WorldWideScience

Sample records for single primer set

  1. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  2. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  3. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  4. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  5. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  6. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  7. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  8. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  9. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  10. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  11. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  12. A primer on standards setting as it applies to surgical education and credentialing.

    Science.gov (United States)

    Cendan, Juan; Wier, Daryl; Behrns, Kevin

    2013-07-01

    Surgical technological advances in the past three decades have led to dramatic reductions in the morbidity associated with abdominal procedures and permanently altered the surgical practice landscape. Significant changes continue apace including surgical robotics, natural orifice-based surgery, and single-incision approaches. These disruptive technologies have on occasion been injurious to patients, and high-stakes assessment before adoption of new technologies would be reasonable. We reviewed the drivers for well-established psychometric techniques available for the standards-setting process. We present a series of examples that are relevant in the surgical domain including standards setting for knowledge and skills assessments. Defensible standards for knowledge and procedural skills will likely become part of surgical clinical practice. Understanding the methodology for determining standards should position the surgical community to assist in the process and lead within their clinical settings as standards are considered that may affect patient safety and physician credentialing.

  13. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  14. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    Science.gov (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  15. Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

    Directory of Open Access Journals (Sweden)

    Sylvia Schäffer

    Full Text Available DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher material is often very difficult to (nearly impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

  16. Amalgam shear bond strength to dentin using single-bottle primer/adhesive systems.

    Science.gov (United States)

    Cobb, D S; Denehy, G E; Vargas, M A

    1999-10-01

    To evaluate the in vitro shear bond strengths (SBS) of a spherical amalgam alloy (Tytin) to dentin using several single-bottle primer/adhesive systems both alone: Single Bond (SB), OptiBond Solo (Sol), Prime & Bond 2.1 (PB), One-Step (OS) and in combination with the manufacturer's supplemental amalgam bonding agent: Single Bond w/3M RelyX ARC (SBX) and Prime & Bond 2.1 w/Amalgam Bonding Accessory Kit (PBA). Two, three-component adhesive systems, Scotchbond Multi-Purpose (SBMP) and Scotchbond Multi-Purpose Plus w/light curing (S + V) and w/o light curing (S+) were used for comparison. One hundred eight extracted human third molars were mounted lengthwise in phenolic rings with acrylic resin. The proximal surfaces were ground to expose a flat dentin surface, then polished to 600 grit silicon carbide paper. The teeth were randomly assigned to 9 groups (n = 12), and dentin surfaces in each group were treated with an adhesive system according to the manufacturer's instructions, except for S + V specimens, where the adhesive was light cured for 10 s before placing the amalgam. Specimens were then secured in a split Teflon mold, having a 3 mm diameter opening and amalgam was triturated and condensed onto the treated dentin surfaces. Twenty minutes after condensation, the split mold was separated. Specimens were placed in distilled water for 24 hrs, then thermocycled (300 cycles, between 5 degrees C and 55 degrees C, with 12 s dwell time). All specimens were stored in 37 degrees C distilled water for 7 days, prior to shear strength testing using a Zwick Universal Testing Machine at a cross-head speed of 0.5 mm/min. The highest to the lowest mean dentin shear bond strength values (MPa) for the adhesive systems tested were: S + V (10.3 +/- 2.3), SBX (10.2 +/- 3.5), PBA, (6.4 +/- 3.6), SOL (5.8 +/- 2.5), SBMP (5.7 +/- 1.8), S+ (4.8 +/- 2.3), PB (2.7 +/- 2.6), SB (2.7 +/- 1.1) and OS (2.5 +/- 1.8). One-way ANOVA and Duncan's Multiple Range Test indicated significant

  17. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  18. Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.

    Science.gov (United States)

    Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe

    2018-04-19

    To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.

  19. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  20. Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

    Science.gov (United States)

    Henry, Kevin A

    2018-01-01

    Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

  1. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  2. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  3. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  4. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  5. Promoting Barrier Performance and Cathodic Protection of Zinc-Rich Epoxy Primer via Single-Layer Graphene

    Directory of Open Access Journals (Sweden)

    Jingrong Liu

    2018-05-01

    Full Text Available The effect of single-layer graphene sheets (Gr on the corrosion protection of zinc-rich epoxy primers (ZRPs was investigated. Scanning electron microscopy (SEM with an energy dispersive spectrometer (EDS were used to characterize morphology and composition of the coatings after immersion for 25 days. The cross-sectional SEM images and X-ray photoelectron spectroscopy (XPS confirmed that the addition of single-layer graphene facilitated assembling of zinc oxides on the interface between the coating and the steel. The open circuit potential (OCP, electrochemical impedance spectroscopy (EIS measurements revealed that both the cathodic protection and barrier performance of the ZRP were enhanced after addition of 0.6 wt. % Gr (Gr0.6-ZRP. In addition, the cathodic protection property of the Gr0.6-ZRP was characterized quantitatively by localized electrochemical impedance spectroscopy (LEIS in the presence of an artificial scratch on the coating. The results demonstrate that moderate amounts of single-layer graphene can significantly improve corrosion resistance of ZRP, due to the barrier protection and cathodic protection effects.

  6. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  7. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...

  8. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  9. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  10. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    Science.gov (United States)

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  11. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  12. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  13. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, Petr; Sudová, Radka; Janoušková, Martina; Čtvrtlíková, Martina; Hejda, Martin; Pánková, Hana; Slavíková, Renata; Štajerová, Kateřina; Vosátka, Miroslav; Sýkorová, Zuzana

    2014-01-01

    Roč. 68, Jan 2014 (2014), s. 482-493 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/0781; GA ČR GAP504/10/1486; GA ČR(CZ) GAP505/11/1112 Institutional support: RVO:67985939 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  14. Easy assessment of diversity in Jatropha curcas L. plants using two single-primer amplification reaction (SPAR) methods

    Energy Technology Data Exchange (ETDEWEB)

    Ranade, Shirish A; Srivastava, Anuj P; Srivastava, Jyoti; Tuli, Rakesh [PMB Division, National Botanical Research Institute, Rana Pratap Marg, Lucknow 226 001, U.P. (India); Rana, Tikam S [Plant Biodiversity and Conservation Biology Division, National Botanical Research Institute, Rana Pratap Marg, Lucknow 226 001, U.P. (India)

    2008-06-15

    Jatropha curcas L. (physic nut) has drawn attention in recent years as a source of seed oil that can provide an economically viable substitute for diesel. Very little work on provenance trials and genetic resources of J. curcas L. has been reported so far. Though J. curcas grows widely in India and several collections of the plant are also maintained, pedigree and provenance records are not always available. This article reports our studies on the diversity amongst the accessions of J. curcas L., both amongst already held collections as well as from a few locations in the wild. Two single-primer amplification reaction (SPAR) methods were used for this purpose. The accessions from the North East were most distant from all other accessions in UPGMA analysis. The NBRI, Bhubaneshwar and Lalkuan accessions were more related to each other. The UPGMA tree clearly shows well-separated accession groups: NBRI, Bhubaneshwar, North East, Lalkuan and Outgroup. The study suggests that this relatively recently introduced plant species shows adequate genetic diversity in India and that the SPAR methods are useful for a rapid assessment of the same. The methods provide important tools for analyzing the diversity within the available collections to shortlist the parental lines for adaptability trials and further improvement of Jatropha plants. (author)

  15. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  16. The Single Needle Lockstitch Machine. [Setting Zippers.] Module 8.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on setting zippers, one in a series on the single needle lockstitch sewing machine for student self-study, contains five sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's final checklist.…

  17. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  18. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  19. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    Science.gov (United States)

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  20. 34 CFR 403.82 - In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women Program...

    Science.gov (United States)

    2010-07-01

    ... Homemakers, and Single Pregnant Women Program be offered? 403.82 Section 403.82 Education Regulations of the... Secretary Assist Under the Basic Programs? Single Parents, Displaced Homemakers, and Single Pregnant Women Program § 403.82 In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women...

  1. The reproducibility of single photon absorptiometry in a clinical setting

    International Nuclear Information System (INIS)

    Valkema, R.; Blokland, J.A.K.; Pauwels, E.K.J.; Papapoulos, S.E.; Bijvoet, O.L.M.

    1989-01-01

    The reproducibility of single photon absorptiometry (SPA) results for detection of changes in bone mineral content (BMC) was evaluated in a clinical setting. During a period of 18 months with 4 different sources, the calibration scans of an aluminium standard had a variation of less than 1% unless the activity of the 125 I source was low. The calibration procedure was performed weekly and this was sufficient to correct for drift of the system. The short term reproducibility in patients was assessed with 119 duplicate measurements made in direct succession. The best reproducibility (CV=1.35%) was found for fat corrected BMC results expressed in g/cm, obtained at the site proximal to the 8 mm space between the radius and ulna. Analysis of all SPA scans made during 1 year (487 scans) showed a failure of the automatic procedure to detect the space of 8 mm between the forearm bones in 19 scans (3.9%). A space adjacent to the ulnar styloid was taken as the site for the first scan in these examinations. This problem may be recognized and corrected relatively easy. A significant correlation was found between BMC at the lower arm and BMC of the lumbar spine assessed with dual photon absorptiometry. However, the error of estimation of proximal BMC (SEE=20%) and distal BMC (SEE=19.4%) made these measurements of little value to predict BMC at the lumbar spine in individuals. The short term reproducibility in patients combined with long term stability of the equipment in our clinical setting showed that SPA is a reliable technique to assess changes in bone mass at the lower arm of 4% between 2 measurements with a confidence level of 95%. (orig.)

  2. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  3. Single-Sex Education in Public School Settings

    Science.gov (United States)

    Crawford-Ferre, Heather Glynn; Wiest, Lynda R.

    2013-01-01

    Although researchers have studied the effectiveness of single-sex education (SSE), the findings have been mixed. This exploratory study reports the perceived goals and effectiveness of single-sex education based on interviews with a small group of educators involved with SSE in various ways. Research participants included a school principal and…

  4. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  5. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  6. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  7. The Single Needle Lockstitch Machine. [Setting a Collar.] Module 5.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on sewing collars, one in a series on the single needle lockstitch sewing machine for student self-study, contains three sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's final checklist.…

  8. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    Directory of Open Access Journals (Sweden)

    Dong Chen

    Full Text Available Genotyping of thiopurine S-methyltransferase (TPMT is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR, termed competitive real-time fluorescent AS-PCR (CRAS-PCR was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques.

  9. Single-event transients (SET) in analog circuits

    International Nuclear Information System (INIS)

    Chen Panxun; Zhou Kaiming

    2006-01-01

    A new phenomenon of single- event upset is introduced. The transient signal is produced in the output of analog circuits after a heavy ion strikes. The transient upset can influence the circuit connected with the output of analog circuits. For example, the output of operational amplifier can be connected with the input of a digital counter, and the pulse of sufficiently high transient output induced by an ion can increase counts of the counter. On the other hand, the transient voltage signal at the output of analog circuits can change the stage of other circuits. (authors)

  10. Costs Associated With Single-Use and Conventional Sets for Distal Radius Plating.

    Science.gov (United States)

    Fugarino, Bryce; Fox, Mary Patricia; Terhoeve, Cristina; Pappas, Nicholas

    2017-11-01

    Volar plating of distal radius fractures is an increasingly common procedure. Presterilized, single-use volar plate fixation sets have been purported to increase operating room efficiency and decrease cost. The purpose of this study was to compare the actual cost of using a conventional set compared with the projected cost of using its single-use counterpart. We retrospectively analyzed 30 consecutive cases of volar plate fixation in which conventional instrument sets were used. Hardware and processing costs were calculated for the conventional sets and compared with the projected cost of using single-use sets. The mean total cost of hardware and processing for the conventional sets was $2,728, whereas the projected cost for the single-use sets was slightly higher at $2,868. Twenty-three of the 30 cases would have required additional screws not available in the single-use set. The cost of the additional screws needed to supplement the single-use set would have added an average of $282/case. Overall, the combined hardware and processing cost was lower for conventional sets in 25 of the 30 cases. Although the price of the single-use set is less than the mean charge for use of a conventional set, additional screws not available in the single-use set were required in 77% of cases and consequently rendered the conventional set cheaper in 83% of cases. Stocking the single-use sets with additional screws to reflect the most commonly used screw lengths could make these sets more cost effective in the future. Economic and decision analysis IV. Copyright © 2017 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  11. High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

    Directory of Open Access Journals (Sweden)

    Weiguo Hou

    2018-05-01

    Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

  12. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  14. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  15. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  16. Does the "Negro" "Still" Need Separate Schools? Single-Sex Educational Settings as Critical Race Counterspaces

    Science.gov (United States)

    Terry, Clarence L., Sr.; Flennaugh, Terry K.; Blackmon, Samarah M.; Howard, Tyrone C.

    2014-01-01

    This article explores whether contemporary educators should consider single-sex educational settings as viable interventions in educating African American males. Using qualitative data from a 2-year study of single-sex educational spaces in two Los Angeles County high schools, the authors argue that when all-male spaces effectively function as…

  17. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  18. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  19. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  20. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  1. Complementary Self-Biased Logics Based on Single-Electron Transistor (SET)/CMOS Hybrid Process

    Science.gov (United States)

    Song, Ki-Whan; Lee, Yong Kyu; Sim, Jae Sung; Kim, Kyung Rok; Lee, Jong Duk; Park, Byung-Gook; You, Young Sub; Park, Joo-On; Jin, You Seung; Kim, Young-Wug

    2005-04-01

    We propose a complementary self-biasing method which enables the single-electron transistor (SET)/complementary metal-oxide semiconductor (CMOS) hybrid multi-valued logics (MVLs) to operate well at high temperatures, where the peak-to-valley current ratio (PVCR) of the Coulomb oscillation markedly decreases. The new architecture is implemented with a few transistors by utilizing the phase control capability of the sidewall depletion gates in dual-gate single-electron transistors (DGSETs). The suggested scheme is evaluated by a SPICE simulation with an analytical DGSET model. Furthermore, we have developed a new process technology for the SET/CMOS hybrid systems. We have confirmed that both of the fabricated devices, namely, SET and CMOS transistors, exhibit the ideal characteristics for the complementary self-biasing scheme: the SET shows clear Coulomb oscillations with a 100 mV period and the CMOS transistors show a high voltage gain.

  2. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  3. Female Students' Experiences of Computer Technology in Single- versus Mixed-Gender School Settings

    Science.gov (United States)

    Burke, Lee-Ann; Murphy, Elizabeth

    2006-01-01

    This study explores how female students compare learning computer technology in a single- versus a mixed- gender school setting. Twelve females participated, all of whom were enrolled in a grade 12 course in Communications' Technology. Data collection included a questionnaire, a semi-structured interview and focus groups. Participants described…

  4. The Single Needle Lockstitch Machine. [Constructing and Setting Sleeves.] Module 7.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on constructing and setting sleeves, one in a series on the single needle lockstitch sewing machine for student self-study, contains two sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's…

  5. The Single Needle Lockstitch Machine. [Constructing and Setting Pockets.] Module 9.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on constructing and setting pockets, one in a series on the single needle lockstitch sewing machine for student self-study, contains three sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an…

  6. The Single Needle Lockstitch Machine. [Making and Setting Cuffs.] Module 6.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on making and setting cuffs, one in a series on the single needle lockstitch sewing machine for student self-study, contains three sections. Each section includes the following parts: an introduction, directions, an objective, learning activities, student information, student self-check, check-out activities, and an instructor's final…

  7. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  8. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  9. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  10. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  11. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  12. Analysis of photogenerated random telegraph signal in single electron detector (photo-SET).

    Science.gov (United States)

    Troudi, M; Sghaier, Na; Kalboussi, A; Souifi, A

    2010-01-04

    In this paper, we analyzed slow single traps, situated inside the tunnel oxide of small area single electron photo-detector (photo-SET or nanopixel). The relationship between excitation signal (photons) and random-telegraph-signal (RTS) was evidenced. We demonstrated that photoinduced RTS observed on a photo-detector is due to the interaction between single photogenerated charges that tunnel from dot to dot and current path. Based on RTS analysis for various temperatures, gate bias and optical power we determined the characteristics of these single photogenerated traps: the energy position within the silicon bandgap, capture cross section and the position within the Si/SiO(x = 1.5) interfaces.

  13. Reducing twin pregnancy rates after IVF--elective single embryo transfer (eSET).

    LENUS (Irish Health Repository)

    Milne, P

    2010-01-01

    Multiple pregnancy is a major complication of IVF and is associated with increased maternal, fetal and neonatal morbidity. Elective single embryo transfer (eSET) during IVF, rather than the more standard transfer of two embryos (double embryo transfer or DET), has been shown to significantly reduce the multiple pregnancy rate associated with IVF, while maintaining acceptable pregnancy rates. Couples undergoing IVF in 2008 who met good prognostic criteria had eSET performed. Pregnancy and twinning rates were compared with those for similar couples in 2007 who had DET. Couples unsuccessful with a fresh cycle of treatment had subsequent frozen embryo transfer cycles with DET. The cumulative pregnancy rate was similar for each group. However there were no multiple pregnancies in the eSET group, compared to 4 twins of 5 pregnancies in the DET group. 96% of eligible couples agreed to eSET. ESET is successful in and acceptable to good prognosis Irish couples undergoing IVF.

  14. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  15. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  16. Generating and executing programs for a floating point single instruction multiple data instruction set architecture

    Science.gov (United States)

    Gschwind, Michael K

    2013-04-16

    Mechanisms for generating and executing programs for a floating point (FP) only single instruction multiple data (SIMD) instruction set architecture (ISA) are provided. A computer program product comprising a computer recordable medium having a computer readable program recorded thereon is provided. The computer readable program, when executed on a computing device, causes the computing device to receive one or more instructions and execute the one or more instructions using logic in an execution unit of the computing device. The logic implements a floating point (FP) only single instruction multiple data (SIMD) instruction set architecture (ISA), based on data stored in a vector register file of the computing device. The vector register file is configured to store both scalar and floating point values as vectors having a plurality of vector elements.

  17. Successful angioplasty of tripolar renal arteries in a single setting: a case report.

    Science.gov (United States)

    Sharma, Gyarsi Lal; Morice, Marie-Claude; Catineau, Patrick

    2002-08-01

    Renal artery stenosis (RAS) is one of the important causes of correctable hypertension. There are various modes of therapy for RAS, including percutaneous transluminal renal angioplasty (PTRA) and surgery. PTRA has emerged as the treatment of choice in cases of renal artery stenosis. PTRA combined with stenting is associated with good immediate and long-term results. This case report describes successful angioplasty of bilateral multiple renal arteries in a single setting with good immediate and follow-up results.

  18. An extended set-value observer for position estimation using single range measurements

    DEFF Research Database (Denmark)

    Marcal, Jose; Jouffroy, Jerome; Fossen, Thor I.

    the observability of the system is briefly discussed and an extended set-valued observer is presented, with some discussion about the effect of the measurements noise on the final solution. This observer estimates bounds in the errors assuming that the exogenous signals are bounded, providing a safe region......The ability of estimating the position of an underwater vehicle from single range measurements is important in applications where one transducer marks an important geographical point, when there is a limitation in the size or cost of the vehicle, or when there is a failure in a system...... of transponders. The knowledge of the bearing of the vehicle and the range measurements from a single location can provide a solution which is sensitive to the trajectory that the vehicle is following, since there is no complete constraint on the position estimate with a single beacon. In this paper...

  19. Level-set simulations of buoyancy-driven motion of single and multiple bubbles

    International Nuclear Information System (INIS)

    Balcázar, Néstor; Lehmkuhl, Oriol; Jofre, Lluís; Oliva, Assensi

    2015-01-01

    Highlights: • A conservative level-set method is validated and verified. • An extensive study of buoyancy-driven motion of single bubbles is performed. • The interactions of two spherical and ellipsoidal bubbles is studied. • The interaction of multiple bubbles is simulated in a vertical channel. - Abstract: This paper presents a numerical study of buoyancy-driven motion of single and multiple bubbles by means of the conservative level-set method. First, an extensive study of the hydrodynamics of single bubbles rising in a quiescent liquid is performed, including its shape, terminal velocity, drag coefficients and wake patterns. These results are validated against experimental and numerical data well established in the scientific literature. Then, a further study on the interaction of two spherical and ellipsoidal bubbles is performed for different orientation angles. Finally, the interaction of multiple bubbles is explored in a periodic vertical channel. The results show that the conservative level-set approach can be used for accurate modelling of bubble dynamics. Moreover, it is demonstrated that the present method is numerically stable for a wide range of Morton and Reynolds numbers.

  20. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  1. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  2. A combined single-multiphase flow formulation of the premixing phase using the level set method

    International Nuclear Information System (INIS)

    Leskovar, M.; Marn, J.

    1999-01-01

    The premixing phase of a steam explosion covers the interaction of the melt jet or droplets with the water prior to any steam explosion occurring. To get a better insight of the hydrodynamic processes during the premixing phase beside hot premixing experiments, where the water evaporation is significant, also cold isothermal premixing experiments are performed. The specialty of isothermal premixing experiments is that three phases are involved: the water, the air and the spheres phase, but only the spheres phase mixes with the other two phases whereas the water and air phases do not mix and remain separated by a free surface. Our idea therefore was to treat the isothermal premixing process with a combined single-multiphase flow model. In this combined model the water and air phase are treated as a single phase with discontinuous phase properties at the water air interface, whereas the spheres are treated as usually with a multiphase flow model, where the spheres represent the dispersed phase and the common water-air phase represents the continuous phase. The common water-air phase was described with the front capturing method based on the level set formulation. In the level set formulation, the boundary of two-fluid interfaces is modeled as the zero set of a smooth signed normal distance function defined on the entire physical domain. The boundary is then updated by solving a nonlinear equation of the Hamilton-Jacobi type on the whole domain. With this single-multiphase flow model the Queos isothermal premixing Q08 has been simulated. A numerical analysis using different treatments of the water-air interface (level set, high-resolution and upwind) has been performed for the incompressible and compressible case and the results were compared to experimental measurements.(author)

  3. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  4. Generation of covariance data among values from a single set of experiments

    International Nuclear Information System (INIS)

    Smith, D.L.

    1992-01-01

    Modern nuclear data evaluation methods demand detailed uncertainty information for all input results to be considered. It can be shown from basic statistical principles that provision of a covariance matrix for a set of data provides the necessary information for its proper consideration in the context of other included experimental data and/or a priori representations of the physical parameters in question. This paper examines how an experimenter should go about preparing the covariance matrix for any single experimental data set he intends to report. The process involves detailed examination of the experimental procedures, identification of all error sources (both random and systematic); and consideration of any internal discrepancies. Some specific examples are given to illustrate the methods and principles involved

  5. Evaluation of auto region of interest settings for single photon emission computed tomography findings

    International Nuclear Information System (INIS)

    Mizuno, Takashi; Takahashi, Masaaki; Yoshioka, Katsunori

    2008-01-01

    It has been noted that the manual settings of region of interest (ROI) to the single-photon-emission-computed-tomography (SPECT) slice lacked objectivity when the fixed quantity value of regional cerebral blood flow (rCBF) was measured previously. Therefore, we jointly developed software Brain ROI' with Daiichi Radioisotope Laboratories, Ltd. (Present name: FUJIFILM RI Pharma Co., Ltd.) The software normalized an individual brain to a standard brain template by using Statistical Parametric Mapping 2 (SPM 2) of the easy Z-score Imaging System ver. 3.0 (eZIS Ver. 3.0), and the ROI template was set to a specific slice. In this study, we evaluated the accuracy of this software with an ROI template that we made of useful size and shape, in some clinical samples. The method of automatic setting of ROI was the objective. However, we felt that we should use the shape of the ROI template without the influence of brain atrophy. Moreover, we should see normalization of the individual brain and confirm the accuracy of normalization. When normalization failed, we should partially correct the ROI or set everything by manual operation for the operator. However, it was thought that this software was useful if the tendency was understood because examples of failure were few. (author)

  6. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  7. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  8. Single port laparoscopic colorectal surgery in debilitated patients and in the urgent setting.

    LENUS (Irish Health Repository)

    Moftah, M

    2012-09-01

    Single port laparoscopy is a relatively new niche in the expanding spectrum of minimal access surgery for colorectal disease. To date the published experience has predominantly focused on planned operations for neoplasia in the elective setting. It seems probable however that the benefits of minimal abdominal wounding will be greatest among those patients with the highest risk of impaired wound healing. Combining this with the impression of improved cosmesis suggests that (the mostly young) patients with inflammatory bowel disease needing urgent operation are the most likely to appreciate and benefit from the extraoperative effort. The extension of single port surgery to the acute setting and for debilitated individuals is therefore a likely next step advance in broadening the category of patients for whom it represents a real benefit and ultimately aid in focusing by selection the subgroups for whom this technique is best suited and most appropriate. We describe here our approach (including routine use of a surgical glove port) to patients presenting for urgent colorectal operation for benign disease. As provision of specialized approaches regardless of timing or mode of presentation is a defining component of any specialty service, this concept will soon be more fully elucidated and established.

  9. Single ion hit detection set-up for the Zagreb ion microprobe

    Science.gov (United States)

    Smith, R. W.; Karlušić, M.; Jakšić, M.

    2012-04-01

    Irradiation of materials by heavy ions accelerated in MV tandem accelerators may lead to the production of latent ion tracks in many insulators and semiconductors. If irradiation is performed in a high resolution microprobe facility, ion tracks can be ordered by submicrometer positioning precision. However, full control of the ion track positioning can only be achieved by a reliable ion hit detection system that should provide a trigger signal irrespectively of the type and thickness of the material being irradiated. The most useful process that can be utilised for this purpose is emission of secondary electrons from the sample surface that follows the ion impact. The status report of the set-up presented here is based on the use of a channel electron multiplier (CEM) detector mounted on an interchangable sample holder that is inserted into the chamber in a close geometry along with the sample to be irradiated. The set-up has been tested at the Zagreb ion microprobe for different ions and energies, as well as different geometrical arrangements. For energies of heavy ions below 1 MeV/amu, results show that efficient (100%) control of ion impact can be achieved only for ions heavier than silicon. The successful use of the set-up is demonstrated by production of ordered single ion tracks in a polycarbonate film and by monitoring fluence during ion microbeam patterning of Foturan glass.

  10. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  11. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  12. The Effects of Noncontingent Access to Single-versus Multiple-Stimulus Sets on Self-Injurious Behavior.

    Science.gov (United States)

    DeLeon, Iser G.; Anders, Bonita M.; Rodriguez-Catter, Vanessa; Neidert, Pamela L.

    2000-01-01

    The automatically reinforced self-injury of a girl (age 11) with autism was treated by providing noncontingent access to a single set of preferred toys during 30-minute sessions. Rotating toy sets after 10 minutes or providing access to multiple toy sets resulted in reductions that lasted the entire 30 minutes. (Contains four references.)…

  13. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  14. On assessing surrogacy in a single trial setting using a semi-competing risks paradigm

    Science.gov (United States)

    Ghosh, Debashis

    2009-01-01

    Summary There has been a recent emphasis on the identification of biomarkers and other biologic measures that may be potentially used as surrogate endpoints in clinical trials. We focus on the setting of data from a single clinical trial. In this paper, we consider a framework in which the surrogate must occur before the true endpoint. This suggests viewing the surrogate and true endpoints as semi-competing risks data; this approach is new to the literature on surrogate endpoints and leads to an asymmetrical treatment of the surrogate and true endpoints. However, such a data structure also conceptually complicates many of the previously considered measures of surrogacy in the literature. We propose novel estimation and inferential procedures for the relative effect and adjusted association quantities proposed by Buyse and Molenberghs (1998, Biometrics, 1014 – 1029). The proposed methodology is illustrated with application to simulated data, as well as to data from a leukemia study. PMID:18759839

  15. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    Science.gov (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  16. A computational model for three-dimensional jointed media with a single joint set

    International Nuclear Information System (INIS)

    Koteras, J.R.

    1994-02-01

    This report describes a three-dimensional model for jointed rock or other media with a single set of joints. The joint set consists of evenly spaced joint planes. The normal joint response is nonlinear elastic and is based on a rational polynomial. Joint shear stress is treated as being linear elastic in the shear stress versus slip displacement before attaining a critical stress level governed by a Mohr-Coulomb faction criterion. The three-dimensional model represents an extension of a two-dimensional, multi-joint model that has been in use for several years. Although most of the concepts in the two-dimensional model translate in a straightforward manner to three dimensions, the concept of slip on the joint planes becomes more complex in three dimensions. While slip in two dimensions can be treated as a scalar quantity, it must be treated as a vector in the joint plane in three dimensions. For the three-dimensional model proposed here, the slip direction is assumed to be the direction of maximum principal strain in the joint plane. Five test problems are presented to verify the correctness of the computational implementation of the model

  17. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  18. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  19. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  20. Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

    Science.gov (United States)

    Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

    2015-09-01

    Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  2. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  3. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  4. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  5. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  6. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  7. A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.

    Science.gov (United States)

    Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong

    2015-01-01

    Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

  8. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  9. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  10. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  11. An Interactive Microcomputer Program for Teaching the Impacts of Alternative Policy Sets in the Market for a Single Commodity.

    Science.gov (United States)

    Li, Elton; Stoecker, Arthur

    1995-01-01

    Describes a computer software program where students define alternative policy sets and compare their effects on the welfare of consumers, producers, and the public sector. Policy sets may be a single tax or quota or a mix of taxes, subsidies, and/or price supports implemented in the marketing chain. (MJP)

  12. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  13. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  14. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  15. Single Parents and the Work Setting: The Impact of Multiple Job and Homelife Responsibilities.

    Science.gov (United States)

    Burden, Dianne S.

    1986-01-01

    Examines the impact of combined work/family responsibilities on single-parent employees. Results indicated that parent employees, but particularly single female parents, were at risk for high job-family role strain and reduced levels of well-being. In spite of increased strain, however, single parents exhibited high levels of job satisfaction and…

  16. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  17. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  18. Cognitive behavioral therapy for depression among adults in Japanese clinical settings: a single-group study

    Science.gov (United States)

    2010-01-01

    Background Empirical support for cognitive behavioral therapy (CBT) for treating Japanese patients with major depression is lacking, therefore, a feasibility study of CBT for depression in Japanese clinical settings is urgently required. Findings A culturally adapted, 16-week manualized individual CBT program for Japanese patients with major depressive disorder was developed. A total of 27 patients with major depression were enrolled in a single-group study with the purpose of testing the feasibility of the program. Twenty six patients (96%) completed the study. The mean total score on the Beck Depression Inventory-II (BDI-II) for all patients (Intention-to-treat sample) improved from 32.6 to 11.7, with a mean change of 20.8 (95% confidence interval: 17.0 to 24.8). Within-group effect size at the endpoint assessment was 2.64 (Cohen's d). Twenty-one patients (77.7%) showed treatment response and 17 patients (63.0%) achieved remission at the end of the program. Significant improvement was observed in measurement of subjective and objective depression severity (assessed by BDI-II, Quick Inventory of Depressive Symptomatology-Self Rated, and Hamilton Depression Rating Scale), dysfunctional attitude (assessed by Dysfunctional Attitude Scale), global functioning (assessed by Global Assessment of Functioning of DSM-IV) and subjective well-being (assessed by WHO Subjective Well-being Inventory) (all p values < 0.001). Conclusions Our manualized treatment comprised of a 16-week individual CBT program for major depression appears feasible and may achieve favorable treatment outcomes among Japanese patients with major depression. Further research involving a larger sample in a randomized, controlled trial design is warranted. Trial registration UMIN-CTR UMIN000002542. PMID:20529252

  19. Cognitive behavioral therapy for depression among adults in Japanese clinical settings: a single-group study

    Directory of Open Access Journals (Sweden)

    Kikuchi Toshiaki

    2010-06-01

    Full Text Available Abstract Background Empirical support for cognitive behavioral therapy (CBT for treating Japanese patients with major depression is lacking, therefore, a feasibility study of CBT for depression in Japanese clinical settings is urgently required. Findings A culturally adapted, 16-week manualized individual CBT program for Japanese patients with major depressive disorder was developed. A total of 27 patients with major depression were enrolled in a single-group study with the purpose of testing the feasibility of the program. Twenty six patients (96% completed the study. The mean total score on the Beck Depression Inventory-II (BDI-II for all patients (Intention-to-treat sample improved from 32.6 to 11.7, with a mean change of 20.8 (95% confidence interval: 17.0 to 24.8. Within-group effect size at the endpoint assessment was 2.64 (Cohen's d. Twenty-one patients (77.7% showed treatment response and 17 patients (63.0% achieved remission at the end of the program. Significant improvement was observed in measurement of subjective and objective depression severity (assessed by BDI-II, Quick Inventory of Depressive Symptomatology-Self Rated, and Hamilton Depression Rating Scale, dysfunctional attitude (assessed by Dysfunctional Attitude Scale, global functioning (assessed by Global Assessment of Functioning of DSM-IV and subjective well-being (assessed by WHO Subjective Well-being Inventory (all p values Conclusions Our manualized treatment comprised of a 16-week individual CBT program for major depression appears feasible and may achieve favorable treatment outcomes among Japanese patients with major depression. Further research involving a larger sample in a randomized, controlled trial design is warranted. Trial registration UMIN-CTR UMIN000002542.

  20. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  1. AN ANALYSIS OF TEN YEARS OF THE FOUR GRAND SLAM MEN'S SINGLES DATA FOR LACK OF INDEPENDENCE OF SET OUTCOMES

    Directory of Open Access Journals (Sweden)

    Denny Meyer

    2006-12-01

    Full Text Available The objective of this paper is to use data from the highest level in men's tennis to assess whether there is any evidence to reject the hypothesis that the two players in a match have a constant probability of winning each set in the match. The data consists of all 4883 matches of grand slam men's singles over a 10 year period from 1995 to 2004. Each match is categorised by its sequence of win (W or loss (L (in set 1, set 2, set 3,... to the eventual winner. Thus, there are several categories of matches from WWW to LLWWW. The methodology involves fitting several probabilistic models to the frequencies of the above ten categories. One four-set category is observed to occur significantly more often than the other two. Correspondingly, a couple of the five-set categories occur more frequently than the others. This pattern is consistent when the data is split into two five-year subsets. The data provides significant statistical evidence that the probability of winning a set within a match varies from set to set. The data supports the conclusion that, at the highest level of men's singles tennis, the better player (not necessarily the winner lifts his play in certain situations at least some of the time

  2. Single-site community consultation for emergency research in a community hospital setting.

    Science.gov (United States)

    Galbraith, Kyle L; Keck, Anna-Sigrid; Little, Charletta

    2014-01-01

    The purpose of this study was to evaluate community member feedback from community consultation and public disclosure activities performed for a clinical investigation involving a device designed to treat traumatic brain injury in prehospital contexts. The clinical investigation of that device was to be performed under the federal regulations providing an exception from prospective informed consent requirements in emergency settings. Secondarily, we sought to assess the community consultation process by measuring the levels of outreach provided by the different communication methods used in these activities, with special attention to the effectiveness of social media for community outreach. The medical device investigation consists of a single-site pilot study based at a 345-bed community hospital in east central Illinois, which also serves as the area's only level I trauma center. Investigators, in collaboration with the local institutional review board, fulfilled community consultation and public disclosure requirements through four public town hall meetings, seven targeted focus groups, targeted mailings to 884 community leaders and researchers, a press conference and press release, internal and external websites, and multiple postings to the hospital's Facebook and Twitter accounts. Community members provided feedback by completing paper or electronic comment cards. A total of 428 community members attended the four town hall meetings and seven focus group sessions. Attendance at each meeting ranged from 4 to 20 attendees for the town hall meetings and 8 to 140 attendees for the focus groups. The investigation's external website received 626 unique visitors and the intranet website received 528 unique visits. Social media postings on Facebook and Twitter received six comments and eight "likes" to indicate that an individual read the posting. In total, attendees completed 175 comment cards to provide their feedback. Community member attitudes regarding the

  3. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  4. Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

    Science.gov (United States)

    Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

    2017-12-01

    We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

  5. Gene Set Analyses of Genome-Wide Association Studies on 49 Quantitative Traits Measured in a Single Genetic Epidemiology Dataset

    Directory of Open Access Journals (Sweden)

    Jihye Kim

    2013-09-01

    Full Text Available Gene set analysis is a powerful tool for interpreting a genome-wide association study result and is gaining popularity these days. Comparison of the gene sets obtained for a variety of traits measured from a single genetic epidemiology dataset may give insights into the biological mechanisms underlying these traits. Based on the previously published single nucleotide polymorphism (SNP genotype data on 8,842 individuals enrolled in the Korea Association Resource project, we performed a series of systematic genome-wide association analyses for 49 quantitative traits of basic epidemiological, anthropometric, or blood chemistry parameters. Each analysis result was subjected to subsequent gene set analyses based on Gene Ontology (GO terms using gene set analysis software, GSA-SNP, identifying a set of GO terms significantly associated to each trait (pcorr < 0.05. Pairwise comparison of the traits in terms of the semantic similarity in their GO sets revealed surprising cases where phenotypically uncorrelated traits showed high similarity in terms of biological pathways. For example, the pH level was related to 7 other traits that showed low phenotypic correlations with it. A literature survey implies that these traits may be regulated partly by common pathways that involve neuronal or nerve systems.

  6. Inclusive Classrooms for LGBTQ Students: Using Linked Text Sets to Challenge the Hegemonic "Single Story"

    Science.gov (United States)

    Dodge, Autumn M.; Crutcher, Paul A.

    2015-01-01

    As teachers, it is important that we grapple with the reality that schools, teachers, and the larger social institutions that impact us are never neutral. Scholars explain that the starting place for teachers who want to enact practices for social justice and to disrupt harmful "single stories" is to read LGBTQ titles and consider how…

  7. Job Satisfaction of Married, Divorced, and Single Working Women in a Medical Setting.

    Science.gov (United States)

    Lottinville, Elinor; Scherman, Avraham

    1988-01-01

    Examined whether early divorce would affect job satisfaction of professional or clerical/technical women (N=88) working in hospitals and explored differences among married, divorced, and single working women in their perceptions of different areas of their work. Results revealed significant positive relationship between job level and job…

  8. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  9. Perturbation expansion theory corrected from basis set superposition error. I. Locally projected excited orbitals and single excitations.

    Science.gov (United States)

    Nagata, Takeshi; Iwata, Suehiro

    2004-02-22

    The locally projected self-consistent field molecular orbital method for molecular interaction (LP SCF MI) is reformulated for multifragment systems. For the perturbation expansion, two types of the local excited orbitals are defined; one is fully local in the basis set on a fragment, and the other has to be partially delocalized to the basis sets on the other fragments. The perturbation expansion calculations only within single excitations (LP SE MP2) are tested for water dimer, hydrogen fluoride dimer, and colinear symmetric ArM+ Ar (M = Na and K). The calculated binding energies of LP SE MP2 are all close to the corresponding counterpoise corrected SCF binding energy. By adding the single excitations, the deficiency in LP SCF MI is thus removed. The results suggest that the exclusion of the charge-transfer effects in LP SCF MI might indeed be the cause of the underestimation for the binding energy. (c) 2004 American Institute of Physics.

  10. A Comparison Study of Single-Parent Families Living on Remote, Rural Islands and in Urban Settings in Japan.

    Science.gov (United States)

    Hiratani, Yuko; Hohashi, Naohiro

    2016-06-01

    Nursing interventions that aim to enhance the family environment are necessary to help single-parent families with children to improve family functioning. The cultural and social factors that are unique to Japan's remote islands should be considered to assess the influence of this unique setting on family functioning. The objectives of this study were to evaluate the family functioning of child-rearing single-parent families living in different environments and to investigate the association between family demographics and family functioning. A self-administered questionnaire, the Japanese version of the Survey of Family Environment, was used to evaluate the sufficiency of family functioning. The participants were families with children enrolled in nurseries and kindergartens who were either living in remote, rural islands or in an urban city on the mainland in Japan. Family functioning was significantly higher for single-parent families living on the islands than for those living in the city in terms of media use, participation in community activities, and the collaboration of family members in child-rearing. Family functioning of single-parent families correlated significantly with household income, the parent's gender, family members' health, and family life cycle. Single-parent families living on Japanese offshore islands maintained family functioning through mutual support and the effective use of information technology. Nevertheless, single-parent families require additional support to improve their healthcare and financial situations.

  11. Investigations on heavy ion induced Single-Event Transients (SETs) in highly-scaled FinFETs

    Energy Technology Data Exchange (ETDEWEB)

    Gaillardin, M., E-mail: marc.gaillardin@cea.fr [CEA, DAM, DIF, F-91297 Arpajon (France); Raine, M.; Paillet, P. [CEA, DAM, DIF, F-91297 Arpajon (France); Adell, P.C. [Jet Propulsion Laboratory, Pasadena, CA 91101 (United States); Girard, S. [Université de Saint-Etienne, Laboratoire H. Curien, UMR-5516, 42000 Saint-Etienne (France); Duhamel, O. [CEA, DAM, DIF, F-91297 Arpajon (France); Andrieu, F.; Barraud, S.; Faynot, O. [CEA, LETI-Minatec, 17 avenue des Martyrs, 38000 Grenoble (France)

    2015-12-15

    We investigate Single-Event Transients (SET) in different designs of multiple-gate devices made of FinFETs with various geometries. Heavy ion experimental results are explained by using a thorough charge collection analysis of fast transients measured on dedicated test structures. Multi-level simulations are performed to get new insights into the charge collection mechanisms in multiple-gate devices. Implications for multiple-gate device design hardening are finally discussed.

  12. PPDS compas-primer

    International Nuclear Information System (INIS)

    Alekhin, S.I.; Bazeeva, V.V.; Grudtsin, S.N.

    1987-01-01

    Catalogue of IHEP data bases on particle physics (PPDS) and short guide for unexperienced user are presented. All data bases are under common data base management system and include bibliographic and factographic ones. Binary search and set of applied programs controlling input and formatting output make using of system easy and convenient. Basic programs are developed in FORTRAN

  13. A Primer of Existentialism.

    Science.gov (United States)

    Bigelow, Gordon E.

    1961-01-01

    Although no set of principles can apply uniformly to all existentialists, certain basic characteristics of existentialism are central to both the nonreligious writers like Sartre and Camus and the theistic existentialists like Kierkegaard, Maritain, Marcel, Tillich, Berdyaev, and Buber. These characteristics are (1) an insistence that human life…

  14. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  15. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  16. Domestic violence, single parenthood, and fathers in the setting of teenage pregnancy.

    Science.gov (United States)

    Tan, Louisa H; Quinlivan, Julie A

    2006-03-01

    To explore the relative impact of demographic and early interpersonal family relationships as associations of fatherhood where the mother is a teenager, compared to where the mother is over 20 years of age. A prospective cross-sectional cohort study was undertaken. Institutional ethics committee approval and informed consent were obtained. Data were analyzed from interviews with consecutive males about to become fathers where the mother was aged less than 20 years (teenage) and compared to information from males about to become fathers where the mother was aged 20 years or more (control). Subjects were interviewed to obtain information covering their early life experiences, demographic information, drug use, opinion of the pregnancy, and future planning. In multivariate analysis, and after controlling for family income and education, the following factors had a significant independent association with fatherhood in the setting of teenage pregnancy: a history of parental separation/divorce in early childhood, exposure to family violence in early childhood, and illicit drug use (ever or in pregnancy). Fathers, in the setting of teenage pregnancy, are more likely to report adverse early family relationships, such as exposure to domestic violence or parental separation or divorce. As such, these fathers may lack a positive role model for parenting and fatherhood.

  17. Identification of a core set of rhizobial infection genes using data from single cell-types

    Directory of Open Access Journals (Sweden)

    Da-Song eChen

    2015-07-01

    Full Text Available Genome-wide expression studies on nodulation have varied in their scale from entire root systems to dissected nodules or root sections containing nodule primordia. More recently efforts have focused on developing methods for isolation of root hairs from infected plants and the application of laser-capture microdissection technology to nodules. Here we analyze two published data sets to identify a core set of infection genes that are expressed in the nodule and in root hairs during infection. Among the genes identified were those encoding phenylpropanoid biosynthesis enzymes including Chalcone-O-Methyltransferase which is required for the production of the potent Nod gene inducer 4’,4-dihydroxy-2-methoxychalcone. A promoter-GUS analysis in transgenic hairy roots for two genes encoding Chalcone-O-Methyltransferase isoforms revealed their expression in rhizobially infected root hairs and the nodule infection zone but not in the nitrogen fixation zone. We also describe a group of Rhizobially Induced Peroxidases whose expression overlaps with the production of superoxide in rhizobially infected root hairs and in nodules and roots. Finally, we identify a cohort of co-regulated transcription factors as candidate regulators of these processes.

  18. Training With Curved Laparoscopic Instruments in Single-Port Setting Improves Performance Using Straight Instruments: A Prospective Randomized Simulation Study.

    Science.gov (United States)

    Lukovich, Peter; Sionov, Valery Ben; Kakucs, Timea

    2016-01-01

    Lately single-port surgery is becoming a widespread procedure, but it is more difficult than conventional laparoscopy owing to the lack of triangulation. Although, these operations are also possible with standard laparoscopic instruments, curved instruments are being developed. The aims of the study were to identify the effect of training on a box trainer in single-port setting on the quality of acquired skills, and transferred with the straight and curved instruments for the basic laparoscopic tasks, and highlight the importance of a special laparoscopic training curriculum. A prospective study on a box trainer in single-port setting was conducted using 2 groups. Each group performed 2 tasks on the box trainer in single-port setting. Group-S used conventional straight laparoscopic instruments, and Group-C used curved laparoscopic instruments. Learning curves were obtained by daily measurements recorded in 7-day sessions. On the last day, the 2 groups changed instruments between each other. 1st Department of Surgery, Semmelweis University of Medicine from Budapest, Hungary, a university teaching hospital. In all, 20 fifth-year medical students were randomized into 2 groups. None of them had any laparoscopic or endoscopic experience. Participation was voluntary. Although Group-S performed all tasks significantly faster than Group-C on the first day, the difference proved to be nonsignificant on the last day. All participants achieved significantly shorter task completion time on the last day than on the first day, regardless of the instrument they used. Group-S showed improvement of 63.5%, and Group-C 69.0% improvement by the end of the session. After swapping the instruments, Group-S reached significantly higher task completion time with curved instruments, whereas Group-C showed further progression of 8.9% with straight instruments. Training with curved instruments in a single-port setting allows for a better acquisition of skills in a shorter period. For this

  19. Blockchain: A Primer

    OpenAIRE

    Dwyer, Gerald P

    2016-01-01

    The Bitcoin blockchain is the primary innovation in Bitcoin that makes it practical. Blockchains have applications in many contexts other than cryptocurrencies. This note is an introduction to blockchains that requires no prior knowledge, including of Bitcoin. Blockchains are ledgers of transactions kept by a set of participants, none of which is accorded special status as the “correct one.” Instead, agreement is reached by a process of consensus. I show how this works for Bitcoin, discuss ap...

  20. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. The calculus primer

    CERN Document Server

    Schaaf, William L

    2011-01-01

    Comprehensive but concise, this introduction to differential and integral calculus covers all the topics usually included in a first course. The straightforward development places less emphasis on mathematical rigor, and the informal manner of presentation sets students at ease. Many carefully worked-out examples illuminate the text, in addition to numerous diagrams, problems, and answers.Bearing the needs of beginners constantly in mind, the treatment covers all the basic concepts of calculus: functions, derivatives, differentiation of algebraic and transcendental functions, partial different

  2. Primer on radiation

    International Nuclear Information System (INIS)

    Rados, B.

    1979-01-01

    Sources of anthropogenic radiation and their relative risk are discussed. Natural radiation accounts for more than half the exposure most U.S. citizens receive; the average citizen is exposed to about 100 mrem/yr. Medical and dental X-rays and radioactive material used to diagnose and treat illness account for 90% of all anthropogenic exposure. The remaining 10% comes from nuclear weapons testing, nuclear power plants, industrial uses of radioactive materials, and minute emissions from consumer products, such as color television sets. Occupationally exposed workers face greater risks from radiation. Means of calculating health risks are explained. Mechanisms of biological damage from ionizing radiation are outlined

  3. Identity Management A Primer

    CERN Document Server

    Sharoni, Ilan; Williamson, Graham; Yip, David

    2009-01-01

    In an age in which the boundaries between the real and the virtual are becoming increasingly blurred, this timely guide teaches both the key issues of identity management as well as appropriate strategies and preventative measures for ensuring personal safety in the virtual world. In a corporate setting, it is essential to identify and control the way in which the organization deals with customers, suppliers, employees, and other users who may interact with the information systems of the company. Providing strategies for overcoming this task in real-world terms as well as questions that assist

  4. Comprehensive detection of diverse exon 19 deletion mutations of EGFR in lung Cancer by a single probe set.

    Science.gov (United States)

    Bae, Jin Ho; Jo, Seong-Min; Kim, Hak-Sung

    2015-12-15

    Detection of exon 19 deletion mutation of EGFR, one of the most frequently occurring mutations in lung cancer, provides the crucial information for diagnosis and treatment guideline in non-small-cell lung cancer (NSCLC). Here, we demonstrate a simple and efficient method to detect various exon 19 deletion mutations of EGFR using a single probe set comprising of an oligo-quencher (oligo-Q) and a molecular beacon (MB). While the MB hybridizes to both the wild and mutant target DNA, the oligo-Q only binds to the wild target DNA, leading to a fluorescent signal in case of deletion mutation. This enables the comprehensive detection of the diverse exon 19 deletion mutations using a single probe set. We demonstrated the utility and efficiency of the approach by detecting the frequent exon 19 deletion mutations of EGFR through a real-time PCR and in situ fluorescence imaging. Our approach enabled the detection of genomic DNA as low as 0.02 ng, showing a detection limit of 2% in a heterogeneous DNA mixture, and could be used for detecting mutations in a single cell level. The present MB and oligo-Q dual probe system can be used for diagnosis and treatment guideline in NSCLC. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Testing initiatives increase rates of HIV diagnosis in primary care and community settings: an observational single-centre cohort study.

    Directory of Open Access Journals (Sweden)

    Prini Mahendran

    Full Text Available The primary objective was to examine trends in new HIV diagnoses in a UK area of high HIV prevalence between 2000 and 2012 with respect to site of diagnosis and stage of HIV infection.Single-centre observational cohort study.An outpatient HIV department in a secondary care UK hospital.1359 HIV-infected adults.Demographic information (age, gender, ethnicity, and sexual orientation, site of initial HIV diagnosis (Routine settings such as HIV/GUM clinics versus Non-Routine settings such as primary care and community venues, stage of HIV infection, CD4 count and seroconversion symptoms were collated for each participant.There was a significant increase in the proportion of new HIV diagnoses made in Non-Routine settings (from 27.0% in 2000 to 58.8% in 2012; p<0.001. Overall there was a decrease in the rate of late diagnosis from 50.7% to 32.9% (p=0.001. Diagnosis of recent infection increased from 23.0% to 47.1% (p=0.001. Of those with recent infection, significantly more patients were likely to report symptoms consistent with a seroconversion illness over the 13 years (17.6% to 65.0%; p<0.001.This is the first study, we believe, to demonstrate significant improvements in HIV diagnosis and a shift in diagnosis of HIV from HIV/GUM settings to primary practice and community settings due to multiple initiatives.

  6. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  7. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  8. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  9. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  10. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  11. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  12. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  13. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  14. A primer on metagenomics.

    Directory of Open Access Journals (Sweden)

    John C Wooley

    2010-02-01

    Full Text Available Metagenomics is a discipline that enables the genomic study of uncultured microorganisms. Faster, cheaper sequencing technologies and the ability to sequence uncultured microbes sampled directly from their habitats are expanding and transforming our view of the microbial world. Distilling meaningful information from the millions of new genomic sequences presents a serious challenge to bioinformaticians. In cultured microbes, the genomic data come from a single clone, making sequence assembly and annotation tractable. In metagenomics, the data come from heterogeneous microbial communities, sometimes containing more than 10,000 species, with the sequence data being noisy and partial. From sampling, to assembly, to gene calling and function prediction, bioinformatics faces new demands in interpreting voluminous, noisy, and often partial sequence data. Although metagenomics is a relative newcomer to science, the past few years have seen an explosion in computational methods applied to metagenomic-based research. It is therefore not within the scope of this article to provide an exhaustive review. Rather, we provide here a concise yet comprehensive introduction to the current computational requirements presented by metagenomics, and review the recent progress made. We also note whether there is software that implements any of the methods presented here, and briefly review its utility. Nevertheless, it would be useful if readers of this article would avail themselves of the comment section provided by this journal, and relate their own experiences. Finally, the last section of this article provides a few representative studies illustrating different facets of recent scientific discoveries made using metagenomics.

  15. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  16. Regenerative medicine primer.

    Science.gov (United States)

    Terzic, Andre; Nelson, Timothy J

    2013-07-01

    The pandemic of chronic diseases, compounded by the scarcity of usable donor organs, mandates radical innovation to address the growing unmet needs of individuals and populations. Beyond life-extending measures that are often the last available option, regenerative strategies offer transformative solutions in treating degenerative conditions. By leveraging newfound knowledge of the intimate processes fundamental to organogenesis and healing, the emerging regenerative armamentarium aims to boost the aptitude of human tissues for self-renewal. Regenerative technologies strive to promote, augment, and reestablish native repair processes, restituting organ structure and function. Multimodal regenerative approaches incorporate transplant of healthy tissues into damaged environments, prompt the body to enact a regenerative response in damaged tissues, and use tissue engineering to manufacture new tissue. Stem cells and their products have a unique aptitude to form specialized tissues and promote repair signaling, providing active ingredients of regenerative regimens. Concomitantly, advances in materials science and biotechnology have unlocked additional prospects for growing tissue grafts and engineering organs. Translation of regenerative principles into practice is feasible and safe in the clinical setting. Regenerative medicine and surgery are, thus, poised to transit from proof-of-principle studies toward clinical validation and, ultimately, standardization, paving the way for next-generation individualized management algorithms. Copyright © 2013 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  17. Single case design studies in music therapy: resurrecting experimental evidence in small group and individual music therapy clinical settings.

    Science.gov (United States)

    Geist, Kamile; Hitchcock, John H

    2014-01-01

    The profession would benefit from greater and routine generation of causal evidence pertaining to the impact of music therapy interventions on client outcomes. One way to meet this goal is to revisit the use of Single Case Designs (SCDs) in clinical practice and research endeavors in music therapy. Given the appropriate setting and goals, this design can be accomplished with small sample sizes and it is often appropriate for studying music therapy interventions. In this article, we promote and discuss implementation of SCD studies in music therapy settings, review the meaning of internal study validity and by extension the notion of causality, and describe two of the most commonly used SCDs to demonstrate how they can help generate causal evidence to inform the field. In closing, we describe the need for replication and future meta-analysis of SCD studies completed in music therapy settings. SCD studies are both feasible and appropriate for use in music therapy clinical practice settings, particularly for testing effectiveness of interventions for individuals or small groups. © the American Music Therapy Association 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  19. Characterization of n-heptane as a single component Diesel surrogate fuel. EHPC test set-up implementation

    Energy Technology Data Exchange (ETDEWEB)

    Meijer, M.

    2010-06-15

    The availability of accurately measured fuel properties, during an injection event under engine relevant conditions is critical within the surrogate fuel approach. There is a need to perform in-house measurements in order to validate developed and new models. A well defined and accurately measured data-set will facilitate on-going work for sophisticated engine related in-cylinder combustion modeling. In this work pure n-heptane fuel is used as a single component surrogate fuel and is studied in a high-pressure constant volume optical test set-up. N-heptane is often used as a single component surrogate diesel fuel since it has a comparable Cetane number as European diesel. Detailed chemical-kinetic mechanisms for low-, intermediate-, and high-temperature n-heptane oxidation are available and several models exist that have sufficiently reduced dimensionality (number of species and reactions) to enable their use in CFD (Computational Fluid Mechanics) simulations. This report discusses the route and implementation to perform such an accurate and relevant n-heptane measurement series. The aim is to combine the efforts of earlier presented EHPC (Eindhoven High Pressure Cell) related work and new approaches, into the proposed surrogate fuel measurement series. The following aspects, related to the applied constant volume combustion chamber set-up, are studied and implemented: Extending the operating ranges towards relevant engine conditions; Study the accuracy and sensitivities of the different measurement steps; Implementing different optical diagnostic principles; and Implement a standardized and robust post processing routine. The different optical diagnostic principles used in this work are: high-speed Schlieren, Mie scattering and beginnings are made to implement a simultaneous LII LIF (Laser Induced Incandescence - Laser Induced Fluorescence) set-up using a new ICCD (Intensified Charge Coupled Device) camera with dual imaging feature. Combining the different

  20. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  1. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  2. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  3. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  4. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  5. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  6. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  7. Accurate prediction of complex free surface flow around a high speed craft using a single-phase level set method

    Science.gov (United States)

    Broglia, Riccardo; Durante, Danilo

    2017-11-01

    This paper focuses on the analysis of a challenging free surface flow problem involving a surface vessel moving at high speeds, or planing. The investigation is performed using a general purpose high Reynolds free surface solver developed at CNR-INSEAN. The methodology is based on a second order finite volume discretization of the unsteady Reynolds-averaged Navier-Stokes equations (Di Mascio et al. in A second order Godunov—type scheme for naval hydrodynamics, Kluwer Academic/Plenum Publishers, Dordrecht, pp 253-261, 2001; Proceedings of 16th international offshore and polar engineering conference, San Francisco, CA, USA, 2006; J Mar Sci Technol 14:19-29, 2009); air/water interface dynamics is accurately modeled by a non standard level set approach (Di Mascio et al. in Comput Fluids 36(5):868-886, 2007a), known as the single-phase level set method. In this algorithm the governing equations are solved only in the water phase, whereas the numerical domain in the air phase is used for a suitable extension of the fluid dynamic variables. The level set function is used to track the free surface evolution; dynamic boundary conditions are enforced directly on the interface. This approach allows to accurately predict the evolution of the free surface even in the presence of violent breaking waves phenomena, maintaining the interface sharp, without any need to smear out the fluid properties across the two phases. This paper is aimed at the prediction of the complex free-surface flow field generated by a deep-V planing boat at medium and high Froude numbers (from 0.6 up to 1.2). In the present work, the planing hull is treated as a two-degree-of-freedom rigid object. Flow field is characterized by the presence of thin water sheets, several energetic breaking waves and plungings. The computational results include convergence of the trim angle, sinkage and resistance under grid refinement; high-quality experimental data are used for the purposes of validation, allowing to

  8. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. Good analytical practice: statistics and handling data in biomedical science. A primer and directions for authors. Part 1: Introduction. Data within and between one or two sets of individuals.

    Science.gov (United States)

    Blann, A D; Nation, B R

    2008-01-01

    The biomedical scientist is bombarded on a daily basis by information, almost all of which refers to the health status of an individual or groups of individuals. This review is the first of a two-part article written to explain some of the issues related to the presentation and analysis of data. The first part focuses on types of data and how to present and analyse data from an individual or from one or two groups of persons. The second part will examine data from three or more sets of persons, what methods are available to allow this analysis (i.e., statistical software packages), and will conclude with a statement on appropriate descriptors of data, their analyses, and presentation for authors considering submission of their data to this journal.

  11. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  12. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  13. Fruit Set and Single Visit Stigma Pollen Deposition by Managed Bumble Bees and Wild Bees in Citrullus lanatus (Cucurbitales: Cucurbitaceae).

    Science.gov (United States)

    Campbell, Joshua W; Daniels, Jaret C; Ellis, James D

    2018-04-02

    Pollinators provide essential services for watermelon, Citrullus lanatus (Thunb.; Cucurbitales: Cucurbitaceae). Managed bumble bees, Bombus impatiens (Cresson; Hymenoptera: Apidae), have been shown to be a useful watermelon pollinator in some areas. However, the exact contribution bumble bees make to watermelon pollination and how their contribution compares to that of other bees is unclear. We used large cages (5.4 × 2.5 × 2.4 m) to confine bumble bee hives to watermelon plants and compared fruit set in those cages to cages containing watermelons but no pollinators, and to open areas of field next to cages (allows all pollinators). We also collected data on single visit pollen deposition onto watermelon stigmas by managed bumble bees, honey bees, and wild bees. Overall, more fruit formed within the open cages than in cages of the other two treatment groups. B. impatiens and Melissodes spp. deposited the most pollen onto watermelon stigmas per visit, but all bee species observed visiting watermelon flowers were capable of depositing ample pollen to watermelon stigmas. Although B. impatiens did deposit large quantities of pollen to stigmas, they were not common within the field (i.e., outside the cages) as they were readily drawn to flowering plants outside of the watermelon field. Overall, bumble bees can successfully pollinate watermelon, but may be useful in greenhouses or high tunnels where watermelon flowers have no competition from other flowering plants that could draw bumble bees away from watermelon.

  14. A single center study: Aβ42/p-Tau181 CSF ratio to discriminate AD from FTD in clinical setting.

    Science.gov (United States)

    Vergallo, Andrea; Carlesi, Cecilia; Pagni, Cristina; Giorgi, Filippo Sean; Baldacci, Filippo; Petrozzi, Lucia; Ceravolo, Roberto; Tognoni, Gloria; Siciliano, Gabriele; Bonuccelli, Ubaldo

    2017-10-01

    Abnormal levels of beta amyloid (Aβ42) and tau protein concentrations in the cerebral spinal fluid (CSF) have been largely described in Alzheimer's disease (AD). Thus, CSF analysis of these biomarkers has been incorporated in recent AD diagnostic criteria, and it is increasingly performed for neurodegenerative dementia diagnostic workout in clinical setting. Nevertheless, the precise biomarkers CSF features in neurodegenerative dementia, either AD or Frontotemporal dementia (FTD), are still not fully clear today. This is mainly due to lack of CSF clear cutoff values due to a well-known intersite (but even intrasite) variability of CSF procedures, ranging from collection to analysis. Applying CSF biomarker ratios, rather than their single values could represent a useful tool, especially for the differential diagnosis of different forms of dementia. We explored clinical values of six CSF ratios (by combining Aβ42 and tau) in order to better discriminate between AD and FTD; we identified Aβ42/p-Tau 181 ratio as a potential good candidate for helping differentiating AD from FTD in the clinical practice.

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  16. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  17. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  18. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  19. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... the environmental quality of agroecosystems and are indeed considered as ..... five isopod species in standardized tests for pH preference. Eur. J. Soil. Biol. ... Zimmer M. and Topp W. 1997 Does food quality influence pop-.

  20. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  1. Post procedural complications of cardiac implants done in a resource limited setting under 'C' arm: A single centre experience.

    Science.gov (United States)

    Jayachandra, A; Aggarwal, Vivek; Kumar, Sandeep; Nagesh, I V

    2018-04-01

    Cardiology interventions in peripheral hospitals is a challenging task where cardiologist have to fight against time and limited resources. Most of the sudden cardiac deaths occur due to arrhythmia and heart blocks/sinus node dysfunction. Our study is a single peripheral center experience of cardiac devices implantation using a 'C' Arm. The aim of this study was to post procedural complications of cardiac implants done in aresource limited setting under 'C' arm. This study is done at a peripheral cardiology center with no cardiac catheterization laboratory (CCL) facilities. Consecutive patients reporting to cardiology center, between Jan 2015 and Oct 2016, with a definite indication for cardiac device implant were included in the study. All the procedure of implantation was done in the operation theatre under 'C' arm under local anesthesia with continuous cardiac monitoring and critical care back up. Total 58 device implantations were done from Jan 2015 to Oct 2016. The mean age of the patients was 67.15 ± 10.85 years. Males constituted almost two third (68.9%) of patients. The commonest indication for device implantation was sinus node dysfunction in 60.34% followed by complete heart block in 25.86% and ventricular tachycardia in 12.06%. No post procedure infection was observed in our study. Device implantation constitute a major group of life saving interventions in cardiology practice. Our study has emphasised that when appropriate aseptic measures are taken during device implantation at peripheral centres, the complications rate are comparable to interventions done at advance cardiac centres.

  2. Performance of single and concatenated sets of mitochondrial genes at inferring metazoan relationships relative to full mitogenome data.

    Directory of Open Access Journals (Sweden)

    Justin C Havird

    Full Text Available Mitochondrial (mt genes are some of the most popular and widely-utilized genetic loci in phylogenetic studies of metazoan taxa. However, their linked nature has raised questions on whether using the entire mitogenome for phylogenetics is overkill (at best or pseudoreplication (at worst. Moreover, no studies have addressed the comparative phylogenetic utility of mitochondrial genes across individual lineages within the entire Metazoa. To comment on the phylogenetic utility of individual mt genes as well as concatenated subsets of genes, we analyzed mitogenomic data from 1865 metazoan taxa in 372 separate lineages spanning genera to subphyla. Specifically, phylogenies inferred from these datasets were statistically compared to ones generated from all 13 mt protein-coding (PC genes (i.e., the "supergene" set to determine which single genes performed "best" at, and the minimum number of genes required to, recover the "supergene" topology. Surprisingly, the popular marker COX1 performed poorest, while ND5, ND4, and ND2 were most likely to reproduce the "supergene" topology. Averaged across all lineages, the longest ∼2 mt PC genes were sufficient to recreate the "supergene" topology, although this average increased to ∼5 genes for datasets with 40 or more taxa. Furthermore, concatenation of the three "best" performing mt PC genes outperformed that of the three longest mt PC genes (i.e, ND5, COX1, and ND4. Taken together, while not all mt PC genes are equally interchangeable in phylogenetic studies of the metazoans, some subset can serve as a proxy for the 13 mt PC genes. However, the exact number and identity of these genes is specific to the lineage in question and cannot be applied indiscriminately across the Metazoa.

  3. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  4. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  5. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  6. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  7. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  9. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  10. On the Optimal Policy for the Single-product Inventory Problem with Set-up Cost and a Restricted Production Capacity

    NARCIS (Netherlands)

    Foreest, N. D. van; Wijngaard, J.

    2010-01-01

    The single-product, stationary inventory problem with set-up cost is one of the classical problems in stochastic operations research. Theories have been developed to cope with finite production capacity in periodic review systems, and it has been proved that optimal policies for these cases are not

  11. Operational behavior of the MAP/G/1 queue under N-policy with a single vacation and set-up

    Directory of Open Access Journals (Sweden)

    Ho Woo Lee

    2002-01-01

    Full Text Available This paper considers the MAP/G/1 queue under N-policy with a single vacation and set-up. We derive the vector generating functions of the queue length at an arbitrary time and at departures in decomposed forms. We also derive the Laplace-Stieltjes transform of the waiting time. Computation algorithms for mean performance measures are provided.

  12. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  13. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  14. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  15. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  16. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  17. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  18. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  19. Comparison of different sets of instruments for laparoendoscopic single-site surgery in a surgical simulator with novices.

    Science.gov (United States)

    Wang, Dong; Shi, Long-Qing; Wang, Jing-Min; Jiang, Xiao-Hua; Ji, Zhen-Ling

    2016-04-01

    Given the parallel entry of working instruments through a single incision in laparoendoscopic single-site surgery, loss of triangulation in the abdominal cavity and counteracting movements of the instruments are inevitable obstacles. Some specially designed devices have emerged to ameliorate these challenges. Twenty-four novice participants were randomized into four groups using assigned instruments, conventional straight instruments, single-curved instruments, double-curved instruments and articulating instruments, respectively, to perform two basic tasks (peg transferring and pattern cutting) 14 times in a modified simulator. A test of the tasks and a resection of the intestine segment of a rat were performed. The task scores and evaluation of intraoperative skills during the resection of the intestine segment were recorded. The instrument of modified National Aeronautics and Space Administration Task Load Index (NASA-TLX) was completed. The task scores of the groups using single-curved instruments and articulating instruments were better than the other two groups on the simulator tasks, consistent with the evaluation of intraoperative skills during the resection of intestine segment. As the proficiency with the instruments increased, the task scores improved, as demonstrated by the learning curve. The workload measured by the modified NASA-TLX tool demonstrated that the groups using articulating instruments and double-curved instruments had a heavier workload in most of the categories compared with the other two groups. Single-curved and articulating instruments are more effective than conventional straight and double-curved devices, and are favourable in laparoendoscopic single-site surgery for novice learners. © 2013 Royal Australasian College of Surgeons.

  20. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  1. Comparing signal intensity and refraction sensitivity of double and single mask edge illumination lab-based x-ray phase contrast imaging set-ups

    International Nuclear Information System (INIS)

    Kallon, G K; Diemoz, P C; Vittoria, F A; Basta, D; Endrizzi, M; Olivo, A

    2017-01-01

    Double mask edge illumination (DM-EI) set-ups can detect differential phase and attenuation information from a sample. However, analytical separation of the two signals often requires acquiring two frames with inverted differential phase contrast signals. Typically, between these two acquisitions, the first mask is moved to create a different illumination condition. This can lead to potential errors which adversely affect the data collected. In this paper, we implement a single mask EI laboratory set-up that allows for a single shot retrieval of the differential phase and attenuation images, without the need for a high resolution detector or high magnification. As well as simplifying mask alignment, the advantages of the proposed set-up can be exploited in one of two ways: either the total acquisition time can be halved with respect to the DM-EI set-up or, for the same acquisition time, twice the statistics can be collected. In this latter configuration, the signal-to-noise ratio and contrast in the mixed intensity images, and the angular sensitivity of the two set-ups were compared. We also show that the angular sensitivity of the single mask set-up can be well approximated from its illumination curve, which has been modelled as a convolution between the source spatial distribution at the detector plane, the pre-sample mask and the detector point spread function (PSF). A polychromatic wave optics simulation was developed on these bases and benchmarked against experimental data. It can also be used to predict the angular sensitivity and contrast of any set-up as a function of detector PSF. (paper)

  2. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  3. Multi-valued logic circuits using hybrid circuit consisting of three gates single-electron transistors (TG-SETs) and MOSFETs.

    Science.gov (United States)

    Shin, SeungJun; Yu, YunSeop; Choi, JungBum

    2008-10-01

    New multi-valued logic (MVL) families using the hybrid circuits consisting of three gates single-electron transistors (TG-SETs) and a metal-oxide-semiconductor field-effect transistor (MOSFET) are proposed. The use of SETs offers periodic literal characteristics due to Coulomb oscillation of SET, which allows a realization of binary logic (BL) circuits as well as multi-valued logic (MVL) circuits. The basic operations of the proposed MVL families are successfully confirmed through SPICE circuit simulation based on the physical device model of a TG-SET. The proposed MVL circuits are found to be much faster, but much larger power consumption than a previously reported MVL, and they have a trade-off between speed and power consumption. As an example to apply the newly developed MVL families, a half-adder is introduced.

  4. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  5. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  6. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  7. The Idiographic Study of Leadership Behavior in Natural Settings: An Empirical Analysis Using a Single Case Experimental Design.

    Science.gov (United States)

    1982-08-01

    Management , 1977, 1, 105-109. LAuthans, F. Leadership : A proposal for a social learning theory base and observational and functional analysis...Manz, C.C., & Sims, H.P. Self management as a substitute for leadership : A social learning theory perspective. Academy of Management Review, 1980, 5...AD-AI19 89 NEBRASKA UNIV LINCOLN DEPT OF MANAGEMENT F/G 5/1 THE IDIOGRAPHIC STUDY OF LEADERSHIP BEHAVIOR IN NATURAL SETTING-ETCIU)AUG 82 T R DAVI , F

  8. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  9. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  10. Visual CRO display of pulse height distribution including discriminator setting for a single channel X-ray analyser

    International Nuclear Information System (INIS)

    Shaw, S.E.

    1979-01-01

    An outline for a simple pulse spectroscope which attaches to a standard laboratory CRO is presented. The peak amplitude voltage of each pulse from the linear amplifier of a single channel X-ray analyser is stored for the duration of one oscilloscope trace. For each amplifier pulse, input from the discriminator is tested and if these is coincidence of pulses the oscilloscope beam is blanked for approximately the first 2 cm of its traverse across the screen. Repetition of pulses forms a pulse height distribution with a rectangular dark area marking the position of the discriminator window. (author)

  11. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  12. Automatic exposure control at single- and dual-heartbeat CTCA on a 320-MDCT volume scanner: effect of heart rate, exposure phase window setting, and reconstruction algorithm.

    Science.gov (United States)

    Funama, Yoshinori; Utsunomiya, Daisuke; Taguchi, Katsuyuki; Oda, Seitaro; Shimonobo, Toshiaki; Yamashita, Yasuyuki

    2014-05-01

    To investigate whether electrocardiogram (ECG)-gated single- and dual-heartbeat computed tomography coronary angiography (CTCA) with automatic exposure control (AEC) yields images with uniform image noise at reduced radiation doses. Using an anthropomorphic chest CT phantom we performed prospectively ECG-gated single- and dual-heartbeat CTCA on a second-generation 320-multidetector CT volume scanner. The exposure phase window was set at 75%, 70-80%, 40-80%, and 0-100% and the heart rate at 60 or 80 or corr80 bpm; images were reconstructed with filtered back projection (FBP) or iterative reconstruction (IR, adaptive iterative dose reduction 3D). We applied AEC and set the image noise level to 20 or 25 HU. For each technique we determined the image noise and the radiation dose to the phantom center. With half-scan reconstruction at 60 bpm, a 70-80% phase window- and a 20-HU standard deviation (SD) setting, the imagenoise level and -variation along the z axis manifested similar curves with FBP and IR. With half-scan reconstruction, the radiation dose to the phantom center with 70-80% phase window was 18.89 and 12.34 mGy for FBP and 4.61 and 3.10 mGy for IR at an SD setting SD of 20 and 25 HU, respectively. At 80 bpm with two-segment reconstruction the dose was approximately twice that of 60 bpm at both SD settings. However, increasing radiation dose at corr80 bpm was suppressed to 1.39 times compared to 60 bpm. AEC at ECG-gated single- and dual-heartbeat CTCA controls the image noise at different radiation dose. Copyright © 2013 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  13. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  14. A primer of analytical mechanics

    CERN Document Server

    Strocchi, Franco

    2018-01-01

    This book presents the basic elements of Analytical Mechanics, starting from the physical motivations that favor it with respect to the Newtonian Mechanics in Cartesian coordinates. Rather than presenting Analytical Mechanics mainly as a formal development of Newtonian Mechanics, it highlights its effectiveness due to the following five important achievements: 1) the most economical description of time evolution in terms of the minimal set of coordinates, so that there are no constraint forces in their evolution equations; 2) the form invariance of the evolution equations, which automatically solves the problem of fictitious forces; 3) only one scalar function encodes the formulation of the dynamics, rather than the full set of vectors which describe the forces in Cartesian Newtonian Mechanics; 4) in the Hamiltonian formulation, the corresponding evolution equations are of first order in time and are fully governed by the Hamiltonian function (usually corresponding to the energy); 5) the emergence of the Hami...

  15. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    Despite economic importance, the origin and domestication of mulberry has not ..... The numbers at the nodes in each tree are the bootstrap percent values (only values greater than or equal to 50 are shown) for the ..... Dandin S B 1998 Mulberry: A versatile biosource in the service of mankind; Acta Sericologica Sinica 24 ...

  16. Moderation of effects of AAC based on setting and types of aided AAC on outcome variables: an aggregate study of single-case research with individuals with ASD.

    Science.gov (United States)

    Ganz, Jennifer B; Rispoli, Mandy J; Mason, Rose Ann; Hong, Ee Rea

    2014-06-01

    The purpose of this meta-analysis was to evaluate the potential moderating effects of intervention setting and type of aided augmentative and alternative communication (AAC) on outcome variables for students with autism spectrum disorders. Improvement rate difference, an effect size measure, was used to calculate aggregate effects across 35 single-case research studies. Results indicated that the largest effects for aided AAC were observed in general education settings. With respect to communication outcomes, both speech generating devices (SGDs) and the Picture Exchange Communication System (PECS) were associated with larger effects than other picture-based systems. With respect to challenging behaviour outcomes, SGDs produced larger effects than PECS. This aggregate study highlights the importance of considering intervention setting, choice of AAC system and target outcomes when designing and planning an aided AAC intervention.

  17. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  18. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  19. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  20. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  1. Chromosome copy analysis by single-cell comparative genomic hybridization technique based on primer extension preamplification and degenerate oligonucleotide primed-PCR%引物延伸预扩增结合简并引物PCR在单细胞比较基因组杂交分析染色体异常中的应用

    Institute of Scientific and Technical Information of China (English)

    谭珂; 狄玉芬; 程德华; 徐芳; 卢光绣; 谭跃球

    2010-01-01

    Objective To establish a single-cell whole genome amplification (WGA) technique, in combination with comparative genomic hybridization (CGH), for analyzing chromosomal copy number changes, and to explore its clinical application in preimplantation genetic diagnosis (PGD). Methods Twelve single cell samples with known karyotypes, including 5 chorionic villus samples, 4 human embryonic stem cell (hESC) samples and 3 peripheral lymphocyte samples, and 4 single blastomere samples carrying chromosomal abnormalities detected by PGD, were collected for whole genome amplification by combining primer extension preamplification (PEP) with degenerate oligonucleotide primed-PCR (DOP-PCR)amplification. The amplified products labeled by red fluorescence were mixed with control DNA labeled by green fluorescence, and then the mixture was analyzed by CGH. As a comparison, 10 single cell samples were amplified by DOP-PCR only and then CGH analysis was performed. Results The amplification using PEP-DOP-PCR was more stable than traditional DOP-PCR. The products of PEP-DOP-PCR range from 100 bp to 1000 bp, with the mean size being about 400 bp. The CGH results were consistent with analyses by other methods. However, only 6 out of 10 single cell samples were successfully amplified by DOP-PCR,and CGH analysis showed a high background and 2 samples showed inconsistent results from other methods. Conclusion PEP-DOP-PCR can effectively amplify the whole genome DNA of single cell.Combined with CGH, this WGA method can successfully detect single-cell chromosomal copy number changes, while DOP-PCR was easy to fail to amplify and amplify inhomogeneousty, and CGH analysis using this PCR product usually showed high background. These results suggest that PEP-DOP-CGH is a promising method for preimplantation genetic diagnosis.%目的 建立一种可信的单细胞全基因组扩增(whole genome amplification.WGA)技术,结合比较基因组杂交(comparative genomic hybridization,CGH)分析单细

  2. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  3. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  4. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  5. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  6. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  7. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  8. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

    Science.gov (United States)

    Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

    2010-02-01

    QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

  9. A bilingual child learns social communication skills through video modeling-a single case study in a norwegian school setting

    Directory of Open Access Journals (Sweden)

    Meral Özerk

    2015-09-01

    Full Text Available Video modeling is one of the recognized methods used in the training and teaching of children with Autism Spectrum Disorders (ASD. The model’s theoretical base stems from Albert Bandura's (1977; 1986 social learning theory in which he asserts that children can learn many skills and behaviors observationally through modeling. One can assume that by observing others, a child with ASD can construct an idea of how new behaviors are performed, and on later occasions this mentally and visually constructed information will serve as a guide for his/her way of behaving. There are two types of methods for model learning: 1 In Vivo Modeling and 2 Video Modeling. These can be used a to teach children with ASD skills that are not yet in their behavioral repertoire and / or b to improve the children's emerging behaviors or skills. In the case of linguistic minority children at any stage of their bilingual development, it has been presumed that some of their behaviors that can be interpreted as attitude or culture-related actions. This approach, however, can sometimes delay referral, diagnosis, and intervention. In our project, we used Video Modeling and achieved positive results with regard to teaching social communication skills and target behavior to an eleven year-old bilingual boy with ASD. Our study also reveals that through Video Modeling, children with ASD can learn desirable behavioral skills as by-products. Video Modeling can also contribute positively to the social inclusion of bilingual children with ASD in school settings. In other words, bilingual children with ASD can transfer the social communication skills and targeted behaviors they learn through second-language at school to a first-language milieu.

  10. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  11. Intensive intervention for children and adolescents with autism in a community setting in Italy: a single-group longitudinal study

    Directory of Open Access Journals (Sweden)

    Valenti Marco

    2010-09-01

    Full Text Available Abstract Background Previous studies have shown favourable results with intensive behavioural treatment for children with autism: evidence has emerged that treatment can be successfully implemented in a community setting and in adolescent participants. The aim of this study was to describe the 2-year adaptive functioning outcome of children and adolescents with autism treated intensively within the context of special autism centres, as well as to evaluate family satisfaction with the activity of the centres. Methods Sixty participants with autism (20 females and 40 males, aged between 4 and 18 years attending the semi-residential rehabilitation centres for autism located in the Abruzzo region (Central Italy were followed up and their adaptive functioning was evaluated both at baseline and after one and two years using the Vineland Adaptive Behaviour Scales (VABS. Parents' satisfaction with the service was evaluated using the Orbetello Satisfaction Scale for Children and Adolescent Mental Health. Results The increase in VABS scores was significant on several domains in the different gender and age categories. It is worth noting that male children had improved a great deal (roughly, an effect size >0.20 in the domains of communication, daily living and motor skills (effect sizes 0.34, 0.45 and 0.27 respectively whereas in male adolescents, a notable increase in VABS scores was recorded in the domain of socialization only (effect size 0.23. On the other hand, adaptive behaviour in female children increased in the domains of socialization and motor skills (effect sizes 0.27 and 0.42 respectively whereas in female adolescents, good results were achieved in the domains of daily living, socialization and motor skills (effect sizes 0.22, 0.26 and 0.20 respectively. The level of satisfaction of users of the service over time was found to be substantial, even when they had recently started the program. Conclusions Our results support the implementation of

  12. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  13. Current procedural terminology; a primer.

    Science.gov (United States)

    Hirsch, Joshua A; Leslie-Mazwi, Thabele M; Nicola, Gregory N; Barr, Robert M; Bello, Jacqueline A; Donovan, William D; Tu, Raymond; Alson, Mark D; Manchikanti, Laxmaiah

    2015-04-01

    In 1966, The American Medical Association (AMA) working with multiple major medical specialty societies developed an iterative coding system for describing medical procedures and services using uniform language, the Current Procedural Terminology (CPT) system. The current code set, CPT IV, forms the basis of reporting most of the services performed by healthcare providers, physicians and non-physicians as well as facilities allowing effective, reliable communication among physician and other providers, third parties and patients. This coding system and its maintenance has evolved significantly since its inception, and now goes well beyond its readily perceived role in reimbursement. Additional roles include administrative management, tracking new and investigational procedures, and evolving aspects of 'pay for performance'. The system also allows for local, regional and national utilization comparisons for medical education and research. Neurointerventional specialists use CPT category I codes regularly--for example, 36,215 for first-order cerebrovascular angiography, 36,216 for second-order vessels, and 37,184 for acute stroke treatment by mechanical means. Additionally, physicians add relevant modifiers to the CPT codes, such as '-26' to indicate 'professional charge only,' or '-59' to indicate a distinct procedural service performed on the same day. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  14. Double perovskites overtaking the single perovskites: A set of new solar harvesting materials with much higher stability and efficiency

    Science.gov (United States)

    Kangsabanik, Jiban; Sugathan, Vipinraj; Yadav, Anuradha; Yella, Aswani; Alam, Aftab

    2018-05-01

    Solar energy plays an important role in substituting the ever declining source of fossil fuel energy. Finding novel materials for solar cell applications is an integral part of photovoltaic research. Hybrid lead halide perovskites are one of, if not the most, well sought material in the photovoltaic research community. Its unique intrinsic properties, flexible synthesis techniques, and device fabrication architecture made the community highly buoyant over the past few years. Yet, there are two fundamental issues that still remain a concern, i.e., the stability in external environment and the toxicity due to Pb. This led to a search for alternative materials. More recently, double perovskite [A2B B'X6 (X =Cl, Br, I)] materials have emerged as a promising choice. Few experimental synthesis and high throughput computational studies have been carried out to check for promising candidates of this class. The main outcome from these studies, however, can essentially be summarized into two categories: (i) either they have an indirect band gap or (ii) a direct but large optical band gap, which is not suitable for solar devices. Here we propose a large set of stable double perovskite materials, Cs2B B 'X6 (X =Cl, Br, I), which show indirect to direct band gap transition via small Pb+2 doping at both B and B'sites. This is done by careful band (orbital) engineering using first-principles calculations. This kind of doping has helped to change the topology of the band structure, triggering an indirect to direct transition that is optically allowed. It also reduces the band gap significantly, bringing it well into the visible region. We also simulated the optical absorption spectra of these systems and found a comparable/higher absorption coefficient and solar efficiency with respect to the state of the art photovoltaic absorber material CH3NH3PbI3 . A number of materials Cs2(B0.75Pb0.25) (B0.75'Pb0.25) X6 (for various combinations of B ,B ', and X ) are found to be promising

  15. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  16. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  17. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  18. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  19. A Set of Plastid Loci for Use in Multiplex Fragment Length Genotyping for Intraspecific Variation in Pinus (Pinaceae

    Directory of Open Access Journals (Sweden)

    Austin M. Wofford

    2014-04-01

    Full Text Available Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences ofycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group.

  20. A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

    Science.gov (United States)

    Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

    2014-01-01

    • Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

  1. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  4. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  5. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  6. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  7. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  8. Deep groundwater flow systems and their characterization in single-well settings by ''push-pull'' tracer tests

    International Nuclear Information System (INIS)

    Hebig-Schubert, Klaus

    2014-01-01

    This thesis demonstrates the growing importance of deep groundwater research and the increasing demand for the development of suitable single-well test methods. At the forefront of the research on groundwater in the deep underground, radioactive waste disposal in deep geological repositories, CO 2 storage, geothermal energy supply, and aquifer storage and recovery systems (ASR) are on the agenda. The developments of suitable methods for investigating these resources are a main target. Currently available methods show considerable limitations. Accordingly, comprehensive methods for the hydraulic and hydrochemical characterization of deeper aquifers with single-well access are needed. Therefore, the goal of this PhD thesis was to identify, test, and enhance potentially suitable single-well methods for characterization of groundwater flow and solute transport in such settings. For this, several Single-Well Injection-Withdrawal (''push-pull'') tracer tests were applied at the Hamasato field site (Horonobe, Japan) in a ∝100 m deep groundwater monitoring well. Aim was to characterize the impact of a dynamic saltwater-freshwater interface on a coastal aquifer. Based on the experiences of the first methodological test, a second field campaign was conducted. This campaign focused on a systematic evaluation of the push-pull tracer test method for the first time at all. The experiments focused on the investigation of the so-called ''chaser'' and its impact on the test results. The chaser is a specific part of many push-pull tracer tests setups. From these experiments, a specific test design for the investigation of the saltwater-freshwater interface in a single-well setting was developed. The application of this design on questions regarding different fluids within the same system, e.g. different mineralized fluids (saltwater-freshwater-interface, ASR) or temperatures (geothermal research), are promising future approaches for this

  9. Deep groundwater flow systems and their characterization in single-well settings by ''push-pull'' tracer tests

    Energy Technology Data Exchange (ETDEWEB)

    Hebig-Schubert, Klaus

    2014-11-21

    This thesis demonstrates the growing importance of deep groundwater research and the increasing demand for the development of suitable single-well test methods. At the forefront of the research on groundwater in the deep underground, radioactive waste disposal in deep geological repositories, CO{sub 2} storage, geothermal energy supply, and aquifer storage and recovery systems (ASR) are on the agenda. The developments of suitable methods for investigating these resources are a main target. Currently available methods show considerable limitations. Accordingly, comprehensive methods for the hydraulic and hydrochemical characterization of deeper aquifers with single-well access are needed. Therefore, the goal of this PhD thesis was to identify, test, and enhance potentially suitable single-well methods for characterization of groundwater flow and solute transport in such settings. For this, several Single-Well Injection-Withdrawal (''push-pull'') tracer tests were applied at the Hamasato field site (Horonobe, Japan) in a ∝100 m deep groundwater monitoring well. Aim was to characterize the impact of a dynamic saltwater-freshwater interface on a coastal aquifer. Based on the experiences of the first methodological test, a second field campaign was conducted. This campaign focused on a systematic evaluation of the push-pull tracer test method for the first time at all. The experiments focused on the investigation of the so-called ''chaser'' and its impact on the test results. The chaser is a specific part of many push-pull tracer tests setups. From these experiments, a specific test design for the investigation of the saltwater-freshwater interface in a single-well setting was developed. The application of this design on questions regarding different fluids within the same system, e.g. different mineralized fluids (saltwater-freshwater-interface, ASR) or temperatures (geothermal research), are promising future approaches for

  10. Signal-to-noise assessment for diffusion tensor imaging with single data set and validation using a difference image method with data from a multicenter study

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhiyue J., E-mail: jerry.wang@childrens.com [Department of Radiology, Children' s Medical Center, Dallas, Texas 75235 and Department of Radiology, University of Texas Southwestern Medical Center, Dallas, Texas 75390 (United States); Chia, Jonathan M. [Clinical Science, Philips Healthcare, Cleveland, Ohio 44143 (United States); Ahmed, Shaheen; Rollins, Nancy K. [Department of Radiology, Children' s Medical Center, Dallas, TX 75235 and Department of Radiology, University of Texas Southwestern Medical Center, Dallas, TX 75390 (United States)

    2014-09-15

    Purpose: To describe a quantitative method for determination of SNR that extracts the local noise level using a single diffusion data set. Methods: Brain data sets came from a multicenter study (eight sites; three MR vendors). Data acquisition protocol required b = 0, 700 s/mm{sup 2}, fov = 256 × 256 mm{sup 2}, acquisition matrix size 128 × 128, reconstruction matrix size 256 × 256; 30 gradient encoding directions and voxel size 2 × 2 × 2 mm{sup 3}. Regions-of-interest (ROI) were placed manually on the b = 0 image volume on transverse slices, and signal was recorded as the mean value of the ROI. The noise level from the ROI was evaluated using Fourier Transform based Butterworth high-pass filtering. Patients were divided into two groups, one for filter parameter optimization (N = 17) and one for validation (N = 10). Six white matter areas (the genu and splenium of corpus callosum, right and left centrum semiovale, right and left anterior corona radiata) were analyzed. The Bland–Altman method was used to compare the resulting SNR with that from the difference image method. The filter parameters were optimized for each brain area, and a set of “global” parameters was also obtained, which represent an average of all regions. Results: The Bland–Altman analysis on the validation group using “global” filter parameters revealed that the 95% limits of agreement of percent bias between the SNR obtained with the new and the reference methods were −15.5% (median of the lower limit, range [−24.1%, −8.9%]) and 14.5% (median of the higher limits, range [12.7%, 18.0%]) for the 6 brain areas. Conclusions: An FT-based high-pass filtering method can be used for local area SNR assessment using only one DTI data set. This method could be used to evaluate SNR for patient studies in a multicenter setting.

  11. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  12. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  13. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Evaluation of J and CTOD (Crack Tip Opening Displacement) fracture parameters for pipeline steels using Single Edge Notch Tension SE(T) specimens

    Energy Technology Data Exchange (ETDEWEB)

    Paredes Tobar, Lenin Marcelo; Ruggieri, Claudio [Universidade de Sao Paulo (USP), SP (Brazil). Escola Politecnica. Dept. de Engenharia Naval e Oceanica

    2009-12-19

    This work presents an evaluation procedure to determine the elastic-plastic J-integral and CTOD for pin-loaded and clamped single edge notch tension (SE(T)) specimens based upon the eta-method. The primary objective is to derive estimation equations applicable to determine J and CTOD fracture parameters for a wide range of a/W-ratios and material flow properties. Very detailed non-linear finite element analyses for plane-strain and full-thickness, 3-D models provide the evolution of load with increased crack mouth opening displacement which is required for the estimation procedure. The present analyses, when taken together with previous studies provide a fairly extensive body of results which serve to determine parameters J and CTOD for different materials using tension specimens with varying geometries. (author)

  15. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  16. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  17. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  18. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  19. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  20. RIRS versus mPCNL for single renal stone of 2-3 cm: clinical outcome and cost-effective analysis in Chinese medical setting.

    Science.gov (United States)

    Pan, Jiahua; Chen, Qi; Xue, Wei; Chen, Yonghui; Xia, Lei; Chen, Haige; Huang, Yiran

    2013-02-01

    The aim of the study was to compare the clinical outcome and the cost-effectiveness between retrograde intra renal surgery (RIRS) and mini-percutaneous nephrolithotripsy (mPCNL) for the management of single renal stone of 2-3 cm in Chinese medical setting. From May 2005 to February 2011, 115 patients with solitary renal calculi were treated either by RIRS or mPCNL. 56 patients were in RIRS group while 59 were in mPCNL group. Patients' demographics between the two groups, in terms of gender, age, BMI, history of ESWL as well as stone side, stone location and stone size were comparable. Peri-operative course, clinical outcome, complication rates and medical cost were compared. The effective quotient (EQ) of two groups was calculated. Data were analyzed using Fisher's exact test, Chi-square test and Student's t test. EQ for RIRS and mPCNL were 0.52 and 0.90. The initial stone-free rate (SFR) of RIRS group and mPCNL group was 71.4 and 96.6 %, respectively (P = 0.000). The mean procedure number was 1.18 in RIRS group and 1.03 in mPCNL group, respectively (P = 0.035). The operative time for RIRS was longer (P = 0.000) while the mean hospital stay was shorter (P = 0.000). There was no statistical difference in peri-operative complications between the groups. The initial hospitalization cost, laboratory and radiology test cost of RIRS group were lower (P = 0.000). However, counting the retreatment cost in the two groups, the total medical expenditure including the overall hospitalization cost, overall laboratory and radiology test cost and post-operative out-patient department (OPD) visit cost was similar between two groups. In conclusion, with similar total medical cost, mPCNL achieved faster stone clearance and lower retreatment rate without major complications, which implied higher cost-effectiveness for the treatment of single renal stone of 2-3 cm in Chinese medical setting. RIRS is also a safe and reliable choice for patients having contraindications or

  1. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  2. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  3. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  4. A single-arm pilot study of guided self-help treatment based cognitive behavioral therapy for bulimia nervosa in Japanese clinical settings.

    Science.gov (United States)

    Setsu, R; Asano, K; Numata, N; Tanaka, M; Ibuki, H; Yamamoto, T; Uragami, R; Matsumoto, J; Hirano, Y; Iyo, M; Shimizu, E; Nakazato, M

    2018-04-25

    Guided self-help treatments based on cognitive behavioral therapy (CBT-GSH) are regarded as a first-line effective treatment for bulimia nervosa (BN). With limited application for CBT-GSH in Japanese clinical settings, we conducted a single arm pilot study in order to confirm the acceptability and availability of CBT-GSH in Japan. 25 women with BN received 16-20 sessions of face-to-face CBT-GSH. Primary outcomes were the completion rate of intervention and abstinence rates from objective bingeing and purging as assessed by the Eating Disorder Examination. Secondary outcomes were other self-report measurements of the frequency of bingeing and purging, and characteristic psychopathologies of eating disorders. Assessments were conducted before CBT as baseline as well as after CBT. 92% (23/25) of the participants completed the CBT sessions. After CBT-GSH, 40% (10/25) of the participants (intention-to-treat) achieved symptom abstinence. The mean binge and purge episodes during the previous 28 days improved from 21.88 to 10.96 (50% reduction) and from 22.44 to 10.88 (52% reduction), each (before CBT-GSH to after CBT-GSH), and the within-group effect sizes were medium (Cohen's d = 0.67, 0.65, each). Our study provided a preliminary evidence about the feasibility of CBT-GSH in Japanese clinical settings for the future. Trial registration This study was registered retrospectively in the national UMIN Clinical Trials Registry on July 10, 2013 (registration ID: UMIN000011120).

  5. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  6. Effect of loading on unintentional lifting velocity declines during single sets of repetitions to failure during upper and lower extremity muscle actions.

    Science.gov (United States)

    Izquierdo, M; González-Badillo, J J; Häkkinen, K; Ibáñez, J; Kraemer, W J; Altadill, A; Eslava, J; Gorostiaga, E M

    2006-09-01

    The purpose of this study was to examine the effect of different loads on repetition speed during single sets of repetitions to failure in bench press and parallel squat. Thirty-six physical active men performed 1-repetition maximum in a bench press (1 RM (BP)) and half squat position (1 RM (HS)), and performed maximal power-output continuous repetition sets randomly every 10 days until failure with a submaximal load (60 %, 65 %, 70 %, and 75 % of 1RM, respectively) during bench press and parallel squat. Average velocity of each repetition was recorded by linking a rotary encoder to the end part of the bar. The values of 1 RM (BP) and 1 RM (HS) were 91 +/- 17 and 200 +/- 20 kg, respectively. The number of repetitions performed for a given percentage of 1RM was significantly higher (p bench press performance. Average repetition velocity decreased at a greater rate in bench press than in parallel squat. The significant reductions observed in the average repetition velocity (expressed as a percentage of the average velocity achieved during the initial repetition) were observed at higher percentage of the total number of repetitions performed in parallel squat (48 - 69 %) than in bench press (34 - 40 %) actions. The major finding in this study was that, for a given muscle action (bench press or parallel squat), the pattern of reduction in the relative average velocity achieved during each repetition and the relative number of repetitions performed was the same for all percentages of 1RM tested. However, relative average velocity decreased at a greater rate in bench press than in parallel squat performance. This would indicate that in bench press the significant reductions observed in the average repetition velocity occurred when the number of repetitions was over one third (34 %) of the total number of repetitions performed, whereas in parallel squat it was nearly one half (48 %). Conceptually, this would indicate that for a given exercise (bench press or squat) and

  7. A comparison of single and multiple aliquot TT-OSL data sets for sand-sized quartz from the Arabian Peninsula

    International Nuclear Information System (INIS)

    Rosenberg, T.M.; Preusser, F.; Wintle, A.G.

    2011-01-01

    The quartz OSL signal from dune sands from Saudi Arabia and Oman start to saturate at doses of about 100 Gy. In order to try to date dune sands with greater expected doses, a previously published, single-aliquot, regenerative-dose protocol (SAR) for thermally-transferred optically stimulated luminescence (TT-OSL) was tested. Dose recovery tests, recycling and recuperation ratios showed robust functioning and dose response curves demonstrated the potential to extend the dose range to beyond 600 Gy. Multiple aliquot additive dose (MAAD) TT-OSL protocols were used to test for sensitivity changes in the SAR TT-OSL protocol up to doses of 1200 Gy. A strong dose dependent deviation of the SAR TT-OSL relative to the MAAD TT-OSL dose response is observed. Comparison of the TT-OSL and OSL sensitivity data obtained from the MAAD and SAR data sets shows a lack of proportionality between TT-OSL and OSL for the SAR data which will result in a problem when SAR dose response curves are constructed using many regeneration points with doses above 300 Gy.

  8. Systematic instruction of assistive technology for cognition (ATC) in an employment setting following acquired brain injury: A single case, experimental study.

    Science.gov (United States)

    Powell, Laurie E; Glang, Ann; Pinkelman, Sarah; Albin, Richard; Harwick, Robin; Ettel, Deborah; Wild, Michelle R

    2015-01-01

    Assistive technology for cognition (ATC) can be an effective means of compensating for cognitive impairments following acquired brain injury. Systematic instruction is an evidence-based approach to training a variety of skills and strategies, including the use of ATC. This study experimentally evaluated systematic instruction applied to assistive technology for cognition (ATC) in a vocational setting. The study used a single-case, multiple-probe design across behaviors design. The participant was a 50-year old female with cognitive impairments following an acquired brain injury (ABI). As a part-time employee, she was systematically instructed on how to operate and routinely use selected applications (apps) on her iPod Touch to support three work-related skills: (a) recording/recalling the details of work assignments, (b) recording/recalling work-related meetings and conversations, and (c) recording/performing multi-step technology tasks. The experimental intervention was systematic instruction applied to ATC. The dependent measures were: (a) the use of ATC at work as measured by an ATC routine task analysis; and (b) recall of work-related tasks and information. Treatment effects were replicated across the three work-related skills and were maintained up to one year following the completion of intensive training across behaviors with periodic review (booster sessions). Systematic instruction is a critical component to teaching the routine use of ATC to compensate for cognitive impairments following ABI.

  9. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  10. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  11. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  12. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  14. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  15. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  16. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  17. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  18. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  19. Development of a set of SSR markers for genetic polymorphism detection and interspecific hybrid jute breeding

    Directory of Open Access Journals (Sweden)

    Dipnarayan Saha

    2017-10-01

    Full Text Available Corchorus capsularis (white jute and C. olitorius (dark jute are the two principal cultivated species of jute that produce natural bast fiber of commercial importance. We have identified 4509 simple sequence repeat (SSR loci from 34,163 unigene sequences of C. capsularis to develop a non-redundant set of 2079 flanking primer pairs. Among the SSRs, trinucleotide repeats were most frequent (60% followed by dinucleotide repeats (37.6%. Annotation of the SSR-containing unigenes revealed their putative functions in various biological and molecular processes, including responses to biotic and abiotic signals. Eighteen expressed gene-derived SSR (eSSR markers were successfully mapped to the existing single-nucleotide polymorphism (SNP linkage map of jute, providing additional anchor points. Amplification of 72% of the 74 randomly selected primer pairs was successful in a panel of 24 jute accessions, comprising five and twelve accessions of C. capsularis and C. olitorius, respectively, and seven wild jute species. Forty-three primer pairs produced an average of 2.7 alleles and 58.1% polymorphism in a panel of 24 jute accessions. The mean PIC value was 0.34 but some markers showed PIC values higher than 0.5, suggesting that these markers can efficiently measure genetic diversity and serve for mapping of quantitative trait loci (QTLs in jute. A primer polymorphism survey with parents of a wide-hybridized population between a cultivated jute and its wild relative revealed their efficacy for interspecific hybrid identification. For ready accessibility of jute eSSR primers, we compiled all information in a user-friendly web database, JuteMarkerdb (http://jutemarkerdb.icar.gov.in/ for the first time in jute. This eSSR resource in jute is expected to be of use in characterization of germplasm, interspecific hybrid and variety identification, and marker-assisted breeding of superior-quality jute.

  20. The Optimal Timing of Stage 2 Palliation for Hypoplastic Left Heart Syndrome: An Analysis of the Pediatric Heart Network Single Ventricle Reconstruction Trial Public Data Set.

    Science.gov (United States)

    Meza, James M; Hickey, Edward J; Blackstone, Eugene H; Jaquiss, Robert D B; Anderson, Brett R; Williams, William G; Cai, Sally; Van Arsdell, Glen S; Karamlou, Tara; McCrindle, Brian W

    2017-10-31

    In infants requiring 3-stage single-ventricle palliation for hypoplastic left heart syndrome, attrition after the Norwood procedure remains significant. The effect of the timing of stage 2 palliation (S2P), a physician-modifiable factor, on long-term survival is not well understood. We hypothesized that an optimal interval between the Norwood and S2P that both minimizes pre-S2P attrition and maximizes post-S2P survival exists and is associated with individual patient characteristics. The National Institutes of Health/National Heart, Lung, and Blood Institute Pediatric Heart Network Single Ventricle Reconstruction Trial public data set was used. Transplant-free survival (TFS) was modeled from (1) Norwood to S2P and (2) S2P to 3 years by using parametric hazard analysis. Factors associated with death or heart transplantation were determined for each interval. To account for staged procedures, risk-adjusted, 3-year, post-Norwood TFS (the probability of TFS at 3 years given survival to S2P) was calculated using parametric conditional survival analysis. TFS from the Norwood to S2P was first predicted. TFS after S2P to 3 years was then predicted and adjusted for attrition before S2P by multiplying by the estimate of TFS to S2P. The optimal timing of S2P was determined by generating nomograms of risk-adjusted, 3-year, post-Norwood, TFS versus the interval from the Norwood to S2P. Of 547 included patients, 399 survived to S2P (73%). Of the survivors to S2P, 349 (87%) survived to 3-year follow-up. The median interval from the Norwood to S2P was 5.1 (interquartile range, 4.1-6.0) months. The risk-adjusted, 3-year, TFS was 68±7%. A Norwood-S2P interval of 3 to 6 months was associated with greatest 3-year TFS overall and in patients with few risk factors. In patients with multiple risk factors, TFS was severely compromised, regardless of the timing of S2P and most severely when S2P was performed early. No difference in the optimal timing of S2P existed when stratified by

  1. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  2. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  3. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  4. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  5. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  6. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  7. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  8. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro

    2012-11-01

    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  9. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  10. Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

    Science.gov (United States)

    Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

    2016-01-01

    Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

  11. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  12. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  13. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  14. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  15. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  17. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  18. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  20. Effects of music in advertising: Three experiments replicating single-exposure musical conditioning of consumer choice (Gorn, 1982) in an individual setting.

    NARCIS (Netherlands)

    Vermeulen, I.E.; Beukeboom, C.J.

    2016-01-01

    Can single pairing of background music with an advertised product condition choice behavior? Gorn's (1982) demonstration of this effect remains controversial given his unconventional conditioning procedure, unusual data analyses, probably confounded stimuli, and possible demand artifacts. We review

  1. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  2. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  3. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  4. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  5. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  6. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

    Science.gov (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

    2016-01-01

    Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

  7. The Influence of Function, Topography, and Setting on Noncontingent Reinforcement Effect Sizes for Reduction in Problem Behavior: A Meta-Analysis of Single-Case Experimental Design Data

    Science.gov (United States)

    Ritter, William A.; Barnard-Brak, Lucy; Richman, David M.; Grubb, Laura M.

    2018-01-01

    Richman et al. ("J Appl Behav Anal" 48:131-152, 2015) completed a meta-analytic analysis of single-case experimental design data on noncontingent reinforcement (NCR) for the treatment of problem behavior exhibited by individuals with developmental disabilities. Results showed that (1) NCR produced very large effect sizes for reduction in…

  8. Coeducational or Single-Sex Schools? A Review of the Literature. New Zealand Council for Educational Research, Set 76, Number 1 Item 9.

    Science.gov (United States)

    Irving, James

    This article is part of an informational kit for teachers published by the New Zealand Council for Educational Research. The focus of this article is on the advantages and disadvantages of co-educational and single-sex secondary schools as discussed in research efforts from England and New Zealand. (JLL)

  9. Toward Understanding the Role of Web 2.0 Technology in Self-Directed Learning and Job Performance in a Single Organizational Setting: A Qualitative Case Study

    Science.gov (United States)

    Caruso, Shirley J.

    2016-01-01

    This single instrumental qualitative case study explores and thickly describes job performance outcomes based upon the manner in which self-directed learning activities of a purposefully selected sample of 3 construction managers are conducted, mediated by the use of Web 2.0 technology. The data collected revealed that construction managers are…

  10. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  11. The Single and Combined Effects of Multiple Intensities of Behavior Modification and Methylphenidate for Children with Attention Deficit Hyperactivity Disorder in a Classroom Setting

    Science.gov (United States)

    Fabiano, Gregory A.; Pelham, William E., Jr.; Gnagy, Elizabeth M.; Burrows-MacLean, Lisa; Coles, Erika K.; Chacko, Anil; Wymbs, Brian T.; Walker, Kathryn S.; Arnold, Fran; Garefino, Allison; Keenan, Jenna K.; Onyango, Adia N.; Hoffman, Martin T.; Massetti, Greta M.; Robb, Jessica A.

    2007-01-01

    Currently behavior modification, stimulant medication, and combined treatments are supported as evidence-based interventions for attention deficit hyperactivity disorder in classroom settings. However, there has been little study of the relative effects of these two modalities and their combination in classrooms. Using a within-subject design, the…

  12. Coupled-Mode Theory derivation of the formal equivalence between a three-mode waveguide and a set of three mutually coupled single-mode waveguides

    Directory of Open Access Journals (Sweden)

    Boucher Yann G.

    2017-01-01

    Full Text Available The formal identification between a two-mode waveguide and a system of two mutually coupled single-mode waveguides stems from the symmetries of the evolution operator. When the gap tends to zero, the super-modes of the coupled system merge continuously into the modes of the multimode waveguide. For modelling purposes, it is very tempting to extend the analogy to three-mode waveguides (and beyond. But not without some precautions…

  13. A dark-field microscope for background-free detection of resonance fluorescence from single semiconductor quantum dots operating in a set-and-forget mode.

    Science.gov (United States)

    Kuhlmann, Andreas V; Houel, Julien; Brunner, Daniel; Ludwig, Arne; Reuter, Dirk; Wieck, Andreas D; Warburton, Richard J

    2013-07-01

    Optically active quantum dots, for instance self-assembled InGaAs quantum dots, are potentially excellent single photon sources. The fidelity of the single photons is much improved using resonant rather than non-resonant excitation. With resonant excitation, the challenge is to distinguish between resonance fluorescence and scattered laser light. We have met this challenge by creating a polarization-based dark-field microscope to measure the resonance fluorescence from a single quantum dot at low temperature. We achieve a suppression of the scattered laser exceeding a factor of 10(7) and background-free detection of resonance fluorescence. The same optical setup operates over the entire quantum dot emission range (920-980 nm) and also in high magnetic fields. The major development is the outstanding long-term stability: once the dark-field point has been established, the microscope operates for days without alignment. The mechanical and optical designs of the microscope are presented, as well as exemplary resonance fluorescence spectroscopy results on individual quantum dots to underline the microscope's excellent performance.

  14. A dark-field microscope for background-free detection of resonance fluorescence from single semiconductor quantum dots operating in a set-and-forget mode

    International Nuclear Information System (INIS)

    Kuhlmann, Andreas V.; Houel, Julien; Warburton, Richard J.; Brunner, Daniel; Ludwig, Arne; Reuter, Dirk; Wieck, Andreas D.

    2013-01-01

    Optically active quantum dots, for instance self-assembled InGaAs quantum dots, are potentially excellent single photon sources. The fidelity of the single photons is much improved using resonant rather than non-resonant excitation. With resonant excitation, the challenge is to distinguish between resonance fluorescence and scattered laser light. We have met this challenge by creating a polarization-based dark-field microscope to measure the resonance fluorescence from a single quantum dot at low temperature. We achieve a suppression of the scattered laser exceeding a factor of 10 7 and background-free detection of resonance fluorescence. The same optical setup operates over the entire quantum dot emission range (920–980 nm) and also in high magnetic fields. The major development is the outstanding long-term stability: once the dark-field point has been established, the microscope operates for days without alignment. The mechanical and optical designs of the microscope are presented, as well as exemplary resonance fluorescence spectroscopy results on individual quantum dots to underline the microscope's excellent performance

  15. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  16. Neighborhood-targeted and case-triggered use of a single dose of oral cholera vaccine in an urban setting: Feasibility and vaccine coverage.

    Science.gov (United States)

    Parker, Lucy A; Rumunu, John; Jamet, Christine; Kenyi, Yona; Lino, Richard Laku; Wamala, Joseph F; Mpairwe, Allan M; Muller, Vincent; Llosa, Augusto E; Uzzeni, Florent; Luquero, Francisco J; Ciglenecki, Iza; Azman, Andrew S

    2017-06-01

    In June 2015, a cholera outbreak was declared in Juba, South Sudan. In addition to standard outbreak control measures, oral cholera vaccine (OCV) was proposed. As sufficient doses to cover the at-risk population were unavailable, a campaign using half the standard dosing regimen (one-dose) targeted high-risk neighborhoods and groups including neighbors of suspected cases. Here we report the operational details of this first public health use of a single-dose regimen of OCV and illustrate the feasibility of conducting highly targeted vaccination campaigns in an urban area. Neighborhoods of the city were prioritized for vaccination based on cumulative attack rates, active transmission and local knowledge of known cholera risk factors. OCV was offered to all persons older than 12 months at 20 fixed sites and to select groups, including neighbors of cholera cases after the main campaign ('case-triggered' interventions), through mobile teams. Vaccination coverage was estimated by multi-stage surveys using spatial sampling techniques. 162,377 individuals received a single-dose of OCV in the targeted neighborhoods. In these neighborhoods vaccine coverage was 68.8% (95% Confidence Interval (CI), 64.0-73.7) and was highest among children ages 5-14 years (90.0%, 95% CI 85.7-94.3), with adult men being less likely to be vaccinated than adult women (Relative Risk 0.81, 95% CI: 0.68-0.96). In the case-triggered interventions, each lasting 1-2 days, coverage varied (range: 30-87%) with an average of 51.0% (95% CI 41.7-60.3). Vaccine supply constraints and the complex realities where cholera outbreaks occur may warrant the use of flexible alternative vaccination strategies, including highly-targeted vaccination campaigns and single-dose regimens. We showed that such campaigns are feasible. Additional work is needed to understand how and when to use different strategies to best protect populations against epidemic cholera.

  17. Near infra-red spectroscopy quantitative modelling of bivalve protein, lipid and glycogen composition using single-species versus multi-species calibration and validation sets

    Science.gov (United States)

    Bartlett, Jill K.; Maher, William A.; Purss, Matthew B. J.

    2018-03-01

    Near infrared spectroscopy (NIRS) quantitative modelling was used to measure the protein, lipid and glycogen composition of five marine bivalve species (Saccostrea glomerata, Ostrea angasi, Crassostrea gigas, Mytilus galloprovincialis and Anadara trapezia) from multiple locations and seasons. Predictive models were produced for each component using individual species and aggregated sample populations for the three oyster species (S. glomerata, O. angasi and C. gigas) and for all five bivalve species. Whole animal tissues were freeze dried, ground to > 20 μm and scanned by NIRS. Protein, lipid and glycogen composition were determined by traditional chemical analyses and calibration models developed to allow rapid NIRS-measurement of these components in the five bivalve species. Calibration modelling was performed using wavelet selection, genetic algorithms and partial least squares analysis. Model quality was assessed using RPIQ and RMESP. For protein composition, single species model results had RPIQ values between 2.4 and 3.5 and RMSEP between 8.6 and 18%, the three oyster model had an RPIQ of 2.6 and an RMSEP of 10.8% and the five bivalve species had an RPIQ of 3.6 and RMSEP of 8.7% respectively. For lipid composition, single species models achieved RPIQ values between 2.9 and 5.3 with RMSEP between 9.1 and 11.2%, the oyster model had an RPIQ of 3.6 and RMSEP of 6.8 and the five bivalve model had an RPIQ of 5.2 and RMSEP of 6.8% respectively. For glycogen composition, the single species models had RPIQs between 3.8 and 18.9 with RMSEP between 3.5 and 9.2%, the oyster model had an RPIQ of 5.5 and RMSEP of 7.1% and the five bivalve model had an RPIQ of 4 and RMSEP of 7.6% respectively. Comparison between individual species models and aggregated models for three oyster species and five bivalve species for each component indicate that aggregating data from like species produces high quality models with robust and reliable quantitative application. The benefit of

  18. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  19. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  20. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  1. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  2. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  3. An evaluation of a body image intervention in adolescent girls delivered in single-sex versus co-educational classroom settings.

    Science.gov (United States)

    Dunstan, Candice J; Paxton, Susan J; McLean, Siân A

    2017-04-01

    Body dissatisfaction is now recognized as having considerable negative impact on social, psychological, and physical health, particularly in adolescent girls. Consequently, we have developed a six-session co-educational body image intervention (Happy Being Me Co-educational) designed to reduce body dissatisfaction and its risk factors in Grade 7 girls. In addition to evaluating the program's efficacy, we aimed to identify whether girls would benefit equally when it was delivered as a universal intervention to a whole class including both boys and girls (co-educational delivery), or delivered as a selective intervention to girls only (single-sex delivery). Participants were 200 Grade 7 girls from five schools in Melbourne, Australia. Schools were randomly allocated to receive the intervention in single-sex classes (n=74), co-educational classes (n=73), or participate as a no-intervention control (n=53). Girls completed self-report assessments of body dissatisfaction, psychological (internalization of the thin ideal, appearance comparison, and self-esteem) and peer environment (weight-related teasing and appearance conversations) risk factors for body dissatisfaction, and dietary restraint, at baseline, post-intervention, and at 6-month follow-up. Significant improvements in body dissatisfaction and psychological risk factors were observed in the intervention group at post-intervention and these were maintained at follow-up for psychological risk factors. Importantly, no significant differences between universal and selective delivery were observed, suggesting that the intervention is appropriate for dissemination in both modes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Single-item measures for depression and anxiety: Validation of the Screening Tool for Psychological Distress in an inpatient cardiology setting.

    Science.gov (United States)

    Young, Quincy-Robyn; Nguyen, Michelle; Roth, Susan; Broadberry, Ann; Mackay, Martha H

    2015-12-01

    Depression and anxiety are common among patients with cardiovascular disease (CVD) and confer significant cardiac risk, contributing to CVD morbidity and mortality. Unfortunately, due to the lack of screening tools that address the specific needs of hospitalized patients, few cardiac inpatient programs offer routine screening for these forms of psychological distress, despite recommendations to do so. The purpose of this study was to validate single-item measures for depression and anxiety among cardiac inpatients. Consecutive inpatients were recruited from the cardiology and cardiac surgery step-down units at a university-affiliated, quaternary-care hospital. Subjects completed a questionnaire that included: (a) demographics, (b) single-item-measures for depression and anxiety (from the Screening Tool for Psychological Distress (STOP-D)), and (c) Hospital Anxiety and Depression Scale (HADS). One hundred and five participants were recruited with a wide variety of cardiac diagnoses, having a mean age of 66 years, and 28% were women. Both STOP-D items were highly correlated with their corresponding validated measures and demonstrated robust receiver-operator characteristic curves. Severity scores on both items correlated well with established severity cut-off scores on the corresponding subscales of the HADS. The STOP-D is a self-administered, self-report measure using two independent items that provide severity scores for depression and anxiety. The tool performs very well compared with other previously validated measures. Requiring no additional scoring and being free, STOP-D offers a simple and valid method for identifying hospitalized cardiac patients who are experiencing psychological distress. This crucial first step triggers initiation of appropriate monitoring and intervention, thus reducing the likelihood of the adverse cardiac outcomes associated with psychological distress. © The European Society of Cardiology 2014.

  5. Effect of using a laryngeal tube on the no-flow time in a simulated, single-rescuer, basic life support setting with inexperienced users.

    Science.gov (United States)

    Meyer, O; Bucher, M; Schröder, J

    2016-03-01

    The laryngeal tube (LT) is a recommended alternative to endotracheal intubation during advanced life support (ALS). Its insertion is relatively simple; therefore, it may also serve as an alternative to bag mask ventilation (BMV) for untrained personnel performing basic life support (BLS). Data support the influence of LT on the no-flow time (NFT) compared with BMV during ALS in manikin studies. We performed a manikin study to investigate the effect of using the LT for ventilation instead of BMV on the NFT during BLS in a prospective, randomized, single-rescuer study. All 209 participants were trained in BMV, but were inexperienced in using LT; each participant performed BLS during a 4-min time period. No significant difference in total NFT (LT: mean 81.1 ± 22.7 s; BMV: mean 83.2 ± 13.1 s, p = 0.414) was found; however, significant differences in the later periods of the scenario were identified. While ventilating with the LT, the proportion of chest compressions increased significantly from 67.2 to 73.2%, whereas the proportion of chest compressions increased only marginally when performing BMV. The quality of the chest compressions and the associated ventilation rate did not differ significantly. The mean tidal volume and mean minute volume were significantly lower when performing BMV. The NFT was significantly shorter in the later periods in a single-rescuer, cardiac arrest scenario when using an LT without previous training compared with BMV with previous training. A possible explanation for this result may be the complexity and workload of alternating tasks (e.g., time loss when reclining the head and positioning the mask for each ventilation during BMV).

  6. A segmentation and classification scheme for single tooth in MicroCT images based on 3D level set and k-means+.

    Science.gov (United States)

    Wang, Liansheng; Li, Shusheng; Chen, Rongzhen; Liu, Sze-Yu; Chen, Jyh-Cheng

    2017-04-01

    Accurate classification of different anatomical structures of teeth from medical images provides crucial information for the stress analysis in dentistry. Usually, the anatomical structures of teeth are manually labeled by experienced clinical doctors, which is time consuming. However, automatic segmentation and classification is a challenging task because the anatomical structures and surroundings of the tooth in medical images are rather complex. Therefore, in this paper, we propose an effective framework which is designed to segment the tooth with a Selective Binary and Gaussian Filtering Regularized Level Set (GFRLS) method improved by fully utilizing 3 dimensional (3D) information, and classify the tooth by employing unsupervised learning i.e., k-means++ method. In order to evaluate the proposed method, the experiments are conducted on the sufficient and extensive datasets of mandibular molars. The experimental results show that our method can achieve higher accuracy and robustness compared to other three clustering methods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  8. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  9. The emergence of consensus: a primer

    Science.gov (United States)

    Baronchelli, Andrea

    2018-02-01

    The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges `spontaneously' in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems.

  10. A mathematical primer on quantum mechanics

    CERN Document Server

    Teta, Alessandro

    2018-01-01

    This book offers a rigorous yet elementary approach to quantum mechanics that will meet the needs of Master’s-level Mathematics students and is equally suitable for Physics students who are interested in gaining a deeper understanding of the mathematical structure of the theory. Throughout the coverage, which is limited to single-particle quantum mechanics, the focus is on formulating theory and developing applications in a mathematically precise manner. Following a review of selected key concepts in classical physics and the historical background, the basic elements of the theory of operators in Hilbert spaces are presented and used to formulate the rules of quantum mechanics. The discussion then turns to free particles, harmonic oscillators, delta potential, and hydrogen atoms, providing rigorous proofs of the corresponding dynamical properties. Starting from an analysis of these applications, readers are subsequently introduced to more advanced topics such as the classical limit, scattering theory, and s...

  11. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  12. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  13. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  14. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  15. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  16. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  17. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  18. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  19. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  20. Macroecology: A Primer for Biological Oceanography

    Science.gov (United States)

    Li, W. K. W.

    2016-02-01

    Macroecology is the study of ecological patterns discerned at a spatial, temporal, or organization scale higher than that at which the focal entities interact. Such patterns are statistical or emergent manifestations arising from the ensemble of component entities. Although macroecology is a neologism largely based in terrestrial and avian ecology, macroscopic patterns have long been recognised in biological oceanography. Familiar examples include Redfield elemental stoichiometry, Elton trophic pyramids, Sheldon biomass spectrum, and Margalef life-forms mandala. Macroecological regularities can often be found along various continua, such as along body size in power-law scaling or along habitat temperature in metabolic theory. Uniquely in oceanography, a partition of the world ocean continuum into Longhurst biogeochemical provinces provides a spatial organization well-suited for macroecological investigations. In this rational discrete approach, fundamental processes in physical and biological oceanography that differentiate a set of non-overlapping ocean regions also appear to shape the macroecological structure of phytoplankton communities.

  1. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2014-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  2. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2016-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  3. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eve J.; Chiang, Eugene, E-mail: evelee@berkeley.edu, E-mail: echiang@astro.berkeley.edu [Department of Astronomy, University of California Berkeley, Berkeley, CA 94720-3411 (United States)

    2016-08-20

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  4. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    International Nuclear Information System (INIS)

    Lee, Eve J.; Chiang, Eugene

    2016-01-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  5. A Primer on Unifying Debris Disk Morphologies

    Science.gov (United States)

    Lee, Eve J.; Chiang, Eugene

    2016-08-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  6. In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin

    Directory of Open Access Journals (Sweden)

    Reena Vora

    2012-01-01

    Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.

  7. Effect of a whitening agent application on enamel bond strength of self-etching primer systems.

    Science.gov (United States)

    Miyazaki, Masashi; Sato, Hikaru; Sato, Tomomi; Moore, B Keith; Platt, Jeffrey A

    2004-06-01

    Though reduction in bond strength after tooth whitening has been reported, little is known about it's effect on enamel bond strength of two-step bonding systems that exclude phosphoric acid etching prior to bonding agent application. The purpose of this study was to determine the effect of whitening procedure using an in-office whitening agent on enamel bond strength of self-etching primer systems. Three self-etching primer systems, Imperva Fluoro Bond, Mac Bond II, Clearfil SE Bond, and a one-bottle adhesive system Single Bond as a control material, were used. Bovine mandibular incisors were mounted in self-curing resin and the facial enamel or dentin surfaces were ground wet on 600-grit SiC paper. An in-office whitening agent, Hi-Lite was applied on the tooth surface according to the manufacturer's instruction. Bonding procedures were done soon after rinsing off the whitening agent or after 24 hours storage in distilled water. Specimens without whitening procedure were prepared as controls. Fifteen specimens per test group were stored in 37 degrees C distilled water for 24 hours, then shear tested at a crosshead speed of 1.0 mm/minute. One-way ANOVA followed by Duncan multiple range test were used for statistical analysis of the results. For the specimens made soon after rinsing off the whitening agent, a significant decrease in enamel bond strength was observed for all the bonding systems used. For the specimens made after 24 hours storage in water, a small decrease in enamel bond strength was observed and no significant differences were found compared to those of controls (without whitening). From the results of this study, enamel bond strengths of the self-etching primer systems might be affected to a lesser degree after rinsing with water followed by 24 hours storage in water.

  8. Online social networking: a primer for radiology.

    Science.gov (United States)

    Prasanna, Prasanth M; Seagull, F Jacob; Nagy, Paul

    2011-10-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-communication is effective? What are the potential benefits and pitfalls of this form of communication? Physicians are exploring how social networking might provide a forum for interacting with their patients, and advance collaborative patient care. Several organizations and institutions have set forth policies to address these questions and more. Though still in its infancy, this form of media has the power to revolutionize the way physicians interact with their patients and fellow health care workers. In the end, physicians must ask what value is added by engaging patients or other health care providers in a social networking format. Social networks may flourish in health care as a means of distributing information to patients or serve mainly as support groups among patients. Physicians must tread a narrow path to bring value to interactions in these networks while limiting their exposure to unwanted liability.

  9. Single, community-based blood glucose readings may be a viable alternative for community surveillance of HbA1c and poor glycaemic control in people with known diabetes in resource-poor settings

    Directory of Open Access Journals (Sweden)

    Daniel D. Reidpath

    2016-08-01

    Full Text Available Background: The term HbA1c (glycated haemoglobin is commonly used in relation to diabetes mellitus. The measure gives an indication of the average blood sugar levels over a period of weeks or months prior to testing. For most low- and middle-income countries HbA1c measurement in community surveillance is prohibitively expensive. A question arises about the possibility of using a single blood glucose measure for estimating HbA1c and therefore identifying poor glycaemic control in resource-poor settings. Design: Using data from the 2011–2012 US National Health and Nutrition Examination Surveys, we examined the relationship between HbA1c and a single fasting measure of blood glucose in a non-clinical population of people with known diabetes (n=333. A linear equation for estimating HbA1c from blood glucose was developed. Appropriate blood glucose cut-off values were set for poor glycaemic control (HbA1c≥69.4 mmol/mol. Results: The HbA1c and blood glucose measures were well correlated (r=0.7. Three blood glucose cut-off values were considered for classifying poor glycaemic control: 8.0, 8.9, and 11.4 mmol/L. A blood glucose of 11.4 had a specificity of 1, but poor sensitivity (0.37; 8.9 had high specificity (0.94 and moderate sensitivity (0.7; 8.0 was associated with good specificity (0.81 and sensitivity (0.75. Conclusions: Where HbA1c measurement is too expensive for community surveillance, a single blood glucose measure may be a reasonable alternative. Generalising the specific results from these US data to low resource settings may not be appropriate, but the general approach is worthy of further investigation.

  10. A U.S. Biodefense Strategy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, D

    2009-05-11

    The anthrax mailings that followed the attacks of September 11, 2001 highlighted the need for a comprehensive national strategy to prevent, prepare for, respond to, and mitigate the effects of biological attacks. The goal of U.S. biodefense strategy is to reduce the likelihood of a future biological event, improve overall U.S. public health security, and minimize the economic and social disruption of a biological incident. Presidential communications, federal legislation, and executive agency planning documents provide the foundation for this strategy. Central to current U.S. biodefense strategy is the 2004 Homeland Security Presidential Directive (HSPD) 10, Biodefense for the 21st Century, which states that ''the United States will use all means necessary to prevent, protect against, and mitigate biological weapons attacks perpetrated against our homeland and our global interests.'' HSPD-10 also sets forth four pillars of U.S. biodefense: {sm_bullet} Threat awareness includes timely, accurate, and relevant intelligence, threat assessment, and the anticipation of future threats. {sm_bullet} Prevention and protection involve continuing and expanding efforts to limit access to agents, technologies, and knowledge to certain groups and countries as well as protecting critical infrastructure from the effects of biological attacks. {sm_bullet} Surveillance and detection provide early warning or recognition of biological attacks to permit a timely response and mitigation of consequences as well as attribution. {sm_bullet} Response and recovery include pre-attack planning and preparedness, capabilities to treat casualties, risk communications, physical control measures, medical countermeasures, and decontamination capabilities.

  11. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  12. The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

    Science.gov (United States)

    Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

    2018-01-01

    We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

  13. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  14. Development and bin mapping of a Rosaceae Conserved Ortholog Set (COS) of markers.

    Science.gov (United States)

    Cabrera, Antonio; Kozik, Alex; Howad, Werner; Arus, Pere; Iezzoni, Amy F; van der Knaap, Esther

    2009-11-29

    Detailed comparative genome analyses within the economically important Rosaceae family have not been conducted. This is largely due to the lack of conserved gene-based molecular markers that are transferable among the important crop genera within the family [e.g. Malus (apple), Fragaria (strawberry), and Prunus (peach, cherry, apricot and almond)]. The lack of molecular markers and comparative whole genome sequence analysis for this family severely hampers crop improvement efforts as well as QTL confirmation and validation studies. We identified a set of 3,818 rosaceaous unigenes comprised of two or more ESTs that correspond to single copy Arabidopsis genes. From this Rosaceae Conserved Orthologous Set (RosCOS), 1039 were selected from which 857 were used for the development of intron-flanking primers and allele amplification. This led to successful amplification and subsequent mapping of 613 RosCOS onto the Prunus TxE reference map resulting in a genome-wide coverage of 0.67 to 1.06 gene-based markers per cM per linkage group. Furthermore, the RosCOS primers showed amplification success rates from 23 to 100% across the family indicating that a substantial part of the RosCOS primers can be directly employed in other less studied rosaceaous crops. Comparisons of the genetic map positions of the RosCOS with the physical locations of the orthologs in the Populus trichocarpa genome identified regions of colinearity between the genomes of Prunus-Rosaceae and Populus-Salicaceae. Conserved orthologous genes are extremely useful for the analysis of genome evolution among closely and distantly related species. The results presented in this study demonstrate the considerable potential of the mapped Prunus RosCOS for genome-wide marker employment and comparative whole genome studies within the Rosaceae family. Moreover, these markers will also function as useful anchor points for the genome sequencing efforts currently ongoing in this family as well as for comparative QTL

  15. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  16. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  17. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  18. Counting SET-free sets

    OpenAIRE

    Harman, Nate

    2016-01-01

    We consider the following counting problem related to the card game SET: How many $k$-element SET-free sets are there in an $n$-dimensional SET deck? Through a series of algebraic reformulations and reinterpretations, we show the answer to this question satisfies two polynomiality conditions.

  19. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  20. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  2. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  3. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  4. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  5. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  7. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  8. t-PA power-pulse spray with rheolytic mechanical thrombectomy using cross-sectional image-guided portal vein access for single setting treatment of subacute superior mesenteric vein thrombosis.

    Science.gov (United States)

    Syed, Mubin I; Gallagher, Ryan M; Ahmed, Rukan S; Shaikh, Azim; Roberto, Edward; Patel, Sumeet

    2018-01-01

    Isolated superior mesenteric vein (SMV) thrombosis is a rare but potentially fatal condition if untreated. Current treatments include transjugular or transhepatic approaches for rheolytic mechanical thrombectomy and subsequent infusions of thrombolytics. Tissue plasminogen activator (t-PA) power-pulse spray can provide benefit in a single setting without thrombolytic infusions. Computed tomography (CT) guidance for portal vein access is underutilized in this setting. Case 1 discusses acute SMV thrombosis treated with rheolytic mechanical thrombectomy alone using ultrasound guidance for portal vein access. Case 2 discusses subacute SMV thrombosis treated with the addition of t-PA power-pulse spray to the rheolytic mechanical thrombectomy, using CT guidance for portal vein access. With rheolytic mechanical thrombectomy alone, the patient in Case 1 had significant improvement in abdominal pain. Follow-up CT demonstrated no residual SMV thrombosis and the patient continued to do well in long-term follow-up. With the addition of t-PA power-pulse spray to rheolytic mechanical thrombectomy, the patient in Case 2 with subacute SMV thrombosis dramatically improved postprocedure with resolution of abdominal pain. Follow-up imaging demonstrated patency to the SMV and partial resolution of thrombus. The patient continued to do well at 2-year follow-up. Adding t-PA power-pulse spray to rheolytic mechanical thrombectomy can provide benefit in a single setting versus mechanical thrombectomy alone and prevent the need for subsequent infusions of thrombolytic therapy. CT guidance is a useful alternative of localization for portal vein access via the transhepatic route that is nonoperator-dependent and helpful in the case of obese patients.

  9. t-PA power-pulse spray with rheolytic mechanical thrombectomy using cross-sectional image-guided portal vein access for single setting treatment of subacute superior mesenteric vein thrombosis

    Directory of Open Access Journals (Sweden)

    Mubin I Syed

    2018-01-01

    Full Text Available Background: Isolated superior mesenteric vein (SMV thrombosis is a rare but potentially fatal condition if untreated. Current treatments include transjugular or transhepatic approaches for rheolytic mechanical thrombectomy and subsequent infusions of thrombolytics. Tissue plasminogen activator (t-PA power-pulse spray can provide benefit in a single setting without thrombolytic infusions. Computed tomography (CT guidance for portal vein access is underutilized in this setting. Materials and Methods: Case 1 discusses acute SMV thrombosis treated with rheolytic mechanical thrombectomy alone using ultrasound guidance for portal vein access. Case 2 discusses subacute SMV thrombosis treated with the addition of t-PA power-pulse spray to the rheolytic mechanical thrombectomy, using CT guidance for portal vein access. Results: With rheolytic mechanical thrombectomy alone, the patient in Case 1 had significant improvement in abdominal pain. Follow-up CT demonstrated no residual SMV thrombosis and the patient continued to do well in long-term follow-up. With the addition of t-PA power-pulse spray to rheolytic mechanical thrombectomy, the patient in Case 2 with subacute SMV thrombosis dramatically improved postprocedure with resolution of abdominal pain. Follow-up imaging demonstrated patency to the SMV and partial resolution of thrombus. The patient continued to do well at 2-year follow-up. Conclusions: Adding t-PA power-pulse spray to rheolytic mechanical thrombectomy can provide benefit in a single setting versus mechanical thrombectomy alone and prevent the need for subsequent infusions of thrombolytic therapy. CT guidance is a useful alternative of localization for portal vein access via the transhepatic route that is nonoperator-dependent and helpful in the case of obese patients.

  10. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  11. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  12. Comparative evaluation of self-etching primers and phosphoric acid effectiveness on composite to enamel bond: an in vitro study.

    Science.gov (United States)

    Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay

    2013-09-01

    The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.

  13. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  14. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  15. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  16. STRP Screening Sets for the human genome at 5 cM density

    Directory of Open Access Journals (Sweden)

    Marth Gabor

    2003-02-01

    Full Text Available Abstract Background Short tandem repeat polymorphisms (STRPs are powerful tools for gene mapping and other applications. A STRP genome scan of 10 cM is usually adequate for mapping single gene disorders. However mapping studies involving genetically complex disorders and especially association (linkage disequilibrium often require higher STRP density. Results We report the development of two separate 10 cM human STRP Screening Sets (Sets 12 and 52 which span all chromosomes. When combined, the two Sets contain a total of 782 STRPs, with average STRP spacing of 4.8 cM, average heterozygosity of 0.72, and total sex-average coverage of 3535 cM. The current Sets are comprised almost entirely of STRPs based on tri- and tetranucleotide repeats. We also report correction of primer sequences for many STRPs used in previous Screening Sets. Detailed information for the new Screening Sets is available from our web site: http://research.marshfieldclinic.org/genetics. Conclusion Our new human STRP Screening Sets will improve the quality and cost effectiveness of genotyping for gene mapping and other applications.

  17. Automatic sets and Delone sets

    International Nuclear Information System (INIS)

    Barbe, A; Haeseler, F von

    2004-01-01

    Automatic sets D part of Z m are characterized by having a finite number of decimations. They are equivalently generated by fixed points of certain substitution systems, or by certain finite automata. As examples, two-dimensional versions of the Thue-Morse, Baum-Sweet, Rudin-Shapiro and paperfolding sequences are presented. We give a necessary and sufficient condition for an automatic set D part of Z m to be a Delone set in R m . The result is then extended to automatic sets that are defined as fixed points of certain substitutions. The morphology of automatic sets is discussed by means of examples

  18. Biocompatibility of RealSeal, its primer and AH Plus implanted in subcutaneous connective tissue of rats

    Directory of Open Access Journals (Sweden)

    Fabiana Soares Grecca

    2011-02-01

    Full Text Available OBJECTIVE: This study tested rat connective tissue response to RealSeal, RealSeal primer or AH Plus after 7, 15, 30, 60 and 90 days of implantation. MATERIAL AND METHODS: Thirty Wistar rats had subcutaneous sockets created on their back and received four implants each of polyethylene tubes containing one of the materials tested according to the groups: AH (AH Plus Sealer; RS (RealSeal Sealer; RP (RealSeal Primer; CG (control group - empty tube. After histological processing, sections were analyzed to identify the presence of neutrophils, lymphocytes and plasma cells, eosinophils, macrophages and giant cells, as well as fibrous capsule and abscesses, by an examiner using light microscope. Kruskal-Wallis and multiple-comparisons test were used for statistical analysis. Significance level was set at 5%. RESULTS: Lymphoplasmacytic infiltrate scores significantly higher than those of the control group were observed at 14 and 60 days in AH group, and at 90 days in RS group (p<0.05. There were no differences in terms of presence of macrophages, giant cells, eosinophils, neutrophils or fibrosis. AH Plus group scored higher for abscesses at 7 days than after any other period (p=0.031. RP group scored higher for lymphoplasmacytic infiltrate at 14 days than at 90 days (p=0.04. CONCLUSION: The main contribution of this study was to demonstrate that issues involved with tissue tolerance of a Resilon-containing sealer, RealSeal Sealer, cannot be attributed to its primer content.

  19. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)

    Badar‑uz‑Zaman

    2012-08-01

    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.

  20. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Directory of Open Access Journals (Sweden)

    Roberts WE

    2015-09-01

    Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance

  1. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  2. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  3. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  4. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  5. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  6. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  7. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  8. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  9. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  10. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    Science.gov (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  11. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  12. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  13. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per

    2012-01-01

    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  14. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  15. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  16. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  17. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  19. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  20. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  1. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  2. Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

    Science.gov (United States)

    Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

    2017-08-16

    Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and

  3. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  4. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  5. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  6. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  7. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  8. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  9. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  10. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  11. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  12. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  13. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  14. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  15. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  16. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  17. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  18. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  19. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  20. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  1. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  2. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  3. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  4. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  5. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  6. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  7. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  8. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  9. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  10. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  11. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  12. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  13. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  14. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  15. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  16. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  17. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  18. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  19. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  20. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  1. Development and bin mapping of a Rosaceae Conserved Ortholog Set (COS of markers

    Directory of Open Access Journals (Sweden)

    Kozik Alex

    2009-01-01

    Full Text Available Abstract Background Detailed comparative genome analyses within the economically important Rosaceae family have not been conducted. This is largely due to the lack of conserved gene-based molecular markers that are transferable among the important crop genera within the family [e.g. Malus (apple, Fragaria (strawberry, and Prunus (peach, cherry, apricot and almond]. The lack of molecular markers and comparative whole genome sequence analysis for this family severely hampers crop improvement efforts as well as QTL confirmation and validation studies. Results We identified a set of 3,818 rosaceaous unigenes comprised of two or more ESTs that correspond to single copy Arabidopsis genes. From this Rosaceae Conserved Orthologous Set (RosCOS, 1039 were selected from which 857 were used for the development of intron-flanking primers and allele amplification. This led to successful amplification and subsequent mapping of 613 RosCOS onto the Prunus TxE reference map resulting in a genome-wide coverage of 0.67 to 1.06 gene-based markers per cM per linkage group. Furthermore, the RosCOS primers showed amplification success rates from 23 to 100% across the family indicating that a substantial part of the RosCOS primers can be directly employed in other less studied rosaceaous crops. Comparisons of the genetic map positions of the RosCOS with the physical locations of the orthologs in the Populus trichocarpa genome identified regions of colinearity between the genomes of Prunus-Rosaceae and Populus-Salicaceae. Conclusion Conserved orthologous genes are extremely useful for the analysis of genome evolution among closely and distantly related species. The results presented in this study demonstrate the considerable potential of the mapped Prunus RosCOS for genome-wide marker employment and comparative whole genome studies within the Rosaceae family. Moreover, these markers will also function as useful anchor points for the genome sequencing efforts currently

  2. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  3. NASA and ESA Collaboration on Hexavalent Chrome Alternatives - Pretreatments with Primers Screening Final Test Report

    Science.gov (United States)

    Rothgeb, Matthew J.; Kessel, Kurt R.

    2015-01-01

    Hexavalent chromium (hex chrome or Cr(VI)) is a widely used element within applied coating systems because of its self-healing and corrosion-resistant properties. The replacement of hex chrome in the processing of aluminum for aviation and aerospace applications remains a goal of great significance. Aluminum is the major manufacturing material of structures and components in the space flight arena. The National Aeronautics and Space Administration (NASA) and the European Space Agency (ESA) are engaged in a collaborative effort to test and evaluate alternatives to hexavalent chromium containing corrosion coating systems. NASA and ESA share common risks related to material obsolescence associated with hexavalent chromium used in corrosion-resistant coatings. In the United States, Occupational Safety and Health Administration (OSHA) studies have concluded that hexavalent chromium is carcinogenic and poses significant risk to human health. On May 5, 2011, amendments to the Defense Federal Acquisition Regulation Supplement (DFARS) were issued in the Federal Register. Subpart 223.73 prohibits contracts from requiring hexavalent chromium in deliverables unless certain exceptions apply. Subpart 252.223-7008 provides the contract clause prohibiting contractors and subcontractors from using or delivering hexavalent chromium in a concentration greater than 0.1 percent by weight for all new contracts associated with supplies, maintenance and repair services, and construction materials. ESA faces its own increasingly stringent regulations within European directives such as Registration, Evaluation, Authorization and Restriction of Chemical (REACH) substances and the Restriction of Hazardous Substances Directive (RoHS) which have set a mid-2017 sunset date for hexavalent chromium. NASA and ESA continue to search for an alternative to hexavalent chromium in coatings applications that meet their performance requirements in corrosion protection, cost, operability, and health and

  4. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  5. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  6. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  7. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  8. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  9. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  10. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  11. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  12. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  13. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  14. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  15. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  16. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  17. Primers for Low-Copy Nuclear Genes in the Hawaiian Endemic Clermontia (Campanulaceae and Cross-Amplification in Lobelioideae

    Directory of Open Access Journals (Sweden)

    Yohan Pillon

    2013-06-01

    Full Text Available Premise of the study: Primers were developed to amplify 12 intron-less, low-copy nuclear genes in the Hawaiian genus Clermontia (Campanulaceae, a suspected tetraploid. Methods and Results: Data from a pooled 454 titanium run of the partial transcriptomes of seven Clermontia species were used to identify the loci of interest. Most loci were amplified and sequenced directly with success in a representative selection of lobeliads even though several of these loci turned out to be duplicated. Levels of variation were comparable to those observed in commonly used plastid and ribosomal markers. Conclusions: We found evidence of a genome duplication that likely predates the diversification of the Hawaiian lobeliads. Some genes nevertheless appear to be single-copy and should be useful for phylogenetic studies of Clermontia or the entire Lobelioideae subfamily.

  18. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  19. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  20. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  1. A comparative clinical study of the failure rate of orthodontic brackets bonded with two adhesive systems: conventional and self-etching primer (SEP).

    Science.gov (United States)

    Dominguez, Gladys Cristina; Tortamano, André; Lopes, Luiz Vicente de Moura; Catharino, Priscilla Campanatti Chibebe; Morea, Camillo

    2013-01-01

    This study compared the clinical performance of orthodontic brackets bonded with Transbond adhesive paste after two primer systems: a two-stage conventional system (acid etching + Transbond XT adhesive primer) and a single-stage self-etching primer (SEP) (Transbond Plus). The sample comprised 480 metal brackets bonded to the teeth of 24 consecutive patients treated for 36 to 48 months. A split-mouth design was used for bonding, and both systems were used in each patient. Bracket failure rates for each system were analyzed; and failure causes as reported by the patients and the quadrant of teeth for which brackets failed were recorded. The conventional system group had a failure rate of 5.41%, whereas the rate for SEP was 4.58%. In this group, there were 5 failures (38.4%) in the right maxillary quadrant, 2 (15.4%) in the left maxillary quadrant, 4 (30.8%) in the right mandibular quadrant, and 2 (15.4%) in the left mandibular quadrant. In the SEP group, there were 4 (36.4%) failures in the right maxillary quadrant, 1 (9%) in the left maxillary quadrant, 3 (27.3%) in the right mandibular quadrant, and 3 (27.3%) in the left mandibular quadrant. Results of descriptive statistical analysis and odds ratio did not show any significant differences between rates (p = 0.67). The clinical efficiency of SEP was similar to that of the conventional system.

  2. Enhanced performance feedback and patient participation to improve hand hygiene compliance of health-care workers in the setting of established multimodal promotion: a single-centre, cluster randomised controlled trial.

    Science.gov (United States)

    Stewardson, Andrew James; Sax, Hugo; Gayet-Ageron, Angèle; Touveneau, Sylvie; Longtin, Yves; Zingg, Walter; Pittet, Didier

    2016-12-01

    Hand hygiene compliance of health-care workers remains suboptimal despite standard multimodal promotion, and evidence for the effectiveness of novel interventions is urgently needed. We aimed to assess the effect of enhanced performance feedback and patient participation on hand hygiene compliance in the setting of multimodal promotion. We did a single-centre, cluster randomised controlled trial at University of Geneva Hospitals (Geneva, Switzerland). All wards hosting adult, lucid patients, and all health-care workers and patients in these wards, were eligible. After a 15-month baseline period, eligible wards were assigned by computer-generated block randomisation (1:1:1), stratified by the type of ward, to one of three groups: control, enhanced performance feedback, or enhanced performance feedback plus patient participation. Standard multimodal hand hygiene promotion was done hospital-wide throughout the study. The primary outcome was hand hygiene compliance of health-care workers (according to the WHO Five Moments of Hand Hygiene) at the opportunity level, measured by direct observation (20-min sessions) by 12 validated infection control nurses, with each ward audited at least once every 3 months. This trial is registered with ISRCTN, number ISRCTN43599478. We randomly assigned 67 wards to the control group (n=21), enhanced performance feedback (n=24), or enhanced performance feedback plus patient participation (n=22) on May 19, 2010. One ward in the control group became a high-dependency unit and was excluded from analysis. During 1367 observation sessions, 12 579 hand hygiene opportunities were recorded. Between the baseline period (April 1, 2009, to June 30, 2010) and the intervention period (July 1, 2010, to June 30, 2012), mean hand hygiene compliance increased from 66% (95% CI 62-70) to 73% (70-77) in the control group (odds ratio [OR] 1·41, 95% CI 1·21-1·63), from 65% (62-69) to 75% (72-77) in the enhanced performance feedback group (1·61, 1·41-1

  3. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  4. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

  5. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    Science.gov (United States)

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  6. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    Science.gov (United States)

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  8. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  9. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  10. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  11. Difference sets connecting algebra, combinatorics, and geometry

    CERN Document Server

    Moore, Emily H

    2013-01-01

    Difference sets belong both to group theory and to combinatorics. Studying them requires tools from geometry, number theory, and representation theory. This book lays a foundation for these topics, including a primer on representations and characters of finite groups. It makes the research literature on difference sets accessible to students who have studied linear algebra and abstract algebra, and it prepares them to do their own research. This text is suitable for an undergraduate capstone course, since it illuminates the many links among topics that the students have already studied. To this end, almost every chapter ends with a coda highlighting the main ideas and emphasizing mathematical connections. This book can also be used for self-study by anyone interested in these connections and concrete examples. An abundance of exercises, varying from straightforward to challenging, invites the reader to solve puzzles, construct proofs, and investigate problems--by hand or on a computer. Hints and solutions are...

  12. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  13. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  14. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    individual policy activities. Subfunctions are assigned a numeric identifier (ending in a single digit ) related to the function to which they belong...operations, equipment repair, and maintenance of defense facilities, healthcare costs, and administration. 24% Military Personnel (MILPERS) Pay and

  15. Primer Control System Cyber Security Framework and Technical Metrics

    Energy Technology Data Exchange (ETDEWEB)

    Wayne F. Boyer; Miles A. McQueen

    2008-05-01

    The Department of Homeland Security National Cyber Security Division supported development of a control system cyber security framework and a set of technical metrics to aid owner-operators in tracking control systems security. The framework defines seven relevant cyber security dimensions and provides the foundation for thinking about control system security. Based on the developed security framework, a set of ten technical metrics are recommended that allow control systems owner-operators to track improvements or degradations in their individual control systems security posture.

  16. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  17. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  18. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  19. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  20. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  1. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  2. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  3. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    Science.gov (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  4. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  5. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  6. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  7. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  8. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  9. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  10. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  11. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  12. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  13. Ranking Specific Sets of Objects.

    Science.gov (United States)

    Maly, Jan; Woltran, Stefan

    2017-01-01

    Ranking sets of objects based on an order between the single elements has been thoroughly studied in the literature. In particular, it has been shown that it is in general impossible to find a total ranking - jointly satisfying properties as dominance and independence - on the whole power set of objects. However, in many applications certain elements from the entire power set might not be required and can be neglected in the ranking process. For instance, certain sets might be ruled out due to hard constraints or are not satisfying some background theory. In this paper, we treat the computational problem whether an order on a given subset of the power set of elements satisfying different variants of dominance and independence can be found, given a ranking on the elements. We show that this problem is tractable for partial rankings and NP-complete for total rankings.

  14. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  15. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  16. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Zhiyuan Wu

    2014-01-01

    Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

  17. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Science.gov (United States)

    Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

    2014-01-01

    A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

  18. Single particle dynamics

    International Nuclear Information System (INIS)

    Siemens, P.J.; Jensen, A.S.

    1985-01-01

    It is shown that the opening of the 3-quasiparticle continuum at 3Δ sets the energy scale for the enhancement of the effective mass near the Fermi surface of nuclei. The authors argue that the spreading width of single-particle states due to coupling with low-lying collective modes is qualitatively different from the two-body collision mechanism, and contributes little to the single-particle lifetime in the sense of the optical model. (orig.)

  19. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  20. iRODS Primer Integrated Rule-Oriented Data System

    CERN Document Server

    Rajasekar, Arcot

    2010-01-01

    Policy-based data management enables the creation of community-specific collections. Every collection is created for a purpose. The purpose defines the set of properties that will be associated with the collection. The properties are enforced by management policies that control the execution of procedures that are applied whenever data are ingested or accessed. The procedures generate state information that defines the outcome of enforcing the management policy. The state information can be queried to validate assessment criteria and verify that the required collection properties have been con