-05-01

    We experimentally study the behavior of one multimode fiber-hollow core fiber-multimode fiber structure when nanofilms are deposited on it with the aim of developing practical evanescent field-based devices, such as sensors, filters, etc. The electrostatic self-assembly (ESA) method is used as the deposition technique and the chosen polymers are PDDA and Poly R-478 because of their well-known optical properties and their potential application as humidity sensors. Three different types of hollow core, fibers are used for the fabrication of the devices and at two different wavelengths. An oscillatory-decreasing transmitted optical power is obtained as the thickness of the nanofilms is increased.

  19. Space Charge Mitigation by Hollow Bunches

    CERN Multimedia

    Oeftiger, AO

    2014-01-01

    To satisfy the requirements of the HL-LHC (High Luminosity Large Hadron Collider), the LHC injector chain will need to supply a higher brightness, i.e. deliver the same transverse beam emittances \\epsilon_{x,y} while providing a higher intensity N. However, a larger number of particles per bunch enhances space charge effects. One approach to mitigate the impact of space charge is to change the longitudinal phase space distribution: hollow bunches feature a depleted bunch centre and a densely populated periphery. Thus, the spatial line density maximum is depressed which ultimately decreases the tune spread imposed by space charge. Therefore, a higher intensity can be accepted while keeping the same overall space charge tune shift. 3 different methods to create hollow bunches in the PSBooster are simulated.

  20. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino......-terminal DNA binding domain, is capable of Rad51 delivery to DNA but is deficient in DNA annealing. Results from chromatin immunoprecipitation experiments find that rad52-R70A associates with DNA double-strand breaks and promotes recruitment of Rad51 as efficiently as wild-type Rad52. Analysis of gene...... conversion intermediates reveals that rad52-R70A cells can mediate DNA strand invasion but are unable to complete the recombination event. These results provide evidence that DNA binding by the evolutionarily conserved amino terminus of Rad52 is needed for the capture of the second DNA end during homologous...