WorldWideScience

Sample records for single primer set

  1. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  2. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  3. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545–549. Table 1.

  4. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Directory of Open Access Journals (Sweden)

    Nora Scarcelli

    Full Text Available Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC. Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon and non-coding regions (intron and intergenic spacer. They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC and 15 in the Inverted Repeat region (IR. Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae, Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae, Digitaria excilis and Pennisetum glaucum (Poaceae. The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR. We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies.

  5. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  6. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  7. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples.

    Science.gov (United States)

    Maheux, Andrée F; Picard, François J; Boissinot, Maurice; Bissonnette, Luc; Paradis, Sonia; Bergeron, Michel G

    2009-07-01

    The analytical performance of 9 different PCR primer sets designed to detect Escherichia coli and Shigella in water has been evaluated in terms of ubiquity, specificity, and analytical detection limit. Of the 9 PCR primer sets tested, only 3 of the 5 primer sets targeting uidA gene and the primer set targeting tuf gene amplified DNA from all E. coli strains tested. However, of those 4 primer sets, only the primer set targeting the tuf gene also amplified DNA from all Shigella strains tested. For the specificity, only the primer sets targeting the uidA gene were 100% specific although the primer sets targeting 16S rRNA, phoE, and tuf genes only amplified Escherichia fergusonii as non-specific target. Finally, the primer set targeting the 16S-ITS-23S gene region, was not specific as it amplified DNA from many other Enterobacteriaceae species. In summary, only the assay targeting the tuf gene detected all E. coli/Shigella strains tested in this study. However, if it becomes important to discriminate between E. coli and E. fergusonii, assays targeting the uidA gene would represent a good choice although none of them were totally ubiquitous to detect of the presence of Shigella strains.

  8. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... A set of ten diverse mulberry accessions was used for screening the primers and standardizing PCR conditions. The PCR amplifications were carried out in 10 µl reaction volume, containing 10 ng template DNA, 1X DreamTaqTM Green Buffer (ThermoFisher. Scientific, Lithuania), 0.1 mM of each dNTPs, ...

  9. Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics.

    Science.gov (United States)

    Kim, Hyun-Joong; Ryu, Ji-Oh; Lee, Shin-Young; Kim, Ei-Seul; Kim, Hae-Yeong

    2015-10-26

    The genus Vibrio is clinically significant and major pathogenic Vibrio species causing human Vibrio infections are V. cholerae, V. parahaemolyticus, V. vulnificus, V. alginolyticus and V. mimicus. In this study, we screened for novel genetic markers using comparative genomics and developed a Vibrio multiplex PCR for the reliable diagnosis of the Vibrio genus and the associated major pathogenic Vibrio species. A total of 30 Vibrio genome sequences were subjected to comparative genomics, and specific genes of the Vibrio genus and five major pathogenic Vibrio species were screened. The designed primer sets from the screened genes were evaluated by single PCR using DNAs from various Vibrio spp. and other non-Vibrio bacterial strains. A sextuplet multiplex PCR using six primer sets was developed to enable detection of the Vibrio genus and five pathogenic Vibrio species. The designed primer sets from the screened genes yielded specific diagnostic results for target the Vibrio genus and Vibrio species. The specificity of the developed multiplex PCR was confirmed with various Vibrio and non-Vibrio strains. This Vibrio multiplex PCR was evaluated using 117 Vibrio strains isolated from the south seashore areas in Korea and Vibrio isolates were identified as Vibrio spp., V. parahaemolyticus, V. vulnificus and V. alginolyticus, demonstrating the specificity and discriminative ability of the assay towards Vibrio species. This novel multiplex PCR method could provide reliable and informative identification of the Vibrio genus and major pathogenic Vibrio species in the food safety industry and in early clinical treatment, thereby protecting humans against Vibrio infection.

  10. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  11. Cloning flanking sequence by single-primer PCR in transgenic plants.

    Science.gov (United States)

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  12. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...

  13. Primer system for single cell detection of double mutation for Tay-Sachs disease.

    Science.gov (United States)

    Liu, M C; Drury, K C; Kipersztok, S; Zheng, W; Williams, R S

    2000-02-01

    Nearly 100% of infantile Tay-Sachs disease is produced by two mutations occurring in the alpha chain of the lysosomal enzyme beta-N-acetylhexosaminidase (HEXA) in the Ashkenazi Jewish population. Although others have described primer systems used to amplify both sites simultaneously, few discuss the allele dropout problems inherent in this test. Our goal was to construct a more robust test enabling stronger signal generation for single cell preimplantation genetic diagnosis and to investigate the occurrence of allele dropout. New nested primers were designed to optimize detection of both major Tay-Sachs mutations. Four hundred fifty-seven single cells, including normal cells and those carrying mutations of either the 4bp insertion exon 11 or splice-site intron 12 defects, were used to screen a new primer system. Based on PCR amplified product analysis, total efficiency of amplification was 85.3%, (390/457). The allele dropout rate for the 4bp insertion mutation in exon 11 and splice-site mutation in intron 12 was 4.8% and 5.8%, respectively. Multiple mutation detection and analysis within the Tay-Sachs disease gene (HEXA) is possible using single cells for clinical preimplantation genetic diagnosis. Alternative PCR primers and conditions offer various methods for developing systems compatible to specific program requirements.

  14. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex

    Directory of Open Access Journals (Sweden)

    Marilena dos Anjos Martins

    2015-01-01

    Conclusions: These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis.

  15. An In Vitro Single-Primer Site-Directed Mutagenesis Method for Use in Biotechnology.

    Science.gov (United States)

    Huang, Yanchao; Zhang, Likui

    2017-01-01

    Site-directed mutagenesis is a powerful method to introduce mutation(s) into DNA sequences. A number of methods have been developed over the years with a main goal being to create a high number of mutant genes. The single-mutagenic primer method for site-directed mutagenesis is the most direct method that yields mutant genes in about 25-50 % of transformants in a robust, low-cost reaction. The supercompetent XL10-Gold bacteria used in the Stratagene protocol carry a phage, which may be a problem for some applications; however, in our single-mutagenic primer method the supercompetent bacteria are not needed. A thermostable DNA polymerase with high fidelity and processivity, such as Phusion DNA polymerase, is required for our optimized procedure to avoid extra mutation(s) and enhance mutagenic efficiency.

  16. Primer System for Single Cell Detection of Double Mutation for Tay-Sachs Disease

    OpenAIRE

    Liu, Ming Cheng; Drury, Kenneth C.; Kipersztok, Simon; Zheng, Wenrong; Williams, R. Stan

    2000-01-01

    Purpose: Nearly 100% of infantile Tay-Sachs disease isproduced by two mutations occurring in the alpha chain ofthe lysosomal enzyme beta-N-acetylhexosaminidase (HEXA)in the Ashkenazi Jewish population. Although others havedescribed primer systems used to amplify both sitessimultaneously, few discuss the allele dropout problems inherent inthis test. Our goal was to construct a more robust testenabling stronger signal generation for single cellpreimplantation genetic diagnosis and to investigat...

  17. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    Science.gov (United States)

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    Science.gov (United States)

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  19. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    Science.gov (United States)

    Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

    2012-01-01

    An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to

  20. Comparative evaluation of the GP5+/6+, MY09/11 and PGMY09/11 primer sets for HPV detection by PCR in oral squamous cell carcinomas.

    Science.gov (United States)

    Erhart, Sibele Morais Miyata; Rivero, Elena Riet Correa; Bazzo, Maria Luiza; Onofre, Alexandre Sherlley Casimiro

    2016-02-01

    The aim of this study was to evaluate the use of GP5+/6+, MY09/11 and PGMY09/11 primer sets for the detection of human papillomavirus (HPV) DNA by single step polymerase chain reaction (PCR) and nested PCR in formalin-fixed and paraffin-embedded (FFPE) tissues from oral squamous cell carcinomas (OSCCs). DNA extracted from FFPE tissues were tested for amplification of the human beta globin gene with PCO3/4 primers. Positive samples for this gene were tested for HPV DNA using single step PCR with GP5+/6+, MY09/11 and PGMY09/11 primer sets. All negative samples at single step PCR with MY09/11 and PGMY09/11 were subjected to a further PCR with GP5+/6+ primers using the non-amplified product in the previously reactions (nested PCR) as samples. Among 26 samples, 23 were positive for the human beta globin gene and were considered viable for HPV DNA detection by PCR. Single step PCR with GP5+/6+ and MY09/11 primers and MY/GP+ nested PCR did not amplify HPV DNA in any samples. PGMY09/11 primers detected HPV DNA in 13.0% of OSCC cases and this rate was raise to 17.4% with the use of PGMY/GP+ nested PCR. According to our results the PGMY/GP+ nested PCR is the most appropriate primer set for the detection of HPV DNA using FFPE samples from OSCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Sequencing Angiosperm Plastid Genomes Made Easy: A Complete Set of Universal Primers and a Case Study on the Phylogeny of Saxifragales

    Science.gov (United States)

    Dong, Wenpan; Xu, Chao; Cheng, Tao; Lin, Kui; Zhou, Shiliang

    2013-01-01

    Plastid genomes are an invaluable resource for plant biological studies. However, the number of completely sequenced plant plastid genomes is still small compared with the vast number of species. To provide an alternative generalized approach, we designed a set of 138 pairs of universal primers for amplifying (termed “short-range PCR”) and sequencing the entire genomes of the angiosperm plastid genomes. The universality of the primers was tested by using species from the basal to asterid angiosperms. The polymerase chain reaction (PCR) success rate was higher than 96%. We sequenced the complete chloroplast genome of Liquidambar formosana as an example using this method and compared it to the genomes independently determined by long-range PCR (from 6.3 kb to 13.3 kb) and next-generation sequencing methods. The three genomes showed that they were completely identical. To test the phylogenetic efficiency of this method, we amplified and sequenced 18 chloroplast regions of 19 Saxifragales and Saxifragales-related taxa, as a case study, to reconstruct the phylogeny of all families of the order. Phylograms based on a combination of our data, together with those from GenBank, clearly indicate three family groups and three single families within the order. This set of universal primers is expected to accelerate the accumulation of angiosperm plastid genomes and to make faster mass data collection of plastid genomes for molecular systematics. PMID:23595020

  2. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  3. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    Directory of Open Access Journals (Sweden)

    Leighton Pritchard

    Full Text Available BACKGROUND: An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. METHODOLOGY/PRINCIPAL FINDINGS: Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. CONCLUSIONS/SIGNIFICANCE: Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high

  4. The impact of primer sets on detection of the gene encoding biofilm-associated protein (Bap) in Acinetobacter baumannii: in silico and in vitro analysis.

    Science.gov (United States)

    Kodori, M; Douraghi, M; Yaseri, M; Rahbar, M

    2017-04-01

    The Acinetobacter baumannii virulence protein Bap is encoded by a large gene and contains both variable sequence and repetitive modules. To date, four primer sets targeting different regions of bap have been designed, but no study has evaluated all these primers simultaneously for detection of bap. Here, we assessed the effect of primer sets Bap I-IV, on detection of bap both in silico and in vitro. Using the primer set Bap II, all 143 tested strains yielded an amplicon corresponding to the bap gene. This primer set showed the highest sensitivity (100, 95% CI: 97·9-100%) compared to the other primer sets. This study demonstrates that primer set Bap II performs with optimal efficiency for detection of the bap gene among different strains. This study investigated the effect of nucleotide variation on PCR detection of the bap gene in various Acinetobacter baumannii strains. Since bap is the target gene for many detection assays, this variation can affect the detection efficiency. Here we present a primer set Bap II with optimal detection efficiency amongst 143 different strains, as shown by in silico and in vitro evidence. © 2017 The Society for Applied Microbiology.

  5. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  6. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  7. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  8. Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.

    Science.gov (United States)

    Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe

    2018-04-19

    To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.

  9. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed...

  10. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies

    Directory of Open Access Journals (Sweden)

    Edelheit Oded

    2009-06-01

    Full Text Available Abstract Background In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. Results In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95°C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC subunits. The method has been tested for 1–3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. Conclusion The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  11. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.

    Science.gov (United States)

    Edelheit, Oded; Hanukoglu, Aaron; Hanukoglu, Israel

    2009-06-30

    In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95 degrees C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC) subunits. The method has been tested for 1-3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  12. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  13. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    Science.gov (United States)

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  14. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    Science.gov (United States)

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments.

  15. Single-nucleotide polymorphisms may cause erroneous results in primer-introduced restriction enzyme analyses: a case of molecular misdiagnosis of homozygous vs heterozygous familial hypercholesterolemia.

    Science.gov (United States)

    Vuorio, A F; Paulin, L; Saltevo, J; Kontula, K

    1999-12-01

    PCR amplification followed by a primer introduced restriction analysis PCR (PIRA-PCR) is a widely used method to detect point mutations. Usually the artificial RFLP is created by siting one nucleotide mismatch near the 3; end of the primer. This does not alter the hybrization of the primer to the target DNA sequence. Unfortunately, unexpected single nucleotide polymorphisms (SNPs) may lead to additional mismatches and result in no amplification of the allele having unexpected SNP. We describe a warning example in which heterozygous familial hypercholesterolemia patient had an unexpected SNP and this led to his misdiagnosis. Copyright 1999 Academic Press.

  16. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  17. Novel set of real-time PCR primers for simultaneous detection of Liberibacter species associated with citrus Huanglongbing

    Directory of Open Access Journals (Sweden)

    Ingrid Georgina Orce

    2015-06-01

    Full Text Available Huanglongbing (HLB, a devastating citrus disease caused by the bacterium “Candidatus Liberibacter spp.”, is now responsible for significant economic losses worldwide. Yet, no effective disease control has been found, and the non-cultivability of the bacterium has severely hampered studies on the pathogen. The 16S rDNA gene is a well-characterized sequence, essential for cell survival, and is used for bacterial identification or assignment of close relationships at the genus and species levels. Quantitative Real-Time PCR (qPCR assays based on 16S rDNA genes are widely used in the detection of “Ca. Liberibacter spp.” in multiplex reactions. We have developed for the first time a set of qPCR primers based on the conserved 16S rDNA gene, which specifically and simultaneously detects in a singleplex reaction, all three bacterial species associated with HLB, and can differentiateCa.Liberibacter asiaticus or africanus from americanus by their characteristic melting curves. The assay is very sensitive, and it was possible to amplify expected DNA fragments with an efficiency of 98 % using the Syber Green system and a Ct value lower than tested methods for HLB diagnosis. The application of this fast, simple and efficient detection methodology could also be important in the detection of all species of HLB-associated Liberibacters and could contribute to early pathogen detection, a crucial step in the development of preventive strategies aimed at avoiding the dissemination of this devastating disease in HLB-free areas.

  18. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.

    Science.gov (United States)

    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra

    2007-12-01

    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification.

  19. Alternative primer sets for PCR detection of genotypes involved in bacterial aerobic BTEX degradation : Distribution of the genes in BTEX degrading isolates and in subsurface soils of a BTEX contaminated industrial site

    NARCIS (Netherlands)

    Hendrickx, B; Junca, H; Vosahlova, J; Lindner, A; Ruegg, [No Value; Bucheli-Witschel, M; Faber, F; Egli, T; Mau, M; Schlomann, M; Brennerova, M; Brenner, [No Value; Pieper, DH; Top, EM; Dejonghe, W; Bastiaens, L; Springael, D

    Eight new primer sets were designed for PCR detection of (i) mono-oxygenase and dioxygenase gene sequences involved in initial attack of bacterial aerobic BTEX degradation and of (ii) catechol 2,3-dioxygenase gene sequences responsible for metacleavage of the aromatic ring. The new primer sets

  20. Single primer amplification reaction (SPAR) methods reveal subsequent increase in genetic variations in micropropagated plants of Nepenthes khasiana Hook. f. maintained for three consecutive regenerations.

    Science.gov (United States)

    Devi, Soibam Purnima; Kumaria, Suman; Rao, Satyawada Rama; Tandon, Pramod

    2014-03-15

    The genetic fidelity of in vitro-raised plants of three successive regenerations of Nepenthes khasiana Hook. f. was assessed using three different single primer amplification reaction (SPAR) methods, viz., random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR) and direct amplification of minisatellite DNA region (DAMD) markers. Out of 80 RAPD primers screened, 14 primers reflected a genetic variation of 4.1% in the first regeneration which was increased to 9.4% in the third regeneration. In the case of ISSR, out of 36 primers screened for assessment of genetic homogeneity of the regenerated plantlets, 12 primers showed an increase of genetic variation from 4.3% to 10% from the first to the third regenerations. In DAMD profiling, 15 primers were used for the evaluation of genetic fidelity where 8.47% of polymorphism was observed in the first regeneration which was increased to 13.33% in the third regeneration. The cumulative analysis reflected a genetic variation of 5.65% in the first regeneration which increased subsequently to 7.77% in the second regeneration and 10.87% in the third regeneration. The present study demonstrates SPAR technique to be an efficient tool for the assessment of clonal fidelity of in vitro-raised plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  2. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  3. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, Petr; Sudová, Radka; Janoušková, Martina; Čtvrtlíková, Martina; Hejda, Martin; Pánková, Hana; Slavíková, Renata; Štajerová, Kateřina; Vosátka, Miroslav; Sýkorová, Zuzana

    2014-01-01

    Roč. 68, Jan 2014 (2014), s. 482-493 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/0781; GA ČR GAP504/10/1486; GA ČR(CZ) GAP505/11/1112 Institutional support: RVO:67985939 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  4. The Single Needle Lockstitch Machine. [Setting Zippers.] Module 8.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on setting zippers, one in a series on the single needle lockstitch sewing machine for student self-study, contains five sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's final checklist.…

  5. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    of only deoxyribonucleotides (hereafter denoted standard primers). Biotin-labeled ddNTPs were used in the SBE reaction, and the SBE products were purified using the monomeric avidin triethylamine purification protocol, ensuring that only primers extended with a biotin-ddNTP in the 3'-end were isolated...

  6. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  7. Genotyping Single Nucleotide Polymorphism C4685T in 14. Intron of Bovine CAPN1 Gene by Rapid Tetra-Primer ARMS-PCR Method

    Directory of Open Access Journals (Sweden)

    Michal Gábor

    2011-05-01

    Full Text Available Single nucleotide polymorphism (SNP C4685T located in 14. intron of bovine CAPN1 gene have shown significant association with a higher lean share in valuable cuts for mutant genotype TT. The work was oriented to developed a sensitive single tube tetra-primer amplification refractory mutation system PCR (ARMS-PCR method for detection of C4685T polymorphism in CAPNI gene and analysis of genotype structure in population of 130 animals of Slovak Pinzgau cattle. The genomic DNA was isolated from samples of blood and hairs of cattle. Design of primers for ARMS-PCR was realized by using program Tetra-Primer ARMS-PCR. The presence of wild allele C and mutant allele T on agarose gel was detected by one control 439 bp fragment for both alleles and one specific fragment for each allele C - 204 bp and T - 290 bp. For the checking of correct genotyping was used PCR-RFLP method with restriction endonuclease BseGI. In the population of Slovak Pinzgau cattle we detected all genotypes. There were detected homozygote genotype CC with frequency 0.3308, heterozygote genotype CT with frequency 0.4 and homozygote genotype TT with frequency 0.2692. Frequency of alleles C and T for SNP C4685T of gene CAPN1 were 0.5308 and 0.4692.

  8. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  9. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  10. Development of primer sets that can verify the enrichment of histone modifications, and their application to examining vernalization-mediated chromatin changes in Brassica rapa L.

    Science.gov (United States)

    Kawanabe, Takahiro; Osabe, Kenji; Itabashi, Etsuko; Okazaki, Keiichi; Dennis, Elizabeth S; Fujimoto, Ryo

    2016-07-20

    Epigenetic regulation is crucial for the development of plants and for adaptation to a changing environment. Recently, genome-wide profiles of histone modifications have been determined by a combination of chromatin immunoprecipitation (ChIP) and genomic tiling arrays (ChIP on chip) or ChIP and high-throughput sequencing (ChIP-seq) in species including Arabidopsis thaliana, rice and maize. Validation of ChIP analysis by PCR or qPCR using positive and negative regions of histone modification is necessary. In contrast, information about histone modifications is limited in Chinese cabbage, Brassica rapa. The aim of this study was to develop positive and negative control primer sets for H3K4me3 (trimethylation of the 4(th) lysine of H3), H3K9me2, H3K27me3 and H3K36me3 in B. rapa. The expression and histone modification of four FLC paralogs in B. rapa, before and after vernalization, were examined using the method developed here. After vernalization, expression of all four BrFLC genes was reduced, and accumulation of H3K27me3 was observed in three of them. As with A. thaliana, the vernalization response and stability of FLC repression correlated with the accumulation of H3K27me3. These results suggest that the epigenetic state during vernalization is important for high bolting resistance in B. rapa. The positive and negative control primer sets developed here revealed positive and negative histone modifications in B. rapa that can be used as a control for future studies.

  11. Single-Sex Education in Public School Settings

    Science.gov (United States)

    Crawford-Ferre, Heather Glynn; Wiest, Lynda R.

    2013-01-01

    Although researchers have studied the effectiveness of single-sex education (SSE), the findings have been mixed. This exploratory study reports the perceived goals and effectiveness of single-sex education based on interviews with a small group of educators involved with SSE in various ways. Research participants included a school principal and…

  12. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  13. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  14. Detection of Single-Nucleotide Polymorphisms in Plasmodium falciparum by PCR Primer Extension and Lateral Flow Immunoassay

    NARCIS (Netherlands)

    Moers, A. P. H. A.; Hallett, R. L.; Burrow, R.; Schallig, H. D. F. H.; Sutherland, C. J.; van Amerongen, A.

    2015-01-01

    The resistance of Plasmodium falciparum to some antimalarial drugs is linked to single-nucleotide polymorphisms (SNPs). Currently, there are no methods for the identification of resistant parasites that are sufficiently simple, cheap, and fast enough to be performed at point-of-care, i.e., in local

  15. The Single Needle Lockstitch Machine. [Setting a Collar.] Module 5.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on sewing collars, one in a series on the single needle lockstitch sewing machine for student self-study, contains three sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's final checklist.…

  16. Examining Multiple Variables within a Single ER Setting

    Science.gov (United States)

    Karlin, Omar; Romanko, Rick

    2010-01-01

    This study examined the gains in student affect, vocabulary, and reading fluency for 110 university students in an extensive reading program in Japan. It was important to measure all of these dimensions within a single study and teaching methodology, so gains could be appropriately compared against each other. The adopted teaching methodology was…

  17. Single-tube genotyping using a solid-phase method that combines alpha-phosphorothioate-mediated primer extension and ExoIII: proof of concept with the F508del cystic fibrosis diagnosis.

    Science.gov (United States)

    Brugère, Jean-François; Gobron, Stéphane; Baud, Eric; Cailloux, Fabrice

    2008-01-01

    Detection of single nucleotide polymorphisms (SNPs) and of mutations is of importance in the field of genetics, biomedical research and in vitro diagnosis. We report here a genotyping procedure that can be virtually applied to any locus within a genome: it uses alpha-phosphorothioate deoxynucleotides in a primer-extension step followed by an ExoIII treatment. Non-extended primers are hydrolyzed whereas extended primers resist this treatment, indicating which nucleotide has been incorporated, i.e. the genotype of the locus. A 3-bp deletion in the CFTR gene (F508del, the most prevalent mutation involved in cystic fibrosis) was used as a model, in a single-tube procedure for each nucleotide to be tested. Human genomic DNA samples were correctly genotyped in less than 3h by a solid-phase PCR followed by primer extension, ExoIII treatment and an ELISA-like detection method. The same principle (primer extension with alpha-phosphorothioate deoxynucleotide, ExoIII treatment) should also be combined with other detection systems such as gel or capillary electrophoresis, mass spectrometry or DNA chips.

  18. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  19. Costs Associated With Single-Use and Conventional Sets for Distal Radius Plating.

    Science.gov (United States)

    Fugarino, Bryce; Fox, Mary Patricia; Terhoeve, Cristina; Pappas, Nicholas

    2017-11-01

    Volar plating of distal radius fractures is an increasingly common procedure. Presterilized, single-use volar plate fixation sets have been purported to increase operating room efficiency and decrease cost. The purpose of this study was to compare the actual cost of using a conventional set compared with the projected cost of using its single-use counterpart. We retrospectively analyzed 30 consecutive cases of volar plate fixation in which conventional instrument sets were used. Hardware and processing costs were calculated for the conventional sets and compared with the projected cost of using single-use sets. The mean total cost of hardware and processing for the conventional sets was $2,728, whereas the projected cost for the single-use sets was slightly higher at $2,868. Twenty-three of the 30 cases would have required additional screws not available in the single-use set. The cost of the additional screws needed to supplement the single-use set would have added an average of $282/case. Overall, the combined hardware and processing cost was lower for conventional sets in 25 of the 30 cases. Although the price of the single-use set is less than the mean charge for use of a conventional set, additional screws not available in the single-use set were required in 77% of cases and consequently rendered the conventional set cheaper in 83% of cases. Stocking the single-use sets with additional screws to reflect the most commonly used screw lengths could make these sets more cost effective in the future. Economic and decision analysis IV. Copyright © 2017 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  20. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  1. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  2. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  3. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. 34 CFR 403.82 - In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women Program...

    Science.gov (United States)

    2010-07-01

    ... EDUCATION STATE VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAM What Kinds of Activities Does the... secondary school settings, including area vocational education schools, and community-based organizations... 34 Education 3 2010-07-01 2010-07-01 false In what settings may the Single Parents, Displaced...

  5. Approaching the Hartree-Fock Limit through the Complementary Auxiliary Basis Set Singles Correction and Auxiliary Basis Sets.

    Science.gov (United States)

    Shaw, Robert A; Hill, J Grant

    2017-04-11

    Auxiliary basis sets for use in the resolution of the identity (RI) approximation in explicitly correlated methods are presented for the elements H-Ar. These extend the cc-pVnZ-F12/OptRI (n = D-Q) auxiliary basis sets of Peterson and co-workers by the addition of a small number of s- and p-functions, optimized so as to yield the greatest complementary auxiliary basis set (CABS) singles correction to the Hartree-Fock energy. The new sets, denoted OptRI+, also lead to a reduction in errors due to the RI approximation and hence an improvement in correlation energies. The atomization energies and heats of formation for a test set of small molecules, and spectroscopic constants for 27 diatomics, calculated at the CCSD(T)-F12b level, are shown to have improved error distributions for the new auxiliary basis sets with negligible additional effort. The OptRI+ sets retain all of the desirable properties of the original OptRI, including the production of smooth potential energy surfaces, while maintaining a compact nature.

  6. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  7. Does the "Negro" "Still" Need Separate Schools? Single-Sex Educational Settings as Critical Race Counterspaces

    Science.gov (United States)

    Terry, Clarence L., Sr.; Flennaugh, Terry K.; Blackmon, Samarah M.; Howard, Tyrone C.

    2014-01-01

    This article explores whether contemporary educators should consider single-sex educational settings as viable interventions in educating African American males. Using qualitative data from a 2-year study of single-sex educational spaces in two Los Angeles County high schools, the authors argue that when all-male spaces effectively function as…

  8. A single-electron tunneling reset-set flip-flop

    Energy Technology Data Exchange (ETDEWEB)

    Alencar, Bianca M. S. M. de; Guimarães, Janaina G. [Department of Electrical Engineering, University of Brasilia, Campus Universitário Darcy Ribeiro, Asa Norte, P.O. Box 4386, Brasilia-DF, 70919-970 (Brazil)

    2014-05-15

    In this paper, a new Reset-Set flip-flop fully implemented with single-electron devices is proposed. Its topology derived from NAND gates and was validated at room temperature by simulation. Furthermore, a comparison between the proposed single-electron device and MOS devices in terms of power consumption and occupied area is presented.

  9. Single-Subject Designs and Action Research in the K-12 Setting

    Science.gov (United States)

    Forbes, Sean A.; Ross, Margaret E.; Chesser, Svetlana S.

    2011-01-01

    In as much as educational research is concerned with individual student assessment and development, it is surprising that single-subject designs are not more readily utilized in classroom-based action research. The purpose of this article is to emphasize benefits of single-subject research in the K-12 setting, given that teachers teach and assess…

  10. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  11. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  12. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  13. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  14. Complementary Self-Biased Logics Based on Single-Electron Transistor (SET)/CMOS Hybrid Process

    Science.gov (United States)

    Song, Ki-Whan; Lee, Yong Kyu; Sim, Jae Sung; Kim, Kyung Rok; Lee, Jong Duk; Park, Byung-Gook; You, Young Sub; Park, Joo-On; Jin, You Seung; Kim, Young-Wug

    2005-04-01

    We propose a complementary self-biasing method which enables the single-electron transistor (SET)/complementary metal-oxide semiconductor (CMOS) hybrid multi-valued logics (MVLs) to operate well at high temperatures, where the peak-to-valley current ratio (PVCR) of the Coulomb oscillation markedly decreases. The new architecture is implemented with a few transistors by utilizing the phase control capability of the sidewall depletion gates in dual-gate single-electron transistors (DGSETs). The suggested scheme is evaluated by a SPICE simulation with an analytical DGSET model. Furthermore, we have developed a new process technology for the SET/CMOS hybrid systems. We have confirmed that both of the fabricated devices, namely, SET and CMOS transistors, exhibit the ideal characteristics for the complementary self-biasing scheme: the SET shows clear Coulomb oscillations with a 100 mV period and the CMOS transistors show a high voltage gain.

  15. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  16. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  17. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  18. Physical Activity Levels in Coeducational and Single-Gender High School Physical Education Settings

    Science.gov (United States)

    Hannon, James; Ratliffe, Thomas

    2005-01-01

    The purpose of this study was to investigate the effects of coeducational (coed) and single-gender game-play settings on the activity levels of Caucasian and African American high school physical education students. Students participated in flag football, ultimate Frisbee, and soccer units. Classes were as follows: there were two coed classes, two…

  19. The Single Needle Lockstitch Machine. [Constructing and Setting Sleeves.] Module 7.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on constructing and setting sleeves, one in a series on the single needle lockstitch sewing machine for student self-study, contains two sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's…

  20. The Single Needle Lockstitch Machine. [Constructing and Setting Pockets.] Module 9.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on constructing and setting pockets, one in a series on the single needle lockstitch sewing machine for student self-study, contains three sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an…

  1. The Single Needle Lockstitch Machine. [Making and Setting Cuffs.] Module 6.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on making and setting cuffs, one in a series on the single needle lockstitch sewing machine for student self-study, contains three sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's final…

  2. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  3. Reducing twin pregnancy rates after IVF--elective single embryo transfer (eSET).

    LENUS (Irish Health Repository)

    Milne, P

    2010-01-01

    Multiple pregnancy is a major complication of IVF and is associated with increased maternal, fetal and neonatal morbidity. Elective single embryo transfer (eSET) during IVF, rather than the more standard transfer of two embryos (double embryo transfer or DET), has been shown to significantly reduce the multiple pregnancy rate associated with IVF, while maintaining acceptable pregnancy rates. Couples undergoing IVF in 2008 who met good prognostic criteria had eSET performed. Pregnancy and twinning rates were compared with those for similar couples in 2007 who had DET. Couples unsuccessful with a fresh cycle of treatment had subsequent frozen embryo transfer cycles with DET. The cumulative pregnancy rate was similar for each group. However there were no multiple pregnancies in the eSET group, compared to 4 twins of 5 pregnancies in the DET group. 96% of eligible couples agreed to eSET. ESET is successful in and acceptable to good prognosis Irish couples undergoing IVF.

  4. Effects of single vs. multiple-set short-term strength training in elderly women.

    Science.gov (United States)

    Radaelli, Regis; Wilhelm, Eurico N; Botton, Cíntia E; Rech, Anderson; Bottaro, Martim; Brown, Lee E; Pinto, Ronei S

    2014-01-01

    The strength training has been shown to be effective for attenuating the age-related physiological decline. However, the adequate volume of strength training volume adequate to promote improvements, mainly during the initial period of training, still remains controversial. Thus, the purpose of this study was to compare the effects of a short-term strength training program with single or multiple sets in elderly women. Maximal dynamic (1-RM) and isometric strength, muscle activation, muscle thickness (MT), and muscle quality (MQ = 1-RM and MT quadriceps quotient) of the knee extensors were assessed. Subjects were randomly assigned into one of two groups: single set (SS; n = 14) that performed one set per exercise or multiple sets (MS; n = 13) that performed three-sets per exercise, twice weekly for 6 weeks. Following training, there were significant increases (p ≤ 0.05) in knee extension 1-RM (16.1 ± 12 % for SS group and 21.7 ± 7.7 % for MS group), in all MT (p ≤ 0.05; vastus lateralis, rectus femoris, vastus medialis, and vastus intermedius), and in MQ (p ≤ 0.05); 15.0 ± 12.2 % for SS group and 12.6 ± 7.2 % for MS group), with no differences between groups. These results suggest that during the initial stages of strength training, single- and multiple-set training demonstrate similar capacity for increasing dynamic strength, MT, and MQ of the knee extensors in elderly women.

  5. Single- and multiple-set resistance training improves skeletal and respiratory muscle strength in elderly women.

    Science.gov (United States)

    Abrahin, Odilon; Rodrigues, Rejane P; Nascimento, Vanderson C; Da Silva-Grigoletto, Marzo E; Sousa, Evitom C; Marçal, Anderson C

    2014-01-01

    Aging involves a progressive reduction of respiratory muscle strength as well as muscle strength. Compare the effects of resistance training volume on the maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), functional performance, and muscle strength in elderly women. Thirty elderly women were randomly assigned to a group performing either single sets (1-SET) or three sets (3-SET) of exercises. The sit-to-stand test, MIP, MEP, and muscle strength were assessed before and after 24 training sessions. Progressive resistance training was performed two times per week for a total of 8-12 repetitions, using the main muscle groups of the upper and lower limbs. The main results showed that the participants significantly increased their MEP (Ptraining sessions, muscle strength also significantly increased (Ptraining programs increased MIP, MEP, muscle strength, and sit-to-stand test performance in elderly women after 24 sessions of training. In conclusion, our results suggested that elderly women who are not in the habit of physical activity may start with single-set resistance training programs as a short-term strategy for the maintenance of health.

  6. Generating and executing programs for a floating point single instruction multiple data instruction set architecture

    Science.gov (United States)

    Gschwind, Michael K

    2013-04-16

    Mechanisms for generating and executing programs for a floating point (FP) only single instruction multiple data (SIMD) instruction set architecture (ISA) are provided. A computer program product comprising a computer recordable medium having a computer readable program recorded thereon is provided. The computer readable program, when executed on a computing device, causes the computing device to receive one or more instructions and execute the one or more instructions using logic in an execution unit of the computing device. The logic implements a floating point (FP) only single instruction multiple data (SIMD) instruction set architecture (ISA), based on data stored in a vector register file of the computing device. The vector register file is configured to store both scalar and floating point values as vectors having a plurality of vector elements.

  7. What are task-sets: a single, integrated representation or a collection of multiple control representations?

    Science.gov (United States)

    Rangelov, Dragan; Töllner, Thomas; Müller, Hermann J; Zehetleitner, Michael

    2013-01-01

    Performing two randomly alternating tasks typically results in higher reaction times (RTs) following a task switch, relative to a task repetition. These task switch costs (TSC) reflect processes of switching between control settings for different tasks. The present study investigated whether task sets operate as a single, integrated representation or as an agglomeration of relatively independent components. In a cued task switch paradigm, target detection (present/absent) and discrimination (blue/green/right-/left-tilted) tasks alternated randomly across trials. The target was either a color or an orientation singleton among homogeneous distractors. Across two trials, the task and target-defining dimension repeated or changed randomly. For task switch trials, agglomerated task sets predict a difference between dimension changes and repetitions: joint task and dimension switches require full task set reconfiguration, while dimension repetitions permit re-using some control settings from the previous trial. By contrast, integrated task sets always require full switches, predicting dimension repetition effects (DREs) to be absent across task switches. RT analyses showed significant DREs across task switches as well as repetitions supporting the notion of agglomerated task sets. Additionally, two event-related potentials (ERP) were analyzed: the Posterior-Contralateral-Negativity (PCN) indexing spatial selection dynamics, and the Sustained-Posterior-Contralateral-Negativity (SPCN) indexing post-selective perceptual/semantic analysis. Significant DREs across task switches were observed for both the PCN and SPCN components. Together, DREs across task switches for RTs and two functionally distinct ERP components suggest that re-using control settings across different tasks is possible. The results thus support the "agglomerated-task-set" hypothesis, and are inconsistent with "integrated task sets."

  8. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  9. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  10. Setting Single Photon Detectors for Use with an Entangled Photon Distribution System

    Science.gov (United States)

    2017-12-01

    System by Daniel E Jones, Drew Weninger, and Michael Brodsky Approved for public release; distribution is unlimited...Laboratory Setting Single Photon Detectors for Use with an Entangled Photon Distribution System by Daniel E Jones and Michael Brodsky Computational...Use with an Entangled Photon Distribution System 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Daniel E Jones

  11. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  12. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  13. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  14. What are task-sets: a single, integrated representation or a collection of multiple control representations?

    Directory of Open Access Journals (Sweden)

    Dragan eRangelov

    2013-09-01

    Full Text Available Performing two randomly alternating tasks typically results in higher reaction times (RTs following a task switch, relative to a task repetition. These task switch costs (TSC reflect processes of switching between control settings for different tasks. The present study investigated whether task sets operate as a single, integrated representation or as an agglomeration of relatively independent components. In a cued task switch paradigm, target detection (present/absent and discrimination (blue/green/right-/left-tilted tasks alternated randomly across trials. The target was either a color or an orientation singleton among homogeneous distractors. Across two trials, the task and target-defining dimension repeated or changed randomly. For task switch trials, agglomerated task sets predict a difference between dimension changes and repetitions: joint task and dimension switches require full task set reconfiguration, while dimension repetitions permit re-using some control settings from the previous trial. By contrast, integrated task sets always require full switches, predicting dimension repetition effects (DREs to be absent across task switches. RT analyses showed significant DREs across task switches as well as repetitions supporting the notion of agglomerated task sets. Additionally, two event-related potentials (ERP were analyzed: the Posterior-Contralateral-Negativity (PCN indexing spatial selection dynamics, and the Sustained-Posterior-Contralateral-Negativity (SPCN indexing post-selective perceptual/semantic analysis. Significant DREs across task switches were observed for both the PCN and SPCN components. Together, DREs across task switches for RTs and two functionally distinct ERP components suggest that re-using control settings across different tasks is possible. The results thus support the ‘agglomerated-task-set’ hypothesis, and are inconsistent with ‘integrated task sets’.

  15. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  16. An extended set-value observer for position estimation using single range measurements

    DEFF Research Database (Denmark)

    Marcal, Jose; Jouffroy, Jerome; Fossen, Thor I.

    the observability of the system is briefly discussed and an extended set-valued observer is presented, with some discussion about the effect of the measurements noise on the final solution. This observer estimates bounds in the errors assuming that the exogenous signals are bounded, providing a safe region......The ability of estimating the position of an underwater vehicle from single range measurements is important in applications where one transducer marks an important geographical point, when there is a limitation in the size or cost of the vehicle, or when there is a failure in a system...

  17. Generation of covariance data among values from a single set of experiments

    International Nuclear Information System (INIS)

    Smith, D.L.

    1992-01-01

    Modern nuclear data evaluation methods demand detailed uncertainty information for all input results to be considered. It can be shown from basic statistical principles that provision of a covariance matrix for a set of data provides the necessary information for its proper consideration in the context of other included experimental data and/or a priori representations of the physical parameters in question. This paper examines how an experimenter should go about preparing the covariance matrix for any single experimental data set he intends to report. The process involves detailed examination of the experimental procedures, identification of all error sources (both random and systematic); and consideration of any internal discrepancies. Some specific examples are given to illustrate the methods and principles involved

  18. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  19. Single port laparoscopic colorectal surgery in debilitated patients and in the urgent setting.

    LENUS (Irish Health Repository)

    Moftah, M

    2012-09-01

    Single port laparoscopy is a relatively new niche in the expanding spectrum of minimal access surgery for colorectal disease. To date the published experience has predominantly focused on planned operations for neoplasia in the elective setting. It seems probable however that the benefits of minimal abdominal wounding will be greatest among those patients with the highest risk of impaired wound healing. Combining this with the impression of improved cosmesis suggests that (the mostly young) patients with inflammatory bowel disease needing urgent operation are the most likely to appreciate and benefit from the extraoperative effort. The extension of single port surgery to the acute setting and for debilitated individuals is therefore a likely next step advance in broadening the category of patients for whom it represents a real benefit and ultimately aid in focusing by selection the subgroups for whom this technique is best suited and most appropriate. We describe here our approach (including routine use of a surgical glove port) to patients presenting for urgent colorectal operation for benign disease. As provision of specialized approaches regardless of timing or mode of presentation is a defining component of any specialty service, this concept will soon be more fully elucidated and established.

  20. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  1. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  2. Effects of single- vs. multiple-set resistance training on maximum strength and body composition in trained postmenopausal women.

    Science.gov (United States)

    Kemmler, Wolfgang K; Lauber, Dirk; Engelke, Klaus; Weineck, Juergen

    2004-11-01

    The purpose of this study was to examine the effect of a single- vs. a multiple-set resistance training protocol in well-trained early postmenopausal women. Subjects (N = 71) were randomly assigned to begin either with 12 weeks of the single-set or 12 weeks of the multiple-set protocol. After another 5 weeks of regenerational resistance training, the subgroup performing the single-set protocol during the first 12 weeks crossed over to the 12-week multiple-set protocol and vice versa. Neither exercise type nor exercise intensity, degree of fatigue, rest periods, speed of movement, training sessions per week, compliance and attendance, or periodization strategy differed between exercise protocols. Body mass, body composition, and 1 repetition maximum (1RM) values for leg press, bench press, rowing, and leg adduction were measured at baseline and after each period. Multiple-set training resulted in significant increases (3.5-5.5%) for all 4 strength measurements, whereas single-set training resulted in significant decreases (-1.1 to -2.0%). Body mass and body composition did not change during the study. The results show that, in pretrained subjects, multiple-set protocols are superior to single-set protocols in increasing maximum strength.

  3. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  4. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  5. Hormonal responses of multiset versus single-set heavy-resistance exercise protocols.

    Science.gov (United States)

    Gotshalk, L A; Loebel, C C; Nindl, B C; Putukian, M; Sebastianelli, W J; Newton, R U; Häkkinen, K; Kraemer, W J

    1997-06-01

    The purpose of this study was to compare serum growth hormone (GH), testosterone (T), cortisol (C), and whole blood lactate (L) responses to single set (1S) versus multiple set (3S) heavy-resistance exercise protocols. Eight recreationally weight-trained men completed two identical resistance exercise workouts (1S vs. 3S). Blood was obtained preexercise (PRE), immediately postexercise (OP), and 5 min (5P), 15 min (15P), 30 min (30P) and 60 min (60P) postexercise and was analyzed for GH, T, C, and L levels. For 1S and 3S, GH, L, and T significantly increased from PRE to OP and remained significantly elevated to 60P, except for 1S. For GH, T, and L, 3S showed significantly greater increases compared to 1S. For C, 3S and 1S were increased significantly from resting at OP, 5P, and 15P; 3S increased compared to 1S at 5P, 15P and 30P. Higher volumes of total work produce significantly greater increases in circulating anabolic hormones during the recovery phase following exercise.

  6. A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.

    Science.gov (United States)

    Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong

    2015-01-01

    Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

  7. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  8. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  9. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  10. Single-reviewer electronic phenotyping validation in operational settings: Comparison of strategies and recommendations.

    Science.gov (United States)

    Kukhareva, Polina; Staes, Catherine; Noonan, Kevin W; Mueller, Heather L; Warner, Phillip; Shields, David E; Weeks, Howard; Kawamoto, Kensaku

    2017-02-01

    Develop evidence-based recommendations for single-reviewer validation of electronic phenotyping results in operational settings. We conducted a randomized controlled study to evaluate whether electronic phenotyping results should be used to support manual chart review during single-reviewer electronic phenotyping validation (N=3104). We evaluated the accuracy, duration and cost of manual chart review with and without the availability of electronic phenotyping results, including relevant patient-specific details. The cost of identification of an erroneous electronic phenotyping result was calculated based on the personnel time required for the initial chart review and subsequent adjudication of discrepancies between manual chart review results and electronic phenotype determinations. Providing electronic phenotyping results (vs not providing those results) was associated with improved overall accuracy of manual chart review (98.90% vs 92.46%, preview duration per test case (62.43 vs 76.78s, preview and electronic phenotyping results was higher when the phenotyping results were provided (Cohen's kappa 0.98 vs 0.88, previewer chart review of electronic phenotyping can be conducted more accurately, quickly, and at lower cost when supported by electronic phenotyping results. However, human reviewers tend to agree with electronic phenotyping results even when those results are wrong. Thus, the value of providing electronic phenotyping results depends on the accuracy of the underlying electronic phenotyping algorithm. We recommend using a mix of phenotyping validation strategies, with the balance of strategies based on the anticipated electronic phenotyping error rate, the tolerance for missed electronic phenotyping errors, as well as the expertise, cost, and availability of personnel involved in chart review and discrepancy adjudication. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  12. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  13. An Interactive Microcomputer Program for Teaching the Impacts of Alternative Policy Sets in the Market for a Single Commodity.

    Science.gov (United States)

    Li, Elton; Stoecker, Arthur

    1995-01-01

    Describes a computer software program where students define alternative policy sets and compare their effects on the welfare of consumers, producers, and the public sector. Policy sets may be a single tax or quota or a mix of taxes, subsidies, and/or price supports implemented in the marketing chain. (MJP)

  14. Cognitive behavioral therapy for depression among adults in Japanese clinical settings: a single-group study

    Directory of Open Access Journals (Sweden)

    Kikuchi Toshiaki

    2010-06-01

    Full Text Available Abstract Background Empirical support for cognitive behavioral therapy (CBT for treating Japanese patients with major depression is lacking, therefore, a feasibility study of CBT for depression in Japanese clinical settings is urgently required. Findings A culturally adapted, 16-week manualized individual CBT program for Japanese patients with major depressive disorder was developed. A total of 27 patients with major depression were enrolled in a single-group study with the purpose of testing the feasibility of the program. Twenty six patients (96% completed the study. The mean total score on the Beck Depression Inventory-II (BDI-II for all patients (Intention-to-treat sample improved from 32.6 to 11.7, with a mean change of 20.8 (95% confidence interval: 17.0 to 24.8. Within-group effect size at the endpoint assessment was 2.64 (Cohen's d. Twenty-one patients (77.7% showed treatment response and 17 patients (63.0% achieved remission at the end of the program. Significant improvement was observed in measurement of subjective and objective depression severity (assessed by BDI-II, Quick Inventory of Depressive Symptomatology-Self Rated, and Hamilton Depression Rating Scale, dysfunctional attitude (assessed by Dysfunctional Attitude Scale, global functioning (assessed by Global Assessment of Functioning of DSM-IV and subjective well-being (assessed by WHO Subjective Well-being Inventory (all p values Conclusions Our manualized treatment comprised of a 16-week individual CBT program for major depression appears feasible and may achieve favorable treatment outcomes among Japanese patients with major depression. Further research involving a larger sample in a randomized, controlled trial design is warranted. Trial registration UMIN-CTR UMIN000002542.

  15. Cognitive behavioral therapy for depression among adults in Japanese clinical settings: a single-group study

    Science.gov (United States)

    2010-01-01

    Background Empirical support for cognitive behavioral therapy (CBT) for treating Japanese patients with major depression is lacking, therefore, a feasibility study of CBT for depression in Japanese clinical settings is urgently required. Findings A culturally adapted, 16-week manualized individual CBT program for Japanese patients with major depressive disorder was developed. A total of 27 patients with major depression were enrolled in a single-group study with the purpose of testing the feasibility of the program. Twenty six patients (96%) completed the study. The mean total score on the Beck Depression Inventory-II (BDI-II) for all patients (Intention-to-treat sample) improved from 32.6 to 11.7, with a mean change of 20.8 (95% confidence interval: 17.0 to 24.8). Within-group effect size at the endpoint assessment was 2.64 (Cohen's d). Twenty-one patients (77.7%) showed treatment response and 17 patients (63.0%) achieved remission at the end of the program. Significant improvement was observed in measurement of subjective and objective depression severity (assessed by BDI-II, Quick Inventory of Depressive Symptomatology-Self Rated, and Hamilton Depression Rating Scale), dysfunctional attitude (assessed by Dysfunctional Attitude Scale), global functioning (assessed by Global Assessment of Functioning of DSM-IV) and subjective well-being (assessed by WHO Subjective Well-being Inventory) (all p values < 0.001). Conclusions Our manualized treatment comprised of a 16-week individual CBT program for major depression appears feasible and may achieve favorable treatment outcomes among Japanese patients with major depression. Further research involving a larger sample in a randomized, controlled trial design is warranted. Trial registration UMIN-CTR UMIN000002542. PMID:20529252

  16. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  17. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  18. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  19. AN ANALYSIS OF TEN YEARS OF THE FOUR GRAND SLAM MEN'S SINGLES DATA FOR LACK OF INDEPENDENCE OF SET OUTCOMES

    Directory of Open Access Journals (Sweden)

    Denny Meyer

    2006-12-01

    Full Text Available The objective of this paper is to use data from the highest level in men's tennis to assess whether there is any evidence to reject the hypothesis that the two players in a match have a constant probability of winning each set in the match. The data consists of all 4883 matches of grand slam men's singles over a 10 year period from 1995 to 2004. Each match is categorised by its sequence of win (W or loss (L (in set 1, set 2, set 3,... to the eventual winner. Thus, there are several categories of matches from WWW to LLWWW. The methodology involves fitting several probabilistic models to the frequencies of the above ten categories. One four-set category is observed to occur significantly more often than the other two. Correspondingly, a couple of the five-set categories occur more frequently than the others. This pattern is consistent when the data is split into two five-year subsets. The data provides significant statistical evidence that the probability of winning a set within a match varies from set to set. The data supports the conclusion that, at the highest level of men's singles tennis, the better player (not necessarily the winner lifts his play in certain situations at least some of the time

  20. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  1. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  2. Complex Dynamic Scene Perception: Effects of Attentional Set on Perceiving Single and Multiple Event Types

    Science.gov (United States)

    Sanocki, Thomas; Sulman, Noah

    2013-01-01

    Three experiments measured the efficiency of monitoring complex scenes composed of changing objects, or events. All events lasted about 4 s, but in a given block of trials, could be of a single type (single task) or of multiple types (multitask, with a total of four event types). Overall accuracy of detecting target events amid distractors was…

  3. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  4. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  5. Setting Passing Scores on Passage-Based Tests: A Comparison of Traditional and Single-Passage Bookmark Methods

    Science.gov (United States)

    Skaggs, Gary; Hein, Serge F.; Awuor, Risper

    2007-01-01

    In this study, a variation of the bookmark standard setting procedure for passage-based tests is proposed in which separate ordered item booklets are created for the items associated with each passage. This variation is compared to the traditional bookmark procedure for a fifth-grade reading test. The results showed that the single-passage…

  6. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  7. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

    Science.gov (United States)

    Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

    2017-12-01

    We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

  9. Interactive Effects of Growth Regulators, Carbon Sources, pH on Plant Regeneration and Assessment of Genetic Fidelity Using Single Primer Amplification Reaction (SPARS) Techniques in Withania somnifera L.

    Science.gov (United States)

    Fatima, Nigar; Ahmad, Naseem; Ahmad, Iqbal; Anis, Mohammad

    2015-09-01

    An improved and methodical in vitro shoot morphogenic approach through axillary bud multiplication was established in a drug yielding plant, Withania somnifera L. Effects of plant growth regulators [6-benzyladenine (BA), kinetin (Kin), 2-isopentenyladenine (2iP), and thidiazuron (TDZ)] either singly or in combination with α-napthalene acetic acid (NAA), indole-3-butyric acid (IBA), and indole-3-acetic acid (IAA) in Murashige and Skoog (MS) medium were tested. The highest regeneration frequency (90 %) with optimum number of shoots (32 ± 0.00)/explant were obtained on MS medium fortified with 2.5 μM 6-benzyladenine (BA) and 0.5 μM NAA and 30 g/l sucrose at pH 5.8. Among the tried TDZ concentrations, 0.5 μM resulted in maximum number of shoots (20.4 ± 0.40)/explant after 4 weeks of exposure. The proliferating shoot cultures established by repeated subculturing of the mother explants on the hormone-free medium produced the highest shoot number (29.4 ± 0.40) with shoot length (6.80 ± 0.12 cm)/explant at fourth subculture passage, which a decline in shoot proliferation was recorded. Different concentrations of NAA were tested for ex vitro rooting of microshoots. The maximum percentage of rooting 100 % with maximum roots (18.3 ± 0.1) was achieved in soilrite when basal portion of the microshoots were treated with 200 μM (NAA) for 15 min per shoot. The plantlets went through hardening phase in a growth chamber, prior to ex vitro transfer. The PCR-based single primer amplification reaction (SPAR) methods which include random amplified polymorphic DNA (RAPD) and direct amplification of minisatellite DNA (DAMD) markers has been used for assessment of genetic stability of micropropagated plantlets. No variation was observed in DNA fingerprinting patterns among the micropropagated and the donor plants illustrating their genetic uniformity.

  10. Single- and multiple-set resistance training improves skeletal and respiratory muscle strength in elderly women

    Directory of Open Access Journals (Sweden)

    Abrahin O

    2014-10-01

    Full Text Available Odilon Abrahin,1–3 Rejane P Rodrigues,1–3 Vanderson C Nascimento,3 Marzo E Da Silva-Grigoletto,1,4 Evitom C Sousa,3 Anderson C Marçal1,2 1Department of Physical Education, Federal University of Sergipe, Sergipe, Brazil; 2Center of Research in Intracellular Signaling, Department of Morphology, Federal University of Sergipe, Sergipe, Brazil; 3Laboratory of Resistance Exercise and Health, Sports Department, University of Pará State, Belem, Brazil; 4Scientific Sport, Sergipe, Brazil Introduction: Aging involves a progressive reduction of respiratory muscle strength as well as muscle strength. Purpose: Compare the effects of resistance training volume on the maximum inspiratory pressure (MIP, maximum expiratory pressure (MEP, functional performance, and muscle strength in elderly women. Methods: Thirty elderly women were randomly assigned to a group performing either single sets (1-SET or three sets (3-SET of exercises. The sit-to-stand test, MIP, MEP, and muscle strength were assessed before and after 24 training sessions. Progressive resistance training was performed two times per week for a total of 8–12 repetitions, using the main muscle groups of the upper and lower limbs. Results: The main results showed that the participants significantly increased their MEP (P<0.05; 1-SET: 34.6%; 3-SET: 35.8% and MIP (P<0.05; 1-SET: 13.7%; 3-SET: 11.2%. Both groups also improved in the sit-to-stand test (P<0.05; 1-SET: 10.6%; 3-SET: 17.1%. After 24 training sessions, muscle strength also significantly increased (P<0.0001; 40%–80% in both groups. An intergroup comparison did not show any statistically significant differences between the groups in any of the parameters analyzed. Conclusion: Single- and multiple-set resistance training programs increased MIP, MEP, muscle strength, and sit-to-stand test performance in elderly women after 24 sessions of training. In conclusion, our results suggested that elderly women who are not in the habit of

  11. Gene Set Analyses of Genome-Wide Association Studies on 49 Quantitative Traits Measured in a Single Genetic Epidemiology Dataset

    Directory of Open Access Journals (Sweden)

    Jihye Kim

    2013-09-01

    Full Text Available Gene set analysis is a powerful tool for interpreting a genome-wide association study result and is gaining popularity these days. Comparison of the gene sets obtained for a variety of traits measured from a single genetic epidemiology dataset may give insights into the biological mechanisms underlying these traits. Based on the previously published single nucleotide polymorphism (SNP genotype data on 8,842 individuals enrolled in the Korea Association Resource project, we performed a series of systematic genome-wide association analyses for 49 quantitative traits of basic epidemiological, anthropometric, or blood chemistry parameters. Each analysis result was subjected to subsequent gene set analyses based on Gene Ontology (GO terms using gene set analysis software, GSA-SNP, identifying a set of GO terms significantly associated to each trait (pcorr < 0.05. Pairwise comparison of the traits in terms of the semantic similarity in their GO sets revealed surprising cases where phenotypically uncorrelated traits showed high similarity in terms of biological pathways. For example, the pH level was related to 7 other traits that showed low phenotypic correlations with it. A literature survey implies that these traits may be regulated partly by common pathways that involve neuronal or nerve systems.

  12. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  13. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  14. Inclusive Classrooms for LGBTQ Students: Using Linked Text Sets to Challenge the Hegemonic "Single Story"

    Science.gov (United States)

    Dodge, Autumn M.; Crutcher, Paul A.

    2015-01-01

    As teachers, it is important that we grapple with the reality that schools, teachers, and the larger social institutions that impact us are never neutral. Scholars explain that the starting place for teachers who want to enact practices for social justice and to disrupt harmful "single stories" is to read LGBTQ titles and consider how…

  15. Forensic usefulness of a 25 X-chromosome single-nucleotide polymorphism marker set

    DEFF Research Database (Denmark)

    Tomas, Carmen; Sanchez, Juan J; Castro, Jose Aurelio

    2010-01-01

    -nucleotide polymorphisms (X-SNPs) is still limited. STUDY DESIGN AND METHODS: The forensic usefulness of a set of 25 SNPs located across the X-chromosome was analyzed in 13 populations. The applicability of the 25 X-SNPs in kinship testing was illustrated in two immigration cases where the conclusions based....... The usefulness of X-chromosome markers was particularly illustrative in Case 1, where the typing of 25 X-SNPs would have been sufficient to exclude paternity. CONCLUSION: The high level of polymorphism, low degree of linkage disequilibrium, and very low probability of mutation of the 25 X-SNPs makes this set...

  16. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  17. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  18. DNA Cross-Bridging Shapes a Single Nucleus from a Set of Mitotic Chromosomes.

    Science.gov (United States)

    Samwer, Matthias; Schneider, Maximilian W G; Hoefler, Rudolf; Schmalhorst, Philipp S; Jude, Julian G; Zuber, Johannes; Gerlich, Daniel W

    2017-08-24

    Eukaryotic cells store their chromosomes in a single nucleus. This is important to maintain genomic integrity, as chromosomes packaged into separate nuclei (micronuclei) are prone to massive DNA damage. During mitosis, higher eukaryotes disassemble their nucleus and release individualized chromosomes for segregation. How numerous chromosomes subsequently reform a single nucleus has remained unclear. Using image-based screening of human cells, we identified barrier-to-autointegration factor (BAF) as a key factor guiding membranes to form a single nucleus. Unexpectedly, nuclear assembly does not require BAF's association with inner nuclear membrane proteins but instead relies on BAF's ability to bridge distant DNA sites. Live-cell imaging and in vitro reconstitution showed that BAF enriches around the mitotic chromosome ensemble to induce a densely cross-bridged chromatin layer that is mechanically stiff and limits membranes to the surface. Our study reveals that BAF-mediated changes in chromosome mechanics underlie nuclear assembly with broad implications for proper genome function. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Puncture black hole initial data: A single domain Galerkin-collocation method for trumpet and wormhole data sets

    Science.gov (United States)

    Clemente, P. C. M.; de Oliveira, H. P.

    2017-07-01

    We present a single-domain Galerkin-collocation method to calculate puncture initial data sets for single and binary black holes, either in the trumpet or wormhole geometries. The combination of aspects belonging to the Galerkin and the collocation methods together with the adoption of spherical coordinates in all cases are shown to be very effective. We propose a unified expression for the conformal factor to describe trumpet and spinning black holes. In particular, for the spinning trumpet black holes, we exhibit the deformation of the limit surface due to the spin from a sphere to an oblate spheroid. We also revisit the energy content in the trumpet and wormhole puncture data sets. The algorithm can be extended to describe binary black holes.

  20. A set-covering formulation for a drayage problem with single and double container loads

    Science.gov (United States)

    Ghezelsoflu, A.; Di Francesco, M.; Frangioni, A.; Zuddas, P.

    2018-01-01

    This paper addresses a drayage problem, which is motivated by the case study of a real carrier. Its trucks carry one or two containers from a port to importers and from exporters to the port. Since up to four customers can be served in each route, we propose a set-covering formulation for this problem where all possible routes are enumerated. This model can be efficiently solved to optimality by a commercial solver, significantly outperforming a previously proposed node-arc formulation. Moreover, the model can be effectively used to evaluate a new distribution policy, which results in an enlarged set of feasible routes and can increase savings w.r.t. the policy currently employed by the carrier.

  1. Investigations on heavy ion induced Single-Event Transients (SETs) in highly-scaled FinFETs

    International Nuclear Information System (INIS)

    Gaillardin, M.; Raine, M.; Paillet, P.; Adell, P.C.; Girard, S.; Duhamel, O.; Andrieu, F.; Barraud, S.; Faynot, O.

    2015-01-01

    We investigate Single-Event Transients (SET) in different designs of multiple-gate devices made of FinFETs with various geometries. Heavy ion experimental results are explained by using a thorough charge collection analysis of fast transients measured on dedicated test structures. Multi-level simulations are performed to get new insights into the charge collection mechanisms in multiple-gate devices. Implications for multiple-gate device design hardening are finally discussed.

  2. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  3. Training With Curved Laparoscopic Instruments in Single-Port Setting Improves Performance Using Straight Instruments: A Prospective Randomized Simulation Study.

    Science.gov (United States)

    Lukovich, Peter; Sionov, Valery Ben; Kakucs, Timea

    2016-01-01

    Lately single-port surgery is becoming a widespread procedure, but it is more difficult than conventional laparoscopy owing to the lack of triangulation. Although, these operations are also possible with standard laparoscopic instruments, curved instruments are being developed. The aims of the study were to identify the effect of training on a box trainer in single-port setting on the quality of acquired skills, and transferred with the straight and curved instruments for the basic laparoscopic tasks, and highlight the importance of a special laparoscopic training curriculum. A prospective study on a box trainer in single-port setting was conducted using 2 groups. Each group performed 2 tasks on the box trainer in single-port setting. Group-S used conventional straight laparoscopic instruments, and Group-C used curved laparoscopic instruments. Learning curves were obtained by daily measurements recorded in 7-day sessions. On the last day, the 2 groups changed instruments between each other. 1st Department of Surgery, Semmelweis University of Medicine from Budapest, Hungary, a university teaching hospital. In all, 20 fifth-year medical students were randomized into 2 groups. None of them had any laparoscopic or endoscopic experience. Participation was voluntary. Although Group-S performed all tasks significantly faster than Group-C on the first day, the difference proved to be nonsignificant on the last day. All participants achieved significantly shorter task completion time on the last day than on the first day, regardless of the instrument they used. Group-S showed improvement of 63.5%, and Group-C 69.0% improvement by the end of the session. After swapping the instruments, Group-S reached significantly higher task completion time with curved instruments, whereas Group-C showed further progression of 8.9% with straight instruments. Training with curved instruments in a single-port setting allows for a better acquisition of skills in a shorter period. For this

  4. Identification of a core set of rhizobial infection genes using data from single cell-types

    Directory of Open Access Journals (Sweden)

    Da-Song eChen

    2015-07-01

    Full Text Available Genome-wide expression studies on nodulation have varied in their scale from entire root systems to dissected nodules or root sections containing nodule primordia. More recently efforts have focused on developing methods for isolation of root hairs from infected plants and the application of laser-capture microdissection technology to nodules. Here we analyze two published data sets to identify a core set of infection genes that are expressed in the nodule and in root hairs during infection. Among the genes identified were those encoding phenylpropanoid biosynthesis enzymes including Chalcone-O-Methyltransferase which is required for the production of the potent Nod gene inducer 4’,4-dihydroxy-2-methoxychalcone. A promoter-GUS analysis in transgenic hairy roots for two genes encoding Chalcone-O-Methyltransferase isoforms revealed their expression in rhizobially infected root hairs and the nodule infection zone but not in the nitrogen fixation zone. We also describe a group of Rhizobially Induced Peroxidases whose expression overlaps with the production of superoxide in rhizobially infected root hairs and in nodules and roots. Finally, we identify a cohort of co-regulated transcription factors as candidate regulators of these processes.

  5. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    containing 100 μg ml -1 of ampicillin. White colonies were screened for the presence of insert by single colony lysis PCR with M13 forward and reverse primers. PCR protocol included an initial hot start incubation (5 min at 94 o C) followed by 34 cycles... and ambiguously aligned sequences were removed from the further analyses. A phylogenetic analysis was conducted using distance setting maximum likelihood (ML) in MEGA 5.03 (Kumar et al, 2008) with 1000 bootstrap replicates. Individual phylogenetic trees were...

  6. Homogenous, real-time duplex loop-mediated isothermal amplification using a single fluorophore-labeled primer and an intercalator dye: Its application to the simultaneous detection of Shiga toxin genes 1 and 2 in Shiga toxigenic Escherichia coli isolates.

    Science.gov (United States)

    Kouguchi, Yoshihiro; Fujiwara, Takako; Teramoto, Miki; Kuramoto, Mika

    2010-08-01

    We developed a completely homogeneous duplex loop-mediated isothermal amplification (LAMP) method. The present LAMP method employed a combination of a 6-carboxyfluorescein (FAM)-labeled primer (donor) for one target gene, a non-labeled primer for the other, and an intercalator ethidium bromide (EtBr) dye (acceptor) on the basis of fluorescence resonance energy transfer (FRET) between the FAM donor and EtBr acceptor. Measuring changes in fluorescence of FAM enabled the LAMP method to detect two different genes simultaneously. This method was used to detect Shiga toxin genes in Shiga toxigenic Escherichia coli isolates, demonstrating simultaneous detection of two different genes with rapidity and accuracy. Copyright 2010 Elsevier Ltd. All rights reserved.

  7. Comprehensive detection of diverse exon 19 deletion mutations of EGFR in lung Cancer by a single probe set.

    Science.gov (United States)

    Bae, Jin Ho; Jo, Seong-Min; Kim, Hak-Sung

    2015-12-15

    Detection of exon 19 deletion mutation of EGFR, one of the most frequently occurring mutations in lung cancer, provides the crucial information for diagnosis and treatment guideline in non-small-cell lung cancer (NSCLC). Here, we demonstrate a simple and efficient method to detect various exon 19 deletion mutations of EGFR using a single probe set comprising of an oligo-quencher (oligo-Q) and a molecular beacon (MB). While the MB hybridizes to both the wild and mutant target DNA, the oligo-Q only binds to the wild target DNA, leading to a fluorescent signal in case of deletion mutation. This enables the comprehensive detection of the diverse exon 19 deletion mutations using a single probe set. We demonstrated the utility and efficiency of the approach by detecting the frequent exon 19 deletion mutations of EGFR through a real-time PCR and in situ fluorescence imaging. Our approach enabled the detection of genomic DNA as low as 0.02 ng, showing a detection limit of 2% in a heterogeneous DNA mixture, and could be used for detecting mutations in a single cell level. The present MB and oligo-Q dual probe system can be used for diagnosis and treatment guideline in NSCLC. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Testing initiatives increase rates of HIV diagnosis in primary care and community settings: an observational single-centre cohort study.

    Directory of Open Access Journals (Sweden)

    Prini Mahendran

    Full Text Available The primary objective was to examine trends in new HIV diagnoses in a UK area of high HIV prevalence between 2000 and 2012 with respect to site of diagnosis and stage of HIV infection.Single-centre observational cohort study.An outpatient HIV department in a secondary care UK hospital.1359 HIV-infected adults.Demographic information (age, gender, ethnicity, and sexual orientation, site of initial HIV diagnosis (Routine settings such as HIV/GUM clinics versus Non-Routine settings such as primary care and community venues, stage of HIV infection, CD4 count and seroconversion symptoms were collated for each participant.There was a significant increase in the proportion of new HIV diagnoses made in Non-Routine settings (from 27.0% in 2000 to 58.8% in 2012; p<0.001. Overall there was a decrease in the rate of late diagnosis from 50.7% to 32.9% (p=0.001. Diagnosis of recent infection increased from 23.0% to 47.1% (p=0.001. Of those with recent infection, significantly more patients were likely to report symptoms consistent with a seroconversion illness over the 13 years (17.6% to 65.0%; p<0.001.This is the first study, we believe, to demonstrate significant improvements in HIV diagnosis and a shift in diagnosis of HIV from HIV/GUM settings to primary practice and community settings due to multiple initiatives.

  9. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  10. Single case design studies in music therapy: resurrecting experimental evidence in small group and individual music therapy clinical settings.

    Science.gov (United States)

    Geist, Kamile; Hitchcock, John H

    2014-01-01

    The profession would benefit from greater and routine generation of causal evidence pertaining to the impact of music therapy interventions on client outcomes. One way to meet this goal is to revisit the use of Single Case Designs (SCDs) in clinical practice and research endeavors in music therapy. Given the appropriate setting and goals, this design can be accomplished with small sample sizes and it is often appropriate for studying music therapy interventions. In this article, we promote and discuss implementation of SCD studies in music therapy settings, review the meaning of internal study validity and by extension the notion of causality, and describe two of the most commonly used SCDs to demonstrate how they can help generate causal evidence to inform the field. In closing, we describe the need for replication and future meta-analysis of SCD studies completed in music therapy settings. SCD studies are both feasible and appropriate for use in music therapy clinical practice settings, particularly for testing effectiveness of interventions for individuals or small groups. © the American Music Therapy Association 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Lead Free Electric Primer

    Science.gov (United States)

    2011-10-06

    resulted in a number of accidental ignitions. The true nanocomposite is significantly more ESD sensitive. Normally, a Tesla coil will set off the Al(80nm...Bi2O3 (2 µ) composite at a distance of 2 inches. The nanocomposite ignites when the Tesla coil gets within 10 to 12 inches. While the nanocomposite... valve was placed in the ice chest along with an abundant amount of dry ice. Appropriate plastic hoses were attached to the inlet and outlet fittings

  12. Identity Management A Primer

    CERN Document Server

    Sharoni, Ilan; Williamson, Graham; Yip, David

    2009-01-01

    In an age in which the boundaries between the real and the virtual are becoming increasingly blurred, this timely guide teaches both the key issues of identity management as well as appropriate strategies and preventative measures for ensuring personal safety in the virtual world. In a corporate setting, it is essential to identify and control the way in which the organization deals with customers, suppliers, employees, and other users who may interact with the information systems of the company. Providing strategies for overcoming this task in real-world terms as well as questions that assist

  13. Primer on radiation

    International Nuclear Information System (INIS)

    Rados, B.

    1979-01-01

    Sources of anthropogenic radiation and their relative risk are discussed. Natural radiation accounts for more than half the exposure most U.S. citizens receive; the average citizen is exposed to about 100 mrem/yr. Medical and dental X-rays and radioactive material used to diagnose and treat illness account for 90% of all anthropogenic exposure. The remaining 10% comes from nuclear weapons testing, nuclear power plants, industrial uses of radioactive materials, and minute emissions from consumer products, such as color television sets. Occupationally exposed workers face greater risks from radiation. Means of calculating health risks are explained. Mechanisms of biological damage from ionizing radiation are outlined

  14. The calculus primer

    CERN Document Server

    Schaaf, William L

    2011-01-01

    Comprehensive but concise, this introduction to differential and integral calculus covers all the topics usually included in a first course. The straightforward development places less emphasis on mathematical rigor, and the informal manner of presentation sets students at ease. Many carefully worked-out examples illuminate the text, in addition to numerous diagrams, problems, and answers.Bearing the needs of beginners constantly in mind, the treatment covers all the basic concepts of calculus: functions, derivatives, differentiation of algebraic and transcendental functions, partial different

  15. Single-channel EEG sleep stage classification based on a streamlined set of statistical features in wavelet domain.

    Science.gov (United States)

    da Silveira, Thiago L T; Kozakevicius, Alice J; Rodrigues, Cesar R

    2017-02-01

    The main objective of this study was to enhance the performance of sleep stage classification using single-channel electroencephalograms (EEGs), which are highly desirable for many emerging technologies, such as telemedicine and home care. The proposed method consists of decomposing EEGs by a discrete wavelet transform and computing the kurtosis, skewness and variance of its coefficients at selected levels. A random forest predictor is trained to classify each epoch into one of the Rechtschaffen and Kales' stages. By performing a comprehensive set of tests on 106,376 epochs available from the Physionet public database, it is demonstrated that the use of these three statistical moments has enhanced performance when compared to their application in the time domain. Furthermore, the chosen set of features has the advantage of exhibiting a stable classification performance for all scoring systems, i.e., from 2- to 6-state sleep stages. The stability of the feature set is confirmed with ReliefF tests which show a performance reduction when any individual feature is removed, suggesting that this group of feature cannot be further reduced. The accuracies and kappa coefficients yield higher than 90 % and 0.8, respectively, for all of the 2- to 6-state sleep stage classification cases.

  16. A primer in combinatorics

    CERN Document Server

    Kheyfits, Alexander

    2010-01-01

    This textbook is devoted to Combinatorics and Graph Theory, which are cornerstones of Discrete Mathematics. Every section begins with simple model problems. Following their detailed analysis, the reader is led through the derivation of definitions, concepts and methods for solving typical problems. Theorems then are formulated, proved and illustrated by more problems of increasing difficulty. Topics covered include elementary combinatorial constructions, application to probability theory, introduction to graphs and trees with application to hierarchical clustering algorithms, more advanced counting techniques, and existence theorems in combinatorial analysis. The text systematically employs the basic language of set theory. This approach is often useful for solving combinatorial problems, especially problems where one has to identify some objects, and significantly reduces the number of the students' errors; it is demonstrated in the text on many examples. The textbook is suitable for undergraduate and entry-...

  17. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  18. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  19. A primer on metagenomics.

    Directory of Open Access Journals (Sweden)

    John C Wooley

    2010-02-01

    Full Text Available Metagenomics is a discipline that enables the genomic study of uncultured microorganisms. Faster, cheaper sequencing technologies and the ability to sequence uncultured microbes sampled directly from their habitats are expanding and transforming our view of the microbial world. Distilling meaningful information from the millions of new genomic sequences presents a serious challenge to bioinformaticians. In cultured microbes, the genomic data come from a single clone, making sequence assembly and annotation tractable. In metagenomics, the data come from heterogeneous microbial communities, sometimes containing more than 10,000 species, with the sequence data being noisy and partial. From sampling, to assembly, to gene calling and function prediction, bioinformatics faces new demands in interpreting voluminous, noisy, and often partial sequence data. Although metagenomics is a relative newcomer to science, the past few years have seen an explosion in computational methods applied to metagenomic-based research. It is therefore not within the scope of this article to provide an exhaustive review. Rather, we provide here a concise yet comprehensive introduction to the current computational requirements presented by metagenomics, and review the recent progress made. We also note whether there is software that implements any of the methods presented here, and briefly review its utility. Nevertheless, it would be useful if readers of this article would avail themselves of the comment section provided by this journal, and relate their own experiences. Finally, the last section of this article provides a few representative studies illustrating different facets of recent scientific discoveries made using metagenomics.

  20. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  1. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  2. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  3. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  4. A prospective 10-year study of metal ceramic single crowns and fixed dental prosthesis retainers in private practice settings.

    Science.gov (United States)

    Reitemeier, Bernd; Hänsel, Kristina; Kastner, Christian; Weber, Anke; Walter, Michael H

    2013-03-01

    Metal ceramic restorations are widely used in prosthodontics, but long-term data on their clinical performance in private practice settings based on prospective trials are sparse. This clinical trial was designed to provide realistic long-term survival rates for different outcomes related to tooth loss, crown loss, and metal ceramic defect. Ninety-five participants were provided with 190 noble metal ceramic single crowns and 138 participants with 276 fixed dental prosthesis retainer crowns on vital posterior teeth. Follow-up examinations were scheduled 2 weeks after insertion, annually up to 8 years, and after 10 years. Kaplan-Meier survival analyses, Mantel-Cox logrank tests, and Cox regression analyses were conducted. Because of variations in the time of the last examinations, the maximum observation period was 12.1 years. For the primary outcome 'loss of crown or tooth', the Kaplan-Meier survival rate was 94.3% ±1.8% (standard error) at 8.0 years (last outcome event) for single crowns and 94.4% ±1.5% at 11.0 years for fixed dental prosthesis retainer crowns. The difference between the survival functions was not significant (P>.05). For the secondary outcome 'metal ceramic defect', the survival rate was 88.8% ±3.2% at 11.0 years for single crowns and 81.7% ±3.5% at 11.0 years for fixed dental prosthesis retainer crowns. In Cox regression models, the only significant covariates for the outcome event 'metal ceramic defect' were bruxism in the medical history (single crowns) and signs and symptoms of bruxism (fixed dental prosthesis retainer crowns) with hazard ratios of 3.065 (95% CI 1.063 - 8.832) and 2.554 (95% CI 1.307 - 4.992). Metal ceramic crowns provided in private practice settings show good longevity. Bruxism appears to indicate a risk for metal ceramic defects. Copyright © 2013 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  5. Consistent indexing of a (set of) single crystal SAED pattern(s) with the ProcessDiffraction program

    International Nuclear Information System (INIS)

    Labar, Janos L.

    2005-01-01

    A computer program called 'ProcessDiffraction' helps indexing a set of single crystal selected area electron diffraction (SAED) patterns by determining which of the presumed structures can fit all the measured patterns simultaneously. Distances and angles are measured in the digitalized patterns with a graphical tool by clicking on the two shortest non-collinear vectors (spots), using user-supplied calibration data. Centers of the spots and center of the pattern are optionally refined by the program. Suggested individual indexing solutions (consistent with an assumed unit cell) are listed by the program for each pattern. Simulated patterns are also consulted to check if the shortest calculated distances coincide with measured ones. Common solutions for the set are selected by checking the angles between the suggested zone axes against the angles between the experimental goniometer settings. The indexing process is manually controlled by selecting the candidate structures (one-by-one) for indexing and by specifying the tolerances for d-values, plane angles and zone angles. Patterns of any crystal system can be indexed successfully. Although error bars are larger in electron diffraction than in X-ray diffraction (XRD), frequently, many unrelated indexings are possible for any one electron diffraction pattern (irrespective of the indexing method), a set of SAED patterns can generally be indexed unambiguously, i.e. the three-dimensional reciprocal space can be identified correctly. Two other tools also help planning tilting experiments: zones along a plane can be listed (with their angles extended from a pre-selected zone in that plane) and zones lying at a given angle (specified with a tolerance) from a zone can also be identified (as they are situated between two cones). Another tool searches the XRD database directly either for advice on possible structures for a composition or to help calibration

  6. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  7. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  8. Accurate prediction of complex free surface flow around a high speed craft using a single-phase level set method

    Science.gov (United States)

    Broglia, Riccardo; Durante, Danilo

    2017-11-01

    This paper focuses on the analysis of a challenging free surface flow problem involving a surface vessel moving at high speeds, or planing. The investigation is performed using a general purpose high Reynolds free surface solver developed at CNR-INSEAN. The methodology is based on a second order finite volume discretization of the unsteady Reynolds-averaged Navier-Stokes equations (Di Mascio et al. in A second order Godunov—type scheme for naval hydrodynamics, Kluwer Academic/Plenum Publishers, Dordrecht, pp 253-261, 2001; Proceedings of 16th international offshore and polar engineering conference, San Francisco, CA, USA, 2006; J Mar Sci Technol 14:19-29, 2009); air/water interface dynamics is accurately modeled by a non standard level set approach (Di Mascio et al. in Comput Fluids 36(5):868-886, 2007a), known as the single-phase level set method. In this algorithm the governing equations are solved only in the water phase, whereas the numerical domain in the air phase is used for a suitable extension of the fluid dynamic variables. The level set function is used to track the free surface evolution; dynamic boundary conditions are enforced directly on the interface. This approach allows to accurately predict the evolution of the free surface even in the presence of violent breaking waves phenomena, maintaining the interface sharp, without any need to smear out the fluid properties across the two phases. This paper is aimed at the prediction of the complex free-surface flow field generated by a deep-V planing boat at medium and high Froude numbers (from 0.6 up to 1.2). In the present work, the planing hull is treated as a two-degree-of-freedom rigid object. Flow field is characterized by the presence of thin water sheets, several energetic breaking waves and plungings. The computational results include convergence of the trim angle, sinkage and resistance under grid refinement; high-quality experimental data are used for the purposes of validation, allowing to

  9. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  10. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  11. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  12. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  13. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  14. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  15. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L. and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance.

    Directory of Open Access Journals (Sweden)

    Steve Babben

    Full Text Available Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.. Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i identification of genomic and coding sequences (CDS of candidate genes, (ii intron- and exon-structure reconstruction, (iii identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv; testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT lines, a set of 65 primer pairs (54.6%, corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence.

  16. Single well thermal tracer test, a new experimental set up for characterizing thermal transport in fractured media

    Science.gov (United States)

    de La Bernardie, Jérôme; Bour, Olivier; Guihéneuf, Nicolas; Chatton, Eliot; Labasque, Thierry; Longuevergne, Laurent; Le Lay, Hugo; Koch, Floriant; Gerard, Marie-Françoise; Le Borgne, Tanguy

    2017-04-01

    Thermal transport in fractured media depends on the hydrological properties of fractures and thermal characteristics of rock. Tracer tests using heat as tracer can thus be a good alternative to characterize fractured media for shallow geothermal needs. This study investigates the possibility of implementing a new thermal tracer test set up, the single well thermal tracer test, to characterize hydraulic and thermal transport properties of fractured crystalline rock. The experimental setup is based on injecting hot water in a fracture isolated by a double straddle packer in the borehole while pumping and monitoring the temperature in a fracture crossing the same borehole at greater elevation. One difficulty comes from the fact that injection and withdrawal are achieved in the same borehole involving thermal losses along the injection tube that may disturb the heat recovery signal. To be able to well localize the heat influx, we implemented a Fiber-Optic Distributed Temperature Sensing (FO-DTS) which allows the temperature monitoring with high spatial and temporal resolution (29 centimeters and 30 seconds respectively). Several tests, at different pumping and injection rates, were performed in a crystalline rock aquifer at the experimental site of Ploemeur (H+ observatory network). We show through signal processing how the thermal breakthrough may be extracted thanks to Fiber-Optic distributed temperature measurements. In particular, we demonstrate how detailed distributed temperature measurements were useful to identify different inflows and to estimate how much heat was transported and stored within the fractures network. Thermal breakthrough curves of single well thermal tracer tests were then interpreted with a simple analytical model to characterize hydraulic and thermal characteristics of the fractured media. We finally discuss the advantages of these tests compared to cross-borehole thermal tracer tests.

  17. Reusable, extensible, and modifiable R scripts and Kepler workflows for comprehensive single set ChIP-seq analysis.

    Science.gov (United States)

    Cormier, Nathan; Kolisnik, Tyler; Bieda, Mark

    2016-07-05

    There has been an enormous expansion of use of chromatin immunoprecipitation followed by sequencing (ChIP-seq) technologies. Analysis of large-scale ChIP-seq datasets involves a complex series of steps and production of several specialized graphical outputs. A number of systems have emphasized custom development of ChIP-seq pipelines. These systems are primarily based on custom programming of a single, complex pipeline or supply libraries of modules and do not produce the full range of outputs commonly produced for ChIP-seq datasets. It is desirable to have more comprehensive pipelines, in particular ones addressing common metadata tasks, such as pathway analysis, and pipelines producing standard complex graphical outputs. It is advantageous if these are highly modular systems, available as both turnkey pipelines and individual modules, that are easily comprehensible, modifiable and extensible to allow rapid alteration in response to new analysis developments in this growing area. Furthermore, it is advantageous if these pipelines allow data provenance tracking. We present a set of 20 ChIP-seq analysis software modules implemented in the Kepler workflow system; most (18/20) were also implemented as standalone, fully functional R scripts. The set consists of four full turnkey pipelines and 16 component modules. The turnkey pipelines in Kepler allow data provenance tracking. Implementation emphasized use of common R packages and widely-used external tools (e.g., MACS for peak finding), along with custom programming. This software presents comprehensive solutions and easily repurposed code blocks for ChIP-seq analysis and pipeline creation. Tasks include mapping raw reads, peakfinding via MACS, summary statistics, peak location statistics, summary plots centered on the transcription start site (TSS), gene ontology, pathway analysis, and de novo motif finding, among others. These pipelines range from those performing a single task to those performing full analyses of

  18. Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

    Science.gov (United States)

    Koester, Meike; Gergs, René

    2017-10-05

    Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

  19. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  20. A Marker-Based Approach for the Automated Selection of a Single Segmentation from a Hierarchical Set of Image Segmentations

    Science.gov (United States)

    Tarabalka, Y.; Tilton, J. C.; Benediktsson, J. A.; Chanussot, J.

    2012-01-01

    The Hierarchical SEGmentation (HSEG) algorithm, which combines region object finding with region object clustering, has given good performances for multi- and hyperspectral image analysis. This technique produces at its output a hierarchical set of image segmentations. The automated selection of a single segmentation level is often necessary. We propose and investigate the use of automatically selected markers for this purpose. In this paper, a novel Marker-based HSEG (M-HSEG) method for spectral-spatial classification of hyperspectral images is proposed. Two classification-based approaches for automatic marker selection are adapted and compared for this purpose. Then, a novel constrained marker-based HSEG algorithm is applied, resulting in a spectral-spatial classification map. Three different implementations of the M-HSEG method are proposed and their performances in terms of classification accuracies are compared. The experimental results, presented for three hyperspectral airborne images, demonstrate that the proposed approach yields accurate segmentation and classification maps, and thus is attractive for remote sensing image analysis.

  1. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  2. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  3. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  4. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  5. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  6. Performance of single and concatenated sets of mitochondrial genes at inferring metazoan relationships relative to full mitogenome data.

    Directory of Open Access Journals (Sweden)

    Justin C Havird

    Full Text Available Mitochondrial (mt genes are some of the most popular and widely-utilized genetic loci in phylogenetic studies of metazoan taxa. However, their linked nature has raised questions on whether using the entire mitogenome for phylogenetics is overkill (at best or pseudoreplication (at worst. Moreover, no studies have addressed the comparative phylogenetic utility of mitochondrial genes across individual lineages within the entire Metazoa. To comment on the phylogenetic utility of individual mt genes as well as concatenated subsets of genes, we analyzed mitogenomic data from 1865 metazoan taxa in 372 separate lineages spanning genera to subphyla. Specifically, phylogenies inferred from these datasets were statistically compared to ones generated from all 13 mt protein-coding (PC genes (i.e., the "supergene" set to determine which single genes performed "best" at, and the minimum number of genes required to, recover the "supergene" topology. Surprisingly, the popular marker COX1 performed poorest, while ND5, ND4, and ND2 were most likely to reproduce the "supergene" topology. Averaged across all lineages, the longest ∼2 mt PC genes were sufficient to recreate the "supergene" topology, although this average increased to ∼5 genes for datasets with 40 or more taxa. Furthermore, concatenation of the three "best" performing mt PC genes outperformed that of the three longest mt PC genes (i.e, ND5, COX1, and ND4. Taken together, while not all mt PC genes are equally interchangeable in phylogenetic studies of the metazoans, some subset can serve as a proxy for the 13 mt PC genes. However, the exact number and identity of these genes is specific to the lineage in question and cannot be applied indiscriminately across the Metazoa.

  7. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species

    OpenAIRE

    Sánchez Robles, José Manuel; Talavera Lozano, Salvador; García Castaño, Juan Luis; Terrab Benjelloun, Anass; Navarro Sampedro, Laura; Balao Robles, Francisco J.

    2012-01-01

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other ...

  8. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  9. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... They constitute an interesting model because they are indispensable for biochemical ecosystem balance (Paoletti and Hassall 1999) and because of their suitability for measuring the direct effects of human activi- ties on their habitats. ... Such increases in plot size may entail habitat fragmenta- tion through ...

  10. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... ing the impact of changes in agricultural practices on agroe- cosystems and their associated isopod diversity, we ... landscape features and agricultural practices on genetic struc- ture and demographic history of A. nasatum ..... In Integrating efficient grassland farming and biodiversity, (ed. R. Lillak, R. Viiralt,.

  11. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  12. Comparing the Accuracy Rate of Two Different Universal Primers in Enteric Pathogen Diagnosis From Blood

    Directory of Open Access Journals (Sweden)

    Esmaeil Soleimani

    2014-02-01

    Full Text Available Background: Detecting enteric bacteria in blood by culture is a slow assay with low accuracy rate. PCR might be a suitable alternative assay but as several species can cause bacteremia, it is necessary to use universal primers. Objectives: In this study we evaluated and compared two pairs of universal primers in detecting four enteric bacteria in blood, which are common causes of bacteremia in human. Materials and Methods: Standard strains of E. faecalis, S. typhi, E. coli, and S. Aeruginosa, were used in this study. A serially diluted bacterial suspension of all strains was made for inoculation to four sets of defibrinated sheep blood which were used to prepare blood specimens with different bacterial contents for performing routine assay and PCR. PCR was performed using two different universal primers designed from two ribosomal genes, 16sr RNA and 23sr RNA. Results: PCR with 16sr RNA universal primer showed more accuracy rate than both blood culture and PCR with 23sr RNA universal primer. Mean time for performing PCR assay and blood culture was eight and 48 hours, respectively. Conclusions: Both PCR with 16sr RNA and 23sr RNA universal primers have more accuracy rate than blood culture and are faster in detection of bacteremia. PCR with 16sr RNA universal primer is more accurate than both PCR with 16sr RNA universal primer and blood culture for diagnosis of bacteremia.

  13. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  14. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  15. On the existence and uniqueness problems of solutions for set-valued and single-valued nonlinear operator equations in probabilistic normed spaces

    Directory of Open Access Journals (Sweden)

    Shih-Sen Chang

    1994-01-01

    Full Text Available In this paper, we introduce the concept of more general probabilistic contractors in probabilistic normed spaces and show the existence and uniqueness of solutions for set-valued and single-valued nonlinear operator equations in Menger probabilistic normed spaces.

  16. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    Science.gov (United States)

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  17. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  18. Group vs. single mindfulness meditation: exploring avoidance, impulsivity, and weight management in two separate mindfulness meditation settings.

    Science.gov (United States)

    Mantzios, Michail; Giannou, Kyriaki

    2014-07-01

    Recent research has identified that mindfulness meditation in group settings supports people who are trying to lose weight. The present research investigated mindfulness meditation in group and individual settings, and explored the potential impact on weight loss and other factors (i.e. mindfulness, impulsivity, and avoidance) that may assist or hinder weight loss. Specifically, the hypotheses tested were that the group setting assisted dieters more than the individual setting by reducing weight, cognitive-behavioral avoidance, and impulsivity and by increasing mindfulness. Participants (n = 170) who were trying to lose weight were randomly assigned to practice meditation for 6 weeks within a group or independently. Measurements in mindfulness, cognitive-behavioral avoidance, impulsivity, and weight occurred twice (pre- and post-intervention). Results indicated that participants in the group setting lost weight and lowered their levels of cognitive-behavioral avoidance, while impulsivity and mindfulness remained stable. On the other hand, participants in the individual condition lost less weight, while there was an increase in cognitive-behavioral avoidance and mindfulness scores, but a decrease in impulsivity. Seeing that benefits and limitations observed in group settings are not replicated when people meditate alone, this study concluded that mindfulness meditation in individual settings needs to be used with caution, although there are some potential benefits that could aid future weight loss research. © 2014 The International Association of Applied Psychology.

  19. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  20. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  1. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  2. Fixed Points of Single- and Set-Valued Mappings in Uniformly Convex Metric Spaces with No Metric Convexity

    Directory of Open Access Journals (Sweden)

    Rafa Espínola

    2010-01-01

    Full Text Available We study the existence of fixed points and convergence of iterates for asymptotic pointwise contractions in uniformly convex metric spaces. We also study the existence of fixed points for set-valued nonexpansive mappings in the same class of spaces. Our results do not assume convexity of the metric which makes a big difference when studying the existence of fixed points for set-valued mappings.

  3. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  4. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  5. Comparing signal intensity and refraction sensitivity of double and single mask edge illumination lab-based x-ray phase contrast imaging set-ups

    Science.gov (United States)

    Kallon, G. K.; Diemoz, P. C.; Vittoria, F. A.; Basta, D.; Endrizzi, M.; Olivo, A.

    2017-10-01

    Double mask edge illumination (DM-EI) set-ups can detect differential phase and attenuation information from a sample. However, analytical separation of the two signals often requires acquiring two frames with inverted differential phase contrast signals. Typically, between these two acquisitions, the first mask is moved to create a different illumination condition. This can lead to potential errors which adversely affect the data collected. In this paper, we implement a single mask EI laboratory set-up that allows for a single shot retrieval of the differential phase and attenuation images, without the need for a high resolution detector or high magnification. As well as simplifying mask alignment, the advantages of the proposed set-up can be exploited in one of two ways: either the total acquisition time can be halved with respect to the DM-EI set-up or, for the same acquisition time, twice the statistics can be collected. In this latter configuration, the signal-to-noise ratio and contrast in the mixed intensity images, and the angular sensitivity of the two set-ups were compared. We also show that the angular sensitivity of the single mask set-up can be well approximated from its illumination curve, which has been modelled as a convolution between the source spatial distribution at the detector plane, the pre-sample mask and the detector point spread function (PSF). A polychromatic wave optics simulation was developed on these bases and benchmarked against experimental data. It can also be used to predict the angular sensitivity and contrast of any set-up as a function of detector PSF.

  6. Comparing signal intensity and refraction sensitivity of double and single mask edge illumination lab-based x-ray phase contrast imaging set-ups

    International Nuclear Information System (INIS)

    Kallon, G K; Diemoz, P C; Vittoria, F A; Basta, D; Endrizzi, M; Olivo, A

    2017-01-01

    Double mask edge illumination (DM-EI) set-ups can detect differential phase and attenuation information from a sample. However, analytical separation of the two signals often requires acquiring two frames with inverted differential phase contrast signals. Typically, between these two acquisitions, the first mask is moved to create a different illumination condition. This can lead to potential errors which adversely affect the data collected. In this paper, we implement a single mask EI laboratory set-up that allows for a single shot retrieval of the differential phase and attenuation images, without the need for a high resolution detector or high magnification. As well as simplifying mask alignment, the advantages of the proposed set-up can be exploited in one of two ways: either the total acquisition time can be halved with respect to the DM-EI set-up or, for the same acquisition time, twice the statistics can be collected. In this latter configuration, the signal-to-noise ratio and contrast in the mixed intensity images, and the angular sensitivity of the two set-ups were compared. We also show that the angular sensitivity of the single mask set-up can be well approximated from its illumination curve, which has been modelled as a convolution between the source spatial distribution at the detector plane, the pre-sample mask and the detector point spread function (PSF). A polychromatic wave optics simulation was developed on these bases and benchmarked against experimental data. It can also be used to predict the angular sensitivity and contrast of any set-up as a function of detector PSF. (paper)

  7. Single-case effect size calculation: comparing regression and non-parametric approaches across previously published reading intervention data sets.

    Science.gov (United States)

    Ross, Sarah G; Begeny, John C

    2014-08-01

    Growing from demands for accountability and research-based practice in the field of education, there is recent focus on developing standards for the implementation and analysis of single-case designs. Effect size methods for single-case designs provide a useful way to discuss treatment magnitude in the context of individual intervention. Although a standard effect size methodology does not yet exist within single-case research, panel experts recently recommended pairing regression and non-parametric approaches when analyzing effect size data. This study compared two single-case effect size methods: the regression-based, Allison-MT method and the newer, non-parametric, Tau-U method. Using previously published research that measured the Words read Correct per Minute (WCPM) variable, these two methods were examined by comparing differences in overall effect size scores and rankings of intervention effect. Results indicated that the regression method produced significantly larger effect sizes than the non-parametric method, but the rankings of the effect size scores had a strong, positive relation. Implications of these findings for research and practice are discussed. Copyright © 2014 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  8. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  10. Multi-valued logic circuits using hybrid circuit consisting of three gates single-electron transistors (TG-SETs) and MOSFETs.

    Science.gov (United States)

    Shin, SeungJun; Yu, YunSeop; Choi, JungBum

    2008-10-01

    New multi-valued logic (MVL) families using the hybrid circuits consisting of three gates single-electron transistors (TG-SETs) and a metal-oxide-semiconductor field-effect transistor (MOSFET) are proposed. The use of SETs offers periodic literal characteristics due to Coulomb oscillation of SET, which allows a realization of binary logic (BL) circuits as well as multi-valued logic (MVL) circuits. The basic operations of the proposed MVL families are successfully confirmed through SPICE circuit simulation based on the physical device model of a TG-SET. The proposed MVL circuits are found to be much faster, but much larger power consumption than a previously reported MVL, and they have a trade-off between speed and power consumption. As an example to apply the newly developed MVL families, a half-adder is introduced.

  11. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.

    Directory of Open Access Journals (Sweden)

    Hideki Shojo

    Full Text Available Polymerase chain reaction-amplified product length polymorphism (PCR-APLP is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  12. Effect of Modifying Intervention Set Size with Acquisition Rate Data While Practicing Single-Digit Multiplication Facts

    Science.gov (United States)

    Burns, Matthew K.; Zaslofsky, Anne F.; Maki, Kathrin E.; Kwong, Elena

    2016-01-01

    Incremental rehearsal (IR) has consistently led to effective retention of newly learned material, including math facts. The number of new items taught during one intervention session, called the intervention set, could be used to individualize the intervention. The appropriate amount of information that a student can rehearse and later recall…

  13. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  14. Return to Work and Multilevel Versus Single-Level Cervical Fusion for Radiculopathy in a Workers' Compensation Setting.

    Science.gov (United States)

    Faour, Mhamad; Anderson, Joshua T; Haas, Arnold R; Percy, Rick; Woods, Stephen T; Ahn, Uri M; Ahn, Nicholas U

    2017-01-15

    Retrospective comparative cohort study. Examine the impact of multilevel fusion on return to work (RTW) status and compare RTW status after multi- versus single-level cervical fusion for patients with work-related injury. Patients with work-related injuries in the workers' compensation systems have less favorable surgical outcomes. Cervical fusion provides a greater than 90% likelihood of relieving radiculopathy and stabilizing or improving myelopathy. However, more levels fused at index surgery are reportedly associated with poorer surgical outcomes than single-level fusion. Data was collected from the Ohio Bureau of Workers' Compensation (BWC) between 1993 and 2011. The study population included patients who underwent cervical fusion for radiculopathy. Two groups were constructed (multilevel fusion [MLF] vs. single-level fusion [SLF]). Outcomes measures evaluated were: RTW criteria, RTW cervical fusion for radiculopathy was associated with poor return to work profile after surgery. Multilevel cervical fusion was associated with lower RTW rates, less likelihood of achieving stable return to work, and higher rate of disability after surgery. 3.

  15. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    , ALS1 and HWP1 genes were specific for C. albicans, while the ones for CAP1, CAT1, EFG1, LIP3, and PLB1 were detected in C. albicans and C. dubliniensis. After optimization, all primers presented a single peak on melt curves, correlation coefficient of ≅1 and qPCR reaction efficiency of 90-110%, with slope of ≅-3.3. Therefore, these primers should be suitable for future gene expression analyses from clinical samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. The Idiographic Study of Leadership Behavior in Natural Settings: An Empirical Analysis Using a Single Case Experimental Design.

    Science.gov (United States)

    1982-08-01

    Management , 1977, 1, 105-109. LAuthans, F. Leadership : A proposal for a social learning theory base and observational and functional analysis...Manz, C.C., & Sims, H.P. Self management as a substitute for leadership : A social learning theory perspective. Academy of Management Review, 1980, 5...AD-AI19 89 NEBRASKA UNIV LINCOLN DEPT OF MANAGEMENT F/G 5/1 THE IDIOGRAPHIC STUDY OF LEADERSHIP BEHAVIOR IN NATURAL SETTING-ETCIU)AUG 82 T R DAVI , F

  17. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  18. Visual CRO display of pulse height distribution including discriminator setting for a single channel X-ray analyser

    International Nuclear Information System (INIS)

    Shaw, S.E.

    1979-01-01

    An outline for a simple pulse spectroscope which attaches to a standard laboratory CRO is presented. The peak amplitude voltage of each pulse from the linear amplifier of a single channel X-ray analyser is stored for the duration of one oscilloscope trace. For each amplifier pulse, input from the discriminator is tested and if these is coincidence of pulses the oscilloscope beam is blanked for approximately the first 2 cm of its traverse across the screen. Repetition of pulses forms a pulse height distribution with a rectangular dark area marking the position of the discriminator window. (author)

  19. Single-dose compared with multiple day antibiotic prophylaxis for cesarean section in low-resource settings, a randomized controlled, noninferiority trial.

    Science.gov (United States)

    Westen, Esther H M N; Kolk, Pascal R; van Velzen, Christine L; Unkels, Regine; Mmuni, Nicholaus S; Hamisi, Alex D; Nakua, Ritha E; Vlek, Anne L M; van Beekhuizen, Heleen J

    2015-01-01

    To investigate the efficacy of a single prophylactic dose of ampicillin combined with metronidazole to prevent postcesarean section infections compared with a multiple day regimen in low-resource settings. An evaluator-blinded randomized, controlled, noninferiority trial. Two rural hospitals in Tanzania. Of 181 enrolled eligible women with an indication for cesarean section, information on 176 was analyzed by intention-to-treat. The women were randomly assigned to either the intervention group who received a single dose of ampicillin and metronidazole, or to the control group who received a multiple-day regimen of ampicillin/amoxicillin and metronidazole. The primary outcome was maternal postcesarean infection. Secondary outcomes were severity of these infections, other maternal complications, and the duration of hospital stay. In the intervention group (n = 89), six women (6.7%) developed a wound infection compared with nine (10.3%) in the control group (n = 87) (difference 3.60; 95% CI -4.65 to 11.85) (p = 0.40). A single dose of prophylactic ampicillin and metronidazole is equally effective as a multiple-day regimen in preventing postcesarean wound infections in low-resource settings, therefore it can be considered as a good strategy in low-resource settings. The reduced quantity of prophylactic antibiotics will reduce costs without increasing the risk of maternal infection. © 2014 Nordic Federation of Societies of Obstetrics and Gynecology.

  20. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  1. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  2. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  3. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  4. A 5-year retrospective study of survival of zirconia single crowns fitted in a private clinical setting.

    Science.gov (United States)

    Ortorp, Anders; Kihl, Maria Lind; Carlsson, Gunnar E

    2012-06-01

    The aim of this report was to evaluate the 5-year clinical performance and survival of zirconia (NobelProcera™) single crowns. All patients treated with porcelain-veneered zirconia single crowns in a private practice during the period October 2004 to November 2005 were included. The records were scrutinized for clinical data. Information was available for 162 patients and 205 crowns. Most crowns (78%) were placed on premolars and molars. Out of the 143 crowns that were followed for 5 years, 126 (88%) did not have any complications. Of those with complications, the most common were: extraction of abutment tooth (7; 3%), loss of retention (15; 7%), need of endodontic treatment (9; 4%) and porcelain veneer fracture (6; 3%). No zirconia cores fractured. In total 19 restorations (9%) were recorded as failures: abutment tooth extraction (7), remake of crown due to lost retention (6), veneer fracture (4), persistent pain (1) and caries (1). The 5-year cumulative survival rate (CSR) was 88.8%. According to the present 5-year results zirconia crowns (NobelProcera™) are a promising prosthodontic alternative also in the premolar and molar regions. Out of the 143 crowns followed for 5 years, 126 (88%) did not have any complications. However, 9% of the restorations were judged as failures. Further studies are necessary to evaluate the long-term success. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus.

    Science.gov (United States)

    Komorowska, B; Malinowski, T; Michalczuk, L

    2010-09-01

    Detection of Apple stem pitting virus (ASPV) using RT-PCR based methods was studied in infected apple and pear trees. Three virus-specific primers (ASPF1CP, ASPF2CP, ASPR3CP) were designed to target the most conservative regions of the coat protein gene of 10 virus isolates in Poland and 7 other ASPV sequences available in GenBank. The suitability of the primer pairs ASPF1CP-ASPR3CP and ASPF2CP-ASPR3CP for detection of 19 virus isolates was checked. Both new primer pairs initiated amplification of a specific product from all sources tested. From 1 to 11 isolates were not detected with the primer sets published previously. Detection of the virus in the samples collected in March, using ASPF1CP-ASPR3CP primer pair, was possible up to 512 times dilution. For the samples collected in July, virus was detected in the extracts from infected plants diluted eight times. More than 100-fold increase of sensitivity could be obtained by semi-nested PCR with primers ASPF2CP-ASPR3CP following the first round with ASPF1CP-ASPR3CP. Identification of virus isolates with different number of deletions in the coat protein gene was possible using RT-PCR with newly designed reverse primer ASPDEL in combination with the published primer ASPV7956. Besides, the comparative analysis of silicacapture-RT-PCR (SC-RT-PCR) versus immunocapture-RT-PCR (IC-RT-PCR) assays was carried out. Few ASPV isolates escaped detection by IC-RT-PCR, while all isolates tested were detected using the SC-RT-PCR with the new primers. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Moderation of effects of AAC based on setting and types of aided AAC on outcome variables: an aggregate study of single-case research with individuals with ASD.

    Science.gov (United States)

    Ganz, Jennifer B; Rispoli, Mandy J; Mason, Rose Ann; Hong, Ee Rea

    2014-06-01

    The purpose of this meta-analysis was to evaluate the potential moderating effects of intervention setting and type of aided augmentative and alternative communication (AAC) on outcome variables for students with autism spectrum disorders. Improvement rate difference, an effect size measure, was used to calculate aggregate effects across 35 single-case research studies. Results indicated that the largest effects for aided AAC were observed in general education settings. With respect to communication outcomes, both speech generating devices (SGDs) and the Picture Exchange Communication System (PECS) were associated with larger effects than other picture-based systems. With respect to challenging behaviour outcomes, SGDs produced larger effects than PECS. This aggregate study highlights the importance of considering intervention setting, choice of AAC system and target outcomes when designing and planning an aided AAC intervention.

  7. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  8. Association of different primers and resin cements for adhesive bonding to zirconia ceramics.

    Science.gov (United States)

    Maeda, Fernando Akio; Bello-Silva, Marina Stella; de Paula Eduardo, Carlos; Miranda Junior, Walter Gomes; Cesar, Paulo Francisco

    2014-06-01

    To evaluate the shear bond strength (SBS) to zirconia ceramics using different associations of primers and resin cements. Two blocks of LAVA zirconia (3Y-TZP) were randomly submitted to an application of three different commercially available primers: Alloy Primer (AP), Z-Prime Plus (ZP), and Signum Zirconia Bond (SZB). Nonprimed specimens were considered controls. After treatment, the 80 specimens (5 mm × 5 mm × 2 mm) were randomly cemented with one of the resin cements: Panavia F, Multilink, seT, and NX3. For cementation, cylinders of resin cement were built on the ceramic surfaces using the SDI SBS apparatus. The specimens were submitted to the SBS test. Fractured surfaces were observed under stereomicroscopy to determine the failure mode, and mean bond strength values were analyzed using the Kruskal-Wallis and Mann-Whitney tests (α = 0.05). Signum Zirconia Bond had the highest SBS compared to all other primers and the control group, regardless of the resin cement used. The highest values were obtained when associating Panavia F with Signum Zirconia Bond. Alloy Primer increased bonding values when associated with seT cement only. When no primer was used, no statistical difference was observed among resin cements. All specimens fractured due to adhesive failure. Signum Zirconia Bond is capable of increasing bonding values of resin cements to zirconia ceramics. Its association with Panavia F shows enhanced results when considering short-term adhesion to zirconia.

  9. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  10. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  11. Preclinical evaluation of Sunitinib as a single agent in the prophylactic setting in a mouse model of bone metastases

    Directory of Open Access Journals (Sweden)

    Schem Christian

    2013-01-01

    Full Text Available Abstract Background A substantial number of breast cancer patients are identified as being at high risk of developing metastatic disease. With increasing number of targeted therapeutics entering clinical trials, chronic administration of these agents may be a feasible approach for the prevention of metastases within this subgroup of patients. In this preclinical study we examined whether Sunitinib, a multi-tyrosine kinase inhibitor which has anti-angiogenic and anti-resorptive activity, is effective in the prevention of bone metastases. Method Sunitinib was administered daily with the first dose commencing prior to tumor cell inoculation. Intracardiac injection was performed with MDA-MB23 bone-seeking cells, which were stably transfected with DsRed2. In vivo plain radiography and fluorescent imaging (Berthold NightOwl was used in the analysis of bone metastases. Histomorphometry was used for the quantification of TRAP+ cells from bone sections and immunohistochemistry was performed using an antibody reactive to CD34 for quantification of microvessel density. Results Preventive dosing administration of Sunitinib does not inhibit colonization of tumor cells to bone or reduce the size of osteolytic lesions. There was a decrease in the number of TRAP+ cells with Sunitinib treatment but this did not reach significance. Sunitinib inhibited tumor growth as determined by imaging of fluorescent tumor area. Immunohistochemical analyses of microvessel density revealed a concomitant decrease in the number of tumor blood vessels. Conclusions The findings suggest that Sunitinib can be used as a therapeutic agent for the treatment of bone metastases but as a single agent it is not effective in terms of prevention. Therefore a combination approach with other cytostatic drugs should be pursued.

  12. Use of allele-specific sequencing primers is an efficient alternative to PCR subcloning of low-copy nuclear genes.

    Science.gov (United States)

    Scheen, Anne-Cathrine; Pfeil, Bernard E; Petri, Anna; Heidari, Nahid; Nylinder, Stephan; Oxelman, Bengt

    2012-01-01

    Direct Sanger sequencing of polymerase chain reaction (PCR)-amplified nuclear genes leads to polymorphic sequences when allelic variation is present. To overcome this problem, most researchers subclone the PCR products to separate alleles. An alternative is to directly sequence the separate alleles using allele-specific primers. We tested two methods to enhance the specificity of allele-specific primers for use in direct sequencing: using short primers and amplification refractory mutation system (ARMS) technique. By shortening the allele-specific primer to 15-13 nucleotides, the single mismatch in the ultimate base of the primer is enough to hinder the amplification of the nontarget allele in direct sequencing and recover only the targeted allele at high accuracy. The deliberate addition of a second mismatch, as implemented in the ARMS technique, was less successful and seems better suited for allele-specific amplification in regular PCR rather than in direct sequencing. © 2011 Blackwell Publishing Ltd.

  13. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    Despite economic importance, the origin and domestication of mulberry has not ..... The numbers at the nodes in each tree are the bootstrap percent values (only values greater than or equal to 50 are shown) for the ..... Dandin S B 1998 Mulberry: A versatile biosource in the service of mankind; Acta Sericologica Sinica 24 ...

  14. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    ). Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the ...

  15. A Bilingual Child Learns Social Communication Skills through Video Modeling-A Single Case Study in a Norwegian School Setting

    Directory of Open Access Journals (Sweden)

    Meral Özerk

    2015-09-01

    Full Text Available Video modeling is one of the recognized methods used in the training and teaching of children with Autism Spectrum Disorders (ASD. The model’s theoretical base stems from Albert Bandura's (1977; 1986 social learning theory in which he asserts that children can learn many skills and behaviors observationally through modeling. One can assume that by observing others, a child with ASD can construct an idea of how new behaviors are performed, and on later occasions this mentally and visually constructed information will serve as a guide for his/her way of behaving. There are two types of methods for model learning: 1 In Vivo Modeling and 2 Video Modeling. These can be used a to teach children with ASD skills that are not yet in their behavioral repertoire and / or b to improve the children's emerging behaviors or skills. In the case of linguistic minority children at any stage of their bilingual development, it has been presumed that some of their behaviors that can be interpreted as attitude or culture-related actions. This approach, however, can sometimes delay referral, diagnosis, and intervention. In our project, we used Video Modeling and positive targeted results with regard to teaching social communication skills and target behavior to an eleven year-old bilingual boy with ASD. Our study also reveals that through Video Modeling, children with ASD can learn desirable behavioral skills as by-products. Video Modeling can also contribute positively to the social inclusion of bilingual children with ASD in school settings. In other words, bilingual children with ASD can transfer the social communication skills and targeted behaviors they learn through second-language at school to a first-language milieu.

  16. A bilingual child learns social communication skills through video modeling-a single case study in a norwegian school setting

    Directory of Open Access Journals (Sweden)

    Meral Özerk

    2015-09-01

    Full Text Available Video modeling is one of the recognized methods used in the training and teaching of children with Autism Spectrum Disorders (ASD. The model’s theoretical base stems from Albert Bandura's (1977; 1986 social learning theory in which he asserts that children can learn many skills and behaviors observationally through modeling. One can assume that by observing others, a child with ASD can construct an idea of how new behaviors are performed, and on later occasions this mentally and visually constructed information will serve as a guide for his/her way of behaving. There are two types of methods for model learning: 1 In Vivo Modeling and 2 Video Modeling. These can be used a to teach children with ASD skills that are not yet in their behavioral repertoire and / or b to improve the children's emerging behaviors or skills. In the case of linguistic minority children at any stage of their bilingual development, it has been presumed that some of their behaviors that can be interpreted as attitude or culture-related actions. This approach, however, can sometimes delay referral, diagnosis, and intervention. In our project, we used Video Modeling and achieved positive results with regard to teaching social communication skills and target behavior to an eleven year-old bilingual boy with ASD. Our study also reveals that through Video Modeling, children with ASD can learn desirable behavioral skills as by-products. Video Modeling can also contribute positively to the social inclusion of bilingual children with ASD in school settings. In other words, bilingual children with ASD can transfer the social communication skills and targeted behaviors they learn through second-language at school to a first-language milieu.

  17. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  18. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  19. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  20. Setting Single or Multiple Goals for Diet and Physical Activity Behaviors Improves Cardiovascular Disease Risk Factors in Adults With Type 2 Diabetes: A Pragmatic Pilot Randomized Trial.

    Science.gov (United States)

    Swoboda, Christine M; Miller, Carla K; Wills, Celia E

    2016-08-01

    The purpose of this study was to evaluate a 4-month telephone-based goal-setting and decision support intervention among adults with type 2 diabetes mellitus (T2DM) and multiple risk factors for cardiovascular disease (CVD). A randomized pretest-posttest control group design was employed. Overweight or obese adults aged 40 to 75 years with T2DM and ≥1 additional CVD risk factor were provided with individualized CVD risk information. At baseline and each biweekly telephone call, the multiple-goal group self-selected both diet- and physical activity-related goals, the single goal group set a single goal, and the control group received information about community health resources. Dietary intake was assessed via a food frequency questionnaire, physical activity via questionnaire, and A1C and blood lipids via fasting fingerstick sample. Between-group differences for clinical (ie, A1C, blood pressure, and blood lipids), physical activity, and dietary variables were evaluated using Kruskal-Wallis, Mann-Whitney U, analysis of variance, and t tests. From pre- to postintervention, the single-goal group demonstrated significant improvement in systolic blood pressure and intake of servings of fruits, vegetables, and refined grains (all P < .05). The multiple-goal group reported significant reduction in percent energy from total, saturated, monounsaturated, and trans fat intake and significant increase in leisure time walking (all P < .05). A multiple-goal approach over 4 months can improve dietary and physical activity outcomes, while a single-goal approach may facilitate improvement in one behavioral domain. Additional research is needed to evaluate maintenance of the achieved changes. © 2016 The Author(s).

  1. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  2. A primer of analytical mechanics

    CERN Document Server

    Strocchi, Franco

    2018-01-01

    This book presents the basic elements of Analytical Mechanics, starting from the physical motivations that favor it with respect to the Newtonian Mechanics in Cartesian coordinates. Rather than presenting Analytical Mechanics mainly as a formal development of Newtonian Mechanics, it highlights its effectiveness due to the following five important achievements: 1) the most economical description of time evolution in terms of the minimal set of coordinates, so that there are no constraint forces in their evolution equations; 2) the form invariance of the evolution equations, which automatically solves the problem of fictitious forces; 3) only one scalar function encodes the formulation of the dynamics, rather than the full set of vectors which describe the forces in Cartesian Newtonian Mechanics; 4) in the Hamiltonian formulation, the corresponding evolution equations are of first order in time and are fully governed by the Hamiltonian function (usually corresponding to the energy); 5) the emergence of the Hami...

  3. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  4. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  5. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  6. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  7. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  8. Deep groundwater flow systems and their characterization in single-well settings by ''push-pull'' tracer tests

    Energy Technology Data Exchange (ETDEWEB)

    Hebig-Schubert, Klaus

    2014-11-21

    This thesis demonstrates the growing importance of deep groundwater research and the increasing demand for the development of suitable single-well test methods. At the forefront of the research on groundwater in the deep underground, radioactive waste disposal in deep geological repositories, CO{sub 2} storage, geothermal energy supply, and aquifer storage and recovery systems (ASR) are on the agenda. The developments of suitable methods for investigating these resources are a main target. Currently available methods show considerable limitations. Accordingly, comprehensive methods for the hydraulic and hydrochemical characterization of deeper aquifers with single-well access are needed. Therefore, the goal of this PhD thesis was to identify, test, and enhance potentially suitable single-well methods for characterization of groundwater flow and solute transport in such settings. For this, several Single-Well Injection-Withdrawal (''push-pull'') tracer tests were applied at the Hamasato field site (Horonobe, Japan) in a ∝100 m deep groundwater monitoring well. Aim was to characterize the impact of a dynamic saltwater-freshwater interface on a coastal aquifer. Based on the experiences of the first methodological test, a second field campaign was conducted. This campaign focused on a systematic evaluation of the push-pull tracer test method for the first time at all. The experiments focused on the investigation of the so-called ''chaser'' and its impact on the test results. The chaser is a specific part of many push-pull tracer tests setups. From these experiments, a specific test design for the investigation of the saltwater-freshwater interface in a single-well setting was developed. The application of this design on questions regarding different fluids within the same system, e.g. different mineralized fluids (saltwater-freshwater-interface, ASR) or temperatures (geothermal research), are promising future approaches for

  9. Setting up a Prospective Thyroid Biobank for Translational Research: Practical Approach of a Single Institution (2004-2009, Pasteur Hospital, Nice, France).

    Science.gov (United States)

    Lassalle, Sandra; Hofman, Véronique; Ilie, Marius; Butori, Catherine; Bonnetaud, Christelle; Gaziello, Marie Clotilde; Selva, Eric; Gavric-Tanga, Virginie; Guevara, Nicolas; Castillo, Laurent; Santini, José; Chabannon, Christian; Hofman, Paul

    2011-03-01

    In the last few years, conditions for setting up a human biobank in France have been upgraded by taking into account (1) the new laws and regulations that integrate the ethical and societal dimension of biobanking and delineate the risks for patients associated with the procurement of human cells and tissues, (2) the increasing request by scientists for human samples with proven biological quality and sophisticated sets of annotations, including information produced through the evergrowing use of molecular biology in pathology, and (3) establishment of procedures concerning the safety of the personnel working with biological products. For this purpose, health authorities and national research institutes in France have provided significant support for the set up of biobanks. The present work was conducted to describe how we set up a biobank targeting diseases of a specific organ (thyroid gland), with the aim of rapidly developing translational research projects. The prospective experience of a single institution (Pasteur Hospital, Nice, France) over a 6-year period (2004-2009) is presented from the practical point of view of a surgical pathology laboratory. We describe different procedures required to obtain high-quality thyroid biological resources and clinical annotations. The procedures were established for the management of biological products obtained from 1454 patients who underwent thyroid surgery. The preanalytical steps leading to the storage of frozen specimens were carried out in parallel with diagnostic procedures. As the number of international networks for research programs using biological products is steadily increasing, it is crucial to harmonize the procedures used by biobanks. In this regard, the described thyroid biobank has been set up using criteria established by the French National Cancer Institute (Institut National du Cancer) to guarantee the quality of different collections stored in biobanks.

  10. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  11. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  12. Geographic exchange standard and primer

    Energy Technology Data Exchange (ETDEWEB)

    1978-10-01

    The ANSI Draft Proposal Specifications for an Information Interchange Data Descriptive File, X3L5.SEP, contains some Guidelines for Implementation (Appendix D). However, some additional guidelines should be provided specifically for the more commonly used systems of coding locational data, and referring thematic data to those codes. While there is no consensus that a single, preferred representation of geographical files can be specified as a standard for exchange, there is agreement on the generic form of record structures for commonly used, two-dimensional files. This report surveys by example common practice and illustrates the use of geocodes as thematic data pointers. It defines the elements of the structures as a subsystem within the interchange standard. An implementation within the Levels of Implementation of the basic IWGDE Standard is proposed and examples for some of the defined file types are presented in numerical form to aid in understanding. The problem of referring thematic data to a geographic file when these data reside in a physically distinct exchange file is discussed. 14 figures, 1 table. (RWR)

  13. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

    Science.gov (United States)

    Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

    2010-02-01

    QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

  14. Evaluation of new multiplex PCR primers for the identification ofPlasmodium species found in Sabah, Malaysia.

    Science.gov (United States)

    Stanis, Cheronie Shely; Song, Beng Kah; Chua, Tock Hing; Lau, Yee Ling; Jelip, Jenarun

    2016-01-05

    Malaria is a major public health problem, especially in the Southeast Asia region, caused by 5 species of Plasmodium (P. falciparum, P. vivax, P. malariae, P. ovale, and P. knowlesi). The aim of this study was to compare parasite species identification methods using the new multiplex polymerase chain reaction (PCR) against nested PCR and microscopy. Blood samples on filter papers were subject to conventional PCR methods using primers designed by us in multiplex PCR and previously designed primers of nested PCR. Both sets of results were compared with microscopic identification. Of the 129 samples identified as malaria-positive by microscopy, 15 samples were positive for P. falciparum, 14 for P. vivax, 6 for P. knowlesi, 72 for P. malariae, and 2 for mixed infection of P. falciparum/P. malariae. Both multiplex and nested PCR identified 12 P. falciparum single infections. For P. vivax, 9 were identified by multiplex and 12 by nested PCR. For 72 P. malariae cases, multiplex PCR identified 58 as P. knowlesi and 10 as P. malariae compared to nested PCR, which identified 59 as P. knowlesi and 7 as P. malariae. Multiplex PCR could be used as alternative molecular diagnosis for the identification of all Plasmodium species as it requires a shorter time to screen a large number of samples.

  15. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  16. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  17. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  18. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  19. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  20. Current procedural terminology; a primer.

    Science.gov (United States)

    Hirsch, Joshua A; Leslie-Mazwi, Thabele M; Nicola, Gregory N; Barr, Robert M; Bello, Jacqueline A; Donovan, William D; Tu, Raymond; Alson, Mark D; Manchikanti, Laxmaiah

    2015-04-01

    In 1966, The American Medical Association (AMA) working with multiple major medical specialty societies developed an iterative coding system for describing medical procedures and services using uniform language, the Current Procedural Terminology (CPT) system. The current code set, CPT IV, forms the basis of reporting most of the services performed by healthcare providers, physicians and non-physicians as well as facilities allowing effective, reliable communication among physician and other providers, third parties and patients. This coding system and its maintenance has evolved significantly since its inception, and now goes well beyond its readily perceived role in reimbursement. Additional roles include administrative management, tracking new and investigational procedures, and evolving aspects of 'pay for performance'. The system also allows for local, regional and national utilization comparisons for medical education and research. Neurointerventional specialists use CPT category I codes regularly--for example, 36,215 for first-order cerebrovascular angiography, 36,216 for second-order vessels, and 37,184 for acute stroke treatment by mechanical means. Additionally, physicians add relevant modifiers to the CPT codes, such as '-26' to indicate 'professional charge only,' or '-59' to indicate a distinct procedural service performed on the same day. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  1. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  3. Evaluation of J and CTOD (Crack Tip Opening Displacement) fracture parameters for pipeline steels using Single Edge Notch Tension SE(T) specimens

    Energy Technology Data Exchange (ETDEWEB)

    Paredes Tobar, Lenin Marcelo; Ruggieri, Claudio [Universidade de Sao Paulo (USP), SP (Brazil). Escola Politecnica. Dept. de Engenharia Naval e Oceanica

    2009-12-19

    This work presents an evaluation procedure to determine the elastic-plastic J-integral and CTOD for pin-loaded and clamped single edge notch tension (SE(T)) specimens based upon the eta-method. The primary objective is to derive estimation equations applicable to determine J and CTOD fracture parameters for a wide range of a/W-ratios and material flow properties. Very detailed non-linear finite element analyses for plane-strain and full-thickness, 3-D models provide the evolution of load with increased crack mouth opening displacement which is required for the estimation procedure. The present analyses, when taken together with previous studies provide a fairly extensive body of results which serve to determine parameters J and CTOD for different materials using tension specimens with varying geometries. (author)

  4. General derivation of the Green's functions for the atomic approach of the Anderson model: application to a single electron transistor (SET)

    Science.gov (United States)

    Foglio, M. E.; Lobo, T.; Figueira, M. S.

    2012-09-01

    We consider the cumulant expansion of the periodic Anderson model (PAM) in the case of a finite electronic correlation U, employing the hybridization as perturbation, and obtain a formal expression of the exact one-electron Green's function (GF). This expression contains effective cumulants that are as difficult to calculate as the original GF, and the atomic approach consists in substituting the effective cumulants by the ones that correspond to the atomic case, namely by taking a conduction band of zeroth width and local hybridization. In a previous work (T. Lobo, M. S. Figueira, and M. E. Foglio, Nanotechnology 21, 274007 (2010), 10.1088/0957-4484/21/27/274007) we developed the atomic approach by considering only one variational parameter that is used to adjust the correct height of the Kondo peak by imposing the satisfaction of the Friedel sum rule. To obtain the correct width of the Kondo peak in the present work, we consider an additional variational parameter that guarantees this quantity. The two constraints now imposed on the formalism are the satisfaction of the Friedel sum rule and the correct Kondo temperature. In the first part of the work, we present a general derivation of the method for the single impurity Anderson model (SIAM), and we calculate several density of states representative of the Kondo regime for finite correlation U, including the symmetrical case. In the second part, we apply the method to study the electronic transport through a quantum dot (QD) embedded in a quantum wire (QW), which is realized experimentally by a single electron transistor (SET). We calculate the conductance of the SET and obtain a good agreement with available experimental and theoretical results.

  5. Comparison of primers for the detection of pathogenic Escherichia coli using real-time PCR.

    Science.gov (United States)

    Barak, J D; Sananikone, K; Delwiche, M J

    2005-01-01

    To evaluate PCR primers for the detection of pathogenic Escherichia coli in a real-time PCR assay and determine their utility in produce irrigation water testing. Three previously published PCR primer sets and one set designed for this study were tested for their ability to produce amplification products for several pathogenic E. coli serotypes from whole cells as template. Two of the previously published primer sets were chosen for real-time PCR detection limit determination. The coneaeA and PEH detection limit of E. coli O157:H7 was 10(0) and 10(1) CFU rxn(-1) in sterile water respectively. To detect E. coli O157:H7 in sprout irrigation water, the water required dilution due to PCR inhibitors. The detection limit of the coneaeA and PEH was 10(1) and between 10(2) and 10(3) CFU rxn(-1) in diluted sprout irrigation water respectively. The primer set coneaeA was able to produce an amplification product from each E. coli serotype, except O128:H7 and most sensitive for real-time PCR detection of pathogenic E. coli in diluted sprout irrigation water. The necessity of a dissociation analysis to distinguish positive samples from those with fluorescence of random dsDNA generation for real-time PCR in a complex background was established.

  6. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  7. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  8. Analysis of bacterial communities in soil by use of denaturing gradient gel electrophoresis and clone libraries, as influenced by different reverse primers

    NARCIS (Netherlands)

    Brons, Jolanda; van Elsas, J.D.

    To assess soil bacterial diversity, PCR systems consisting of several slightly different reverse primers together with forward primer F968-GC were used along with subsequent denaturing gradient gel electrophoresis (DGGE) or clone library analyses. In this study, a set of 13 previously used and novel

  9. A single visit multidisciplinary model for managing patients with mutations in moderate and high-risk genes in a community practice setting.

    Science.gov (United States)

    O'Leary, Michael P; Goldner, Bryan S; Abboy, Sridevi; Mercado, Philip D; Plurad, Hong Yoon

    2018-01-01

    The introduction of screening for multiple high and moderate risk mutations in genes has resulted in a complex approach to patient care involving multiple disciplines. We sought to describe the feasibility of a single visit multidisciplinary approach to the management of patients with an identified high/moderate risk gene mutation. Patients who presented to our community hospital over a 1-year period who were found to have a high/moderate risk genetic mutation on a screening panel were referred to the High Risk Genetic Clinic. Thirty-five patients were included. The majority were female [34 (97.1%)], Hispanic [22 (62.9%)], with a family history of cancer [21 (60%)]. Mean age was 40.3 years. Most of the participants had a BRCA1 gene mutation [10 (28.6%)]. Patients were seen at the High Risk Genetic Clinic within a mean of 41.9 days from the day of genetic mutation diagnosis. Four patients did not show and were significantly younger (19.3 vs. 39.6 years, p = 0.014). In this community setting, we provided coordinated care within multiple disciplines related to a genetic mutation in a single clinic visit. Increased efforts at coordinating early care should be directed towards patients diagnosed at a younger age.

  10. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  11. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  12. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  13. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  14. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  15. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification.

    Directory of Open Access Journals (Sweden)

    Junsun Kim

    Full Text Available Real-time PCR, also called quantitative PCR (qPCR, has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN. One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction.

  16. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  18. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  19. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  20. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  1. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  2. RIRS versus mPCNL for single renal stone of 2-3 cm: clinical outcome and cost-effective analysis in Chinese medical setting.

    Science.gov (United States)

    Pan, Jiahua; Chen, Qi; Xue, Wei; Chen, Yonghui; Xia, Lei; Chen, Haige; Huang, Yiran

    2013-02-01

    The aim of the study was to compare the clinical outcome and the cost-effectiveness between retrograde intra renal surgery (RIRS) and mini-percutaneous nephrolithotripsy (mPCNL) for the management of single renal stone of 2-3 cm in Chinese medical setting. From May 2005 to February 2011, 115 patients with solitary renal calculi were treated either by RIRS or mPCNL. 56 patients were in RIRS group while 59 were in mPCNL group. Patients' demographics between the two groups, in terms of gender, age, BMI, history of ESWL as well as stone side, stone location and stone size were comparable. Peri-operative course, clinical outcome, complication rates and medical cost were compared. The effective quotient (EQ) of two groups was calculated. Data were analyzed using Fisher's exact test, Chi-square test and Student's t test. EQ for RIRS and mPCNL were 0.52 and 0.90. The initial stone-free rate (SFR) of RIRS group and mPCNL group was 71.4 and 96.6 %, respectively (P = 0.000). The mean procedure number was 1.18 in RIRS group and 1.03 in mPCNL group, respectively (P = 0.035). The operative time for RIRS was longer (P = 0.000) while the mean hospital stay was shorter (P = 0.000). There was no statistical difference in peri-operative complications between the groups. The initial hospitalization cost, laboratory and radiology test cost of RIRS group were lower (P = 0.000). However, counting the retreatment cost in the two groups, the total medical expenditure including the overall hospitalization cost, overall laboratory and radiology test cost and post-operative out-patient department (OPD) visit cost was similar between two groups. In conclusion, with similar total medical cost, mPCNL achieved faster stone clearance and lower retreatment rate without major complications, which implied higher cost-effectiveness for the treatment of single renal stone of 2-3 cm in Chinese medical setting. RIRS is also a safe and reliable choice for patients having contraindications or

  3. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. © 2015 John Wiley & Sons Ltd.

  4. Sustainable Assessment of Alternative Sites for the Construction of a Waste Incineration Plant by Applying WASPAS Method with Single-Valued Neutrosophic Set

    Directory of Open Access Journals (Sweden)

    Edmundas Kazimieras Zavadskas

    2015-12-01

    Full Text Available The principles of sustainability have become particularly important in the construction, real estate maintenance sector, and all areas of life in recent years. The one of the major problem of urban territories that domestic and construction waste of generated products cannot be removed automatically. The above necessity induces the demand of systems and technologies for waste life cycle and proper disposal development. Siting of the waste incineration plant is a complex process, which includes all factors of sustainability principles. The selection of the construction area is a complex problem due to the existence of different tangible and intangible factors and the multiple alternatives available. Multicriteria decision-making methods (MCDM present powerful and flexible techniques for the solution of many sustainability problems. In this paper, we propose a new extension of WASPAS method, namely WASPAS-SVNS. This extension is realized in the framework of the single-valued neutrosophic set that enables to represent and model the indeterminacy explicitly and the functions of the truth-membership, the indeterminacy-membership and the falsity-membership are not related to each other. The paper deals with the solution of the waste incineration plant siting problem due to the requirements of sustainability factors.

  5. Systematic instruction of assistive technology for cognition (ATC) in an employment setting following acquired brain injury: A single case, experimental study.

    Science.gov (United States)

    Powell, Laurie E; Glang, Ann; Pinkelman, Sarah; Albin, Richard; Harwick, Robin; Ettel, Deborah; Wild, Michelle R

    2015-01-01

    Assistive technology for cognition (ATC) can be an effective means of compensating for cognitive impairments following acquired brain injury. Systematic instruction is an evidence-based approach to training a variety of skills and strategies, including the use of ATC. This study experimentally evaluated systematic instruction applied to assistive technology for cognition (ATC) in a vocational setting. The study used a single-case, multiple-probe design across behaviors design. The participant was a 50-year old female with cognitive impairments following an acquired brain injury (ABI). As a part-time employee, she was systematically instructed on how to operate and routinely use selected applications (apps) on her iPod Touch to support three work-related skills: (a) recording/recalling the details of work assignments, (b) recording/recalling work-related meetings and conversations, and (c) recording/performing multi-step technology tasks. The experimental intervention was systematic instruction applied to ATC. The dependent measures were: (a) the use of ATC at work as measured by an ATC routine task analysis; and (b) recall of work-related tasks and information. Treatment effects were replicated across the three work-related skills and were maintained up to one year following the completion of intensive training across behaviors with periodic review (booster sessions). Systematic instruction is a critical component to teaching the routine use of ATC to compensate for cognitive impairments following ABI.

  6. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  7. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  8. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  9. Synteny analysis provides a route to design genus-specific PCR primers for rapid identification of all Saccharomyces species.

    Science.gov (United States)

    Sharpe, Ben; Hulin, Michelle; Thorne-Wallis, James; Wheals, Alan

    2014-05-01

    The genus Saccharomyces comprises seven single-genome species (S. arboricola, S. cerevisiae, S. eubayanus, S. kudriavzevii, S. mikatae, S. paradoxus and S. uvarum) and two hybrid species - S. pastorianus (S. cerevisiae plus S. eubayanus) and S. bayanus (mostly S. uvarum plus S. eubayanus). Species-specific primers have already been developed for the identification of each of the single-genome species, and these primers can usually detect both genomes in hybrids. It would be advantageous if a single reaction could detect any member of the clade. We have investigated three potentially generic approaches to design genus-specific primers. Two methods that both use sequence alignment differences for primer design were only partly successful. A third method used synteny data to identify 136 target genes that are potentially present only in all species of the Saccharomyces clade. HSP30 (YCR021C) was fully successful; different primer pairs were developed with high G+C content for use at 63 °C. In genus. This novel approach still uses conventional sequence alignment mismatches but relies principally on the presence of the target gene only within the genus Saccharomyces. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. Peptide Inhibitor of Complement C1 (PIC1) demonstrates antioxidant activity via single electron transport (SET) and hydrogen atom transfer (HAT).

    Science.gov (United States)

    Gregory Rivera, Magdielis; Hair, Pamela S; Cunnion, Kenji M; Krishna, Neel K

    2018-01-01

    Reactive oxygen species (ROS) are natural byproducts of oxidative respiration that are toxic to organs and tissues. To mitigate ROS damage, organisms have evolved a variety of antioxidant systems to counteract these harmful molecules, however in certain pathological conditions these protective mechanisms can be overwhelmed. We have recently demonstrated that Peptide Inhibitor of Complement C1 (PIC1) mitigates peroxidase activity of the heme bearing proteins myeloperoxidase, hemoglobin, and myoglobin through a reversible process. To determine if this property of PIC1 was antioxidant in nature, we tested PIC1 in a number of well-established antioxidant assays. PIC1 showed dose-dependent antioxidant activity in a total antioxidant (TAC) assay, hydroxyl radical antioxidant capacity (HORAC) assay, oxygen radical antioxidant capacity (ORAC) assay as well as the thiobarbituric acid reactive substances (TBARS) assay to screen for PIC1 antioxidant activity in human plasma. The antioxidant activity of PIC1 in the TAC assay, as well as the HORAC/ORAC assay demonstrated that this peptide acts via the single electron transport (SET) and hydrogen atom transfer (HAT) mechanisms, respectively. Consistent with this mechanism of action, PIC1 did not show activity in a metal chelating activity (MCA) assay. PIC1 contains two vicinal cysteine residues and displayed similar antioxidant activity to the well characterized cysteine-containing tripeptide antioxidant molecule glutathione (GSH). Consistent with the role of the cysteine residues in the antioxidant activity of PIC1, oxidation of these residues significantly abrogated antioxidant activity. These results demonstrate that in addition to its described complement inhibiting activity, PIC1 displays in vitro antioxidant activity.

  11. A Novel Teaching-Learning-Based Optimization for Improved Mutagenic Primer Design in Mismatch PCR-RFLP SNP Genotyping.

    Science.gov (United States)

    Cheng, Yu-Huei

    2016-01-01

    Many single nucleotide polymorphisms (SNPs) for complex genetic diseases are genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in small-scale basic research studies. It is an essential work to design feasible PCR-RFLP primer pair and find out available restriction enzymes to recognize the target SNP for PCR experiments. However, many SNPs are incapable of performing PCR-RFLP makes SNP genotyping become unpractical. A genetic algorithm (GA) had been proposed for designing mutagenic primer and get available restriction enzymes, but it gives an unrefined solution in mutagenic primers. In order to improve the mutagenic primer design, we propose TLBOMPD (TLBO-based Mutagenic Primer Design) a novel computational intelligence-based method that uses the notion of "teaching and learning" to search for more feasible mutagenic primers and provide the latest available restriction enzymes. The original Wallace's formula for the calculation of melting temperature is maintained, and more accurate calculation formulas of GC-based melting temperature and thermodynamic melting temperature are introduced into the proposed method. Mutagenic matrix is also reserved to increase the efficiency of judging a hypothetical mutagenic primer if involve available restriction enzymes for recognizing the target SNP. Furthermore, the core of SNP-RFLPing version 2 is used to enhance the mining work for restriction enzymes based on the latest REBASE. Twenty-five SNPs with mismatch PCR-RFLP screened from 288 SNPs in human SLC6A4 gene are used to appraise the TLBOMPD. Also, the computational results are compared with those of the GAMPD. In the future, the usage of the mutagenic primers in the wet lab needs to been validated carefully to increase the reliability of the method. The TLBOMPD is implemented in JAVA and it is freely available at http://tlbompd.googlecode.com/.

  12. Effect of Metal Primers on Bond Strength of a Composite Resin to Nickel-Chrome Metal Alloy.

    Science.gov (United States)

    Nima, Gabriel; Ferreira, Paulo Vitor Campos; Paula, Andreia Bolzan de; Consani, Simonides; Giannini, Marcelo

    2017-01-01

    This study evaluated the effects of three metal primers and one multi-mode adhesive system on the shear bond strength (SBS) of a flowable composite resin to nickel-chrome metal alloy (Ni-Cr). Ninety plates were cast from Ni-Cr and divided in nine groups (n=10). The surfaces were sandblasted with Al2O3 and primed with three adhesive primers: Alloy Primer (AP), Universal Primer (TP) and RelyX Ceramic Primer (CP), and a multi-mode adhesive (Scotchbond Universal, SU). The Adper Single Bond Plus (SB) and SU adhesives were also combined with adhesive primers. Control group did not have any surface treatment. The groups were: AP, AP+SB, AP+SU, TP+SB, TP+SU, CP+SB, CP+SU and SU. Composite cylinders were built on alloy surface. After 24 h, half the specimens were subjected to SBS and the other half to thermal cycling before testing. Data were analyzed by two-way ANOVA and Tukey's test (a=0.05). Failure modes were assessed by SEM observation. Higher SBS were obtained with AP and TP combined with adhesives at 24 h and the lowest one for control group. Thermocycling reduced SBS for AP, CP+SU and SU. Combination between TP and SU resulted in the highest SBS after the thermocycling. TP groups showed all types of failures and high incidence of mixed failures. The use of AP and UP metal primers before application of SU and SB adhesive systems increased the SBS of composite to Ni-Cr. These combinations between metal primers and adhesives had the highest SBS after thermocycling.

  13. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    Science.gov (United States)

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  14. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers.

    Directory of Open Access Journals (Sweden)

    In-Cheol Baek

    Full Text Available Major histocompatibility complex (MHC class I chain-related gene B (MICB encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI, whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024 present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations.

  16. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  17. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  18. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  19. Development of a set of SSR markers for genetic polymorphism detection and interspecific hybrid jute breeding

    Directory of Open Access Journals (Sweden)

    Dipnarayan Saha

    2017-10-01

    Full Text Available Corchorus capsularis (white jute and C. olitorius (dark jute are the two principal cultivated species of jute that produce natural bast fiber of commercial importance. We have identified 4509 simple sequence repeat (SSR loci from 34,163 unigene sequences of C. capsularis to develop a non-redundant set of 2079 flanking primer pairs. Among the SSRs, trinucleotide repeats were most frequent (60% followed by dinucleotide repeats (37.6%. Annotation of the SSR-containing unigenes revealed their putative functions in various biological and molecular processes, including responses to biotic and abiotic signals. Eighteen expressed gene-derived SSR (eSSR markers were successfully mapped to the existing single-nucleotide polymorphism (SNP linkage map of jute, providing additional anchor points. Amplification of 72% of the 74 randomly selected primer pairs was successful in a panel of 24 jute accessions, comprising five and twelve accessions of C. capsularis and C. olitorius, respectively, and seven wild jute species. Forty-three primer pairs produced an average of 2.7 alleles and 58.1% polymorphism in a panel of 24 jute accessions. The mean PIC value was 0.34 but some markers showed PIC values higher than 0.5, suggesting that these markers can efficiently measure genetic diversity and serve for mapping of quantitative trait loci (QTLs in jute. A primer polymorphism survey with parents of a wide-hybridized population between a cultivated jute and its wild relative revealed their efficacy for interspecific hybrid identification. For ready accessibility of jute eSSR primers, we compiled all information in a user-friendly web database, JuteMarkerdb (http://jutemarkerdb.icar.gov.in/ for the first time in jute. This eSSR resource in jute is expected to be of use in characterization of germplasm, interspecific hybrid and variety identification, and marker-assisted breeding of superior-quality jute.

  20. Return to Work Rates After Single-level Cervical Fusion for Degenerative Disc Disease Compared With Fusion for Radiculopathy in a Workers' Compensation Setting.

    Science.gov (United States)

    Faour, Mhamad; Anderson, Joshua T; Haas, Arnold R; Percy, Rick; Woods, Stephen T; Ahn, Uri M; Ahn, Nicholas U

    2016-07-15

    A retrospective comparative cohort study. To compare return to work (RTW) rates for patients who underwent single-level cervical fusion for radiculopathy compared with fusion for degenerative disc disease (DDD) as an indication for surgery. Studies have shown that workers' compensation subjects have less favorable surgical and functional outcomes compared with the general population. Cervical decompression and fusion have provided great results with relieving radicular symptoms. Fusion for DDD, however, remains controversial. We retrospectively collected data of 21 169 subjects with cervical comorbidities who filed their claims for work-related injuries with Ohio Bureau of Workers' Compensation (BWC) between 1993 and 2011. The primary outcome was whether subjects met RTW criteria within 3-year follow-up after fusion. The secondary outcome measures and data on presurgical characteristics and secondary outcomes of each cohort were also collected. Successful RTW status was affected by a number of presurgical risk factors: DDD as an indication for surgery, age of more than 50 years, out of work for more than 6 months, psychological evaluation, opioid use, legal litigation, and permanent disability. The DDD group had lower rate of successful RTW status (50.9%) and was less likely to have a sustained RTW status (odds ratio = 0.61, 95% confidence interval: 0.48-0.79, P = 0.0001) compared with the radiculopathy group (successful RTW rate 62.9%). RTW rate within 1 year after surgery was lower in the DDD group (39.9%) compared with the radiculopathy group (53.1%; P = 0.0001). DDD patients were absent 112 days more on average after surgery compared with radiculopathy patients (P = 0.0003). Cervical fusion for DDD is associated with lower rate of successful RTW status when compared with fusion for radiculopathy in a worker's compensation setting. The decision to include surgical intervention in the management plan of cervical DDD should be approached with

  1. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  5. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  6. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  7. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  8. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  9. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  10. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C; Meyer, Christopher P

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  11. Effectiveness of Annealing Blocking Primers versus Restriction Enzymes for Characterization of Generalist Diets: Unexpected Prey Revealed in the Gut Contents of Two Coral Reef Fish Species

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C.; Meyer, Christopher P.

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet. PMID:23579925

  12. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  13. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  14. 16S rRNA gene sequencing of mock microbial populations- impact of DNA extraction method, primer choice and sequencing platform.

    Science.gov (United States)

    Fouhy, Fiona; Clooney, Adam G; Stanton, Catherine; Claesson, Marcus J; Cotter, Paul D

    2016-06-24

    Next-generation sequencing platforms have revolutionised our ability to investigate the microbiota composition of complex environments, frequently through 16S rRNA gene sequencing of the bacterial component of the community. Numerous factors, including DNA extraction method, primer sequences and sequencing platform employed, can affect the accuracy of the results achieved. The aim of this study was to determine the impact of these three factors on 16S rRNA gene sequencing results, using mock communities and mock community DNA. The use of different primer sequences (V4-V5, V1-V2 and V1-V2 degenerate primers) resulted in differences in the genera and species detected. The V4-V5 primers gave the most comparable results across platforms. The three Ion PGM primer sets detected more of the 20 mock community species than the equivalent MiSeq primer sets. Data generated from DNA extracted using the 2 extraction methods were very similar. Microbiota compositional data differed depending on the primers and sequencing platform that were used. The results demonstrate the risks in comparing data generated using different sequencing approaches and highlight the merits of choosing a standardised approach for sequencing in situations where a comparison across multiple sequencing runs is required.

  15. Effects of music in advertising: Three experiments replicating single-exposure musical conditioning of consumer choice (Gorn, 1982) in an individual setting.

    NARCIS (Netherlands)

    Vermeulen, I.E.; Beukeboom, C.J.

    2016-01-01

    Can single pairing of background music with an advertised product condition choice behavior? Gorn's (1982) demonstration of this effect remains controversial given his unconventional conditioning procedure, unusual data analyses, probably confounded stimuli, and possible demand artifacts. We review

  16. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  17. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  18. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  19. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, J. Gregory; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob; Bik, Holly

    2015-12-22

    ABSTRACT

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

    ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to

  20. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro

    2012-11-01

    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  1. Nuclear microsatellite primers for the endangered relict fir, Abies pinsapo (Pinaceae) and cross-amplification in related Mediterranean Species.

    Science.gov (United States)

    Sánchez-Robles, Jose M; Balao, Francisco; García-Castaño, Juan L; Terrab, Anass; Navarro-Sampedro, Laura; Talavera, Salvador

    2012-11-05

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  2. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    Science.gov (United States)

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  3. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  4. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  5. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  6. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  7. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  8. The effect of resin cements and primer on retentive force of zirconia copings bonded to zirconia abutments with insufficient retention.

    Science.gov (United States)

    Kim, Seung-Mi; Yoon, Ji-Young; Lee, Myung-Hyun; Oh, Nam-Sik

    2013-05-01

    The purpose of this study was to investigate the effect of resin cements and primer on the retentive force of zirconia copings bonded to zirconia abutments with insufficient retention. Zirconia blocks (Lava, 3M ESPE, St. Paul, MN, USA) were obtained and forty sets of zirconia abutments and copings were fabricated using CAD/CAM technology. They were grouped into 4 categories as follows, depending on the types of resin cements used, and whether the primer is applied or not:Panavia F2.0 (P), Panavia F2.0 using Primer (PRIME Plus, Bisco Inc, Schaumburg, IL, USA) (PZ), Superbond C&B (S), and Superbond C&B using Primer (SZ). For each of the groups, the cementation was conducted. The specimens were kept in sterilized water (37℃) for 24 hours. Retentive forces were tested and measured, and a statistical analysis was carried out. The nature of failure was recorded. The means and standard deviations of retentive force in Newton for each group were 265.15 ± 35.04 N (P), 318.21 ± 22.24 N (PZ), 445.13 ± 78.54 N (S) and 508.21 ± 79.48 N (SZ). Superbond C&B groups (S & SZ) showed significantly higher retentive force than Panavia F2.0 groups (P & PZ). In Panavia F2.0 groups, the use of primer was found to contribute to the increase of retentive force. On the other hand, in Superbond C&B groups, the use of primer did not influence the retention forces. Adhesive failure was observed in all groups. This study suggests that cementation of the zirconia abutments and zirconia copings with Superbond C&B have a higher retentive force than Panavia F2.0. When using Panavia F2.0, the use of primer increases the retentive force.

  9. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples.

    Science.gov (United States)

    Chen, Yi-Lin; Lee, Chuan-Chun; Lin, Ya-Lan; Yin, Kai-Min; Ho, Chung-Liang; Liu, Tsunglin

    2015-01-01

    Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry.

  10. Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

    Science.gov (United States)

    Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

    2016-01-01

    Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

  11. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  12. AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment

    Directory of Open Access Journals (Sweden)

    Petra Pjevac

    2017-08-01

    Full Text Available Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be catalyzed by the concerted activity of ammonia- and nitrite-oxidizing microorganisms. Only recently, complete ammonia oxidizers (“comammox”, which oxidize ammonia to nitrate on their own, were identified in the bacterial genus Nitrospira, previously assumed to contain only canonical nitrite oxidizers. Nitrospira are widespread in nature, but for assessments of the distribution and functional importance of comammox Nitrospira in ecosystems, cultivation-independent tools to distinguish comammox from strictly nitrite-oxidizing Nitrospira are required. Here we developed new PCR primer sets that specifically target the amoA genes coding for subunit A of the distinct ammonia monooxygenase of comammox Nitrospira. While existing primers capture only a fraction of the known comammox amoA diversity, the new primer sets cover as much as 95% of the comammox amoA clade A and 92% of the clade B sequences in a reference database containing 326 comammox amoA genes with sequence information at the primer binding sites. Application of the primers to 13 samples from engineered systems (a groundwater well, drinking water treatment and wastewater treatment plants and other habitats (rice paddy and forest soils, rice rhizosphere, brackish lake sediment and freshwater biofilm detected comammox Nitrospira in all samples and revealed a considerable diversity of comammox in most habitats. Excellent primer specificity for comammox amoA was achieved by avoiding the use of highly degenerate primer preparations and by using equimolar mixtures of oligonucleotides that match existing comammox amoA genes. Quantitative PCR with these equimolar primer mixtures was highly sensitive and specific, and enabled the efficient quantification of clade A and clade B comammox amoA gene copy numbers in environmental samples. The measured relative abundances of comammox Nitrospira, compared

  13. Toward Understanding the Role of Web 2.0 Technology in Self-Directed Learning and Job Performance in a Single Organizational Setting: A Qualitative Case Study

    Science.gov (United States)

    Caruso, Shirley J.

    2016-01-01

    This single instrumental qualitative case study explores and thickly describes job performance outcomes based upon the manner in which self-directed learning activities of a purposefully selected sample of 3 construction managers are conducted, mediated by the use of Web 2.0 technology. The data collected revealed that construction managers are…

  14. The Influence of Function, Topography, and Setting on Noncontingent Reinforcement Effect Sizes for Reduction in Problem Behavior: A Meta-Analysis of Single-Case Experimental Design Data

    Science.gov (United States)

    Ritter, William A.; Barnard-Brak, Lucy; Richman, David M.; Grubb, Laura M.

    2018-01-01

    Richman et al. ("J Appl Behav Anal" 48:131-152, 2015) completed a meta-analytic analysis of single-case experimental design data on noncontingent reinforcement (NCR) for the treatment of problem behavior exhibited by individuals with developmental disabilities. Results showed that (1) NCR produced very large effect sizes for reduction in…

  15. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  16. Optimization of primer specific filter metrics for the assessment of mitochondrial DNA sequence data

    Science.gov (United States)

    CURTIS, PAMELA C.; THOMAS, JENNIFER L.; PHILLIPS, NICOLE R.; ROBY, RHONDA K.

    2011-01-01

    Filter metrics are used as a quick assessment of sequence trace files in order to sort data into different categories, i.e. High Quality, Review, and Low Quality, without human intervention. The filter metrics consist of two numerical parameters for sequence quality assessment: trace score (TS) and contiguous read length (CRL). Primer specific settings for the TS and CRL were established using a calibration dataset of 2817 traces and validated using a concordance dataset of 5617 traces. Prior to optimization, 57% of the traces required manual review before import into a sequence analysis program, whereas after optimization only 28% of the traces required manual review. After optimization of primer specific filter metrics for mitochondrial DNA sequence data, an overall reduction of review of trace files translates into increased throughput of data analysis and decreased time required for manual review. PMID:21171863

  17. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  18. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  19. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  20. Introducing a primer for career development and promotion: succeeding as a psychologist in an academic health center.

    Science.gov (United States)

    Christophersen, Edward; Butt, Zeeshan

    2012-12-01

    Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.

  1. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucle...

  2. The Single and Combined Effects of Multiple Intensities of Behavior Modification and Methylphenidate for Children with Attention Deficit Hyperactivity Disorder in a Classroom Setting

    Science.gov (United States)

    Fabiano, Gregory A.; Pelham, William E., Jr.; Gnagy, Elizabeth M.; Burrows-MacLean, Lisa; Coles, Erika K.; Chacko, Anil; Wymbs, Brian T.; Walker, Kathryn S.; Arnold, Fran; Garefino, Allison; Keenan, Jenna K.; Onyango, Adia N.; Hoffman, Martin T.; Massetti, Greta M.; Robb, Jessica A.

    2007-01-01

    Currently behavior modification, stimulant medication, and combined treatments are supported as evidence-based interventions for attention deficit hyperactivity disorder in classroom settings. However, there has been little study of the relative effects of these two modalities and their combination in classrooms. Using a within-subject design, the…

  3. Coupled-Mode Theory derivation of the formal equivalence between a three-mode waveguide and a set of three mutually coupled single-mode waveguides

    Directory of Open Access Journals (Sweden)

    Boucher Yann G.

    2017-01-01

    Full Text Available The formal identification between a two-mode waveguide and a system of two mutually coupled single-mode waveguides stems from the symmetries of the evolution operator. When the gap tends to zero, the super-modes of the coupled system merge continuously into the modes of the multimode waveguide. For modelling purposes, it is very tempting to extend the analogy to three-mode waveguides (and beyond. But not without some precautions…

  4. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  5. A dark-field microscope for background-free detection of resonance fluorescence from single semiconductor quantum dots operating in a set-and-forget mode.

    Science.gov (United States)

    Kuhlmann, Andreas V; Houel, Julien; Brunner, Daniel; Ludwig, Arne; Reuter, Dirk; Wieck, Andreas D; Warburton, Richard J

    2013-07-01

    Optically active quantum dots, for instance self-assembled InGaAs quantum dots, are potentially excellent single photon sources. The fidelity of the single photons is much improved using resonant rather than non-resonant excitation. With resonant excitation, the challenge is to distinguish between resonance fluorescence and scattered laser light. We have met this challenge by creating a polarization-based dark-field microscope to measure the resonance fluorescence from a single quantum dot at low temperature. We achieve a suppression of the scattered laser exceeding a factor of 10(7) and background-free detection of resonance fluorescence. The same optical setup operates over the entire quantum dot emission range (920-980 nm) and also in high magnetic fields. The major development is the outstanding long-term stability: once the dark-field point has been established, the microscope operates for days without alignment. The mechanical and optical designs of the microscope are presented, as well as exemplary resonance fluorescence spectroscopy results on individual quantum dots to underline the microscope's excellent performance.

  6. A dark-field microscope for background-free detection of resonance fluorescence from single semiconductor quantum dots operating in a set-and-forget mode

    International Nuclear Information System (INIS)

    Kuhlmann, Andreas V.; Houel, Julien; Warburton, Richard J.; Brunner, Daniel; Ludwig, Arne; Reuter, Dirk; Wieck, Andreas D.

    2013-01-01

    Optically active quantum dots, for instance self-assembled InGaAs quantum dots, are potentially excellent single photon sources. The fidelity of the single photons is much improved using resonant rather than non-resonant excitation. With resonant excitation, the challenge is to distinguish between resonance fluorescence and scattered laser light. We have met this challenge by creating a polarization-based dark-field microscope to measure the resonance fluorescence from a single quantum dot at low temperature. We achieve a suppression of the scattered laser exceeding a factor of 10 7 and background-free detection of resonance fluorescence. The same optical setup operates over the entire quantum dot emission range (920–980 nm) and also in high magnetic fields. The major development is the outstanding long-term stability: once the dark-field point has been established, the microscope operates for days without alignment. The mechanical and optical designs of the microscope are presented, as well as exemplary resonance fluorescence spectroscopy results on individual quantum dots to underline the microscope's excellent performance

  7. A dark-field microscope for background-free detection of resonance fluorescence from single semiconductor quantum dots operating in a set-and-forget mode

    Energy Technology Data Exchange (ETDEWEB)

    Kuhlmann, Andreas V.; Houel, Julien; Warburton, Richard J. [Department of Physics, University of Basel, Klingelbergstrasse 82, CH-4056 Basel (Switzerland); Brunner, Daniel [Instituto de Física Interdisciplinar y Sistemas Complejos, IFISC (CSIC-UIB), Campus Universitat Illes Balears, E-07122 Palma de Mallorca (Spain); Ludwig, Arne [Department of Physics, University of Basel, Klingelbergstrasse 82, CH-4056 Basel (Switzerland); Lehrstuhl für Angewandte Festkörperphysik, Ruhr-Universität Bochum, D-44780 Bochum (Germany); Reuter, Dirk [Lehrstuhl für Angewandte Festkörperphysik, Ruhr-Universität Bochum, D-44780 Bochum (Germany); Department Physik, Universität Paderborn, Warburger Strasse 100, D-33098 Paderborn (Germany); Wieck, Andreas D. [Lehrstuhl für Angewandte Festkörperphysik, Ruhr-Universität Bochum, D-44780 Bochum (Germany)

    2013-07-15

    Optically active quantum dots, for instance self-assembled InGaAs quantum dots, are potentially excellent single photon sources. The fidelity of the single photons is much improved using resonant rather than non-resonant excitation. With resonant excitation, the challenge is to distinguish between resonance fluorescence and scattered laser light. We have met this challenge by creating a polarization-based dark-field microscope to measure the resonance fluorescence from a single quantum dot at low temperature. We achieve a suppression of the scattered laser exceeding a factor of 10{sup 7} and background-free detection of resonance fluorescence. The same optical setup operates over the entire quantum dot emission range (920–980 nm) and also in high magnetic fields. The major development is the outstanding long-term stability: once the dark-field point has been established, the microscope operates for days without alignment. The mechanical and optical designs of the microscope are presented, as well as exemplary resonance fluorescence spectroscopy results on individual quantum dots to underline the microscope's excellent performance.

  8. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  9. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  10. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  11. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  12. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  13. A randomized clinical trial evaluating prophylactic single-dose vs prolonged course of antibiotics for caesarean section in a high HIV-prevalence setting.

    Science.gov (United States)

    Gidiri, M F; Ziruma, A

    2014-02-01

    The evidence that perioperative antibiotics for caesarean delivery are effective in reducing infective morbidity is unequivocal. In developing countries, especially those with high HIV-prevalence, clinicians have increasingly become anxious about the efficacy of perioperative antibiotics, hence the adoption of treatment regimens, as described in this study. We set out to investigate if these fears have a basis by conducting a randomised clinical trial. The setting was two tertiary units in a developing country with a significant HIV-prevalence. The outcome measures assessed were: pyrexia, wound infection, admission with puerperal sepsis, laparotomy for pelvic abscess and duration of hospital stay. There was no statistically significant difference between the two arms of the study with regard to the above outcomes. Our conclusion is that the two antibiotic regimens are equivalent in preventing infection, therefore there is no justification for subjecting patients to week-long antibiotics and the unnecessary increase in nurse workload.

  14. Direct and indirect single electron transfer (SET-photochemical approaches for the preparation of novel phthalimide and naphthalimide-based lariat-type crown ethers

    Directory of Open Access Journals (Sweden)

    Dae Won Cho

    2014-02-01

    Full Text Available In this review, we describe direct and indirect photochemical approaches that have been developed for the preparation of phthalimide- and naphthalimide-based, lariat-type crown ethers. The direct route utilizes a strategy in which nitrogen-linked side chains containing polyethoxy-tethered phthalimides and naphthalimides, possessing terminal α-trialkylsilyl groups, are synthesized utilizing concise routes and UV-irradiation to form macrocyclic ring systems. In contrast, the indirect route developed for the synthesis of lariat-type crown ethers employs sequences in which SET-promoted macrocyclization reactions of α-trialkylsilyl-terminated, polyethoxy-tethered phthalimides and naphthalimides are followed by a side chain introduction through substitution reactions at the amidol centers in the macrocyclic ethers. The combined observations made in these investigations demonstrate the unique features of SET-promoted photocyclization reactions that make them well-suited for the use in the synthesis of functionalized crown ethers. In addition, while some limitations exist for the general use of SET-photochemical reactions in large-scale organic synthesis, important characteristics of the photoinduced macrocyclization reactions make them applicable to unique situations in which high temporal and spatial control is required.

  15. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  16. Neighborhood-targeted and case-triggered use of a single dose of oral cholera vaccine in an urban setting: Feasibility and vaccine coverage.

    Science.gov (United States)

    Parker, Lucy A; Rumunu, John; Jamet, Christine; Kenyi, Yona; Lino, Richard Laku; Wamala, Joseph F; Mpairwe, Allan M; Muller, Vincent; Llosa, Augusto E; Uzzeni, Florent; Luquero, Francisco J; Ciglenecki, Iza; Azman, Andrew S

    2017-06-01

    In June 2015, a cholera outbreak was declared in Juba, South Sudan. In addition to standard outbreak control measures, oral cholera vaccine (OCV) was proposed. As sufficient doses to cover the at-risk population were unavailable, a campaign using half the standard dosing regimen (one-dose) targeted high-risk neighborhoods and groups including neighbors of suspected cases. Here we report the operational details of this first public health use of a single-dose regimen of OCV and illustrate the feasibility of conducting highly targeted vaccination campaigns in an urban area. Neighborhoods of the city were prioritized for vaccination based on cumulative attack rates, active transmission and local knowledge of known cholera risk factors. OCV was offered to all persons older than 12 months at 20 fixed sites and to select groups, including neighbors of cholera cases after the main campaign ('case-triggered' interventions), through mobile teams. Vaccination coverage was estimated by multi-stage surveys using spatial sampling techniques. 162,377 individuals received a single-dose of OCV in the targeted neighborhoods. In these neighborhoods vaccine coverage was 68.8% (95% Confidence Interval (CI), 64.0-73.7) and was highest among children ages 5-14 years (90.0%, 95% CI 85.7-94.3), with adult men being less likely to be vaccinated than adult women (Relative Risk 0.81, 95% CI: 0.68-0.96). In the case-triggered interventions, each lasting 1-2 days, coverage varied (range: 30-87%) with an average of 51.0% (95% CI 41.7-60.3). Vaccine supply constraints and the complex realities where cholera outbreaks occur may warrant the use of flexible alternative vaccination strategies, including highly-targeted vaccination campaigns and single-dose regimens. We showed that such campaigns are feasible. Additional work is needed to understand how and when to use different strategies to best protect populations against epidemic cholera.

  17. Near infra-red spectroscopy quantitative modelling of bivalve protein, lipid and glycogen composition using single-species versus multi-species calibration and validation sets

    Science.gov (United States)

    Bartlett, Jill K.; Maher, William A.; Purss, Matthew B. J.

    2018-03-01

    Near infrared spectroscopy (NIRS) quantitative modelling was used to measure the protein, lipid and glycogen composition of five marine bivalve species (Saccostrea glomerata, Ostrea angasi, Crassostrea gigas, Mytilus galloprovincialis and Anadara trapezia) from multiple locations and seasons. Predictive models were produced for each component using individual species and aggregated sample populations for the three oyster species (S. glomerata, O. angasi and C. gigas) and for all five bivalve species. Whole animal tissues were freeze dried, ground to > 20 μm and scanned by NIRS. Protein, lipid and glycogen composition were determined by traditional chemical analyses and calibration models developed to allow rapid NIRS-measurement of these components in the five bivalve species. Calibration modelling was performed using wavelet selection, genetic algorithms and partial least squares analysis. Model quality was assessed using RPIQ and RMESP. For protein composition, single species model results had RPIQ values between 2.4 and 3.5 and RMSEP between 8.6 and 18%, the three oyster model had an RPIQ of 2.6 and an RMSEP of 10.8% and the five bivalve species had an RPIQ of 3.6 and RMSEP of 8.7% respectively. For lipid composition, single species models achieved RPIQ values between 2.9 and 5.3 with RMSEP between 9.1 and 11.2%, the oyster model had an RPIQ of 3.6 and RMSEP of 6.8 and the five bivalve model had an RPIQ of 5.2 and RMSEP of 6.8% respectively. For glycogen composition, the single species models had RPIQs between 3.8 and 18.9 with RMSEP between 3.5 and 9.2%, the oyster model had an RPIQ of 5.5 and RMSEP of 7.1% and the five bivalve model had an RPIQ of 4 and RMSEP of 7.6% respectively. Comparison between individual species models and aggregated models for three oyster species and five bivalve species for each component indicate that aggregating data from like species produces high quality models with robust and reliable quantitative application. The benefit of

  18. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  19. Development of strain-specific PCR primers for the identification of Fusobacterium nucleatum subsp. fusiforme ATCC 51190(T) and subsp. vincentii ATCC 49256(T).

    Science.gov (United States)

    Shin, Hwan Seon; Kim, Min-Jung; Kim, Hwa-Sook; Park, Soon-Nang; Kim, Do Kyung; Baek, Dong-Heon; Kim, Chan; Kook, Joong-Ki

    2010-02-01

    The objective of this study was to develop the strain-specific PCR primers for Fusobacterium nucleatum subsp. fusiforme ATCC 51190(T) and F. nucleatum subsp. vincentii ATCC 49256(T) based on the nucleotide sequence of the Fs17 and Fv35 DNA probes, respectively. The strain specificity was tested against 10 type strains of Fusobacterium spp. or subsp., 21 clinical isolates of F. nucleatum from Koreans, and five type strains of distinct Fusobacterium species. Primer sensitivity was determined by testing serial dilutions (4 ng-4 fg) of the purified genomic DNA from each of the type strains. PCR showed that two pairs of PCR primers, Fs17-F14/Fs17-R14 and Fv35-F1/Fv35-R1 primers, could produce strain-specific amplicons from F. nucleatum subsp. fusiforme ATCC 51190(T) and F. nucleatum subsp. vincentii ATCC 49256(T), respectively. The two PCR primer sets could detect as little as 0.4 pg or 4 pg of the genomic DNA of each target strain. These results suggest that the two sets of PCR primers could be used to identify F. nucleatum subsp. fusiforme ATCC 51190(T) and F. nucleatum subsp. vincentii ATCC 49256(T), particularly for ascertaining the authenticity of the strain. 2009 Elsevier Ltd. All rights reserved.

  20. Analysis of Sensitivity Experiments - A Primer

    National Research Council Canada - National Science Library

    Nance, Douglas V

    2008-01-01

    .... A specialized version of this scheme is derived for stable digital computation. Confidence interval estimation is discussed along with an analysis of variance. A set of example problems are solved; our results are compared with archival solutions.

  1. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets.

    Science.gov (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S; Kerudi, Veerendra V; Patil, Harshal Ashok; Bonde, Prasad Vasudeo; Jaltare, Pratik; Dolas, Siddhesh G

    2016-12-01

    The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (p<0.001) of bond strength with surface roughness of enamel. All groups might show clinically useful SBS values and Transbond XT can be successfully used

  2. Detection of genital human papillomaviruses by polymerase chain reaction amplification with degenerate nested primers.

    Science.gov (United States)

    Williamson, A L; Rybicki, E P

    1991-03-01

    Degenerate oligonucleotide primers were designed for in vitro amplification by polymerase chain reaction (PCR) of a relatively well-conserved portion of the L1 capsid protein gene of genital human papillomaviruses. A specific 441bp fragment was amplified by PCR from genomic clones and clinical biopsy specimens containing DNA from HPV types 6, 11, 16, 18, 31, and 33, as well as from a number of other clinical specimens known to contain unclassified HPV isolates. As some HPV non-specific DNA was also often amplified, another set of degenerate primers was designed which amplified a 335 bp sequence contained within the 441 bp sequence. These nested primers could be used in a two-stage PCR reaction to obtain distinct HPV-specific DNA fragments suitable for direct sequencing. Two-stage PCR was used to demonstrate the presence of HPV DNA in 13 out of 16 biopsies, which had been classified histologically as cervical intraepithelial neoplasia (CIN), but which were negative for HPV on Southern blot hybridization. Seven of these amplification products were sequenced, and one proved to be a previously unsequenced HPV type. The results have important implications for the routine detection and typing of genital and other HPV types in clinical samples.

  3. Affinity and sequence specificity of DNA binding and site selection for primer synthesis by Escherichia coli primase.

    Science.gov (United States)

    Khopde, Sujata; Biswas, Esther E; Biswas, Subhasis B

    2002-12-17

    Primase is an essential DNA replication enzyme in Escherichia coli and responsible for primer synthesis during lagging strand DNA replication. Although the interaction of primase with single-stranded DNA plays an important role in primer RNA and Okazaki fragment synthesis, the mechanism of DNA binding and site selection for primer synthesis remains unknown. We have analyzed the energetics of DNA binding and the mechanism of site selection for the initiation of primer RNA synthesis on the lagging strand of the replication fork. Quantitative analysis of DNA binding by primase was carried out using a number of oligonucleotide sequences: oligo(dT)(25) and a 30 bp oligonucleotide derived from bacteriophage G4 origin (G4ori-wt). Primase bound both sequences with moderate affinity (K(d) = 1.2-1.4 x 10(-)(7) M); however, binding was stronger for G4ori-wt. G4ori-wt contained a CTG trinucleotide, which is a preferred site for initiation of primer synthesis. Analysis of DNA binding isotherms derived from primase binding to the oligonucleotide sequences by fluorescence anisotropy indicated that primase bound to DNA as a dimer, and this finding was further substantiated by electrophoretic mobility shift assays (EMSAs) and UV cross-linking of the primase-DNA complex. Dissection of the energetics involved in the primase-DNA interaction revealed a higher affinity of primase for DNA sequences containing the CTG triplet. This sequence preference of primase may likely be responsible for the initiation of primer synthesis in the CTG triplet sites in the E. coli lagging strand as well as in the origin of replication of bacteriophage G4.

  4. A set of dual promoter vectors for high throughput cloning, screening, and protein expression in eukaryotic and prokaryotic systems from a single plasmid.

    Science.gov (United States)

    Sinah, Namita; Williams, Charlotte A; Piper, Robert C; Shields, S Brookhart

    2012-08-23

    The ability to produce the same recombinant protein in both prokaryotic and eukaryotic cells offers many experimental opportunities. However, the cloning of the same gene into multiple plasmids is required, which is time consuming, laborious and still may not produce soluble, stable protein in sufficient quantities. We have developed a set of expression vectors that allows for ligation-independent cloning and rapid functional screening for protein expression in both E. coli and S. cerevisiae. A set of expression vectors was made that can express the same open reading frame in E. coli (via the T7 phage promoter) and in S. cerevisiae (via the CUP1 or MET25 promoter). These plasmids also contain the essential elements for replication and selection in both cell types and have several advantages: they allow for cloning of genes by homologous recombination in yeast, protein expression can be determined before plasmid isolation and sequencing, and a GST-fusion tag is added to aid in soluble expression and purification. We have also included a TEV recognition site that allows for the specific cleavage of the fusion proteins to yield native proteins. The dual promoter vectors can be used for rapid cloning, expression, and purification of target proteins from both prokaryotic and eukaryotic systems with the ability to study post-translation modifications.

  5. Effect of using a laryngeal tube on the no-flow time in a simulated, single-rescuer, basic life support setting with inexperienced users.

    Science.gov (United States)

    Meyer, O; Bucher, M; Schröder, J

    2016-03-01

    The laryngeal tube (LT) is a recommended alternative to endotracheal intubation during advanced life support (ALS). Its insertion is relatively simple; therefore, it may also serve as an alternative to bag mask ventilation (BMV) for untrained personnel performing basic life support (BLS). Data support the influence of LT on the no-flow time (NFT) compared with BMV during ALS in manikin studies. We performed a manikin study to investigate the effect of using the LT for ventilation instead of BMV on the NFT during BLS in a prospective, randomized, single-rescuer study. All 209 participants were trained in BMV, but were inexperienced in using LT; each participant performed BLS during a 4-min time period. No significant difference in total NFT (LT: mean 81.1 ± 22.7 s; BMV: mean 83.2 ± 13.1 s, p = 0.414) was found; however, significant differences in the later periods of the scenario were identified. While ventilating with the LT, the proportion of chest compressions increased significantly from 67.2 to 73.2%, whereas the proportion of chest compressions increased only marginally when performing BMV. The quality of the chest compressions and the associated ventilation rate did not differ significantly. The mean tidal volume and mean minute volume were significantly lower when performing BMV. The NFT was significantly shorter in the later periods in a single-rescuer, cardiac arrest scenario when using an LT without previous training compared with BMV with previous training. A possible explanation for this result may be the complexity and workload of alternating tasks (e.g., time loss when reclining the head and positioning the mask for each ventilation during BMV).

  6. An evaluation of a body image intervention in adolescent girls delivered in single-sex versus co-educational classroom settings.

    Science.gov (United States)

    Dunstan, Candice J; Paxton, Susan J; McLean, Siân A

    2017-04-01

    Body dissatisfaction is now recognized as having considerable negative impact on social, psychological, and physical health, particularly in adolescent girls. Consequently, we have developed a six-session co-educational body image intervention (Happy Being Me Co-educational) designed to reduce body dissatisfaction and its risk factors in Grade 7 girls. In addition to evaluating the program's efficacy, we aimed to identify whether girls would benefit equally when it was delivered as a universal intervention to a whole class including both boys and girls (co-educational delivery), or delivered as a selective intervention to girls only (single-sex delivery). Participants were 200 Grade 7 girls from five schools in Melbourne, Australia. Schools were randomly allocated to receive the intervention in single-sex classes (n=74), co-educational classes (n=73), or participate as a no-intervention control (n=53). Girls completed self-report assessments of body dissatisfaction, psychological (internalization of the thin ideal, appearance comparison, and self-esteem) and peer environment (weight-related teasing and appearance conversations) risk factors for body dissatisfaction, and dietary restraint, at baseline, post-intervention, and at 6-month follow-up. Significant improvements in body dissatisfaction and psychological risk factors were observed in the intervention group at post-intervention and these were maintained at follow-up for psychological risk factors. Importantly, no significant differences between universal and selective delivery were observed, suggesting that the intervention is appropriate for dissemination in both modes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. A single-shot T2mapping protocol based on echo-split gradient-spin-echo acquisition and parametric multiplexed sensitivity encoding based on projection onto convex sets reconstruction.

    Science.gov (United States)

    Chu, Mei-Lan; Chang, Hing-Chiu; Oshio, Koichi; Chen, Nan-Kuei

    2018-01-01

    To develop a high-speed T 2 mapping protocol that is capable of accurately measuring T 2 relaxation time constants from a single-shot acquisition. A new echo-split single-shot gradient-spin-echo (GRASE) pulse sequence is developed to acquire multicontrast data while suppressing signals from most nonprimary echo pathways in Carr-Purcell-Meiboom-Gill (CPMG) echoes. Residual nonprimary pathway signals are taken into consideration when performing T 2 mapping using a parametric multiplexed sensitivity encoding based on projection onto convex sets (parametric-POCSMUSE) reconstruction method that incorporates extended phase graph modeling of GRASE signals. The single-shot echo-split GRASE-based T 2 mapping procedure was evaluated in human studies at 3 Tesla. The acquired data were compared with reference data obtained with a more time-consuming interleaved spin-echo echo planar imaging protocol. T 2 maps derived from conventional single-shot GRASE scans, in which nonprimary echo pathways were not appropriately addressed, were also evaluated. Using the developed single-shot T 2 mapping protocol, quantitatively accurate T 2 maps can be obtained with a short scan time (parametric-POCSMUSE reconstruction. Magn Reson Med 79:383-393, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  8. A segmentation and classification scheme for single tooth in MicroCT images based on 3D level set and k-means+.

    Science.gov (United States)

    Wang, Liansheng; Li, Shusheng; Chen, Rongzhen; Liu, Sze-Yu; Chen, Jyh-Cheng

    2017-04-01

    Accurate classification of different anatomical structures of teeth from medical images provides crucial information for the stress analysis in dentistry. Usually, the anatomical structures of teeth are manually labeled by experienced clinical doctors, which is time consuming. However, automatic segmentation and classification is a challenging task because the anatomical structures and surroundings of the tooth in medical images are rather complex. Therefore, in this paper, we propose an effective framework which is designed to segment the tooth with a Selective Binary and Gaussian Filtering Regularized Level Set (GFRLS) method improved by fully utilizing 3 dimensional (3D) information, and classify the tooth by employing unsupervised learning i.e., k-means++ method. In order to evaluate the proposed method, the experiments are conducted on the sufficient and extensive datasets of mandibular molars. The experimental results show that our method can achieve higher accuracy and robustness compared to other three clustering methods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Metastable coexistence of multiple genotypes in a constant environment with a single resource through fixed settings of a multiplication-survival trade-off.

    Science.gov (United States)

    Maharjan, Ram; Ferenci, Thomas

    2016-04-01

    The biological complexity of trade-offs has been a major obstacle in understanding bacterial diversity and coexistence. Here we reduce the biological complexity by using isogenic Escherichia coli strains differing only in a multiplication-survival trade-off regulated by RpoS. The contribution of trade-off characteristics to fitness in different environments was determined. We then designed an environment with intermediate-stress levels that elicits an equivalent fitness. We found metastable coexistence of three strains in steady-state chemostats until mutations changed the relative fitness of competing strains. Our results help explain the rich intra- and inter-species diversity of bacteria through alternative settings of relatively few trade-offs. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi

    Directory of Open Access Journals (Sweden)

    Leho Tedersoo

    2015-05-01

    Full Text Available Rapid development of high-throughput (HTS molecular identification methods has revolutionized our knowledge about taxonomic diversity and ecology of fungi. However, PCR-based methods exhibit multiple technical shortcomings that may bias our understanding of the fungal kingdom. This study was initiated to quantify potential biases in fungal community ecology by comparing the relative performance of amplicon-free shotgun metagenomics and amplicons of nine primer pairs over seven nuclear ribosomal DNA (rDNA regions often used in metabarcoding analyses. The internal transcribed spacer (ITS barcodes ITS1 and ITS2 provided greater taxonomic and functional resolution and richness of operational taxonomic units (OTUs at the 97% similarity threshold compared to barcodes located within the ribosomal small subunit (SSU and large subunit (LSU genes. All barcode-primer pair combinations provided consistent results in ranking taxonomic richness and recovering the importance of floristic variables in driving fungal community composition in soils of Papua New Guinea. The choice of forward primer explained up to 2.0% of the variation in OTU-level analysis of the ITS1 and ITS2 barcode data sets. Across the whole data set, barcode-primer pair combination explained 37.6–38.1% of the variation, which surpassed any environmental signal. Overall, the metagenomics data set recovered a similar taxonomic overview, but resulted in much lower fungal rDNA sequencing depth, inability to infer OTUs, and high uncertainty in identification. We recommend the use of ITS2 or the whole ITS region for metabarcoding and we advocate careful choice of primer pairs in consideration of the relative proportion of fungal DNA and expected dominant groups.

  11. Brief motivational interview and educational brochure in emergency room settings for adolescents and young adults with alcohol-related problems: a randomized single-blind clinical trial.

    Science.gov (United States)

    Segatto, Maria Luiza; Andreoni, Solange; de Souza e Silva, Rebeca; Diehl, Alessandra; Pinsky, Ilana

    2011-09-01

    To evaluate the effectiveness of brief motivational interviewing and an educational brochure when delivered in emergency room to reduce alcohol abuse and related problems among adolescents and young adults. A randomized single-blind clinical trial with a three-month follow-up was carried out at three emergency rooms from October 2004 to November 2005; subjects assessed were 16-25 years old treated for alcohol related events up to 6 hours after consumption. Socio-demographic data, quantity, frequency and negative consequences of alcohol consumption, motivation to change habits and future risk perception were evaluated. Statistical analysis was performed on subjects who completed follow-up (completers). ANCOVA model was used to analyze the difference between the intervention groups with statistical significance level α = 5% and confidence interval (CI) of 95%. 186 subjects formed the initial sample, being 175 included and randomized to the educational brochure group (n = 88) or motivational interviewing group (n = 87). Follow-up assessment was performed in 85.2% of the sample. No significant difference between groups was observed. However, significant reductions (p motivational interviewing, educational brochure and nonintervention should be of future interest among Brazilian adolescent populations.

  12. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  13. A genome editing primer for the hematologist

    OpenAIRE

    Hoban, Megan D.; Bauer, Daniel E.

    2016-01-01

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand ...

  14. UVB phototherapy in an outpatient setting or at home: a pragmatic randomised single-blind trial designed to settle the discussion. The PLUTO study.

    Science.gov (United States)

    Koek, Mayke B G; Buskens, Erik; Steegmans, Paul H A; van Weelden, Huib; Bruijnzeel-Koomen, Carla A F M; Sigurdsson, Vigfús

    2006-08-01

    Home ultraviolet B (UVB) treatment is a much-debated treatment, especially with regard to effectiveness, safety and side effects. However, it is increasingly being prescribed, especially in the Netherlands. Despite ongoing discussions, no randomised research has been performed, and only two studies actually compare two groups of patients. Thus, firm evidence to support or discourage the use of home UVB phototherapy has not yet been obtained. This is the goal of the present study, the PLUTO study (Dutch acronym for "national trial on home UVB phototherapy for psoriasis"). We designed a pragmatic randomised single-blind multi-centre trial. This trial is designed to evaluate the impact of home UVB treatment versus UVB phototherapy in a hospital outpatient clinic as to effectiveness, quality of life and cost-effectiveness. In total 196 patients with psoriasis who were clinically eligible for UVB phototherapy were included. Normally 85% of the patients treated with UVB show a relevant clinical response. With a power of 80% and a 0.05 significance level it will be possible to detect a reduction in effectiveness of 15%. Effectiveness will be determined by calculating differences in the Psoriasis Area and Severity Index (PASI) and the Self Administered PASI (SAPASI) scores. Quality of life is measured using several validated generic questionnaires and a disease-specific questionnaire. Other outcome measures include costs, side effects, dosimetry, concomitant use of medication and patient satisfaction. Patients are followed throughout the therapy and for 12 months thereafter. The study is no longer recruiting patients, and is expected to report in 2006. In the field of home UVB phototherapy this trial is the first randomised parallel group study. As such, this trial addresses the weaknesses encountered in previous studies. The pragmatic design ensures that the results can be well generalised to the target population. Because, in addition to effectiveness, aspects such as

  15. UVB phototherapy in an outpatient setting or at home: a pragmatic randomised single-blind trial designed to settle the discussion. The PLUTO study

    Directory of Open Access Journals (Sweden)

    van Weelden Huib

    2006-08-01

    Full Text Available Abstract Background Home ultraviolet B (UVB treatment is a much-debated treatment, especially with regard to effectiveness, safety and side effects. However, it is increasingly being prescribed, especially in the Netherlands. Despite ongoing discussions, no randomised research has been performed, and only two studies actually compare two groups of patients. Thus, firm evidence to support or discourage the use of home UVB phototherapy has not yet been obtained. This is the goal of the present study, the PLUTO study (Dutch acronym for "national trial on home UVB phototherapy for psoriasis". Methods We designed a pragmatic randomised single-blind multi-centre trial. This trial is designed to evaluate the impact of home UVB treatment versus UVB phototherapy in a hospital outpatient clinic as to effectiveness, quality of life and cost-effectiveness. In total 196 patients with psoriasis who were clinically eligible for UVB phototherapy were included. Normally 85% of the patients treated with UVB show a relevant clinical response. With a power of 80% and a 0.05 significance level it will be possible to detect a reduction in effectiveness of 15%. Effectiveness will be determined by calculating differences in the Psoriasis Area and Severity Index (PASI and the Self Administered PASI (SAPASI scores. Quality of life is measured using several validated generic questionnaires and a disease-specific questionnaire. Other outcome measures include costs, side effects, dosimetry, concomitant use of medication and patient satisfaction. Patients are followed throughout the therapy and for 12 months thereafter. The study is no longer recruiting patients, and is expected to report in 2006. Discussion In the field of home UVB phototherapy this trial is the first randomised parallel group study. As such, this trial addresses the weaknesses encountered in previous studies. The pragmatic design ensures that the results can be well generalised to the target population

  16. Robot-assisted radical prostatectomy in the setting of previous abdominal surgery: Perioperative results, oncological and functional outcomes, and complications in a single surgeon's series.

    Science.gov (United States)

    Di Pierro, Giovanni Battista; Grande, Pietro; Mordasini, Livio; Danuser, Hansjörg; Mattei, Agostino

    2016-12-01

    Data on safety and efficacy of robot-assisted radical prostatectomy (RARP) after previous abdominal surgery are scarce. Hence, we assessed perioperative, oncological and functional outcomes, and complications of RARP in patients with previous abdominal surgery after 1-year minimum follow-up. Prospectively collected data from 339 consecutive patients undergoing transperitoneal RARP by a single surgeon (AM) between November 2008 and May 2014 were analysed. Complications were classified according to Modified Clavien System. Biochemical recurrence (BCR) was defined as two consecutive PSA values ≥ 0.2 ng/ml. Functional outcomes were assessed using validated, self-administered questionnaires. In particular, only patients undergoing nerve-sparing RARP with no erectile dysfunction (baseline IIEF-5 score >21) and no use of phosphodiesterase-5 inhibitors preoperatively who were interested in erections and required no adjuvant therapy (radiation, orchiectomy and androgen-deprivation therapy) were evaluated concerning potency recovery. Patients without and with previous abdominal surgery were compared using Mann-Whitney and chi-square tests (or Fisher exact test). On 339 patients, 247 (71.6%) had not undergone previous abdominal surgery (Group 1) and 92 (28.4%) were pre-operated (Group 2). There were no statistically significant differences between Groups 1 and 2 regarding mean operative time (260 vs. 257 min; p = 0.597), median number of resected nodes (16 vs. 17; p = 0.484), mean length of stay (7.2 vs. 7.1 d; p = 0.151), positive surgical margin (12.5% vs. 16.3%; p = 0.233) and complication rates (26.7% vs. 31.5%; p = 0.187). Median (IQR) follow-up was 36 (12-48) months. For Groups 1 and 2, BCR-free survival rates were 78.5% and 79.8% (p = 0.467); continence rates were 97.9% and 100% (p = 0.329), whereas a potency recovery was achieved in 69.5% and 62.2% of patients (p = 0.460), respectively. Transperitoneal RARP is a safe and efficient treatment for

  17. Single, community-based blood glucose readings may be a viable alternative for community surveillance of HbA1c and poor glycaemic control in people with known diabetes in resource-poor settings

    Directory of Open Access Journals (Sweden)

    Daniel D. Reidpath

    2016-08-01

    Full Text Available Background: The term HbA1c (glycated haemoglobin is commonly used in relation to diabetes mellitus. The measure gives an indication of the average blood sugar levels over a period of weeks or months prior to testing. For most low- and middle-income countries HbA1c measurement in community surveillance is prohibitively expensive. A question arises about the possibility of using a single blood glucose measure for estimating HbA1c and therefore identifying poor glycaemic control in resource-poor settings. Design: Using data from the 2011–2012 US National Health and Nutrition Examination Surveys, we examined the relationship between HbA1c and a single fasting measure of blood glucose in a non-clinical population of people with known diabetes (n=333. A linear equation for estimating HbA1c from blood glucose was developed. Appropriate blood glucose cut-off values were set for poor glycaemic control (HbA1c≥69.4 mmol/mol. Results: The HbA1c and blood glucose measures were well correlated (r=0.7. Three blood glucose cut-off values were considered for classifying poor glycaemic control: 8.0, 8.9, and 11.4 mmol/L. A blood glucose of 11.4 had a specificity of 1, but poor sensitivity (0.37; 8.9 had high specificity (0.94 and moderate sensitivity (0.7; 8.0 was associated with good specificity (0.81 and sensitivity (0.75. Conclusions: Where HbA1c measurement is too expensive for community surveillance, a single blood glucose measure may be a reasonable alternative. Generalising the specific results from these US data to low resource settings may not be appropriate, but the general approach is worthy of further investigation.

  18. Effective Natural PCR-RFLP Primer Design for SNP Genotyping Using Teaching-Learning-Based Optimization With Elite Strategy.

    Science.gov (United States)

    Cheng, Yu-Huei; Kuo, Che-Nan; Lai, Ching-Ming

    2016-10-01

    SNP (single nucleotide polymorphism) genotyping is the determination of genetic variations of SNPs between members of a species. In many laboratories, PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) is a usually used biotechnology for SNP genotyping, especially in small-scale basic research studies of complex genetic diseases. PCR-RFLP requires an available restriction enzyme at least for identify a target SNP and an effective primer pair conforms numerous constraints. However, the lots of restriction enzymes, tedious sequence and complicated constraints make the mining of available restriction enzymes and the design of effective primer pairs become a major challenge. In the study, we propose a novel and available CI (Computation Intelligence)-based method called TLBO (teaching-learning-based optimization) and introduce the elite strategy to design effective primer pairs. Three common melting temperature computations are available in the method. REHUNT (Restriction Enzymes HUNTing) is first combined with the method to mine available restriction enzymes. Robust in silico simulations for the GA (genetic algorithm), the PSO (particle swarm optimization), and the method for natural PCR-RFLP primer design in the SLC6A4 gene with two hundred and eighty-eight SNPs had been performed and compared. These methods had been implemented in JAVA and they are freely available at https://sites.google.com/site/yhcheng1981/tlbonpd-elite for users of academic and non-commercial interests.

  19. Mechanism and stoichiometry of interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer synthesis.

    Science.gov (United States)

    Mitkova, Atanaska V; Khopde, Sujata M; Biswas, Subhasis B

    2003-12-26

    Initiation and synthesis of RNA primers in the lagging strand of the replication fork in Escherichia coli requires the replicative DnaB helicase and the DNA primase, the DnaG gene product. In addition, the physical interaction between these two replication enzymes appears to play a role in the initiation of chromosomal DNA replication. In vitro, DnaB helicase stimulates primase to synthesize primers on single-stranded (ss) oligonucleotide templates. Earlier studies hypothesized that multiple primase molecules interact with each DnaB hexamer and single-stranded DNA. We have examined this hypothesis and determined the exact stoichiometry of primase to DnaB hexamer. We have also demonstrated that ssDNA binding activity of the DnaB helicase is necessary for directing the primase to the initiator trinucleotide and synthesis of 11-20-nucleotide long primers. Although, association of these two enzymes determines the extent and rate of synthesis of the RNA primers in vitro, direct evidence of the formation of primase-DnaB complex has remained elusive in E. coli due to the transient nature of their interaction. Therefore, we stabilized this complex using a chemical cross-linker and carried out a stoichiometric analysis of this complex by gel filtration. This allowed us to demonstrate that the primase-helicase complex of E. coli is comprised of three molecules of primase bound to one DnaB hexamer. Fluorescence anisotropy studies of the interaction of DnaB with primase, labeled with the fluorescent probe Ru(bipy)3, and Scatchard analysis further supported this conclusion. The addition of DnaC protein, leading to the formation of the DnaB-DnaC complex, to the simple priming system resulted in the synthesis of shorter primers. Therefore, interactions of the DnaB-primase complex with other replication factors might be critical for determining the physiological length of the RNA primers in vivo and the overall kinetics of primer synthesis.

  20. The single-isocenter treatment of head and neck cancer: time gain using MLC and automatic set-up; Traitement des cancers ORL: gain de temps avec le collimateur multilames et la mise en place automatique

    Energy Technology Data Exchange (ETDEWEB)

    Meerleer, G.O. de; Vakaet, L.A.M.L.; Bate, M.T.; Wagter, C. de; Naeyer, B. de; Neve, W.J. de [University Hospital, Gent (Belgium). Div. of Radiotherapy (R-UZG)

    1999-05-01

    In this manuscript, we studied the difference in the treatment time required to execute a single-isocenter three-field irradiation of the head and neck, using either tray-mounted cerro-bend blocks or a multi-leaf collimator (MLC) for field shaping and automatic set-up. A total of twenty consecutive, unselected patients (16 males, four females), were eligible for this study because the dose they were to received was 44 Gy (2 Gy/fraction) to the head,neck and supraclavicular regions. Patients were randomly allocated to one of two treatment groups. The first group (n=11) was treated on a Philips SL-75 linear accelerator (SL-75), using 5 MV photons and tray-mounted cerro-bend blocks. The second group (n=9) was treated on a Philips SL-25 linear accelerator (SL-25-MLC), using 6 MV photons and a MLC. Patients of the second group were treated using the automatic set-up of the SL-25-MLC, without entering the treatment room between consecutive fields. Overall treatment time was significantly shorter on the SL-25-MLC than on the SL-75 (P<0.0001). The difference in total treatment-execution time was in the range of 157 s per treatment session. The largest difference was observed in the set-up time. There was an average of a 125 s time gain per treatment day (P<0.0001) in favour of the SL-25-MLC. Compared to tray-mounted cerro-bend blocks, a MLC and automatic set-up results in a significant time advantage when a single isocenter technique is used to treat head and neck cancer. (authors)

  1. Computation of methodology-independent single-ion solvation properties from molecular simulations. IV. Optimized Lennard-Jones interaction parameter sets for the alkali and halide ions in water

    Science.gov (United States)

    Reif, Maria M.; Hünenberger, Philippe H.

    2011-04-01

    The raw single-ion solvation free energies computed from atomistic (explicit-solvent) simulations are extremely sensitive to the boundary conditions and treatment of electrostatic interactions used during these simulations. However, as shown recently [M. A. Kastenholz and P. H. Hünenberger, J. Chem. Phys. 124, 224501 (2006), 10.1529/biophysj.106.083667; M. M. Reif and P. H. Hünenberger, J. Chem. Phys. 134, 144103 (2010)], the application of appropriate correction terms permits to obtain methodology-independent results. The corrected values are then exclusively characteristic of the underlying molecular model including in particular the ion-solvent van der Waals interaction parameters, determining the effective ion size and the magnitude of its dispersion interactions. In the present study, the comparison of calculated (corrected) hydration free energies with experimental data (along with the consideration of ionic polarizabilities) is used to calibrate new sets of ion-solvent van der Waals (Lennard-Jones) interaction parameters for the alkali (Li+, Na+, K+, Rb+, Cs+) and halide (F-, Cl-, Br-, I-) ions along with either the SPC or the SPC/E water models. The experimental dataset is defined by conventional single-ion hydration free energies [Tissandier et al., J. Phys. Chem. A 102, 7787 (1998), 10.1021/jp982638r; Fawcett, J. Phys. Chem. B 103, 11181] along with three plausible choices for the (experimentally elusive) value of the absolute (intrinsic) hydration free energy of the proton, namely, Δ G_hyd^{ominus }[H+] = -1100, -1075 or -1050 kJ mol-1, resulting in three sets L, M, and H for the SPC water model and three sets LE, ME, and HE for the SPC/E water model (alternative sets can easily be interpolated to intermediate Δ G_hyd^{ominus }[H+] values). The residual sensitivity of the calculated (corrected) hydration free energies on the volume-pressure boundary conditions and on the effective ionic radius entering into the calculation of the correction terms is

  2. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  3. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  4. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  5. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  6. The emergence of consensus: a primer

    Science.gov (United States)

    Baronchelli, Andrea

    2018-02-01

    The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges `spontaneously' in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems.

  7. A mathematical primer on quantum mechanics

    CERN Document Server

    Teta, Alessandro

    2018-01-01

    This book offers a rigorous yet elementary approach to quantum mechanics that will meet the needs of Master’s-level Mathematics students and is equally suitable for Physics students who are interested in gaining a deeper understanding of the mathematical structure of the theory. Throughout the coverage, which is limited to single-particle quantum mechanics, the focus is on formulating theory and developing applications in a mathematically precise manner. Following a review of selected key concepts in classical physics and the historical background, the basic elements of the theory of operators in Hilbert spaces are presented and used to formulate the rules of quantum mechanics. The discussion then turns to free particles, harmonic oscillators, delta potential, and hydrogen atoms, providing rigorous proofs of the corresponding dynamical properties. Starting from an analysis of these applications, readers are subsequently introduced to more advanced topics such as the classical limit, scattering theory, and s...

  8. A genome editing primer for the hematologist

    Science.gov (United States)

    Hoban, Megan D.

    2016-01-01

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand nicks and targeted biochemical modifications that do not permanently alter the DNA sequence (epigenome editing) may be powerful instruments. In this review, we examine the various technologies, describe their advantages and shortcomings for engendering useful genetic alterations, and consider future prospects for genome editing to impact hematology. PMID:27053532

  9. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2014-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  10. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2016-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  11. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... Introduction. The monophagous domesticated silkworm Bombyx mori derives all its nutritional requirements from the mulberry (Morus spp.) leaves. Therefore, mulberry improvement has a key role in sustainably improving the quality and yield of silk. Lack of co-dominant markers for use in genetic mapping ...

  12. Designing specific chloroplast markers for black walnut from a set of universal primers

    Science.gov (United States)

    Erin Victory; Rodney L. Robichaud; Keith Woeste

    2003-01-01

    Chloroplasts are a valuable source of genetic information because their sequence is highly conserved, they undergo little or no recombination, and they are uniparentally inherited. Chloroplast polymorphisms are powerful genetic tools for identifying matrilineal family groups, studying gene flow from seed versus pollen movement, reconstructing phylogeographic...

  13. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eve J.; Chiang, Eugene, E-mail: evelee@berkeley.edu, E-mail: echiang@astro.berkeley.edu [Department of Astronomy, University of California Berkeley, Berkeley, CA 94720-3411 (United States)

    2016-08-20

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  14. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    International Nuclear Information System (INIS)

    Lee, Eve J.; Chiang, Eugene

    2016-01-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  15. A Primer on Unifying Debris Disk Morphologies

    Science.gov (United States)

    Lee, Eve J.; Chiang, Eugene

    2016-08-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  16. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  17. Onchocercal DNA amplification using beta actin gene primers ...

    African Journals Online (AJOL)

    Onchocercal DNA amplification using beta actin gene primers compared with first internal transcribed spacer sequences for monitoring onchocerciasis eradication strategy. ... Out of the 12 amplicons in agarose gel, there were 6 sharp and 6 faint bands of 100bp molecular weight as documented. The sharp bands included 3 ...

  18. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  19. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  20. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... 500. Figure 1. PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using RAPD primer GLC-07. M = Molecular size marker (100 bp DNA ladder, Gene Link, USA). important crops species including wheat (T. aestivum L.). Among the DNA markers, randomly amplified.

  1. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  2. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  3. t-PA power-pulse spray with rheolytic mechanical thrombectomy using cross-sectional image-guided portal vein access for single setting treatment of subacute superior mesenteric vein thrombosis

    Directory of Open Access Journals (Sweden)

    Mubin I Syed

    2018-01-01

    Full Text Available Background: Isolated superior mesenteric vein (SMV thrombosis is a rare but potentially fatal condition if untreated. Current treatments include transjugular or transhepatic approaches for rheolytic mechanical thrombectomy and subsequent infusions of thrombolytics. Tissue plasminogen activator (t-PA power-pulse spray can provide benefit in a single setting without thrombolytic infusions. Computed tomography (CT guidance for portal vein access is underutilized in this setting. Materials and Methods: Case 1 discusses acute SMV thrombosis treated with rheolytic mechanical thrombectomy alone using ultrasound guidance for portal vein access. Case 2 discusses subacute SMV thrombosis treated with the addition of t-PA power-pulse spray to the rheolytic mechanical thrombectomy, using CT guidance for portal vein access. Results: With rheolytic mechanical thrombectomy alone, the patient in Case 1 had significant improvement in abdominal pain. Follow-up CT demonstrated no residual SMV thrombosis and the patient continued to do well in long-term follow-up. With the addition of t-PA power-pulse spray to rheolytic mechanical thrombectomy, the patient in Case 2 with subacute SMV thrombosis dramatically improved postprocedure with resolution of abdominal pain. Follow-up imaging demonstrated patency to the SMV and partial resolution of thrombus. The patient continued to do well at 2-year follow-up. Conclusions: Adding t-PA power-pulse spray to rheolytic mechanical thrombectomy can provide benefit in a single setting versus mechanical thrombectomy alone and prevent the need for subsequent infusions of thrombolytic therapy. CT guidance is a useful alternative of localization for portal vein access via the transhepatic route that is nonoperator-dependent and helpful in the case of obese patients.

  4. Online social networking: a primer for radiology.

    Science.gov (United States)

    Prasanna, Prasanth M; Seagull, F Jacob; Nagy, Paul

    2011-10-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-communication is effective? What are the potential benefits and pitfalls of this form of communication? Physicians are exploring how social networking might provide a forum for interacting with their patients, and advance collaborative patient care. Several organizations and institutions have set forth policies to address these questions and more. Though still in its infancy, this form of media has the power to revolutionize the way physicians interact with their patients and fellow health care workers. In the end, physicians must ask what value is added by engaging patients or other health care providers in a social networking format. Social networks may flourish in health care as a means of distributing information to patients or serve mainly as support groups among patients. Physicians must tread a narrow path to bring value to interactions in these networks while limiting their exposure to unwanted liability.

  5. Development of allele-specific single-nucleotide polymorphism-based polymerase chain reaction markers in cytochrome oxidase I for the differentiation of Bactrocera papayae and Bactrocera carambolae (Diptera: Tephritidae).

    Science.gov (United States)

    Chua, Tock H; Song, B K; Chong, Y V

    2010-12-01

    Differentiation of Bactrocera papayae Drew & Hancock and Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) based on morphological characters has often been problematical. We describe here a single-nucleotide polymorphism (SNP)-based polymerase chain reaction (PCR) assay to differentiate between these two species. For detection of SNPs, fragments derived from each species were amplified using two primer pairs, COIF/COIR and UEA7/UEA10, sequenced, and aligned to obtain a contiguous 1,517-bp segment. Two new sets of primers were designed based on the 11 SNPs identified in the region. Results of the SNP-PCR test using any one of these species-specific primer sets indicate that these two species could be differentiated on basis of presence or absence of a band in the gel profile. We also tested the SNP-PCR primers on Bactrocera umbrosa F., Bactrocera cucurbitae Coquillett, Bactrocera latifrons Hendel, and Bactrocera tau (Walker) but did not detect any band in the gel, indicating the likelihood of a false positive for B. papayae is nil. This SNP-PCR method is efficient and useful, especially for immature life stages or when only adult body parts of the two species are available for identification, as encountered often in quarantine work.

  6. A U.S. Biodefense Strategy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, D

    2009-05-11

    The anthrax mailings that followed the attacks of September 11, 2001 highlighted the need for a comprehensive national strategy to prevent, prepare for, respond to, and mitigate the effects of biological attacks. The goal of U.S. biodefense strategy is to reduce the likelihood of a future biological event, improve overall U.S. public health security, and minimize the economic and social disruption of a biological incident. Presidential communications, federal legislation, and executive agency planning documents provide the foundation for this strategy. Central to current U.S. biodefense strategy is the 2004 Homeland Security Presidential Directive (HSPD) 10, Biodefense for the 21st Century, which states that ''the United States will use all means necessary to prevent, protect against, and mitigate biological weapons attacks perpetrated against our homeland and our global interests.'' HSPD-10 also sets forth four pillars of U.S. biodefense: {sm_bullet} Threat awareness includes timely, accurate, and relevant intelligence, threat assessment, and the anticipation of future threats. {sm_bullet} Prevention and protection involve continuing and expanding efforts to limit access to agents, technologies, and knowledge to certain groups and countries as well as protecting critical infrastructure from the effects of biological attacks. {sm_bullet} Surveillance and detection provide early warning or recognition of biological attacks to permit a timely response and mitigation of consequences as well as attribution. {sm_bullet} Response and recovery include pre-attack planning and preparedness, capabilities to treat casualties, risk communications, physical control measures, medical countermeasures, and decontamination capabilities.

  7. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  8. The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

    Science.gov (United States)

    Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

    2018-01-01

    We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

  9. Automatic sets and Delone sets

    International Nuclear Information System (INIS)

    Barbe, A; Haeseler, F von

    2004-01-01

    Automatic sets D part of Z m are characterized by having a finite number of decimations. They are equivalently generated by fixed points of certain substitution systems, or by certain finite automata. As examples, two-dimensional versions of the Thue-Morse, Baum-Sweet, Rudin-Shapiro and paperfolding sequences are presented. We give a necessary and sufficient condition for an automatic set D part of Z m to be a Delone set in R m . The result is then extended to automatic sets that are defined as fixed points of certain substitutions. The morphology of automatic sets is discussed by means of examples

  10. [Molecular identification of Mentha haplocalyx and Mentha spicata with specific primers multi-PCR system].

    Science.gov (United States)

    Cao, Liang; Qin, Shuang-shuang; Yuan, Yuan; Zhu, Xiao-qi

    2014-01-01

    To screen specific SNPs loci of Mentha haplocalyx and Mentha spicata,and then specific primers were designed to identify the two species and their mixture rapidly. PsbA-trnH sequences of Mentha haplocalyx and Mentha spicata were obtained by PCR product sequencing and downloading from GenBank. SNPs in the psbA-trnH sequences of Mentha haplocalyx and Mentha spicata were found by ClustulW program and Bioedit software. Primers for authentication of the two species were designed according to the SNP loci, and PCR reaction system was optimized to identify the original plants. Multi-PCR reaction system was constructed. The 181 bp identification band for Mentha haplocalyx or(and) 288 bp identification band for Mentha spicata could be produced by a single PCR reaction,which showed good identification ability to the two species. The multi-PCR reaction system can be applied to identify Mentha haplocalyx and Mentha spicata as well as their mixture.

  11. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  12. Assessment of primers designed for the subspecies-specific discrimination among Babesia canis canis, Babesia canis vogeli and Babesia canis rossi by PCR assay.

    Science.gov (United States)

    Duarte, Sabrina Castilho; Linhares, Guido Fontgalland Coelho; Romanowsky, Tatiana Nunes; da Silveira Neto, Osvaldo José; Borges, Ligia Miranda Ferreira

    2008-03-25

    Canine babesiosis is an infectious disease caused by either Babesia gibsoni or Babesia canis protozoans. The latter is also classified under three different phylogenetic groups, referred to as subspecies B. canis canis, B. canis vogeli and B. canis rossi. The objective of the present study was to validate and standardize a PCR assay to discriminate the organisms at the subspecies level. First, the reference sequences of the 18S rRNA, 5.8S rRNA and 28S rRNA genes, including the internal transcribed spacer 1 (ITS1) and 2 (ITS2) of the most common species and subspecies of the genus Babesia were retrieved from the GenBank database. Subspecies-specific primers (BAB3, BAB4 and BAB5) and one genus-specific primer were designed from the alignment of the sequences. The PCR assays were evaluated in three different combinations of primer pairs in order to assure complete specificity for each reaction. The results of the tests had demonstrated effectiveness of the novel primer pairs BAB1/BAB3, BAB1/BAB4 and BAB1/BAB5 for the amplification of the subspecies-specific target fragments of 746 bp (B. c. canis), 546 bp (B. c. vogeli) and 342 bp (B. c. rossi) by PCR. The original enzymatic amplification assays with novel primers reported in this paper were confirmed to be a reliable tool for the specific discrimination among B. canis subspecies by single-step PCR assays.

  13. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Science.gov (United States)

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  14. Novel intein-containing DNA specific primers for rapid identification of Candida glabrata using Real-Time PCR assays.

    Science.gov (United States)

    Kumar, R Satish; Ramesh, S

    2014-12-01

    Candida glabrata is an opportunistic human pathogen known to cause systemic and vaginal candidiasis. Rapid detection of Candida glabrata is indispensable for appropriate selection of antifungal drugs for chemotherapy. The study describes a unique intein-containing DNA fragment for specific detection of C. glabrata. The designed oligonucleotides detected C. glabrata (Ct mean: 24.75 ± 1.1 and Tm: 70.08 ± 0.23°C) in Real-Time PCR assays. The fluorescent signals were negative when the primers were tested for cross-species and cross-genera amplifications. In conclusion, our study recommends a novel primer set for developing a quick identification system which does not require laborious and time-consuming experimentations. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. STRP Screening Sets for the human genome at 5 cM density

    Directory of Open Access Journals (Sweden)

    Marth Gabor

    2003-02-01

    Full Text Available Abstract Background Short tandem repeat polymorphisms (STRPs are powerful tools for gene mapping and other applications. A STRP genome scan of 10 cM is usually adequate for mapping single gene disorders. However mapping studies involving genetically complex disorders and especially association (linkage disequilibrium often require higher STRP density. Results We report the development of two separate 10 cM human STRP Screening Sets (Sets 12 and 52 which span all chromosomes. When combined, the two Sets contain a total of 782 STRPs, with average STRP spacing of 4.8 cM, average heterozygosity of 0.72, and total sex-average coverage of 3535 cM. The current Sets are comprised almost entirely of STRPs based on tri- and tetranucleotide repeats. We also report correction of primer sequences for many STRPs used in previous Screening Sets. Detailed information for the new Screening Sets is available from our web site: http://research.marshfieldclinic.org/genetics. Conclusion Our new human STRP Screening Sets will improve the quality and cost effectiveness of genotyping for gene mapping and other applications.

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  19. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    Science.gov (United States)

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  20. Detection of mutated primers and impact on targeted metagenomics results

    OpenAIRE

    Antoine-Lorquin, Aymeric; Mahé, Frédéric; Dunthorn, Micah; Belleannée, Catherine

    2016-01-01

    International audience; High-throughout sequencing platforms are widely used in metabarcoding studies of environmental microbial diversity as they can quickly produce millions of reads. Resulting reads in these studies are clustered into molecular operational taxonomic units (OTUs) and compared statistically. In order to limit the number of spurious OTUs retrieved from samples, eliminating the reads with mutated primers has become the norm. This process has the advantage of not requiring the ...

  1. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  2. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  3. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    provides a framework for examining spending patterns of the federal government by category of activity, rather than by agency or type of financing ...federal spending. Since federal agencies often have diverse, overlapping responsibilities , it is not uncommon for them to be associated with multiple...agency responsible for approximately 96% of spending within the National Defense Budget (050). Defense Primer: The National Defense Budget Function

  4. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino

    2006-01-01

    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  5. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  6. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  7. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  8. ExoMeth sequencing of DNA: eliminating the need for subcloning and oligonucleotide primers.

    Science.gov (United States)

    Sorge, J A; Blinderman, L A

    1989-01-01

    A method is reported for sequencing DNA based on exonuclease III digestion and strand protection by using modified nucleoside triphosphates. Up to 10 kilobases of sequence information may be obtained from each strand of a given template without subcloning. Prior knowledge of the restriction map is not important; prior knowledge of any of the sequence is not required. Nor are oligonucleotide primers needed. Double-stranded cosmids, plasmids, lambda phage, or linear molecules (including amplified molecules) may be used as starting material. The method creates a single-stranded template from these starting molecules, thus generating high-quality sequence ladders. Most commonly used DNA polymerases may be utilized, including reverse transcriptase and T7 DNA polymerase. The approach is "ordered", so little time is wasted on redundant sequencing. Images PMID:2556705

  9. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    Directory of Open Access Journals (Sweden)

    Caty Martínez B

    2009-04-01

    Full Text Available Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC y primer intervalo de parto (PIDP en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de variación. En el análisis se consideraron los efectos de año de parto, época de parto, edad al primer parto (no se consideró para EPP, sexo de la cría, grupo racial y peso a los 24 meses. Resultados. La media para la EPP y PIDP fue de 38.9 ± 3.9 meses y 469.2 ± 9 días, respectivamente, donde el efecto época de parto, fue significativo para la duración del PIDP. Los efectos sexo de la cría, peso a los 24 meses y época, no fueron significativos sobre la EPP. Los efectos año de parto, edad al primer parto, sexo de la cría, peso a los 24 meses no fueron significativos sobre el PIDP. Conclusiones. La EPP y PIDP fueron afectados por el año y la época de parto, respectivamente.

  10. Community Based Screening, Brief-Intervention and Referral for Treatment (SBIRT for unhealthy tobacco use: single arm study experience and Implementation Success in rural and semi-rural settings, South-West Nigeria

    Directory of Open Access Journals (Sweden)

    Victor Olufolahan Lasebikan

    2016-08-01

    Full Text Available Objective: To determine whether Screening, Brief Intervention and Referral to Treatment (SBIRT can reduce the prevalence of tobacco use in rural and semi-rural settings. Method: Design and participants: A non-randomized clinical trial with assessments at baseline and post-intervention assessments at 3 and 6 months was conducted in a rural and semi-rural district in South-West of Nigeria. A representative sample of 1203 persons consented to the study and had ASSIST administered to them by trained community healthcare extension workers between October, 2010 and April, 2011. Follow-up participation was more than 99% at all points. Intervention: Participants received a single ASSIST linked brief intervention (BI and referral for treatment (RT at entry, and a booster ASSIST BI and RT at 3 months.Main outcomes and measures: The primary outcome was self-reported scores on ASSIST. Results: At baseline, out of 1203 respondents, lifetime prevalence and current prevalence of any tobacco products was 405 (33.7% and 248 (20.6% respectively. Of the current users, on the ASSIST, 79 (31.9% scored 0-3 (low health risk, 130 (52.4% scored 4-26 (moderate risk, 39 (15.7% scored 27+ (high risk. At 3 months, out of 1199 respondents, prevalence of current users was 199 (16.5% and out of 1195 respondents, was 169 (14.1% at 6 months. Prevalence of tobacco use reduced significantly at 3 months Z = -3.1, p = 0.01 and at 6 months when compared with baseline Z = 4.2, p = 0.001, but not at 6 months compared with at 3 months, Z = 2.1, p = 0.09. Multivariate analysis revealed that age at initiation of tobacco use, gender, marital status, setting of dwelling and socioeconomic status were the only variables that were associated with current tobacco use at baseline, 3 months and 6 months.Conclusion: A one-time BI with a booster at 3 months had a significant effect on tobacco use in persons living in community settings. This finding suggests a need for promoting the adoption of

  11. PCR-Based Diagnosis of Neoscytalidium dimidiatum Infection Using Internal Transcribed Spacer 1 Region of Ribosomal DNA Primers

    Directory of Open Access Journals (Sweden)

    Charussri Leeyaphan, M.D.

    2018-01-01

    Full Text Available Objective: To develop N. dimidiatum-specific single PCR-based identification with DNA sequences of nuclear ribosomal internal transcribed spacer (ITS 1 region primers to facilitate the rapid and accurate detection of N. dimidiatum. Methods: N. dimidiatum-specific PCR primers were designed based on the sequence of the internal transcribed spacer 1 region, which is located between 18S and 5.8S nuclear rDNA. Fungal DNA extracted from common causative species for superficial fungal infection including: 2 strains of N. dimidiatum, 9 species of dermatophyte (DMP and 25 species of non-dermatophyte (NDM colonies grown on culture plates were used for PCR analysis. Also, 30 clinical specimens collected from 30 patients clinically diagnosed with fungal nail and feet infection who attended Dermatology clinic Siriraj Hospital during October 2015 to November 2015 were used for PCR assay. Results: Using N. dimidiatum-specific PCR primers, the PCR product was amplified from two standard strains of N. dimidiatum, and there was no amplification from other DMP or NDM species. Regarding sensitivity as lower limit of detection, this PCR method was able to detect 10 pg of N. dimidiatum DNA with ethidium bromide staining and could detect N. dimidiatum in clinical samples. Conclusion: This newly developed N. dimidiatum-specific PCR identification system is rapid, sensitive, and specific. This diagnostic method will facilitate early and accurate diagnosis and accelerate appropriate treatment in patients with N. dimidiatum infection.

  12. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis.

    Science.gov (United States)

    Wang, M; Park, J S; Ishiai, M; Hurwitz, J; Lee, S H

    2000-12-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) alpha and delta. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol alpha-primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis.

  13. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)

    Badar‑uz‑Zaman

    2012-08-01

    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.

  14. Design and evaluation of PCR primers which differentiate Escherichia coli O157:H7 and related serotypes.

    Science.gov (United States)

    Rice, W C

    2009-01-01

    To develop methods to differentiate Escherichia coli O157:H7 and related serotypes by the use of amplicon length polymorphism (ALP) analysis based on identifying DNA sequence deletions within highly homologous regions of three sequenced E. coli strains. Potential primer locations along the ancestral genomic backbone were identified and evaluated against three sequenced genomes and then applied to a reference set of pathogenic E. coli strains. All 16 primer combinations generated the expected diagnostic fragments as predicted for the E. coli K12 MG1655, O157:H7 EDL933, and O157:H7B Sakai genomes. This study defines a collection of primers distributed along the length of the E. coli genome that were applied to ALP analysis methods to successfully differentiate between serotypes of E. coli O157:H7 and other E. coli serotypes. ALP-PCR analysis method was validated as an independent method of classification when compared with that of rep-PCR. The principles underlying ALP analysis can be readily applied for the detection and differentiation of other closely related microbial species because of the abundance of complete DNA sequence data for a large number of microbial genomes.

  15. Effects of silane- and MDP-based primers application orders on zirconia-resin adhesion-A ToF-SIMS study.

    Science.gov (United States)

    Chuang, Shu-Fen; Kang, Li-Li; Liu, Yi-Chuan; Lin, Jui-Che; Wang, Ching-Cheng; Chen, Hui-Min; Tai, Cheng-Kun

    2017-08-01

    To evaluate the 3-methacryloyloxypropyltrimethoxysilane (MPS)- and 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-base primers, in their single or sequential applications, with regard to modifying zirconia surfaces and improving resin-zirconia adhesion. Zirconia disks received different treatments: without primer (Zr), MPS-base primer (S), MDP-base primer (M), MPS/MDP mixture (SMmix), MPS followed by MDP (SM), and MDP followed by MPS (MS). The compositions and chemical interactions of the coatings to zirconia were analyzed using time-of-flight secondary ion mass spectrometry (ToF-SIMS) and reconstructed 3D ion images. Surface wettability of these coatings to water and resin adhesive was assessed. The shear bond strength (SBS) between resin and the treated zirconia was also examined before and after thermocycling. Groups S and MS presented substantial OH - ions in the coatings and zirconia substrate. PO 2 - and PO 3 - fragments existed in all MDP-treatment groups with various proportions and distributions, while groups M and SM showed higher proportions of PO 3 - and the zirconium phosphate related ions. In 3D ion images, PO 3 - in groups M and SM was denser and segregated to the interface, but was dispersed or overlaid above PO 2 - in SMmix and MS. All the primers increased the surface wettability to water and resin, with M and SM presenting superhydrophilic surfaces. All MDP-treatment groups showed improved SBS before thermocycling, while M and SM retained higher SBS after this. The MDP-base primer shows a relevant function in facilitating POZr bonding and enhancing resin-zirconia bonding. The co-treated MPS impairs the chemical activity of MDP, especially if it is the final coat. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  16. Status of corrosions protection primers for the automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann-Loeser, P. [Adam Opel AG, Ruesselsheim (Germany); Schnell, A. [DaimlerChrysler, Werk Sindelfingen (Germany); Stellnberger, K.H.; Androsch, F.M. [voestalpine Stahl, Linz (Austria); Reier, T. [SZMF, Salzgitter (Germany); Lewandowski, J. [ThyssenKrupp Stahl, Duisburg (Germany); Filthaut, C. [DOC Dortmunder OberflaechenCentrum, Dortmund (Germany); Besseyrias, A. [Arcelor / R and D LEDEPP, Florange (France); Dane, C. [Corus, Ijmuiden (Netherlands); Steinbeck, G. [Steel Institute VDEh, Duesseldorf (Germany)

    2005-07-01

    In Europe, 2.5 - 4 {mu}m Zn-pigmented corrosion protection primers (CPP) are being used by the automotive industry. A short introduction describing the development steps leading up to the state of the art will be given and also the reasons for using it in practice. For some applications it became necessary to try to achieve a significantly higher level of corrosion resistance than this ''first generation'' type coating can offer. It was also important to lower the curing temperature of the paint considerably in order to be able to supply bake-hardening grade steels. This type of corrosion protection primer is now called the ''second generation''. The Opel-production of the Astra-family started using 2{sup nd} generation CPP (4-6 {mu}m) on chromate-free pre-treatment and EG for hood and crash box in 2004. The newest developments show a high potential to lower the coating thickness even further and thus make cost savings possible. The development process is still ongoing and for effective progress, a good mutual basis for laboratory evaluation of properties is of valuable support. In a Steel Institute VDEh working group (Arcelor, Corus, Salzgitter, ThyssenKrupp, voestalpine), test procedures are being generated in order to be able to correctly assess properties such as corrosion resistance, adhesion, peeling-off behavior, etc. An overview of the procedures will be given together with correlations between laboratory results and reality. To round up the paper, corrosion protection primers have a number of potentials which can be utilized by the automotive industry to justify the additional cost. Examples highlighted with results giving evidence of these potentials will be shown. (orig.)

  17. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  18. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  19. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. [eds.; Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  20. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  1. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  2. Primer reporte de la familia Cheiridiidae (Arachnida: Pseudoscorpionida en Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alexander Quirós-Rodríguez

    2015-09-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  3. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  4. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  5. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  6. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per

    2012-01-01

    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  7. Transcriptome-mining for single-copy nuclear markers in ferns.

    Directory of Open Access Journals (Sweden)

    Carl J Rothfels

    Full Text Available BACKGROUND: Molecular phylogenetic investigations have revolutionized our understanding of the evolutionary history of ferns-the second-most species-rich major group of vascular plants, and the sister clade to seed plants. The general absence of genomic resources available for this important group of plants, however, has resulted in the strong dependence of these studies on plastid data; nuclear or mitochondrial data have been rarely used. In this study, we utilize transcriptome data to design primers for nuclear markers for use in studies of fern evolutionary biology, and demonstrate the utility of these markers across the largest order of ferns, the Polypodiales. PRINCIPAL FINDINGS: We present 20 novel single-copy nuclear regions, across 10 distinct protein-coding genes: ApPEFP_C, cryptochrome 2, cryptochrome 4, DET1, gapCpSh, IBR3, pgiC, SQD1, TPLATE, and transducin. These loci, individually and in combination, show strong resolving power across the Polypodiales phylogeny, and are readily amplified and sequenced from our genomic DNA test set (from 15 diploid Polypodiales species. For each region, we also present transcriptome alignments of the focal locus and related paralogs-curated broadly across ferns-that will allow researchers to develop their own primer sets for fern taxa outside of the Polypodiales. Analyses of sequence data generated from our genomic DNA test set reveal strong effects of partitioning schemes on support levels and, to a much lesser extent, on topology. A model partitioned by codon position is strongly favored, and analyses of the combined data yield a Polypodiales phylogeny that is well-supported and consistent with earlier studies of this group. CONCLUSIONS: The 20 single-copy regions presented here more than triple the single-copy nuclear regions available for use in ferns. They provide a much-needed opportunity to assess plastid-derived hypotheses of relationships within the ferns, and increase our capacity to

  8. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  9. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  10. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  11. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  12. Effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers.

    Science.gov (United States)

    Chen, Liang; Shen, Hong; Suh, Byoung In

    2013-11-01

    Some silane primers and some zirconia primers contain extra resins such as bisphenol A glycol dimethacrylate (BisGMA) in their formulations for better wetting. No studies exist on the bonding properties of zirconia and silane primers, which contain extra resins. The purpose of this study was to investigate the effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers. Silica-base lithium disilicate was etched and treated with BisGMA-incorporated Porcelain Primer, unmodified Porcelain Primer, or resin-containing Kerr Silane. Zirconia ceramic was airborne-particle abraded and treated with BisGMA-incorporated Monobond Plus, unmodified Monobond Plus, or BisGMA-containing ZPrime Plus. After primer treatment and cleaning with ethanol, the contact angles were measured to determine surface change (n=10). Shear bond strength tests were also performed to measure the adhesion strength between resin cements and ceramic surfaces (n=10). Data were statistically analyzed by 1-way ANOVA followed by the Tukey multiple comparison as a post hoc test (significance level .05). The incorporation of BisGMA resin did not significantly influence the bond strength or contact angle of the zirconia primer (P>.05), but it did significantly reduce those of the silane primer (PSilane (22 degrees, 23 MPa) had a similar contact angle and higher bond strength than the control (21 degrees, 18 MPa), but lower than Porcelain Primer (88 degrees, 34 MPa). Resin-containing ZPrime Plus (75 degrees, 29 MPa) had a similar contact angle and higher bond strength than both Monobond Plus (74 degrees, 18 MPa) and the control (15 degrees, 4 MPa). The addition of BisGMA resin significantly inhibited the efficacy of silane-containing porcelain primers but did not affect that of phosphate-containing zirconia primers. Copyright © 2013 Editorial Council for the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  13. Studi Operasi Resin Penukar Ion Dalam Sistem Purifikasi Air Primer Pwr

    OpenAIRE

    Biyantoro, Dwi; Basuki, Kris Tri; Subagiono, Subagiono

    2006-01-01

    STUDI OPERASI RESIN PENUKAR ION DALAM SISTEM PURIFIKASI AIR PRIMER PWR. Telah dilakukan studioperasi resin penukar ion dalam sistem purifikasi air primer PWR. Air pendingin reaktor yang pada awalnya sesuaidengan persyaratan setelah pengoperasian reaktor sering kualitasnya berubah, sehingga harus dimurnikan. Unsurunsurpengotor dalam air primer PWR diidentifikasi sebagai penyebab pengotor seperti korosi, pelepasan produk fisi(Cs137, Sr90, Co60,C14, Tc99), dan pelepasan kembali unsur oleh resin ...

  14. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    -chain, the immunoglobulin kappa light chain, and the c-myc locus. Whereas none of the mutants were found to revert to tRNAPro primer utilization, in two tumors resulting from the injection of the SL3-3 Lys3 mutant the primer binding site was altered to match that of a new primer species, tRNA1,2Lys. In addition...

  15. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  16. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  17. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  18. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. RecJ-like protein from Pyrococcus furiosus has 3′–5′ exonuclease activity on RNA: implications for proofreading of 3′-mismatched RNA primers in DNA replication

    Science.gov (United States)

    Yuan, Hui; Liu, Xi-Peng; Han, Zhong; Allers, Thorsten; Hou, Jing-Li; Liu, Jian-Hua

    2013-01-01

    Replicative DNA polymerases require an RNA primer for leading and lagging strand DNA synthesis, and primase is responsible for the de novo synthesis of this RNA primer. However, the archaeal primase from Pyrococcus furiosus (Pfu) frequently incorporates mismatched nucleoside monophosphate, which stops RNA synthesis. Pfu DNA polymerase (PolB) cannot elongate the resulting 3′-mismatched RNA primer because it cannot remove the 3′-mismatched ribonucleotide. This study demonstrates the potential role of a RecJ-like protein from P. furiosus (PfRecJ) in proofreading 3′-mismatched ribonucleotides. PfRecJ hydrolyzes single-stranded RNA and the RNA strand of RNA/DNA hybrids in the 3′–5′ direction, and the kinetic parameters (Km and Kcat) of PfRecJ during RNA strand digestion are consistent with a role in proofreading 3′-mismatched RNA primers. Replication protein A, the single-stranded DNA–binding protein, stimulates the removal of 3′-mismatched ribonucleotides of the RNA strand in RNA/DNA hybrids, and Pfu DNA polymerase can extend the 3′-mismatched RNA primer after the 3′-mismatched ribonucleotide is removed by PfRecJ. Finally, we reconstituted the primer-proofreading reaction of a 3′-mismatched ribonucleotide RNA/DNA hybrid using PfRecJ, replication protein A, Proliferating cell nuclear antigen (PCNA) and PolB. Given that PfRecJ is associated with the GINS complex, a central nexus in archaeal DNA replication fork, we speculate that PfRecJ proofreads the RNA primer in vivo. PMID:23605041

  20. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  1. AAscan, PCRdesign and MutantChecker: a suite of programs for primer design and sequence analysis for high-throughput scanning mutagenesis.

    Directory of Open Access Journals (Sweden)

    Dawei Sun

    Full Text Available Scanning mutagenesis is a powerful protein engineering technique used to study protein structure-function relationship, map binding sites and design more stable proteins or proteins with altered properties. One of the time-consuming tasks encountered in application of this technique is the design of primers for site-directed mutagenesis. Here we present an open-source multi-platform software AAscan developed to design primers for this task according to a set of empirical rules such as melting temperature, overall length, length of overlap regions, and presence of GC clamps at the 3' end, for any desired substitution. We also describe additional software tools which are used to analyse a large number of sequencing results for the presence of desired mutations, as well as related software to design primers for ligation independent cloning. We have used AAscan software to design primers to make over 700 mutants, with a success rate of over 80%. We hope that the open-source nature of our software and ready availability of freeware tools used for its development will facilitate its adaptation and further development. The software is distributed under GPLv3 licence and is available at http://www.psi.ch/lbr/aascan.

  2. A restriction site to differentiate Plasmodium and Haemoproteus infections in birds: on the inefficiency of general primers for detection of mixed infections.

    Science.gov (United States)

    Martínez, J; Martínez-DE LA Puente, J; Herrero, J; Del Cerro, S; Lobato, E; Rivero-DE Aguilar, J; Vásquez, R A; Merino, S

    2009-06-01

    Avian Plasmodium and Haemoproteus parasites are easily detected by DNA analyses of infected samples but only correctly assigned to each genus by sequencing and use of a phylogenetic approach. Here, we present a restriction site to differentiate between both parasite genera avoiding the use of those analyses. Alignments of 820 sequences currently listed in GenBank encoding a particular cytochrome B region of avian Plasmodium and Haemoproteus show a shared restriction site for both genera using the endonuclease Hpy CH4III. An additional restriction site is present in Plasmodium sequences that would initially allow differentiation of both genera by differential migration of digested products on gels. Overall 9 out of 326 sequences containing both potential restriction sites do not fit to the general rule. We used this differentiation of parasite genera based on Hpy CH4III restriction sites to evaluate the efficacy of 2 sets of general primers in detecting mixed infections. To do so, we used samples from hosts infected by parasites of both genera. The use of general primers was only able to detect 25% or less of the mixed infections. Therefore, parasite DNA amplification using general primers to determine the species composition of haemosporidian infections in individual hosts is not recommended. Specific primers for each species and study area should be designed until a new method can efficiently discriminate both parasites.

  3. Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

    Science.gov (United States)

    Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

    2017-08-16

    Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and

  4. A Primer on Concepts and Applications of Proteomics in Neuroscience.

    Science.gov (United States)

    Hosp, Fabian; Mann, Matthias

    2017-11-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS)-based proteomics, focusing on the analysis of whole proteomes, protein-based interactions, and post-translational modifications. We also discuss how advanced workflows help to unravel spatial, regulatory, and temporal aspects of neuronal systems. These tools and approaches have already led to detailed and quantitative proteomic maps of the brain and its signaling architecture, generating new insights into health and disease. We predict that these new approaches will also accelerate biomarker discovery and contribute to novel therapeutics for neurodegenerative and other brain-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  6. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  7. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, L.S.; Garcia, G. [UASLP, San Luis Potosi (Mexico). Inst. of Metallurgy]|[UNLP, La Plata (Argentina); Lopez, C. [Univ. Autonoma de Campeche (Mexico)

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  8. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  9. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  10. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  11. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  12. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  13. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic].

    Science.gov (United States)

    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata

    2014-01-01

    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  14. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  15. Multicriteria identification sets method

    Science.gov (United States)

    Kamenev, G. K.

    2016-11-01

    A multicriteria identification and prediction method for mathematical models of simulation type in the case of several identification criteria (error functions) is proposed. The necessity of the multicriteria formulation arises, for example, when one needs to take into account errors of completely different origins (not reducible to a single characteristic) or when there is no information on the class of noise in the data to be analyzed. An identification sets method is described based on the approximation and visualization of the multidimensional graph of the identification error function and sets of suboptimal parameters. This method allows for additional advantages of the multicriteria approach, namely, the construction and visual analysis of the frontier and the effective identification set (frontier and the Pareto set for identification criteria), various representations of the sets of Pareto effective and subeffective parameter combinations, and the corresponding predictive trajectory tubes. The approximation is based on the deep holes method, which yields metric ɛ-coverings with nearly optimal properties, and on multiphase approximation methods for the Edgeworth-Pareto hull. The visualization relies on the approach of interactive decision maps. With the use of the multicriteria method, multiple-choice solutions of identification and prediction problems can be produced and justified by analyzing the stability of the optimal solution not only with respect to the parameters (robustness with respect to data) but also with respect to the chosen set of identification criteria (robustness with respect to the given collection of functionals).

  16. State-set branching

    DEFF Research Database (Denmark)

    Jensen, Rune Møller; Veloso, Manuela M.; Bryant, Randal E.

    2008-01-01

    In this article, we present a framework called state-set branching that combines symbolic search based on reduced ordered Binary Decision Diagrams (BDDs) with best-first search, such as A* and greedy best-first search. The framework relies on an extension of these algorithms from expanding a single...... state in each iteration to expanding a set of states. We prove that it is generally sound and optimal for two A* implementations and show how a new BDD technique called branching partitioning can be used to efficiently expand sets of states. The framework is general. It applies to any heuristic function...... framework. The algorithms outperform the ordinary A* algorithm in almost all domains. In addition, they can improve the complexity of A* exponentially and often dominate both A* and blind BDD-based search by several orders of magnitude. Moreover, they have substantially better performance than BDDA...

  17. Addition of Na2CO3 Improves the Shelf Life of Experimental 4-META Self-etch Primer.

    Science.gov (United States)

    Matsumoto, Hiro; Yamamoto, Takatsugu; Hanabusa, Masao; Momoi, Yasuko; Hayakawa, Tohru

    2017-01-01

    The objective of this study was to assess the influence of the addition of Na2CO3 on the shelf life and bond strength of 4-META self-etch primer. Two 4-META self-etch primers were experimentally formulated with and without the addition of Na2CO3 (primer A and primer B, respectively). The primers were stored at 37°C for several periods of time after formulation. Clearfil SE Bond Primer (Kuraray Noritake Dental) was used as a control. A composite was bonded to bovine dentin using a combination of the primer and a bonding agent (Clearfil SE Bond), and the shear bond strengths were measured. Changes in the pH of the experimental primers were monitored and macroscopic observations were made as a function of the storage periods. With 0-day storage, the bond strength of primer A was equivalent to that of primer B and significantly lower than that of Clearfil SE Primer. The bond strengths of primer A were stable during 90-day storage; by contrast, the bond strengths of primer B significantly decreased during 7-day storage. primer A exhibited stable pH values during 180-day storage; primer B exhibited significantly lower pH than primer A with 0-day storage and discolored gelation during 7-day storage. By adding Na2CO3, the shelf life of the 4-META self-etch primer was obviously improved without significant deterioration in dentin bond strength. Adjusting the pH to around 4.5 was effective for obtaining sufficient bond strength and hydrolytic stability of the primer.

  18. Direct Visualization of RNA-DNA Primer Removal from Okazaki Fragments Provides Support for Flap Cleavage and Exonucleolytic Pathways in Eukaryotic Cells.

    Science.gov (United States)

    Liu, Bochao; Hu, Jiazhi; Wang, Jingna; Kong, Daochun

    2017-03-24

    During DNA replication in eukaryotic cells, short single-stranded DNA segments known as Okazaki fragments are first synthesized on the lagging strand. The Okazaki fragments originate from ∼35-nucleotide-long RNA-DNA primers. After Okazaki fragment synthesis, these primers must be removed to allow fragment joining into a continuous lagging strand. To date, the models of enzymatic machinery that removes the RNA-DNA primers have come almost exclusively from biochemical reconstitution studies and some genetic interaction assays, and there is little direct evidence to confirm these models. One obstacle to elucidating Okazaki fragment processing has been the lack of methods that can directly examine primer removal in vivo In this study, we developed an electron microscopy assay that can visualize nucleotide flap structures on DNA replication forks in fission yeast ( Schizosaccharomyces pombe ). With this assay, we first demonstrated the generation of flap structures during Okazaki fragment processing in vivo The mean and median lengths of the flaps in wild-type cells were ∼51 and ∼41 nucleotides, respectively. We also used yeast mutants to investigate the impact of deleting key DNA replication nucleases on these flap structures. Our results provided direct in vivo evidence for a previously proposed flap cleavage pathway and the critical function of Dna2 and Fen1 in cleaving these flaps. In addition, we found evidence for another previously proposed exonucleolytic pathway involving RNA-DNA primer digestion by exonucleases RNase H2 and Exo1. Taken together, our observations suggest a dual mechanism for Okazaki fragment maturation in lagging strand synthesis and establish a new strategy for interrogation of this fascinating process. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Science.gov (United States)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  20. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  1. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  2. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  3. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  4. Supplementary table 6. Primers used in real-time PCR for relative ...

    Indian Academy of Sciences (India)

    pushpa

    Supplementary table 6. Primers used in real-time PCR for relative expression analysis of osa-miR399i and osa-miR530 and their predicted target genes. Gene Locus. Primer sequence. TTGTTGGACATGCTCGTGACA. LOC_Os05g48390. TGGTGACAAGCTTCGGCAA. CGTGTGGAGGATTGTATGCATG. LOC_Os01g54480.

  5. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... were used, for the screening of the transformed plants (Pietsch et al., 1997). To verify the amplification of extracted DNAs, a pair of primers CDC(a).F/CDC(a).R targeting the cell division control gene was used (Gimenez et al., 2011). The primers were synthetized using Polyplex machine (Gene machine, ...

  6. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang

    2012-03-01

    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  7. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    Science.gov (United States)

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  8. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... RNA, no direct evidence of interactions with the U-rich anticodon loop of tRNALys3 has been described to date. Here we address the question of the potential role of the interactions between these highly structured regions in the initiation of viral DNA synthesis. To evaluate this we used an antisense...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...

  9. Plant organellar DNA primase-helicase synthesizes RNA primers for organellar DNA polymerases using a unique recognition sequence.

    Science.gov (United States)

    Peralta-Castro, Antolín; Baruch-Torres, Noe; Brieba, Luis G

    2017-10-13

    DNA primases recognize single-stranded DNA (ssDNA) sequences to synthesize RNA primers during lagging-strand replication. Arabidopsis thaliana encodes an ortholog of the DNA primase-helicase from bacteriophage T7, dubbed AtTwinkle, that localizes in chloroplasts and mitochondria. Herein, we report that AtTwinkle synthesizes RNA primers from a 5'-(G/C)GGA-3' template sequence. Within this sequence, the underlined nucleotides are cryptic, meaning that they are essential for template recognition but are not instructional during RNA synthesis. Thus, in contrast to all primases characterized to date, the sequence recognized by AtTwinkle requires two nucleotides (5'-GA-3') as a cryptic element. The divergent zinc finger binding domain (ZBD) of the primase module of AtTwinkle may be responsible for template sequence recognition. During oligoribonucleotide synthesis, AtTwinkle shows a strong preference for rCTP as its initial ribonucleotide and a moderate preference for rGMP or rCMP incorporation during elongation. RNA products synthetized by AtTwinkle are efficiently used as primers for plant organellar DNA polymerases. In sum, our data strongly suggest that AtTwinkle primes organellar DNA polymerases during lagging strand synthesis in plant mitochondria and chloroplast following a primase-mediated mechanism. This mechanism contrasts to lagging-strand DNA replication in metazoan mitochondria, in which transcripts synthesized by mitochondrial RNA polymerase prime mitochondrial DNA polymerase γ. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    Science.gov (United States)

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  11. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  12. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  13. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  14. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  15. Development of a candidate method for forensic microbial genotyping using multiplex pyrosequencing combined with a universal biotinylated primer.

    Science.gov (United States)

    Gu, Yan; Mao, Xuhu; Zha, Lagabaiyila; Hou, Yiping; Yun, Libing

    2015-01-01

    Bacterial genotyping can be used for crime scene investigations and contribute to the attribution of biological attacks for microbial forensics. PyroMark ID Pyrosequencer as an accurate detection platform for single nucleotide polymorphisms (SNPs) has been applied to identify and resolve microorganisms involved in closely Escherichia coli O157:H7 (E. coli O157:H7). To explore more applications and improve the efficiency for pyrosequencing in this field, we developed a method integrated multiplex pyrosequencing with a universal primer. Two multiplex pyrosequencing assays with a universal biotinylated primer were designed to analyze five SNPs located in four gene of E. coli O157:H7 strain. The accuracy of the established assays was validated by genotyping reference strain E. coli O157:H7 EDL933 and E. coli K-12. We also demonstrated that two multiplex pyrosequencing assays were specific and sensitive for genotyping closely related E. coli O157 strains. Reproducibility of results and multiplexing capability were evaluated by a comparison of this method with the monoplex pyrosequencing. Furthermore, these two multiplex pyrosequencing assays have been successfully applied to detect 11 E. coli O157 strains isolated from 1504 Chinese livestock samples. This method reduces costs and time consumption in the process of pyrosequencing analysis, and potentially serves as a rapid tool and reliable candidate strategy for the microbial identification and other genotyping application. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  17. Elektronsko izobraževanje v praksi. Primer programa LOLA

    Directory of Open Access Journals (Sweden)

    Lea Bregar

    2003-12-01

    Full Text Available Slovenija je bila vkljucena v program Phare za studij na da!javo v obdobju od I995 do konca I999 kot ena izmed 11 srednje- in vzhodnoevropskih drzav. Eden od najpomembnejsih cil jev programa Phare je bit razviti človeške vire na podrocju studija na dal javo in odprtega ucenja. v okviru podprojekta Phare Train the Trainers so na Harriot Watt University iz Velike Britanije razvili izobrazevalni program LOLA (ucenje o odprtem ucenju. Leta I999 je bilo organizirano usposab!janje za 400 udeležencev iz 11 drzav Phare. Program LOLAje bit uspdna novost v evropskem izobrazevalnem prostoru ne le zaradi svojih vsebin, temvee tudi zaradi inovativne didaktike, sa} je bit celoten program oblikovan in izvajan kot 'on-line' program. V Clanku je na kratko predstavljen izobrazevalni program LOLA in izkusnje z njegovim izvajanjem kot primer e-izobrazevanja v praksi. Clanek avtorici zakljucujeta s predstavitvijo svojih pogledov na nadaljnje izvajanje programa LOLA in razvoj e-izobrazevanja v Sloveniji ter poudarjata potrebo po kakovostno doloceni in jasni strategiji na podrocju studija na daljavo, odprtega ucenja in e-izobrazevanja v Sloveniji.

  18. Review of Attachment, play, and authenticity: A Winnicott primer.

    Science.gov (United States)

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  19. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  20. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.