WorldWideScience

Sample records for single primer reaction

  1. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies

    Directory of Open Access Journals (Sweden)

    Edelheit Oded

    2009-06-01

    Full Text Available Abstract Background In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. Results In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95°C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC subunits. The method has been tested for 1–3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. Conclusion The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  2. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.

    Science.gov (United States)

    Edelheit, Oded; Hanukoglu, Aaron; Hanukoglu, Israel

    2009-06-30

    In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95 degrees C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC) subunits. The method has been tested for 1-3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  3. Single primer amplification reaction (SPAR) methods reveal subsequent increase in genetic variations in micropropagated plants of Nepenthes khasiana Hook. f. maintained for three consecutive regenerations.

    Science.gov (United States)

    Devi, Soibam Purnima; Kumaria, Suman; Rao, Satyawada Rama; Tandon, Pramod

    2014-03-15

    The genetic fidelity of in vitro-raised plants of three successive regenerations of Nepenthes khasiana Hook. f. was assessed using three different single primer amplification reaction (SPAR) methods, viz., random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR) and direct amplification of minisatellite DNA region (DAMD) markers. Out of 80 RAPD primers screened, 14 primers reflected a genetic variation of 4.1% in the first regeneration which was increased to 9.4% in the third regeneration. In the case of ISSR, out of 36 primers screened for assessment of genetic homogeneity of the regenerated plantlets, 12 primers showed an increase of genetic variation from 4.3% to 10% from the first to the third regenerations. In DAMD profiling, 15 primers were used for the evaluation of genetic fidelity where 8.47% of polymorphism was observed in the first regeneration which was increased to 13.33% in the third regeneration. The cumulative analysis reflected a genetic variation of 5.65% in the first regeneration which increased subsequently to 7.77% in the second regeneration and 10.87% in the third regeneration. The present study demonstrates SPAR technique to be an efficient tool for the assessment of clonal fidelity of in vitro-raised plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  5. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...

  6. Interactive Effects of Growth Regulators, Carbon Sources, pH on Plant Regeneration and Assessment of Genetic Fidelity Using Single Primer Amplification Reaction (SPARS) Techniques in Withania somnifera L.

    Science.gov (United States)

    Fatima, Nigar; Ahmad, Naseem; Ahmad, Iqbal; Anis, Mohammad

    2015-09-01

    An improved and methodical in vitro shoot morphogenic approach through axillary bud multiplication was established in a drug yielding plant, Withania somnifera L. Effects of plant growth regulators [6-benzyladenine (BA), kinetin (Kin), 2-isopentenyladenine (2iP), and thidiazuron (TDZ)] either singly or in combination with α-napthalene acetic acid (NAA), indole-3-butyric acid (IBA), and indole-3-acetic acid (IAA) in Murashige and Skoog (MS) medium were tested. The highest regeneration frequency (90 %) with optimum number of shoots (32 ± 0.00)/explant were obtained on MS medium fortified with 2.5 μM 6-benzyladenine (BA) and 0.5 μM NAA and 30 g/l sucrose at pH 5.8. Among the tried TDZ concentrations, 0.5 μM resulted in maximum number of shoots (20.4 ± 0.40)/explant after 4 weeks of exposure. The proliferating shoot cultures established by repeated subculturing of the mother explants on the hormone-free medium produced the highest shoot number (29.4 ± 0.40) with shoot length (6.80 ± 0.12 cm)/explant at fourth subculture passage, which a decline in shoot proliferation was recorded. Different concentrations of NAA were tested for ex vitro rooting of microshoots. The maximum percentage of rooting 100 % with maximum roots (18.3 ± 0.1) was achieved in soilrite when basal portion of the microshoots were treated with 200 μM (NAA) for 15 min per shoot. The plantlets went through hardening phase in a growth chamber, prior to ex vitro transfer. The PCR-based single primer amplification reaction (SPAR) methods which include random amplified polymorphic DNA (RAPD) and direct amplification of minisatellite DNA (DAMD) markers has been used for assessment of genetic stability of micropropagated plantlets. No variation was observed in DNA fingerprinting patterns among the micropropagated and the donor plants illustrating their genetic uniformity.

  7. Cloning flanking sequence by single-primer PCR in transgenic plants.

    Science.gov (United States)

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  8. An In Vitro Single-Primer Site-Directed Mutagenesis Method for Use in Biotechnology.

    Science.gov (United States)

    Huang, Yanchao; Zhang, Likui

    2017-01-01

    Site-directed mutagenesis is a powerful method to introduce mutation(s) into DNA sequences. A number of methods have been developed over the years with a main goal being to create a high number of mutant genes. The single-mutagenic primer method for site-directed mutagenesis is the most direct method that yields mutant genes in about 25-50 % of transformants in a robust, low-cost reaction. The supercompetent XL10-Gold bacteria used in the Stratagene protocol carry a phage, which may be a problem for some applications; however, in our single-mutagenic primer method the supercompetent bacteria are not needed. A thermostable DNA polymerase with high fidelity and processivity, such as Phusion DNA polymerase, is required for our optimized procedure to avoid extra mutation(s) and enhance mutagenic efficiency.

  9. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    Science.gov (United States)

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. A primer for electroweak induced low-energy nuclear reactions

    Indian Academy of Sciences (India)

    Corresponding author. E-mail: ... some of their electric energy to an electron so that the following reaction was kinematically allowed: ... tube disintegrate it generated electric fields strong enough to accelerate electrons and protons toward each other ...

  11. A primer for electroweak induced low-energy nuclear reactions

    Indian Academy of Sciences (India)

    Under special circumstances, electromagnetic and weak interactions can induce low-energy nuclear reactions to occur with observable rates for a variety of processes. A common element in all these applications is that the electromagnetic energy stored in many relatively slow-moving electrons can – under appropriate ...

  12. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  13. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  14. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  15. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  16. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  17. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  18. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  19. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  20. Detection of genital human papillomaviruses by polymerase chain reaction amplification with degenerate nested primers.

    Science.gov (United States)

    Williamson, A L; Rybicki, E P

    1991-03-01

    Degenerate oligonucleotide primers were designed for in vitro amplification by polymerase chain reaction (PCR) of a relatively well-conserved portion of the L1 capsid protein gene of genital human papillomaviruses. A specific 441bp fragment was amplified by PCR from genomic clones and clinical biopsy specimens containing DNA from HPV types 6, 11, 16, 18, 31, and 33, as well as from a number of other clinical specimens known to contain unclassified HPV isolates. As some HPV non-specific DNA was also often amplified, another set of degenerate primers was designed which amplified a 335 bp sequence contained within the 441 bp sequence. These nested primers could be used in a two-stage PCR reaction to obtain distinct HPV-specific DNA fragments suitable for direct sequencing. Two-stage PCR was used to demonstrate the presence of HPV DNA in 13 out of 16 biopsies, which had been classified histologically as cervical intraepithelial neoplasia (CIN), but which were negative for HPV on Southern blot hybridization. Seven of these amplification products were sequenced, and one proved to be a previously unsequenced HPV type. The results have important implications for the routine detection and typing of genital and other HPV types in clinical samples.

  1. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    Despite economic importance, the origin and domestication of mulberry has not ..... The numbers at the nodes in each tree are the bootstrap percent values (only values greater than or equal to 50 are shown) for the ..... Dandin S B 1998 Mulberry: A versatile biosource in the service of mankind; Acta Sericologica Sinica 24 ...

  2. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    ). Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the ...

  3. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  4. Primer system for single cell detection of double mutation for Tay-Sachs disease.

    Science.gov (United States)

    Liu, M C; Drury, K C; Kipersztok, S; Zheng, W; Williams, R S

    2000-02-01

    Nearly 100% of infantile Tay-Sachs disease is produced by two mutations occurring in the alpha chain of the lysosomal enzyme beta-N-acetylhexosaminidase (HEXA) in the Ashkenazi Jewish population. Although others have described primer systems used to amplify both sites simultaneously, few discuss the allele dropout problems inherent in this test. Our goal was to construct a more robust test enabling stronger signal generation for single cell preimplantation genetic diagnosis and to investigate the occurrence of allele dropout. New nested primers were designed to optimize detection of both major Tay-Sachs mutations. Four hundred fifty-seven single cells, including normal cells and those carrying mutations of either the 4bp insertion exon 11 or splice-site intron 12 defects, were used to screen a new primer system. Based on PCR amplified product analysis, total efficiency of amplification was 85.3%, (390/457). The allele dropout rate for the 4bp insertion mutation in exon 11 and splice-site mutation in intron 12 was 4.8% and 5.8%, respectively. Multiple mutation detection and analysis within the Tay-Sachs disease gene (HEXA) is possible using single cells for clinical preimplantation genetic diagnosis. Alternative PCR primers and conditions offer various methods for developing systems compatible to specific program requirements.

  5. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  6. Primer System for Single Cell Detection of Double Mutation for Tay-Sachs Disease

    OpenAIRE

    Liu, Ming Cheng; Drury, Kenneth C.; Kipersztok, Simon; Zheng, Wenrong; Williams, R. Stan

    2000-01-01

    Purpose: Nearly 100% of infantile Tay-Sachs disease isproduced by two mutations occurring in the alpha chain ofthe lysosomal enzyme beta-N-acetylhexosaminidase (HEXA)in the Ashkenazi Jewish population. Although others havedescribed primer systems used to amplify both sitessimultaneously, few discuss the allele dropout problems inherent inthis test. Our goal was to construct a more robust testenabling stronger signal generation for single cellpreimplantation genetic diagnosis and to investigat...

  7. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    of only deoxyribonucleotides (hereafter denoted standard primers). Biotin-labeled ddNTPs were used in the SBE reaction, and the SBE products were purified using the monomeric avidin triethylamine purification protocol, ensuring that only primers extended with a biotin-ddNTP in the 3'-end were isolated...

  8. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  9. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  10. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang

    2012-03-01

    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  11. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  12. Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.

    Science.gov (United States)

    Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe

    2018-04-19

    To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.

  13. Two consensus primer systems and nested polymerase chain reaction for human papillomavirus detection in cervical biopsies: A study of sensitivity.

    Science.gov (United States)

    Zehbe, I; Wilander, E

    1996-08-01

    Polymerase chain reaction (PCR) is being increasingly used in clinical laboratories for the diagnosis of human papillomavirus. From the L1 region, there are two commonly used consensus primer systems designated CP5+/G6+ and MY09/MY11. Both detect a wide variety of human papillomaviruses (HPVs). In this investigation, the authors compared the sensitivity of these approaches with the modification of hot-start PCR on 148 neutral-buffered formaldehyde-fixed cervical biopsies classified as cervical intraepithelial neoplasia (CIN) I to III. The authors chose hot-start PCR because in a previous study it proved more sensitive than cold-start PCR. Furthermore, the authors combined GP5+/GP6+ and MY09/MY11 in a two-step amplification (nested PCR) to analyze further those cases that proved negative with either GP5+/GP6+ or MY09/MY11. The authors found that the two consensus primer systems were equally sensitive with a correlation of 98%. By using GP5+/GP6+, the authors achieved an HPV positivity rate of 95% and with MY09/MY11 94%. Nested PCR did not improve HPV positivity in the CINs included in this study.

  14. Use of degenerate primers and heat-soaked polymerase chain reaction (PCR) to clone a serine protease antigen from Dermatophilus congolensis.

    Science.gov (United States)

    Mine, O M; Carnegie, P R

    1997-10-01

    Serine proteases are thought to be involved in the initial attack on sheep skin by Dermatophilus congolensis and are obvious antigens for inclusion in a vaccine to prevent lumpy wool disease (dermatophilosis). Degenerate primers were designed after alignment of seven bacterial serine proteases. Inosine was incorporated into the primers at positions of three- and four-base redundancy, and this reduced the complexity of the primer mixtures from several thousand to sixteen different sequences for each primer. The primers were validated by production and sequencing of amplicons from serine protease genes in Bacillus subtilis and Serratia marcescens. The primers were used with heat-soaked polymerase chain reaction (PCR) to produce amplicons from two D. congolensis strains, AG and MB. In the amplicon codons for arginine, rather than the expected serine, were found where inosine was used for both the first and third positions for a codon in the primer. A search with the deduced amino acid sequences of the amplicons showed significant similarity to a keratinase and other serine proteases from various organisms. Similarity was most apparent around the active site residues and other essential secondary structural elements.

  15. Exploring single electrode reactions in polymer electrolyte fuel cells

    Energy Technology Data Exchange (ETDEWEB)

    Kuhn, H.; Wokaun, A.; Scherer, G.G. [Paul Scherrer Institute, Electrochemistry Laboratory, 5232 Villigen (Switzerland)

    2007-01-20

    Utilising a pseudo-reference electrode in polymer electrolyte fuel cells allows for the separation of anodic and cathodic contributions to the entire cell impedance. Modelling the impedance responses by using equivalent circuits inhibits the investigation of kinetic parameters of the basic electrochemical reactions, which take place at single electrode-electrolyte interfaces. Therefore, we evaluate single electrode impedance measurements by a kinetic model, which is based on specific reaction pathways, either for the oxygen reduction reaction (ORR) or the hydrogen oxidation reaction (HOR). As a consequence, it is possible to obtain kinetic parameters for the specific reaction of interest. Furthermore, the information gained from the single electrode impedance measurements and the kinetic model can give insight into single reactions steps. In particular, the ORR has to include a chemical step in the reaction pathway. (author)

  16. Reaction Gradients Viewed Inside Single Photoactive Particles

    Science.gov (United States)

    Alpert, P.; Corral Arroyo, P.; Dou, J.; Kreiger, U.; Luo, B.; Peter, T.; Ammann, M.

    2017-12-01

    In terms of chemical selectivity and spatial resolution, a technique known as scanning transmission X-ray microscopy coupled to near-edge X-ray absorption fine structure spectroscopy (STXM/NEXAFS) is unmatched and will remain so for years into the future. We present a recent development coupling STXM/NEXAFS to a custom-built photochemical environmental reactor in which aerosol particles reside allowing for in situ chemical imaging. A laboratory investigation of metal-organic complex photochemistry was conducted. Transition metals are of great importance to atmospheric chemistry and aerosol photochemical aging due to their ability to catalyze oxidation reactions. Aerosol particles composed of mixtures of citric acid and iron citrate were probed for their organic carbon composition and iron oxidation state under atmospherically relevant conditions. At 40% relative humidity, oxygen diffusion and reaction was severely limited. Fe was reoxidized in the first 200 nm of the particle surface leaving reduced iron in the core. Similar gradients were observed at 60% RH, however waiting approximately 2 hours in the dark resulted in a recovery of the initial Fe(III) concentration. We draw two main conclusions from our findings. Frist, the oxidation gradients must have been the result of anoxic conditions at the interior of aerosol particles. This was predicted using a newly developed model for molecular diffusion through multiple layers with a reaction framework describing the photochemical processing of the metal organic matrix. Second, the lifetime of organic radicals in an anoxic diffusion limited organic matrix must be considerably long ( hours) to completely reoxidize iron as they wait for molecular oxygen. Long radical lifetimes in viscous organic aerosol in turn, could create high radical concentrations or favor radical-radical reactions in particles typically not considered when oxygen is plentiful. Our results impact predictions of aerosol physiochemical properties, e

  17. Single-nucleotide polymorphisms may cause erroneous results in primer-introduced restriction enzyme analyses: a case of molecular misdiagnosis of homozygous vs heterozygous familial hypercholesterolemia.

    Science.gov (United States)

    Vuorio, A F; Paulin, L; Saltevo, J; Kontula, K

    1999-12-01

    PCR amplification followed by a primer introduced restriction analysis PCR (PIRA-PCR) is a widely used method to detect point mutations. Usually the artificial RFLP is created by siting one nucleotide mismatch near the 3; end of the primer. This does not alter the hybrization of the primer to the target DNA sequence. Unfortunately, unexpected single nucleotide polymorphisms (SNPs) may lead to additional mismatches and result in no amplification of the allele having unexpected SNP. We describe a warning example in which heterozygous familial hypercholesterolemia patient had an unexpected SNP and this led to his misdiagnosis. Copyright 1999 Academic Press.

  18. From cutting-edge pointwise cross-section to groupwise reaction rate: A primer

    Science.gov (United States)

    Sublet, Jean-Christophe; Fleming, Michael; Gilbert, Mark R.

    2017-09-01

    The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviations derived from Monte Carlo simulations, to the local and total uncertainty in the simulated reactions rates (RRs), which usually only apply to one application at a time. This paper identifies deficiencies in the traditional treatment, and discusses correct handling of the RR uncertainty quantification and propagation, including details of the cross section components in the RR uncertainty estimates, which are verified for relevant applications. The methodology that rigorously captures the spectral shift and cross section contributions to the uncertainty in the RR are discussed with quantified examples that demonstrate the importance of the proper treatment of the spectrum profile and cross section contributions to the uncertainty in the RR and subsequent response functions. The recently developed inventory code FISPACT-II, when connected to the processed nuclear data libraries TENDL-2015, ENDF/B-VII.1, JENDL-4.0u or JEFF-3.2, forms an enhanced multi-physics platform providing a wide variety of advanced simulation methods for modelling activation, transmutation, burnup protocols and simulating radiation damage sources terms. The system has extended cutting-edge nuclear data forms, uncertainty quantification and propagation methods, which have been the subject of recent integral and differential, fission, fusion and accelerators validation efforts. The simulation system is used to accurately and predictively probe, understand and underpin a modern and sustainable understanding

  19. From cutting-edge pointwise cross-section to groupwise reaction rate: A primer

    Directory of Open Access Journals (Sweden)

    Sublet Jean-Christophe

    2017-01-01

    Full Text Available The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviations derived from Monte Carlo simulations, to the local and total uncertainty in the simulated reactions rates (RRs, which usually only apply to one application at a time. This paper identifies deficiencies in the traditional treatment, and discusses correct handling of the RR uncertainty quantification and propagation, including details of the cross section components in the RR uncertainty estimates, which are verified for relevant applications. The methodology that rigorously captures the spectral shift and cross section contributions to the uncertainty in the RR are discussed with quantified examples that demonstrate the importance of the proper treatment of the spectrum profile and cross section contributions to the uncertainty in the RR and subsequent response functions. The recently developed inventory code FISPACT-II, when connected to the processed nuclear data libraries TENDL-2015, ENDF/B-VII.1, JENDL-4.0u or JEFF-3.2, forms an enhanced multi-physics platform providing a wide variety of advanced simulation methods for modelling activation, transmutation, burnup protocols and simulating radiation damage sources terms. The system has extended cutting-edge nuclear data forms, uncertainty quantification and propagation methods, which have been the subject of recent integral and differential, fission, fusion and accelerators validation efforts. The simulation system is used to accurately and predictively probe, understand and underpin a modern and

  20. Study of single nucleon transfer in α + 12C reaction

    International Nuclear Information System (INIS)

    Pandey, R.; Rana, T.K.; Dey, A.; Bhattacharya, C.; Kundu, S.; Banerjee, K.; Mukherjee, G.; Ghosh, T.K.; Meena, J.K.; Pai, H.; Gohil, M.; Bhattacharya, S.; Biswas, M.

    2011-01-01

    Nucleon transfer reactions are of great significance for understanding the nuclear structure both for direct reaction studies as well as for production of nuclear states. Transfer reactions are simplest to interpret when either the initial and final state of the target nucleus has spin zero and when the conditions are such that the transition from the initial and final states occurs to a good approximation in a single step. In this paper, the measurement of angular momentum distribution and calculation of the spectroscopic factor for one nucleon transfer reaction in α + 12 C reaction have been reported

  1. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  2. Single-Atom Catalysts of Precious Metals for Electrochemical Reactions.

    Science.gov (United States)

    Kim, Jiwhan; Kim, Hee-Eun; Lee, Hyunjoo

    2018-01-10

    Single-atom catalysts (SACs), in which metal atoms are dispersed on the support without forming nanoparticles, have been used for various heterogeneous reactions and most recently for electrochemical reactions. In this Minireview, recent examples of single-atom electrocatalysts used for the oxygen reduction reaction (ORR), hydrogen oxidation reaction (HOR), hydrogen evolution reaction (HER), formic acid oxidation reaction (FAOR), and methanol oxidation reaction (MOR) are introduced. Many density functional theory (DFT) simulations have predicted that SACs may be effective for CO 2 reduction to methane or methanol production while suppressing H 2 evolution, and those cases are introduced here as well. Single atoms, mainly Pt single atoms, have been deposited on TiN or TiC nanoparticles, defective graphene nanosheets, N-doped covalent triazine frameworks, graphitic carbon nitride, S-doped zeolite-templated carbon, and Sb-doped SnO 2 surfaces. Scanning transmission electron microscopy, extended X-ray absorption fine structure measurement, and in situ infrared spectroscopy have been used to detect the single-atom structure and confirm the absence of nanoparticles. SACs have shown high mass activity, minimizing the use of precious metal, and unique selectivity distinct from nanoparticle catalysts owing to the absence of ensemble sites. Additional features that SACs should possess for effective electrochemical applications were also suggested. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Direct single-molecule dynamic detection of chemical reactions.

    Science.gov (United States)

    Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng

    2018-02-01

    Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.

  4. Human Platelet Antigen Alleles in 998 Taiwanese Blood Donors Determined by Sequence-Specific Primer Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Shun-Chung Pai

    2013-01-01

    Full Text Available Polymorphism of human platelet antigens (HPAs leads to alloimmunizations and immune-mediated platelet disorders including fetal-neonatal alloimmune thrombocytopenia (FNAIT, posttransfusion purpura (PTP, and platelet transfusion refractoriness (PTR. HPA typing and knowledge of antigen frequency in a population are important in particular for the provision of HPA-matched blood components for patients with PTR. We have performed allele genotyping for HPA-1 through -6 and -15 among 998 platelet donors from 6 blood centers in Taiwan using sequence-specific primer polymerase chain reaction. The HPA allele frequency was 99.55, and 0.45% for HPA-1a and -1b; 96.49, and 3.51% for HPA-2a and -2b; 55.81, and 44.19% for HPA-3a and -3b; 99.75, and 0.25% for HPA-4a and -4b; 98.50, and 1.50% for HPA-5a and -5b; 97.75 and 2.25% for HPA-6a and -6b; 53.71 and 46.29% for HPA-15a and -15b. HPA-15b and HPA-3a, may be considered the most important, followed by HPA-2, -6, -1, -5, and -4 systems, as a cause of FNAIT, PTP, and PTR based on allele frequency. HPA-4b and HPA-5b role cannot be excluded based on their immunogenicity. A larger-scale study will now be conducted to confirm these hypotheses and to establish an apheresis donor database for the procurement of HPA-matched apheresis platelets for patients with PTR.

  5. Human platelet antigen alleles in 998 Taiwanese blood donors determined by sequence-specific primer polymerase chain reaction.

    Science.gov (United States)

    Pai, Shun-Chung; Burnouf, Thierry; Chen, Jen-Wei; Lin, Liang-In

    2013-01-01

    Polymorphism of human platelet antigens (HPAs) leads to alloimmunizations and immune-mediated platelet disorders including fetal-neonatal alloimmune thrombocytopenia (FNAIT), posttransfusion purpura (PTP), and platelet transfusion refractoriness (PTR). HPA typing and knowledge of antigen frequency in a population are important in particular for the provision of HPA-matched blood components for patients with PTR. We have performed allele genotyping for HPA-1 through -6 and -15 among 998 platelet donors from 6 blood centers in Taiwan using sequence-specific primer polymerase chain reaction. The HPA allele frequency was 99.55, and 0.45% for HPA-1a and -1b; 96.49, and 3.51% for HPA-2a and -2b; 55.81, and 44.19% for HPA-3a and -3b; 99.75, and 0.25% for HPA-4a and -4b; 98.50, and 1.50% for HPA-5a and -5b; 97.75 and 2.25% for HPA-6a and -6b; 53.71 and 46.29% for HPA-15a and -15b. HPA-15b and HPA-3a, may be considered the most important, followed by HPA-2, -6, -1, -5, and -4 systems, as a cause of FNAIT, PTP, and PTR based on allele frequency. HPA-4b and HPA-5b role cannot be excluded based on their immunogenicity. A larger-scale study will now be conducted to confirm these hypotheses and to establish an apheresis donor database for the procurement of HPA-matched apheresis platelets for patients with PTR.

  6. AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment

    Directory of Open Access Journals (Sweden)

    Petra Pjevac

    2017-08-01

    Full Text Available Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be catalyzed by the concerted activity of ammonia- and nitrite-oxidizing microorganisms. Only recently, complete ammonia oxidizers (“comammox”, which oxidize ammonia to nitrate on their own, were identified in the bacterial genus Nitrospira, previously assumed to contain only canonical nitrite oxidizers. Nitrospira are widespread in nature, but for assessments of the distribution and functional importance of comammox Nitrospira in ecosystems, cultivation-independent tools to distinguish comammox from strictly nitrite-oxidizing Nitrospira are required. Here we developed new PCR primer sets that specifically target the amoA genes coding for subunit A of the distinct ammonia monooxygenase of comammox Nitrospira. While existing primers capture only a fraction of the known comammox amoA diversity, the new primer sets cover as much as 95% of the comammox amoA clade A and 92% of the clade B sequences in a reference database containing 326 comammox amoA genes with sequence information at the primer binding sites. Application of the primers to 13 samples from engineered systems (a groundwater well, drinking water treatment and wastewater treatment plants and other habitats (rice paddy and forest soils, rice rhizosphere, brackish lake sediment and freshwater biofilm detected comammox Nitrospira in all samples and revealed a considerable diversity of comammox in most habitats. Excellent primer specificity for comammox amoA was achieved by avoiding the use of highly degenerate primer preparations and by using equimolar mixtures of oligonucleotides that match existing comammox amoA genes. Quantitative PCR with these equimolar primer mixtures was highly sensitive and specific, and enabled the efficient quantification of clade A and clade B comammox amoA gene copy numbers in environmental samples. The measured relative abundances of comammox Nitrospira, compared

  7. Single-molecule chemical reaction reveals molecular reaction kinetics and dynamics.

    Science.gov (United States)

    Zhang, Yuwei; Song, Ping; Fu, Qiang; Ruan, Mingbo; Xu, Weilin

    2014-06-25

    Understanding the microscopic elementary process of chemical reactions, especially in condensed phase, is highly desirable for improvement of efficiencies in industrial chemical processes. Here we show an approach to gaining new insights into elementary reactions in condensed phase by combining quantum chemical calculations with a single-molecule analysis. Elementary chemical reactions in liquid-phase, revealed from quantum chemical calculations, are studied by tracking the fluorescence of single dye molecules undergoing a reversible redox process. Statistical analyses of single-molecule trajectories reveal molecular reaction kinetics and dynamics of elementary reactions. The reactivity dynamic fluctuations of single molecules are evidenced and probably arise from either or both of the low-frequency approach of the molecule to the internal surface of the SiO2 nanosphere or the molecule diffusion-induced memory effect. This new approach could be applied to other chemical reactions in liquid phase to gain more insight into their molecular reaction kinetics and the dynamics of elementary steps.

  8. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    Science.gov (United States)

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  9. High performance platinum single atom electrocatalyst for oxygen reduction reaction

    Science.gov (United States)

    Liu, Jing; Jiao, Menggai; Lu, Lanlu; Barkholtz, Heather M.; Li, Yuping; Wang, Ying; Jiang, Luhua; Wu, Zhijian; Liu, Di-Jia; Zhuang, Lin; Ma, Chao; Zeng, Jie; Zhang, Bingsen; Su, Dangsheng; Song, Ping; Xing, Wei; Xu, Weilin; Wang, Ying; Jiang, Zheng; Sun, Gongquan

    2017-07-01

    For the large-scale sustainable implementation of polymer electrolyte membrane fuel cells in vehicles, high-performance electrocatalysts with low platinum consumption are desirable for use as cathode material during the oxygen reduction reaction in fuel cells. Here we report a carbon black-supported cost-effective, efficient and durable platinum single-atom electrocatalyst with carbon monoxide/methanol tolerance for the cathodic oxygen reduction reaction. The acidic single-cell with such a catalyst as cathode delivers high performance, with power density up to 680 mW cm-2 at 80 °C with a low platinum loading of 0.09 mgPt cm-2, corresponding to a platinum utilization of 0.13 gPt kW-1 in the fuel cell. Good fuel cell durability is also observed. Theoretical calculations reveal that the main effective sites on such platinum single-atom electrocatalysts are single-pyridinic-nitrogen-atom-anchored single-platinum-atom centres, which are tolerant to carbon monoxide/methanol, but highly active for the oxygen reduction reaction.

  10. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  11. Action spectroscopy for single-molecule reactions - Experiments and theory

    Science.gov (United States)

    Kim, Y.; Motobayashi, K.; Frederiksen, T.; Ueba, H.; Kawai, M.

    2015-05-01

    We review several representative experimental results of action spectroscopy (AS) of single molecules on metal surfaces using a scanning tunneling microscope (STM) by M. Kawai's group over last decade. The experimental procedures to observe STM-AS are described. A brief description of a low-temperature STM and experimental setup are followed by key experimental techniques of how to determine an onset bias voltage of a reaction and how to measure a current change associated with reactions and finally how to observe AS for single molecule reactions. The experimental results are presented for vibrationally mediated chemical transformation of trans-2-butene to 1.3-butadiene molecule and rotational motion of a single cis-2-butene molecule among four equivalent orientations on Pd(1 1 0). The AS obtained from the motion clearly detects more vibrational modes than inelastic electron tunneling spectroscopy with an STM. AS is demonstrated as a useful and novel single molecule vibrational spectroscopy. The AS for a lateral hopping of water dimer on Pt(1 1 1) is presented as an example of novelty. Several distinct vibrational modes are detected as the thresholds in the AS. The assignment of the vibrational modes determined from the analysis of the AS is made from a view of the adsorption geometry of hydrogen-bond donor or acceptor molecules in water dimer. A generic theory of STM-AS, i.e., a reaction rate or yield as a function of bias voltage, is presented using a single adsorbate resonance model for single molecule reactions induced by the inelastic tunneling current. Formulas for the reaction rate R (V) and Y (V) , i.e., reaction yield per electron Y (V) = eR (V) / I are derived. It provides a versatile framework to analyze any vibrationally mediated reactions of single adsorbates on metal surfaces. Numerical examples are presented to demonstrate generic features of the vibrational generation rate and Y (V) at different levels of approximations and to show how the effective

  12. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally...

  13. Genotyping Single Nucleotide Polymorphism C4685T in 14. Intron of Bovine CAPN1 Gene by Rapid Tetra-Primer ARMS-PCR Method

    Directory of Open Access Journals (Sweden)

    Michal Gábor

    2011-05-01

    Full Text Available Single nucleotide polymorphism (SNP C4685T located in 14. intron of bovine CAPN1 gene have shown significant association with a higher lean share in valuable cuts for mutant genotype TT. The work was oriented to developed a sensitive single tube tetra-primer amplification refractory mutation system PCR (ARMS-PCR method for detection of C4685T polymorphism in CAPNI gene and analysis of genotype structure in population of 130 animals of Slovak Pinzgau cattle. The genomic DNA was isolated from samples of blood and hairs of cattle. Design of primers for ARMS-PCR was realized by using program Tetra-Primer ARMS-PCR. The presence of wild allele C and mutant allele T on agarose gel was detected by one control 439 bp fragment for both alleles and one specific fragment for each allele C - 204 bp and T - 290 bp. For the checking of correct genotyping was used PCR-RFLP method with restriction endonuclease BseGI. In the population of Slovak Pinzgau cattle we detected all genotypes. There were detected homozygote genotype CC with frequency 0.3308, heterozygote genotype CT with frequency 0.4 and homozygote genotype TT with frequency 0.2692. Frequency of alleles C and T for SNP C4685T of gene CAPN1 were 0.5308 and 0.4692.

  14. Single-collision studies of energy transfer and chemical reaction

    Energy Technology Data Exchange (ETDEWEB)

    Valentini, J.J. [Columbia Univ., New York, NY (United States)

    1993-12-01

    The research focus in this group is state-to-state dynamics of reaction and energy transfer in collisions of free radicals such as H, OH, and CH{sub 3} with H{sub 2}, alkanes, alcohols and other hydrogen-containing molecules. The motivation for the work is the desire to provide a detailed understanding of the chemical dynamics of prototype reactions that are important in the production and utilization of energy sources, most importantly in combustion. The work is primarily experimental, but with an important and growing theoretical/computational component. The focus of this research program is now on reactions in which at least one of the reactants and one of the products is polyatomic. The objective is to determine how the high dimensionality of the reactants and products differentiates such reactions from atom + diatom reactions of the same kinematics and energetics. The experiments use highly time-resolved laser spectroscopic methods to prepare reactant states and analyze the states of the products on a single-collision time scale. The primary spectroscopic tool for product state analysis is coherent anti-Stokes Raman scattering (CARS) spectroscopy. CARS is used because of its generality and because the extraction of quantum state populations from CARS spectra is straightforward. The combination of the generality and easy analysis of CARS makes possible absolute cross section measurements (both state-to-state and total), a particularly valuable capability for characterizing reactive and inelastic collisions. Reactant free radicals are produced by laser photolysis of appropriate precursors. For reactant vibrational excitation stimulated Raman techniques are being developed and implemented.

  15. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  16. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  17. Ligase-free subcloning: a versatile method to subclone polymerase chain reaction (PCR) products in a single day.

    Science.gov (United States)

    Shuldiner, A R; Tanner, K; Scott, L A; Moore, C A; Roth, J

    1991-04-01

    Often, it is convenient to subclone polymerase chain reaction (PCR) products into a plasmid vector for subsequent replication in bacteria, but conventional subcloning methods often fail. We report a rapid and versatile method to subclone PCR products directionally into a specific site of virtually any plasmid vector. The procedure requires only four primers, does not require DNA ligase, and may be accomplished in a single day. Ligase-free subcloning is performed by incorporating into the PCR primers sequences at the 5' ends that result in PCR products whose 3' ends are complementary to the 3' ends of the recipient linearized plasmid. The PCR product and the linearized plasmid are spliced together in a second PCR reaction in which Taq polymerase extends the complementary overlapping 3' ends (ligation by overlap extension). Denaturation followed by heterologous reannealing and cyclization results in a cyclic recombinant plasmid with two nicks that may be used directly to transform competent Escherichia coli. In our hands, ligase-free subcloning is rapid, and offers many advantages over existing strategies.

  18. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    Science.gov (United States)

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  19. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  20. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  1. Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification.

    Directory of Open Access Journals (Sweden)

    Yohei Nishikawa

    Full Text Available Whole genome amplification (WGA is essential for obtaining genome sequences from single bacterial cells because the quantity of template DNA contained in a single cell is very low. Multiple displacement amplification (MDA, using Phi29 DNA polymerase and random primers, is the most widely used method for single-cell WGA. However, single-cell MDA usually results in uneven genome coverage because of amplification bias, background amplification of contaminating DNA, and formation of chimeras by linking of non-contiguous chromosomal regions. Here, we present a novel MDA method, termed droplet MDA, that minimizes amplification bias and amplification of contaminants by using picoliter-sized droplets for compartmentalized WGA reactions. Extracted DNA fragments from a lysed cell in MDA mixture are divided into 105 droplets (67 pL within minutes via flow through simple microfluidic channels. Compartmentalized genome fragments can be individually amplified in these droplets without the risk of encounter with reagent-borne or environmental contaminants. Following quality assessment of WGA products from single Escherichia coli cells, we showed that droplet MDA minimized unexpected amplification and improved the percentage of genome recovery from 59% to 89%. Our results demonstrate that microfluidic-generated droplets show potential as an efficient tool for effective amplification of low-input DNA for single-cell genomics and greatly reduce the cost and labor investment required for determination of nearly complete genome sequences of uncultured bacteria from environmental samples.

  2. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  3. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  4. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  5. Single-molecule stochastic times in a reversible bimolecular reaction.

    Science.gov (United States)

    Keller, Peter; Valleriani, Angelo

    2012-08-28

    In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.

  6. Detection of Single-Nucleotide Polymorphisms in Plasmodium falciparum by PCR Primer Extension and Lateral Flow Immunoassay

    NARCIS (Netherlands)

    Moers, A. P. H. A.; Hallett, R. L.; Burrow, R.; Schallig, H. D. F. H.; Sutherland, C. J.; van Amerongen, A.

    2015-01-01

    The resistance of Plasmodium falciparum to some antimalarial drugs is linked to single-nucleotide polymorphisms (SNPs). Currently, there are no methods for the identification of resistant parasites that are sufficiently simple, cheap, and fast enough to be performed at point-of-care, i.e., in local

  7. Single-particle and collective states in transfer reactions

    International Nuclear Information System (INIS)

    Lhenry, I.; Suomijaervi, T.; Giai, N. van

    1993-01-01

    The possibility to excite collective states in transfer reactions induced by heavy ions is studied. Collective states are described within the Random Phase Approximation (RPA) and the collectivity is defined according to the number of configurations contributing to a given state. The particle transfer is described within the Distorted Wave Born Approximation (DWBA). Calculations are performed for two different stripping reactions: 207 Pb( 20 Ne, 19 Ne) 208 Pb and 59 Co( 20 Ne, 19 F) 60 Ni at 48 MeV/nucleon for which experimental data are available. The calculation shows that a sizeable fraction of collective strength can be excited in these reactions. The comparison with experiment shows that this parameter-free calculation qualitatively explains the data. (author) 19 refs.; 10 figs

  8. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  9. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  10. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.

    Directory of Open Access Journals (Sweden)

    Hideki Shojo

    Full Text Available Polymerase chain reaction-amplified product length polymorphism (PCR-APLP is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  11. Single-tube genotyping using a solid-phase method that combines alpha-phosphorothioate-mediated primer extension and ExoIII: proof of concept with the F508del cystic fibrosis diagnosis.

    Science.gov (United States)

    Brugère, Jean-François; Gobron, Stéphane; Baud, Eric; Cailloux, Fabrice

    2008-01-01

    Detection of single nucleotide polymorphisms (SNPs) and of mutations is of importance in the field of genetics, biomedical research and in vitro diagnosis. We report here a genotyping procedure that can be virtually applied to any locus within a genome: it uses alpha-phosphorothioate deoxynucleotides in a primer-extension step followed by an ExoIII treatment. Non-extended primers are hydrolyzed whereas extended primers resist this treatment, indicating which nucleotide has been incorporated, i.e. the genotype of the locus. A 3-bp deletion in the CFTR gene (F508del, the most prevalent mutation involved in cystic fibrosis) was used as a model, in a single-tube procedure for each nucleotide to be tested. Human genomic DNA samples were correctly genotyped in less than 3h by a solid-phase PCR followed by primer extension, ExoIII treatment and an ELISA-like detection method. The same principle (primer extension with alpha-phosphorothioate deoxynucleotide, ExoIII treatment) should also be combined with other detection systems such as gel or capillary electrophoresis, mass spectrometry or DNA chips.

  12. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  13. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  14. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  15. Single and double polymerase chain reaction for detection of bovine viral diarrhea virus in tissue culture and sera.

    Science.gov (United States)

    Alansari, H; Brock, K V; Potgieter, L N

    1993-04-01

    Bovine viral diarrhea virus (BVDV) is an ubiquitous pathogen of cattle and has been reported in other ruminants. It is also frequently present in laboratory and biological materials as an adventitious agent. This virus is difficult to detect in some specimens, especially in the presence of specific antibody and when the virus is present in low concentrations. In this paper, we describe a single polymerase chain reaction (PCR) to amplify virus sequences from infected cell culture and a nested double PCR to detect small concentrations of several virus strains in sera. Total cellular RNA was extracted from cell cultures infected with the cytopathic strain 72 and noncytopathic strain 2724 of BVDV. Ten different genomic sequences along the length of the viral RNA ranging in size from 397 to 1,016 base pairs (bp) were successfully amplified by PCR. A 404-bp probe made from amplified product from the 3' end hybridized specifically with the RNA of several BVDV strains blotted on nylon filters. Viral RNA was extracted from serum and amplified using 2 sets of degenerate nested primers designed from the 3' end of the viral genome in a double PCR protocol. Double amplification of the viral sequences greatly enhanced the sensitivity of the detection of many strains present in serum. Advantages of using double PCR over single PCR and virus isolation is discussed.

  16. Cowpea Reaction to Single and Mixed Viral Infection with Blackeye ...

    African Journals Online (AJOL)

    The results of the experiment showed that mixed inoculation with the two viruses, induced greater susceptibility to the viral pathogens in the plants, compared to single virus inoculations. The study also indicated that, early viral infection at 2 WAP, was more pathogenic and resulted in higher yield losses compared with ...

  17. Designing primers and evaluation of the efficiency of propidium monoazide - Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius.

    Science.gov (United States)

    Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang

    2017-07-01

    The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.

  18. Designing primers and evaluation of the efficiency of propidium monoazide – Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius

    Directory of Open Access Journals (Sweden)

    Chieh-Hsien Lai

    2017-07-01

    Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.

  19. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  20. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

    Science.gov (United States)

    Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

    2017-05-01

    Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

  2. Catalytic effect of a single water molecule on the OH + CH2NH reaction.

    Science.gov (United States)

    Akbar Ali, Mohamad; M, Balaganesh; Lin, K C

    2018-02-07

    In recent work, there has been considerable speculation about the atmospheric reaction of methylenimine (CH 2 NH), because this compound is highly reactive, soluble in water, and sticky, thus posing severe experimental challenges. In this work, we have revisited the kinetics of the OH + CH 2 NH reaction assisted by a single water molecule. The potential energy surfaces (PESs) for the water-assisted OH + CH 2 NH reaction were calculated using the CCSD(T)//BH&HLYP/aug-cc-pVTZ levels of theory. The rate coefficients for the bimolecular reaction pathways CH 2 NHH 2 O + OH and CH 2 NH + H 2 OHO were computed using canonical variational transition state theory (CVT) with small curvature tunneling correction. The reaction without water has four elementary reaction pathways, depending on how the hydroxyl radical approaches CH 2 NH. In all cases, the reaction begins with the formation of a single pre-reactive complex before producing abstraction and addition products. When water is added, the products of the reaction do not change, and the reaction becomes quite complex, yielding four different pre-reactive complexes and eight reaction pathways. The calculated rate coefficient for the OH + CH 2 NH (water-free) reaction at 300 K is 1.7 × 10 -11 cm 3 molecule -1 s -1 and for OH + CH 2 NH (water-assisted), it is 5.1 × 10 -14 cm 3 molecule -1 s -1 . This result is similar to the isoelectronic analogous reaction OH + CH 2 O (water-assisted). In general, the effective rate coefficients of the water-assisted reaction are 2∼3 orders of magnitude smaller than water-free. Our results show that the water-assisted OH + CH 2 NH reaction cannot accelerate the reaction because the dominated water-assisted process depends parametrically on water concentration. As a result, the overall reaction rate coefficients are smaller.

  3. Mass transfer with complex reversible chemical reactions I. Single reversible chemical reaction

    NARCIS (Netherlands)

    Versteeg, Geert; Kuipers, J.A.M.; van Beckum, F.P.H.; van Swaaij, Willibrordus Petrus Maria

    1989-01-01

    An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass

  4. High-pressure catalytic reactions over single-crystal metal surfaces

    Science.gov (United States)

    Rodriguez, JoséA.; Wayne Goodman, D.

    1991-11-01

    Studies dealing with high-pressure catalytic reactions over single-crystal surfaces are reviewed. The coupling of an apparatus for the measurement of reaction kinetics at elevated pressures with an ultrahigh vacuum system for surface analysis allows detailed study of structure sensitivity, the effects of promoters and inhibitors on catalytic activity, and, in certain cases, identification of reaction intermediates by post-reaction surface analysis. Examples are provided which demonstrate the relevance of single-crystal studies for modeling the behaviour of high-surface-area supported catalysts. Studies of CO methanation and CO oxidation over single-crystal surfaces provide convincing evidence that these reactions are structure insensitive. For structure-sensitive reactions (ammonia synthesis, alkane hydrogenolysis, alkane isomerization, water-gas shift reaction, etc.) model single-crystal studies allow correlations to be established between surface structure and catalytic activity. The effects of both electronegative (S and P) and electropositive (alkali metals) impurities upon the catalytic activity of metal single crystals for ammonia synthesis, CO methanation, alkane hydrogenolysis, ethylene epoxidation and water-gas shift are discussed. The roles of "ensemble" and "ligand" effects in bimetallic catalysts are examined in light of data obtained using surfaces prepared by vapor-depositing one metal onto a crystal face of a dissimilar metal.

  5. Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

    Science.gov (United States)

    Pierce, Kenneth E; Wangh, Lawrence J

    2007-01-01

    Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

  6. Single-Site Palladium(II) Catalyst for Oxidative Heck Reaction: Catalytic Performance and Kinetic Investigations

    Energy Technology Data Exchange (ETDEWEB)

    Duan, Hui; Li, Mengyang; Zhang, Guanghui; Gallagher, James R.; Huang, Zhiliang; Sun, Yu; Luo, Zhong; Chen, Hongzhong; Miller, Jeffrey T.; Zou, Ruqiang; Lei, Aiwen; Zhao, Yanli

    2015-01-01

    ABSTRACT: The development of organometallic single-site catalysts (SSCs) has inspired the designs of new heterogeneous catalysts with high efficiency. Nevertheless, the application of SSCs in certain modern organic reactions, such as C-C bond formation reactions, has still been less investigated. In this study, a single-site Pd(II) catalyst was developed, where 2,2'-bipyridine-grafted periodic mesoporous organosilica (PMO) was employed as the support of a Pd(II) complex. The overall performance of the single-site Pd(II) catalyst in the oxidative Heck reaction was then investigated. The investigation results show that the catalyst displays over 99% selectivity for the product formation with high reaction yield. Kinetic profiles further confirm its high catalytic efficiency, showing that the rate constant is nearly 40 times higher than that for the free Pd(II) salt. X-ray absorption spectroscopy reveals that the catalyst has remarkable lifetime and recyclability.

  7. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

    DEFF Research Database (Denmark)

    Huang, Cancan; Jevric, Martyn; Borges, Anders Christian

    2017-01-01

    a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting......Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single......-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides...

  8. Use of allele-specific sequencing primers is an efficient alternative to PCR subcloning of low-copy nuclear genes.

    Science.gov (United States)

    Scheen, Anne-Cathrine; Pfeil, Bernard E; Petri, Anna; Heidari, Nahid; Nylinder, Stephan; Oxelman, Bengt

    2012-01-01

    Direct Sanger sequencing of polymerase chain reaction (PCR)-amplified nuclear genes leads to polymorphic sequences when allelic variation is present. To overcome this problem, most researchers subclone the PCR products to separate alleles. An alternative is to directly sequence the separate alleles using allele-specific primers. We tested two methods to enhance the specificity of allele-specific primers for use in direct sequencing: using short primers and amplification refractory mutation system (ARMS) technique. By shortening the allele-specific primer to 15-13 nucleotides, the single mismatch in the ultimate base of the primer is enough to hinder the amplification of the nontarget allele in direct sequencing and recover only the targeted allele at high accuracy. The deliberate addition of a second mismatch, as implemented in the ARMS technique, was less successful and seems better suited for allele-specific amplification in regular PCR rather than in direct sequencing. © 2011 Blackwell Publishing Ltd.

  9. Atomic-level insights in optimizing reaction paths for hydroformylation reaction over Rh/CoO single-atom catalyst.

    Science.gov (United States)

    Wang, Liangbing; Zhang, Wenbo; Wang, Shenpeng; Gao, Zehua; Luo, Zhiheng; Wang, Xu; Zeng, Rui; Li, Aowen; Li, Hongliang; Wang, Menglin; Zheng, Xusheng; Zhu, Junfa; Zhang, Wenhua; Ma, Chao; Si, Rui; Zeng, Jie

    2016-12-22

    Rh-based heterogeneous catalysts generally have limited selectivity relative to their homogeneous counterparts in hydroformylation reactions despite of the convenience of catalyst separation in heterogeneous catalysis. Here, we develop CoO-supported Rh single-atom catalysts (Rh/CoO) with remarkable activity and selectivity towards propene hydroformylation. By increasing Rh mass loading, isolated Rh atoms switch to aggregated clusters of different atomicity. During the hydroformylation, Rh/CoO achieves the optimal selectivity of 94.4% for butyraldehyde and the highest turnover frequency number of 2,065 h -1 among the obtained atomic-scale Rh-based catalysts. Mechanistic studies reveal that a structural reconstruction of Rh single atoms in Rh/CoO occurs during the catalytic process, facilitating the adsorption and activation of reactants. In kinetic view, linear products are determined as the dominating products by analysing reaction paths deriving from the two most stable co-adsorbed configurations. As a bridge of homogeneous and heterogeneous catalysis, single-atom catalysts can be potentially applied in other industrial reactions.

  10. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  11. Dual phase multiplex polymerase chain reaction

    Science.gov (United States)

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  12. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    , ALS1 and HWP1 genes were specific for C. albicans, while the ones for CAP1, CAT1, EFG1, LIP3, and PLB1 were detected in C. albicans and C. dubliniensis. After optimization, all primers presented a single peak on melt curves, correlation coefficient of ≅1 and qPCR reaction efficiency of 90-110%, with slope of ≅-3.3. Therefore, these primers should be suitable for future gene expression analyses from clinical samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Single-Atom Catalyst of Platinum Supported on Titanium Nitride for Selective Electrochemical Reactions.

    Science.gov (United States)

    Yang, Sungeun; Kim, Jiwhan; Tak, Young Joo; Soon, Aloysius; Lee, Hyunjoo

    2016-02-05

    As a catalyst, single-atom platinum may provide an ideal structure for platinum minimization. Herein, a single-atom catalyst of platinum supported on titanium nitride nanoparticles were successfully prepared with the aid of chlorine ligands. Unlike platinum nanoparticles, the single-atom active sites predominantly produced hydrogen peroxide in the electrochemical oxygen reduction with the highest mass activity reported so far. The electrocatalytic oxidation of small organic molecules, such as formic acid and methanol, also exhibited unique selectivity on the single-atom platinum catalyst. A lack of platinum ensemble sites changed the reaction pathway for the oxygen-reduction reaction toward a two-electron pathway and formic acid oxidation toward direct dehydrogenation, and also induced no activity for the methanol oxidation. This work demonstrates that single-atom platinum can be an efficient electrocatalyst with high mass activity and unique selectivity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Ignition and growth modeling of detonation reaction zone experiments on single crystals of PETN and HMX

    Science.gov (United States)

    White, Bradley W.; Tarver, Craig M.

    2017-01-01

    It has long been known that detonating single crystals of solid explosives have much larger failure diameters than those of heterogeneous charges of the same explosive pressed or cast to 98 - 99% theoretical maximum density (TMD). In 1957, Holland et al. demonstrated that PETN single crystals have failure diameters of about 8 mm, whereas heterogeneous PETN charges have failure diameters of less than 0.5 mm. Recently, Fedorov et al. quantitatively determined nanosecond time resolved detonation reaction zone profiles of single crystals of PETN and HMX by measuring the interface particle velocity histories of the detonating crystals and LiF windows using a PDV system. The measured reaction zone time durations for PETN and HMX single crystal detonations were approximately 100 and 260 nanoseconds, respectively. These experiments provided the necessary data to develop Ignition and Growth (I&G) reactive flow model parameters for the single crystal detonation reaction zones. Using these parameters, the calculated unconfined failure diameter of a PETN single crystal was 7.5 +/- 0.5 mm, close to the 8 mm experimental value. The calculated failure diameter of an unconfined HMX single crystal was 15 +/- 1 mm. The unconfined failure diameter of an HMX single crystal has not yet been determined precisely, but Fedorov et al. detonated 14 mm diameter crystals confined by detonating a HMX-based plastic bonded explosive (PBX) without initially overdriving the HMX crystals.

  15. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  16. Electronic state selectivity in dication-molecule single electron transfer reactions: NO(2+) + NO.

    Science.gov (United States)

    Parkes, Michael A; Lockyear, Jessica F; Schröder, Detlef; Roithová, Jana; Price, Stephen D

    2011-11-07

    The single-electron transfer reaction between NO(2+) and NO, which initially forms a pair of NO(+) ions, has been studied using a position-sensitive coincidence technique. The reactivity in this class of collision system, which involves the interaction of a dication with its neutral precursor, provides a sensitive test of recent ideas concerning electronic state selectivity in dicationic single-electron transfer reactions. In stark contrast to the recently observed single-electron transfer reactivity in the analogous CO(2)(2+)/CO(2) and O(2)(2+)/O(2) collision systems, electron transfer between NO(2+) and NO generates two product NO(+) ions which behave in an identical manner, whether the ions are formed from NO(2+) or NO. This observed behaviour is in excellent accord with the recently proposed rationalization of the state selectivity in dication-molecule SET reactions using simple propensity rules involving one-electron transitions. This journal is © the Owner Societies 2011

  17. Reaction kinetics of oxygen on single-phase alloys, oxidation of nickel and niobium alloys

    International Nuclear Information System (INIS)

    Lalauze, Rene

    1973-01-01

    This research thesis first addresses the reaction kinetics of oxygen on alloys. It presents some generalities on heterogeneous reactions (conventional theory, theory of jumps), discusses the core reaction (with the influence of pressure), discusses the influence of metal self-diffusion on metal oxidation kinetics (equilibrium conditions at the interface, hybrid diffusion regime), reports the application of the hybrid diffusion model to the study of selective oxidation of alloys (Wagner model, hybrid diffusion model) and the study of the oxidation kinetics of an alloy forming a solid solution of two oxides. The second part reports the investigation of the oxidation of single phase nickel and niobium alloys (phase α, β and γ)

  18. Single-molecule imaging of platinum ligand exchange reaction reveals reactivity distribution.

    Science.gov (United States)

    Esfandiari, N Melody; Wang, Yong; Bass, Jonathan Y; Cornell, Trevor P; Otte, Douglas A L; Cheng, Ming H; Hemminger, John C; McIntire, Theresa M; Mandelshtam, Vladimir A; Blum, Suzanne A

    2010-11-03

    Single-molecule fluorescence microscopy provided information about the real-time distribution of chemical reactivity on silicon oxide supports at the solution-surface interface, at a level of detail which would be unavailable from a traditional ensemble technique or from a technique that imaged the static physical properties of the surface. Chemical reactions on the surface were found to be uncorrelated; that is, the chemical reaction of one metal complex did not influence the location of a future chemical reaction of another metal complex.

  19. Development of allele-specific single-nucleotide polymorphism-based polymerase chain reaction markers in cytochrome oxidase I for the differentiation of Bactrocera papayae and Bactrocera carambolae (Diptera: Tephritidae).

    Science.gov (United States)

    Chua, Tock H; Song, B K; Chong, Y V

    2010-12-01

    Differentiation of Bactrocera papayae Drew & Hancock and Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) based on morphological characters has often been problematical. We describe here a single-nucleotide polymorphism (SNP)-based polymerase chain reaction (PCR) assay to differentiate between these two species. For detection of SNPs, fragments derived from each species were amplified using two primer pairs, COIF/COIR and UEA7/UEA10, sequenced, and aligned to obtain a contiguous 1,517-bp segment. Two new sets of primers were designed based on the 11 SNPs identified in the region. Results of the SNP-PCR test using any one of these species-specific primer sets indicate that these two species could be differentiated on basis of presence or absence of a band in the gel profile. We also tested the SNP-PCR primers on Bactrocera umbrosa F., Bactrocera cucurbitae Coquillett, Bactrocera latifrons Hendel, and Bactrocera tau (Walker) but did not detect any band in the gel, indicating the likelihood of a false positive for B. papayae is nil. This SNP-PCR method is efficient and useful, especially for immature life stages or when only adult body parts of the two species are available for identification, as encountered often in quarantine work.

  20. Single-Molecule Sensing with Nanopore Confinement: from Chemical Reactions to Biological Interactions.

    Science.gov (United States)

    Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao

    2018-03-25

    The nanopore can generate an electrochemical confinement for single-molecule sensing which help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this concept, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  2. Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

    Science.gov (United States)

    Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

    2017-04-01

    The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

  3. Reaction of single-standard DNA with hydroxyl radical generated by iron(II)-ethylenediaminetetraacetic acid

    International Nuclear Information System (INIS)

    Prigodich, R.V.; Martin, C.T.

    1990-01-01

    This study demonstrates that the reaction of Fe(II)-EDTA and hydrogen peroxide with the single-stranded nucleic acids d(pT) 70 and a 29-base sequence containing a mixture of bases results in substantial damage which is not directly detected by gel electrophoresis. Cleavage of the DNA sugar backbone is enhanced significantly after the samples are incubated at 90 degree C in the presence of piperidine. The latter reaction is used in traditional Maxam-Gilbert DNA sequencing to detect base damage, and the current results are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction with sugar may also produce adducts that are uncleaved but labile to cleavage by piperidine). We the authors propose that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction of the sugars in dsDNA is dominant because the bases are sequestered within the double helix. These results have implications both for the study of single-stranded DNA binding protein binding sites and for the interpretation of experiments using the hydroxyl radical to probe DNA structure or to footprint double-stranded DNA binding protein binding sites

  4. Stability results for a reaction-diffusion system with a single measurement

    Energy Technology Data Exchange (ETDEWEB)

    Ramoul, Hichem [Centre universitaire de Khenchela, Route de Batna, BP 1252, Liberte, 40004 Khenchela (Algeria); Gaitan, Patricia [Laboratoire d' analyse, topologie, probabilites CNRS UMR 6632, Marseille (France) and Universite Aix-Marseille II (France); Cristofol, Michel [Laboratoire d' analyse, topologie, probabilites CNRS UMR 6632, Marseille, France and Universite Aix-Marseille III (France)

    2007-06-15

    For a two by two reaction-diffusion system on a bounded domain we give a simultaneous stability result for one coefficient and for the initial conditions. The key ingredient is a global Carleman-type estimate with a single observation acting on a subdomain.

  5. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  6. Tuning Catalytic Performance through a Single or Sequential Post-Synthesis Reaction(s) in a Gas Phase

    Energy Technology Data Exchange (ETDEWEB)

    Shan, Junjun [Department; Department; Zhang, Shiran [Department; Department; Choksi, Tej [Department; Nguyen, Luan [Department; Department; Bonifacio, Cecile S. [Department; Li, Yuanyuan [Department; Zhu, Wei [Department; Department; College; Tang, Yu [Department; Department; Zhang, Yawen [College; Yang, Judith C. [Department; Greeley, Jeffrey [Department; Frenkel, Anatoly I. [Department; Tao, Franklin [Department; Department

    2016-12-05

    Catalytic performance of a bimetallic catalyst is determined by geometric structure and electronic state of the surface or even the near-surface region of the catalyst. Here we report that single and sequential postsynthesis reactions of an as-synthesized bimetallic nanoparticle catalyst in one or more gas phases can tailor surface chemistry and structure of the catalyst in a gas phase, by which catalytic performance of this bimetallic catalyst can be tuned. Pt–Cu regular nanocube (Pt–Cu RNC) and concave nanocube (Pt–Cu CNC) are chosen as models of bimetallic catalysts. Surface chemistry and catalyst structure under different reaction conditions and during catalysis were explored in gas phase of one or two reactants with ambient-pressure X-ray photoelectron spectroscopy (AP-XPS) and extended X-ray absorption fine structure (EXAFS) spectroscopy. The newly formed surface structures of Pt–Cu RNC and Pt–Cu CNC catalysts strongly depend on the reactive gas(es) used in the postsynthesis reaction(s). A reaction of Pt–Cu RNC-as synthesized with H2 at 200 °C generates a near-surface alloy consisting of a Pt skin layer, a Cu-rich subsurface, and a Pt-rich deep layer. This near-surface alloy of Pt–Cu RNC-as synthesized-H2 exhibits a much higher catalytic activity in CO oxidation in terms of a low activation barrier of 39 ± 4 kJ/mol in contrast to 128 ± 7 kJ/mol of Pt–Cu RNC-as synthesized. Here the significant decrease of activation barrier demonstrates a method to tune catalytic performances of as-synthesized bimetallic catalysts. A further reaction of Pt–Cu RNC-as synthesized-H2 with CO forms a Pt–Cu alloy surface, which exhibits quite different catalytic performance in CO oxidation. It suggests the capability of generating a different surface by using another gas. The capability of tuning surface chemistry and structure of bimetallic catalysts was also demonstrated in restructuring of Pt–Cu CNC-as synthesized.

  7. High-throughput microfluidic single-cell digital polymerase chain reaction.

    Science.gov (United States)

    White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

    2013-08-06

    Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

  8. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  9. Modeling of the interplay between single-file diffusion and conversion reaction in mesoporous systems

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jing [Iowa State Univ., Ames, IA (United States)

    2013-01-11

    We analyze the spatiotemporal behavior of species concentrations in a diffusion-mediated conversion reaction which occurs at catalytic sites within linear pores of nanometer diameter. A strict single-file (no passing) constraint occurs in the diffusion within such narrow pores. Both transient and steady-state behavior is precisely characterized by kinetic Monte Carlo simulations of a spatially discrete lattice–gas model for this reaction–diffusion process considering various distributions of catalytic sites. Exact hierarchical master equations can also be developed for this model. Their analysis, after application of mean-field type truncation approximations, produces discrete reaction–diffusion type equations (mf-RDE). For slowly varying concentrations, we further develop coarse-grained continuum hydrodynamic reaction–diffusion equations (h-RDE) incorporating a precise treatment of single-file diffusion (SFD) in this multispecies system. Noting the shortcomings of mf-RDE and h-RDE, we then develop a generalized hydrodynamic (GH) formulation of appropriate gh-RDE which incorporates an unconventional description of chemical diffusion in mixed-component quasi-single-file systems based on a refined picture of tracer diffusion for finite-length pores. The gh-RDE elucidate the non-exponential decay of the steady-state reactant concentration into the pore and the non-mean-field scaling of the reactant penetration depth. Then an extended model of a catalytic conversion reaction within a functionalized nanoporous material is developed to assess the effect of varying the reaction product – pore interior interaction from attractive to repulsive. The analysis is performed utilizing the generalized hydrodynamic formulation of the reaction-diffusion equations which can reliably capture the complex interplay between reaction and restricted transport for both irreversible and reversible reactions.

  10. Highly Durable Platinum Single-Atom Alloy Catalyst for Electrochemical Reactions

    DEFF Research Database (Denmark)

    Kim, Jiwhan; Roh, Chi-Woo; Sahoo, Suman Kalyan

    2018-01-01

    -doped tin oxide (Pt1/ATO) is synthesized by conventional incipient wetness impregnation, with up to 8 wt% Pt. The single atomic Pt structure is confirmed by high-angle annular dark field scanning tunneling electron microscopy images and extended X-ray absorption fine structure analysis results. Density......Single atomic Pt catalyst can offer efficient utilization of the expensive platinum and provide unique selectivity because it lacks ensemble sites. However, designing such a catalyst with high Pt loading and good durability is very challenging. Here, single atomic Pt catalyst supported on antimony...... functional theory calculations show that replacing Sb sites with Pt atoms in the bulk phase or at the surface of SbSn or ATO is energetically favorable. The Pt1/ATO shows superior activity and durability for formic acid oxidation reaction, compared to a commercial Pt/C catalyst. The single atomic Pt...

  11. Scope and Limitations of the Nicking Enzyme Amplification Reaction for the Synthesis of Base-Modified Oligonucleotides and Primers for PCR

    Czech Academy of Sciences Publication Activity Database

    Ménová, Petra; Raindlová, Veronika; Hocek, Michal

    2013-01-01

    Roč. 24, č. 6 (2013), s. 1081-1093 ISSN 1043-1802 R&D Projects: GA ČR GA203/09/0317 Institutional support: RVO:61388963 Keywords : isothermal DNA amplification * cross-coupling reactions * nucleoside triphosphates * polymerase incorporation * functionalized DNA * nucleic-acids Subject RIV: CC - Organic Chemistry Impact factor: 4.821, year: 2013

  12. Improved single particle potential for transport model simulations of nuclear reactions induced by rare isotope beams

    International Nuclear Information System (INIS)

    Xu Chang; Li Baoan

    2010-01-01

    Taking into account more accurately the isospin dependence of nucleon-nucleon interactions in the in-medium many-body force term of the Gogny effective interaction, new expressions for the single-nucleon potential and the symmetry energy are derived. Effects of both the spin (isospin) and the density dependence of nuclear effective interactions on the symmetry potential and the symmetry energy are examined. It is shown that they both play a crucial role in determining the symmetry potential and the symmetry energy at suprasaturation densities. The improved single-nucleon potential will be useful for more accurate simulation of nuclear reactions induced by rare-isotope beams within transport models.

  13. Measurement of Neutron Reaction Cross Sections in Carbon using a Single Crystal Diamond Detector

    Energy Technology Data Exchange (ETDEWEB)

    Pillon, M.; Angelone, M. [Associazione EURATOM-ENEA sulla Fusione, ENEA C.R. Frascati, via E. Fermi, 45 0044 Frascati, Rome (Italy); Krasa, A.; Plompen, A. J. M.; Schillebeeckx, P. [European Commission, Joint Research Centre, Institute for Reference Materials and Measurements, - 2440 Geel (Belgium); Sergi, M. L. [Dipartimento di Fisica e Astronomia, Universita di Catania e INFN-Laboratori Nazionali del Sud, Catania (Italy)

    2011-12-13

    A single crystal diamond detector was exposed to the quasi mono-energetic neutron fields in the energy range from 7 MeV to 20.5 MeV produced by the Van de Graaff neutron generator of the EC-JRC-IRMM. Pulse Height Spectra (PHS) of the neutron interaction with the diamond (carbon) were recorded in order to derive the experimental response function of this detector to neutrons in view of its use as a compact fast neutron spectrometer. Several peaks produced by outgoing charged particles produced when neutrons interact with carbon were identified using the reaction Q-values. The corresponding nuclear reactions, such as (n,{alpha}), (n,p), (n,d) for different excitation states were identified in the PHS. The analysis of the peaks allows the derivation of some neutron reaction cross sections in carbon. The results are presented in this paper together with the associated uncertainties.

  14. Measurement of Neutron Reaction Cross Sections in Carbon using a Single Crystal Diamond Detector

    Science.gov (United States)

    Pillon, M.; Angelone, M.; Krása, A.; Plompen, A. J. M.; Schillebeeckx, P.; Sergi, M. L.

    2011-12-01

    A single crystal diamond detector was exposed to the quasi mono-energetic neutron fields in the energy range from 7 MeV to 20.5 MeV produced by the Van de Graaff neutron generator of the EC-JRC-IRMM. Pulse Height Spectra (PHS) of the neutron interaction with the diamond (carbon) were recorded in order to derive the experimental response function of this detector to neutrons in view of its use as a compact fast neutron spectrometer. Several peaks produced by outgoing charged particles produced when neutrons interact with carbon were identified using the reaction Q-values. The corresponding nuclear reactions, such as (n,α), (n,p), (n,d) for different excitation states were identified in the PHS. The analysis of the peaks allows the derivation of some neutron reaction cross sections in carbon. The results are presented in this paper together with the associated uncertainties.

  15. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  16. Detection of subgenomic mRNA of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (P-sg-QPCR).

    Science.gov (United States)

    Hornyák, Akos; Bálint, Adám; Farsang, Attila; Balka, Gyula; Hakhverdyan, Mikhayil; Rasmussen, Thomas Bruun; Blomberg, Jonas; Belák, Sándor

    2012-05-01

    Feline infectious peritonitis is one of the most severe devastating diseases of the Felidae. Upon the appearance of clinical signs, a cure for the infected animal is impossible. Therefore rapid and proper diagnosis for both the presence of the causative agent, feline coronavirus (FCoV) and the manifestation of feline infectious peritonitis is of paramount importance. In the present work, a novel real-time RT-PCR method is described which is able to detect FCoV and to determine simultaneously the quantity of the viral RNA. The new assay combines the M gene subgenomic messenger RNA (sg-mRNA) detection and the quantitation of the genome copies of FCoV. In order to detect the broadest spectrum of potential FCoV variants and to achieve the most accurate results in the detection ability the new assay is applying the primer-probe energy transfer (PriProET) principle. This technology was chosen since PriProET is very robust to tolerate the nucleotide substitutions in the target area. Therefore, this technology provides a very broad-range system, which is able to detect simultaneously many variants of the virus(es) even if the target genomic regions show large scale of variations. The detection specificity of the new assay was proven by positive amplification from a set of nine different FCoV strains and negative from the tested non-coronaviral targets. Examination of faecal samples of healthy young cats, organ samples of perished animals, which suffered from feline infectious peritonitis, and cat leukocytes from uncertain clinical cases were also subjected to the assay. The sensitivity of the P-sg-QPCR method was high, since as few as 10 genome copies of FCoV were detected. The quantitative sg-mRNA detection method revealed more than 10-50,000 times increase of the M gene sg-mRNA in organ materials of feline infectious peritonitis cases, compared to those of the enteric FCoV variants present in the faeces of normal, healthy cats. These results indicate the applicability of

  17. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification.

    Directory of Open Access Journals (Sweden)

    Junsun Kim

    Full Text Available Real-time PCR, also called quantitative PCR (qPCR, has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN. One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction.

  18. Detection of EGFR Gene Mutations in 100 Non-small Cell Lung Cancer Clinical Samples by a Real-time Polymerase Chain Reaction Method Using Amplification Refractory Mutation System Specific Primers and Taqman Fluorescence Probes

    Directory of Open Access Journals (Sweden)

    Jing ZHAO

    2013-01-01

    Full Text Available Background and objective Epidermal growth factor receptor (EGFR gene mutation is the most important predictor of the efficiency of EGFR-tyrosine kinase inhibitors in the treatment of non-small cell lung cancer (NSCLC. The detection of EGFR gene mutations can guide individual therapies for NSCLC. Numerous methods are used to detect EGFR gene mutation and each method has different features. This study aims to establish a real-time polymerase chain reaction (PCR method for the detection of EGFR gene mutations using amplification refractory mutation system (ARMS specific primers and Taqman fluorescence probes. Methods ARMS specific primers for the two EGFR gene mutations (E746_A750 and L858R and Taqman fluorescence probes for the detection of the target sequence were carefully designed by the Primer Premier 5.0 software. Then, using the recombinants containing E746_A750 and L858R mutations as the study objects, we further analyzed the sensitivity and lower limit of this method, and then determined the cutoff ΔCt value to evaluate specific or non-specific amplification. A total of 100 clinical samples were collected and used to detect the EGFR gene mutations using this method. Results The lower limit of this method for the detection of EGFR gene mutation was 10 copies if no interference of wild-type EGFR gene or background DNA existed. Regarding the method sensitivity, the detection resolution was as high as 1% and 0.1%-0.5% in the background of 500 and 5,000 copies/μL wild-type EGFR gene, respectively. Regarding the method specificity, non-specific amplifications were found when it was used to detect 21 L858R mutations in leukocyte DNA samples from healthy volunteers. However, the minimal ΔCt value was 14.48. Non-specific amplifications were not found when detecting 19 Del mutations. Among the 100 clinical samples, 39 mutations were detected (19 Del and 21 L858R were 21 and 18, respectively using this method. The total mutation rate was 39

  19. Electrochemical Dynamics of a Single Platinum Nanoparticle Collision Event for the Hydrogen Evolution Reaction.

    Science.gov (United States)

    Xiang, Zhi-Peng; Deng, Hai-Qiang; Peljo, Pekka; Fu, Zhi-Yong; Wang, Su-Li; Mandler, Daniel; Sun, Gong-Quan; Liang, Zhen-Xing

    2018-03-19

    Chronoamperometry was used to study the dynamics of Pt nanoparticle (NP) collision with an inert ultramicroelectrode via electrocatalytic amplification (ECA) in the hydrogen evolution reaction. ECA and dynamic light scattering (DLS) results reveal that the NP colloid remains stable only at low proton concentrations (1.0 mm) under a helium (He) atmosphere, ensuring that the collision events occur at genuinely single NP level. Amperometry of single NP collisions under a He atmosphere shows that each discrete current profile of the collision event evolves from spike to staircase at more negative potentials, while a staircase response is observed at all of the applied potentials under hydrogen-containing atmospheres. The particle size distribution estimated from the diffusion-controlled current in He agrees well with electron microscopy and DLS observations. These results shed light on the interfacial dynamics of the single nanoparticle collision electrochemistry. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Kinetics of Single-Enzyme Reactions on Vesicles: Role of Substrate Aggregation

    Science.gov (United States)

    Zhdanov, Vladimir P.

    2015-03-01

    Enzymatic reactions occurring in vivo on lipid membranes can be influenced by various factors including macromolecular crowding in general and substrate aggregation in particular. In academic studies, the role of these factors can experimentally be clarified by tracking single-enzyme kinetics occurring on individual lipid vesicles. To extend the conceptual basis for such experiments, we analyze herein the corresponding kinetics mathematically with emphasis on the role of substrate aggregation. In general, the aggregation may occur on different length scales. Small aggregates may e.g. contain a few proteins or peptides while large aggregates may be mesoscopic as in the case of lipid domains which can be formed in the membranes composed of different lipids. We present a kinetic model describing comprehensively the effect of aggregation of the former type on the dependence of the reaction rate on substrate membrane concentration. The results obtained with physically reasonable parameters indicate that the aggregation-related deviations from the conventional Michaelis-Menten kinetics may be appreciable. Special Issue Comments: This theoretical article is focused on single-enzyme reactions occurring in parallel with substrate aggregation on individual vesicles. This subject is related to a few Special Issue articles concerning enzyme dynamics6,7 and function8 and mathematical aspects of stochastic kinetics.9

  1. Studying Chemical Reactions, One Bond at a Time, with Single Molecule AFM Techniques

    Science.gov (United States)

    Fernandez, Julio M.

    2008-03-01

    The mechanisms by which mechanical forces regulate the kinetics of a chemical reaction are unknown. In my lecture I will demonstrate how we use single molecule force-clamp spectroscopy and protein engineering to study the effect of force on the kinetics of thiol/disulfide exchange. Reduction of disulfide bond via the thiol/disulfide exchange chemical reaction is crucial in regulating protein function and is of common occurrence in mechanically stressed proteins. While reduction is thought to proceed through a substitution nucleophilic bimolecular (SN2) reaction, the role of a mechanical force in modulating this chemical reaction is unknown. We apply a constant stretching force to single engineered disulfide bonds and measure their rate of reduction by dithiothreitol (DTT). We find that while the reduction rate is linearly dependent on the concentration of DTT, it is exponentially dependent on the applied force, increasing 10-fold over a 300 pN range. This result predicts that the disulfide bond lengthens by 0.34 å at the transition state of the thiol/disulfide exchange reaction. In addition to DTT, we also study the reduction of the engineered disulfide bond by the E. coli enzyme thioredoxin (Trx). Thioredoxins are enzymes that catalyze disulfide bond reduction in all organisms. As before, we apply a mechanical force in the range of 25-450 pN to the engineered disulfide bond substrate and monitor the reduction of these bonds by individual enzymes. In sharp contrast with the data obtained with DTT, we now observe two alternative forms of the catalytic reaction, the first requiring a reorientation of the substrate disulfide bond, causing a shortening of the substrate polypeptide by 0.76±0.07 å, and the second elongating the substrate disulfide bond by 0.21±0.01 å. These results support the view that the Trx active site regulates the geometry of the participating sulfur atoms, with sub-ångström precision, in order to achieve efficient catalysis. Single molecule

  2. Force-induced chemical reactions on the metal centre in a single metalloprotein molecule.

    Science.gov (United States)

    Zheng, Peng; Arantes, Guilherme M; Field, Martin J; Li, Hongbin

    2015-06-25

    Metalloproteins play indispensable roles in biology owing to the versatile chemical reactivity of metal centres. However, studying their reactivity in many metalloproteins is challenging, as protein three-dimensional structure encloses labile metal centres, thus limiting their access to reactants and impeding direct measurements. Here we demonstrate the use of single-molecule atomic force microscopy to induce partial unfolding to expose metal centres in metalloproteins to aqueous solution, thus allowing for studying their chemical reactivity in aqueous solution for the first time. As a proof-of-principle, we demonstrate two chemical reactions for the FeS4 centre in rubredoxin: electrophilic protonation and nucleophilic ligand substitution. Our results show that protonation and ligand substitution result in mechanical destabilization of the FeS4 centre. Quantum chemical calculations corroborated experimental results and revealed detailed reaction mechanisms. We anticipate that this novel approach will provide insights into chemical reactivity of metal centres in metalloproteins under biologically more relevant conditions.

  3. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  4. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  5. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  6. Measurement of adenosine triphosphate (ATP) content in single red blood cells using the firefly bioluminescent reaction

    Energy Technology Data Exchange (ETDEWEB)

    Kostuk, R.K.; Muhs, A.G.; Kirkpatrick, F.H.; Gabel, C.W.

    1977-01-01

    A unique optical instrument is described which uses the firefly bioluminscent reaction to measure adenosine triphosphate (ATP) levels in single red blood cells. The method allows chemical content level to be associated with individual cell features. The optical instrument consists of a phase contrast microscope to view cells, a pulsed argon-ion laser to rupture the cell membrane, and a photon counting system to measure the bioluminescent yield. The technique has been calibrated against a standard ATP measurement using bulk analysis methods. The ATP loss mechanism for blood cells in a controlled depletion experiment was also investigated.

  7. Identification of latent neosporosis in sheep in Tehran, Iran by polymerase chain reaction using primers specific for the Nc-5 gene.

    Science.gov (United States)

    Arbabi, Mohsen; Abdoli, Amir; Dalimi, Abdolhossein; Pirestani, Majid

    2016-08-11

    Little is known about latent infection and molecular characterisation of Neospora caninum in sheep (Ovis aries). In this study, 330 sheep samples (180 hearts and 150 brains) were analysed for N. caninum DNA by nested polymerase chain reaction (PCR) targeting the Nc-5 gene. Neospora caninum DNA was detected in 3.9% (13/330) of sheep samples. The parasite's DNA was detected in 6.7% of heart samples (12/180) and 0.7% (1/150) of brain samples. No clinical signs were recorded from infected or uninfected animals. Sequencing of the genomic DNA revealed 96% - 99% similarity with each other and 95.15% - 100% similarity with N. caninum sequences deposited in GenBank. To our knowledge, this is the first report on the use of PCR to identify latent neosporosis in sheep in Iran. The results of this study have the potential to contribute to our understanding of the role of N. caninum-infected sheep in the epidemiology of neosporosis.

  8. Identification of latent neosporosis in sheep in Tehran, Iran by polymerase chain reaction using primers specific for the Nc-5 gene

    Directory of Open Access Journals (Sweden)

    Mohsen Arbabi

    2016-03-01

    Full Text Available Little is known about latent infection and molecular characterisation of Neospora caninum in sheep (Ovis aries. In this study, 330 sheep samples (180 hearts and 150 brains were analysed for N. caninum DNA by nested polymerase chain reaction (PCR targeting the Nc-5 gene. Neospora caninum DNA was detected in 3.9% (13/330 of sheep samples. The parasite’s DNA was detected in 6.7% of heart samples (12/180 and 0.7% (1/150 of brain samples. No clinical signs were recorded from infected or uninfected animals. Sequencing of the genomic DNA revealed 96% – 99% similarity with each other and 95.15% – 100% similarity with N. caninum sequences deposited in GenBank. To our knowledge, this is the first report on the use of PCR to identify latent neosporosis in sheep in Iran. The results of this study have the potential to contribute to our understanding of the role of N. caninum-infected sheep in the epidemiology of neosporosis.

  9. Thermally reversible single-crystal to single-crystal transformation of mononuclear to dinuclear Zn(II) complexes by [2+2] cycloaddition reaction.

    Science.gov (United States)

    Medishetty, Raghavender; Yap, Terence Teck Sheng; Koh, Lip Lin; Vittal, Jagadese J

    2013-10-25

    Two Zn(II) complexes of trans-4-styrylpyridine ligands undergo [2+2] cycloaddition reaction forming Zn(II) complex dimers in a single-crystal to single-crystal (SCSC) manner which were thermally reversible. The dimers are presumed to be the stable intermediates in the formation of 1D coordination polymers upon prolonged exposure to UV light.

  10. Ligand-tailored single-site silica supported titanium catalysts: Synthesis, characterization and towards cyanosilylation reaction

    International Nuclear Information System (INIS)

    Xu, Wei; Li, Yani; Yu, Bo; Yang, Jindou; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    A successive anchoring of Ti(NMe 2 ) 4 , cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on silica was conducted by SOMC strategy in moderate conditions. The silica, monitored by in-situ Fourier transform infrared spectroscopy (in-situ FT-IR), was pretreated at different temperatures (200, 500 and 800 °C). The ligand tailored silica-supported titanium complexes were characterized by in-situ FT-IR, 13 C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) and elemental analysis in detail, verifying that the surface titanium species are single sited. The catalytic activity of the ligand tailored single-site silica supported titanium complexes was evaluated by a cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the dehydroxylation temperatures of silica and the configuration of the ligands. - Graphical abstract: The ligand-tailored silica supported “single site” titanium complexes were synthesized by SOMC strategy and fully characterized. Their catalytic activity were evaluated by benzaldehyde silylcyanation. - Highlights: • Single-site silica supported Ti active species was prepared by SOMC technique. • O-donor ligand tailored Ti surface species was synthesized. • The surface species was characterized by XPS, 13 C CP-MAS NMR, XANES etc. • Catalytic activity of the Ti active species in silylcyanation reaction was evaluated

  11. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  12. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  13. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  14. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse

    Science.gov (United States)

    Hansell, Claire F.; Lu, Annhelen; Patterson, Joseph P.; O'Reilly, Rachel K.

    2014-03-01

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and 1H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and 1H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated. Electronic supplementary information (ESI) available: Further synthetic detail, 1H and 13C NMR spectra, control experiments, TEM images, SANS and DLS data. See DOI: 10.1039/c3nr06706h

  15. Microfluidic Fabrication of Porous Polymer Microspheres: Dual Reactions in Single Droplets

    KAUST Repository

    Gong, Xiuqing

    2009-06-16

    We report the microfluidic fabrication of macroporous polymer microspheres via the simultaneous reactions within single droplets, induced by LTV irradiation. The aqueous phase of the reaction is the decomposition of H 2O2 to yield oxygen, whereas the organic phase is the polymerization of NO A 61, ethylene glycol dimethacrylate (EGDMA), and tri (propylene glycol) diacrylate (TPGDA) precursors. We first used a liquid polymer precursor to encapsulate a multiple number of magnetic Fe3O 4 colloidal suspension (MCS) droplets in a core-shell structure, for the purpose of studying the number of such encapsulated droplets that can be reliably controlled through the variation of flow rates. It was found that the formation of one shell with one, two, three, or more encapsulated droplets is possible. Subsequently, the H2O2 solution was encapsulated in the same way, after which we investigated its decomposition under UV irradiation, which simultaneously induces the polymerization of the encapsulating shell. Because the H2O2 decomposition leads to the release of oxygen, porous microspheres were obtained from a combined H2O2 decomposition/polymer precursor polymerization reaction. The multiplicity of the initially encapsulated H2O 2 droplets ensures the homogeneous distribution of the pores. The pores inside the micrometer-sized spheres range from several micrometers to tens of micrometers, and the maximum internal void volume fraction can attain 70%, similar to that of high polymerized high internal phase emulsion (polyHIPE). © 2009 American Chemical Society.

  16. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  17. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  18. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  19. Synteny analysis provides a route to design genus-specific PCR primers for rapid identification of all Saccharomyces species.

    Science.gov (United States)

    Sharpe, Ben; Hulin, Michelle; Thorne-Wallis, James; Wheals, Alan

    2014-05-01

    The genus Saccharomyces comprises seven single-genome species (S. arboricola, S. cerevisiae, S. eubayanus, S. kudriavzevii, S. mikatae, S. paradoxus and S. uvarum) and two hybrid species - S. pastorianus (S. cerevisiae plus S. eubayanus) and S. bayanus (mostly S. uvarum plus S. eubayanus). Species-specific primers have already been developed for the identification of each of the single-genome species, and these primers can usually detect both genomes in hybrids. It would be advantageous if a single reaction could detect any member of the clade. We have investigated three potentially generic approaches to design genus-specific primers. Two methods that both use sequence alignment differences for primer design were only partly successful. A third method used synteny data to identify 136 target genes that are potentially present only in all species of the Saccharomyces clade. HSP30 (YCR021C) was fully successful; different primer pairs were developed with high G+C content for use at 63 °C. In genus. This novel approach still uses conventional sequence alignment mismatches but relies principally on the presence of the target gene only within the genus Saccharomyces. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  20. Structure and Reactions of 11Be: Many-Body Basis for Single-Neutron Halo

    Science.gov (United States)

    Barranco, F.; Potel, G.; Broglia, R. A.; Vigezzi, E.

    2017-08-01

    The exotic nucleus 11Be has been extensively studied and much experimental information is available on the structure of this system. We treat, within the framework of renormalized nuclear field theory in both configuration and 3D space, the mixing of bound and continuum single-particle states through the coupling to collective vibrations of the 10Be core. We also take care of the Pauli principle acting not only between the single valence particle explicitly considered and those participating in the collective states, but also between fermions involved in two-phonon virtual states dressing the single-particle motion. In this way, it is possible to simultaneously and quantitatively account for the energies of the 1 /2+ , 1 /2- low-lying states, the centroid and line shape of the 5 /2+ resonance and the one-nucleon stripping and pickup absolute differential cross sections involving 11Be as either target or residual nucleus. Also for the dipole transition connecting the 1 /2+ and 1 /2- parity inverted levels as well as the isotopic shift of the charge radius. Theory provides a unified and exhaustive nuclear structure and reaction characterization of the many-body effects which are at the basis of this paradigmatic one-neutron halo system.

  1. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  2. Propensity approach to nonequilibrium thermodynamics of a chemical reaction network: controlling single E-coli β-galactosidase enzyme catalysis through the elementary reaction steps.

    Science.gov (United States)

    Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam

    2013-12-28

    In this work, we develop an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the elementary reaction propensities. The method is akin to the microscopic formulation of the dissipation function in terms of the Kullback-Leibler distance of phase space trajectories in Hamiltonian system. The formalism is applied to a single oligomeric enzyme kinetics at chemiostatic condition that leads the reaction system to a nonequilibrium steady state, characterized by a positive total entropy production rate. Analytical expressions are derived, relating the individual reaction contributions towards the total entropy production rate with experimentally measurable reaction velocity. Taking a real case of Escherichia coli β-galactosidase enzyme obeying Michaelis-Menten kinetics, we thoroughly analyze the temporal as well as the steady state behavior of various thermodynamic quantities for each elementary reaction. This gives a useful insight in the relative magnitudes of various energy terms and the dissipated heat to sustain a steady state of the reaction system operating far-from-equilibrium. It is also observed that, the reaction is entropy-driven at low substrate concentration and becomes energy-driven as the substrate concentration rises.

  3. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  4. Quasifree (p , 2 p ) Reactions on Oxygen Isotopes: Observation of Isospin Independence of the Reduced Single-Particle Strength

    Science.gov (United States)

    Atar, L.; Paschalis, S.; Barbieri, C.; Bertulani, C. A.; Díaz Fernández, P.; Holl, M.; Najafi, M. A.; Panin, V.; Alvarez-Pol, H.; Aumann, T.; Avdeichikov, V.; Beceiro-Novo, S.; Bemmerer, D.; Benlliure, J.; Boillos, J. M.; Boretzky, K.; Borge, M. J. G.; Caamaño, M.; Caesar, C.; Casarejos, E.; Catford, W.; Cederkall, J.; Chartier, M.; Chulkov, L.; Cortina-Gil, D.; Cravo, E.; Crespo, R.; Dillmann, I.; Elekes, Z.; Enders, J.; Ershova, O.; Estrade, A.; Farinon, F.; Fraile, L. M.; Freer, M.; Galaviz Redondo, D.; Geissel, H.; Gernhäuser, R.; Golubev, P.; Göbel, K.; Hagdahl, J.; Heftrich, T.; Heil, M.; Heine, M.; Heinz, A.; Henriques, A.; Hufnagel, A.; Ignatov, A.; Johansson, H. T.; Jonson, B.; Kahlbow, J.; Kalantar-Nayestanaki, N.; Kanungo, R.; Kelic-Heil, A.; Knyazev, A.; Kröll, T.; Kurz, N.; Labiche, M.; Langer, C.; Le Bleis, T.; Lemmon, R.; Lindberg, S.; Machado, J.; Marganiec-Gałązka, J.; Movsesyan, A.; Nacher, E.; Nikolskii, E. Y.; Nilsson, T.; Nociforo, C.; Perea, A.; Petri, M.; Pietri, S.; Plag, R.; Reifarth, R.; Ribeiro, G.; Rigollet, C.; Rossi, D. M.; Röder, M.; Savran, D.; Scheit, H.; Simon, H.; Sorlin, O.; Syndikus, I.; Taylor, J. T.; Tengblad, O.; Thies, R.; Togano, Y.; Vandebrouck, M.; Velho, P.; Volkov, V.; Wagner, A.; Wamers, F.; Weick, H.; Wheldon, C.; Wilson, G. L.; Winfield, J. S.; Woods, P.; Yakorev, D.; Zhukov, M.; Zilges, A.; Zuber, K.; R3B Collaboration

    2018-01-01

    Quasifree one-proton knockout reactions have been employed in inverse kinematics for a systematic study of the structure of stable and exotic oxygen isotopes at the R3B /LAND setup with incident beam energies in the range of 300 - 450 MeV /u . The oxygen isotopic chain offers a large variation of separation energies that allows for a quantitative understanding of single-particle strength with changing isospin asymmetry. Quasifree knockout reactions provide a complementary approach to intermediate-energy one-nucleon removal reactions. Inclusive cross sections for quasifree knockout reactions of the type O A (p ,2 p )N-1A have been determined and compared to calculations based on the eikonal reaction theory. The reduction factors for the single-particle strength with respect to the independent-particle model were obtained and compared to state-of-the-art ab initio predictions. The results do not show any significant dependence on proton-neutron asymmetry.

  5. Ligand-tailored single-site silica supported titanium catalysts: Synthesis, characterization and towards cyanosilylation reaction

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Li, Yani; Yu, Bo; Yang, Jindou; Zhang, Ying; Chen, Xi; Zhang, Guofang, E-mail: gfzhang@snnu.edu.cn; Gao, Ziwei, E-mail: zwgao@snnu.edu.cn

    2015-01-15

    A successive anchoring of Ti(NMe{sub 2}){sub 4}, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on silica was conducted by SOMC strategy in moderate conditions. The silica, monitored by in-situ Fourier transform infrared spectroscopy (in-situ FT-IR), was pretreated at different temperatures (200, 500 and 800 °C). The ligand tailored silica-supported titanium complexes were characterized by in-situ FT-IR, {sup 13}C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) and elemental analysis in detail, verifying that the surface titanium species are single sited. The catalytic activity of the ligand tailored single-site silica supported titanium complexes was evaluated by a cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the dehydroxylation temperatures of silica and the configuration of the ligands. - Graphical abstract: The ligand-tailored silica supported “single site” titanium complexes were synthesized by SOMC strategy and fully characterized. Their catalytic activity were evaluated by benzaldehyde silylcyanation. - Highlights: • Single-site silica supported Ti active species was prepared by SOMC technique. • O-donor ligand tailored Ti surface species was synthesized. • The surface species was characterized by XPS, {sup 13}C CP-MAS NMR, XANES etc. • Catalytic activity of the Ti active species in silylcyanation reaction was evaluated.

  6. Hydrogen Evolution Reaction in Alkaline Solution: From Theory, Single Crystal Models, to Practical Electrocatalysts.

    Science.gov (United States)

    Zheng, Yao; Jiao, Yan; Qiao, Shizhang; Vasileff, Anthony

    2017-12-01

    The hydrogen evolution reaction (HER) is a fundamental process in electrocatalysis and plays an important role in energy conversion for the development of hydrogen-based energy sources. However, the considerably slow rate of the HER in alkaline conditions has hindered advances in water splitting techniques for high-purity hydrogen production. Differing from well documented acidic HER, the mechanistic aspects of alkaline HER are yet to be settled. Herein, we present a critical appraisal of alkaline HER electrocatalysis, with a special emphasis on the connection between fundamental surface electrochemistry on single crystal models and the derived molecular design principle for real-world electrocatalysts. By presenting some typical examples across theoretical calculations, surface characterization, and electrochemical experiments, we try to address some key ongoing debates to deliver a better understanding of alkaline HER at the atomic level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  8. Understanding the Oxygen Reduction Reaction on a Y/Pt(111) Single Crystal

    DEFF Research Database (Denmark)

    Ulrikkeholm, Elisabeth Therese; Johansson, Tobias Peter; Malacrida, Paolo

    2014-01-01

    Polymer electrolyte membrane fuel cells (PEMFC) hold promise as a zero-emission source of power, particularly suitable for automotive vehicles. However, the high loading of Pt required to catalyse the oxygen reduction reaction (ORR) at the PEMFC cathode, prevents the commercialisation of this tec......Polymer electrolyte membrane fuel cells (PEMFC) hold promise as a zero-emission source of power, particularly suitable for automotive vehicles. However, the high loading of Pt required to catalyse the oxygen reduction reaction (ORR) at the PEMFC cathode, prevents the commercialisation...... of this technology. Improving the activity of Pt by alloying it with other metals could decrease the loading of Pt. An earlier theoretical study conducted at our laboratory identified PtxY as an active and stable catalyst for oxygen reduction. Experiments conducted on sputter-cleaned polycrystalline Pt3Y confirmed...... was significantly different from our initial expectations. In order to understand this phenomenon, we investigated a Y/Pt(111) single crystal, formed by depositing large amounts of Y om Pt(111) under ultra-high vacuum (UHV) conditions and annealing to high temperatures. We subsequently characterised the surface...

  9. A detector system for studying nuclear reactions relevant to Single Event Effects

    Energy Technology Data Exchange (ETDEWEB)

    Murin, Yu. [V.G. Khlopin Radium Institute, 2nd Murinski 28, 194021 St. Petersburg (Russian Federation)]. E-mail: murin@jinr.ru; Babain, Yu. [V.G. Khlopin Radium Institute, 2nd Murinski 28, 194021 St. Petersburg (Russian Federation); Chubarov, M. [V.G. Khlopin Radium Institute, 2nd Murinski 28, 194021 St. Petersburg (Russian Federation); Tuboltsev, Yu. [V.G. Khlopin Radium Institute, 2nd Murinski 28, 194021 St. Petersburg (Russian Federation); Pljuschev, V. [V.G. Khlopin Radium Institute, 2nd Murinski 28, 194021 St. Petersburg (Russian Federation); Zubkov, M. [V.G. Khlopin Radium Institute, 2nd Murinski 28, 194021 St. Petersburg (Russian Federation); Nomokonov, P. [High Energy Laboratory, Joint Institute for Nuclear Research, 141980 Moscow Region (Russian Federation); Voronin, A. [Moscow State University, 119992 Moscow (Russian Federation); Merkin, M. [Moscow State University, 119992 Moscow (Russian Federation); Kondratiev, V. [St. Petersburg State University, 198504 St. Petersburg (Russian Federation); Olsson, N.; Blomgren, J. [Department of Neutron Research, Uppsala University, Box 525, SE 751 20 Uppsala (Sweden); Westerberg, L. [Department of Physics, Uppsala University, Box 530, SE 751 21 Uppsala (Sweden); Ekstroem, C.; Kolozhvari, A. [The Svedberg Laboratory, Uppsala University, Box 533, SE 751 21 Uppsala (Sweden); Jaederstroem, H. [Department of Nuclear and Particle Physics, Uppsala University, Box 531, SE 751 21 Uppsala (Sweden); Jakobsson, B.; Golubev, P. [Department of Physics, Lund University, Box 118, SE 221 00 Lund (Sweden); Bargholz, Chr.; Geren, L.; Tegner, P.-E.; Zartova, I. [Department of Physics, Stockholm University, AlbaNova, SE 10691 Stockholm (Sweden); Budzanowski, A.; Czech, B.; Skwirczynska, I. [H. Niewodniczanski Institute of Nuclear Physics, PL 31 342 Cracow (Poland); Tang, H.H.K. [IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598 (United States)

    2007-08-01

    We describe a device to study reactions relevant for the Single Event Effect (SEE) in microelectronics by means of 200A and 300AMeV, inverse kinematics, Si+H and Si+D reactions. The work is focused on the possibility to measure Z=2-14 projectile fragments as efficiently as possible. During commissioning and first experiments the fourth quadrant of the CELSIUS storage ring acted as a spectrometer to register fragments in two planes of Si strip detectors in the angular region 0{sup a}t -0.6{sup a}t. A combination of ring-structured and sector-structured Si strip detector planes operated at angles 0.6{sup a}t-1.1{sup a}t. For specific event tagging a Si+ phoswich scintillator wall operated in the range 3.9{sup a}t-11.7{sup a}t and Si {delta}E-E telescopes of CHICSi type operated at large angles.

  10. Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)

    2010-03-15

    With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

  11. Single particle transfer reactions: what can they tell us about vibrational states

    International Nuclear Information System (INIS)

    Hering, W.R.

    1975-01-01

    The topic discussed concerns single particle transfer reactions (SPTR) which are, in general, used to study SP states. However, good SP states are rare objects in nature and people who try to look for them have often to settle with something less than ideal. Indeed the picture of a pure SP state is physically not even reasonable. It means that a nucleon is moving around a core nucleus which stays in its ground state: a process which one could call equivalent to elastic scattering of a nucleon which is not free but rather in a bound state. However it is shown that inelastic scattering is a very strong competitor to elastic scattering if the nucleus possesses states of high collectivity. Thus one would expect inelastic scattering to happen also while the nucleon is bound. This is a very intuitive picture of what is called the fragmentation of SP states. A final state psi sub(B) is populated by the transfer reaction A + a → B + b where psi sub(B) = α 1 phi 1 phi sub(A)(0) + α 2 phi 2 phi sub(A)(lambda). Hence the population of psi sub(B) automatically involves the collective state phi sub(A)(lambda). A discussion of how one can get information about phi sub(A)(lambda) out of the experimental data is given. (Auth.)

  12. Single particle tracking-based reaction progress kinetic analysis reveals a series of molecular mechanisms of cetuximab-induced EGFR processes in a single living cell.

    Science.gov (United States)

    Kim, Do-Hyeon; Kim, Dong-Kyun; Zhou, Kai; Park, Soyeon; Kwon, Yonghoon; Jeong, Min Gyu; Lee, Nam Ki; Ryu, Sung Ho

    2017-07-01

    Cellular processes occur through the orchestration of multi-step molecular reactions. Reaction progress kinetic analysis (RPKA) can provide the mechanistic details to elucidate the multi-step molecular reactions. However, current tools have limited ability to simultaneously monitor dynamic variations in multiple complex states at the single molecule level to apply RPKA in living cells. In this research, a single particle tracking-based reaction progress kinetic analysis (sptRPKA) was developed to simultaneously determine the kinetics of multiple states of protein complexes in the membrane of a single living cell. The subpopulation ratios of different states were quantitatively (and statistically) reliably extracted from the diffusion coefficient distribution rapidly acquired by single particle tracking at constant and high density over a long period of time using super-resolution microscopy. Using sptRPKA, a series of molecular mechanisms of epidermal growth factor receptor (EGFR) cellular processing induced by cetuximab were investigated. By comprehensively measuring the rate constants and cooperativity of the molecular reactions involving four EGFR complex states, a previously unknown intermediate state was identified that represents the rate limiting step responsible for the selectivity of cetuximab-induced EGFR endocytosis to cancer cells.

  13. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  14. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  15. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  16. N2O + CO reaction over single Ga or Ge atom embedded graphene: A DFT study

    Science.gov (United States)

    Esrafili, Mehdi D.; Vessally, Esmail

    2018-01-01

    The possibility of using a single Ga or Ge atom embedded graphene as an efficient catalyst for the reduction of N2O molecule by CO is examined. We perform density functional theory calculations to calculate adsorption energies as well as analysis of the structural and electronic properties of different species involved in the N2O + CO reaction. The large activation energy for the diffusion of the single Ga or Ge atom on the C vacancy site of graphene shows the high stability of both Ga- and Ge-embedded graphene sheets in the N2O reduction. The activation energy needed for the decomposition of N2O is calculated to be 18.4 and 14.1 kcal/mol over Ga- and Ge-embedded graphene, respectively. The results indicate that the Ge-embedded graphene may serve as an effective catalyst for the N2O reduction. Moreover, the activation energy for the disproportionation of N2O molecules that generates N2 and O2 is relatively high; so, the generation of these side products may be hindered by decreasing the temperature.

  17. A Novel Teaching-Learning-Based Optimization for Improved Mutagenic Primer Design in Mismatch PCR-RFLP SNP Genotyping.

    Science.gov (United States)

    Cheng, Yu-Huei

    2016-01-01

    Many single nucleotide polymorphisms (SNPs) for complex genetic diseases are genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in small-scale basic research studies. It is an essential work to design feasible PCR-RFLP primer pair and find out available restriction enzymes to recognize the target SNP for PCR experiments. However, many SNPs are incapable of performing PCR-RFLP makes SNP genotyping become unpractical. A genetic algorithm (GA) had been proposed for designing mutagenic primer and get available restriction enzymes, but it gives an unrefined solution in mutagenic primers. In order to improve the mutagenic primer design, we propose TLBOMPD (TLBO-based Mutagenic Primer Design) a novel computational intelligence-based method that uses the notion of "teaching and learning" to search for more feasible mutagenic primers and provide the latest available restriction enzymes. The original Wallace's formula for the calculation of melting temperature is maintained, and more accurate calculation formulas of GC-based melting temperature and thermodynamic melting temperature are introduced into the proposed method. Mutagenic matrix is also reserved to increase the efficiency of judging a hypothetical mutagenic primer if involve available restriction enzymes for recognizing the target SNP. Furthermore, the core of SNP-RFLPing version 2 is used to enhance the mining work for restriction enzymes based on the latest REBASE. Twenty-five SNPs with mismatch PCR-RFLP screened from 288 SNPs in human SLC6A4 gene are used to appraise the TLBOMPD. Also, the computational results are compared with those of the GAMPD. In the future, the usage of the mutagenic primers in the wet lab needs to been validated carefully to increase the reliability of the method. The TLBOMPD is implemented in JAVA and it is freely available at http://tlbompd.googlecode.com/.

  18. Applications of a single-molecule detection in early disease diagnosis and enzymatic reaction study

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jiangwei [Iowa State Univ., Ames, IA (United States)

    2008-01-01

    Various single-molecule techniques were utilized for ultra-sensitive early diagnosis of viral DNA and antigen and basic mechanism study of enzymatic reactions. DNA of human papilloma virus (HPV) served as the screening target in a flow system. Alexa Fluor 532 (AF532) labeled single-stranded DNA probes were hybridized to the target HPV-16 DNA in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell and had a linear dynamic range of over 6 orders of magnitude. In the dual-color mode, fluorescence resonance energy transfer (FRET) was employed to achieve zero false-positive count. We also showed that DNA extracts from Pap test specimens did not interfere with the system. A surface-based method was used to improve the throughput of the flow system. HPV-16 DNA was hybridized to probes on a glass surface and detected with a total internal reflection fluorescence (TIRF) microscope. In the single-probe mode, the whole genome and target DNA were fluorescently labeled before hybridization, and the detection limit is similar to the flow system. In the dual-probe mode, a second probe was introduced. The linear dynamic range covers 1.44-7000 copies/cell, which is typical of early infection to near-cancer stages. The dual-probe method was tested with a crudely prepared sample. Even with reduced hybridization efficiency caused by the interference of cellular materials, we were still able to differentiate infected cells from healthy cells. Detection and quantification of viral antigen with a novel single-molecule immunosorbent assay (SMISA) was achieved. Antigen from human immunodeficiency virus type 1(HIV-1) was chosen to be the target in this study. The target was sandwiched between a monoclonal capture antibody and a

  19. Species specific polymerase chain reaction (PCR) assay for ...

    African Journals Online (AJOL)

    A highly specific single step polymerase chain reaction (PCR) is described for the detection of pig (Sus domesticus) meat. A PCR assay was successfully optimized for amplification of 629 and 322-bp DNA fragment extracted from pig meat using designed species-specific primer pairs based on mitochondrial D-loop and 12S ...

  20. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  1. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  3. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  4. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per

    2012-01-01

    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  5. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  6. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  7. Ground reaction forces and knee kinetics during single and repeated badminton lunges.

    Science.gov (United States)

    Lam, Wing Kai; Ding, Rui; Qu, Yi

    2017-03-01

    Repeated movement (RM) lunge that frequently executed in badminton might be used for footwear evaluation. This study examined the influence of single movement (SM) and RM lunges on the ground reaction forces (GRFs) and knee kinetics during the braking phase of a badminton lunge step. Thirteen male university badminton players performed left-forward lunges in both SM and RM sessions. Force platform and motion capturing system were used to measure GRFs and knee kinetics variables. Paired t-test was performed to determine any significant differences between SM and RM lunges regarding mean and coefficient of variation (CV) in each variable. The kinetics results indicated that compared to SM lunges, the RM lunges had shorter contact time and generated smaller maximum loading rate of impact force, peak knee anterior-posterior force, and peak knee sagittal moment but generated larger peak horizontal resultant forces (Ps forces (Ps < 0.05). These results suggested that the RM testing protocols had a distinct loading response and adaptation pattern during lunge and that the RM protocol showed higher within-trial reliability, which may be beneficial for the knee joint loading evaluation under different interventions.

  8. A nonlocal and periodic reaction-diffusion-advection model of a single phytoplankton species.

    Science.gov (United States)

    Peng, Rui; Zhao, Xiao-Qiang

    2016-02-01

    In this article, we are concerned with a nonlocal reaction-diffusion-advection model which describes the evolution of a single phytoplankton species in a eutrophic vertical water column where the species relies solely on light for its metabolism. The new feature of our modeling equation lies in that the incident light intensity and the death rate are assumed to be time periodic with a common period. We first establish a threshold type result on the global dynamics of this model in terms of the basic reproduction number R0. Then we derive various characterizations of R0 with respect to the vertical turbulent diffusion rate, the sinking or buoyant rate and the water column depth, respectively, which in turn give rather precise conditions to determine whether the phytoplankton persist or become extinct. Our theoretical results not only extend the existing ones for the time-independent case, but also reveal new interesting effects of the modeling parameters and the time-periodic heterogeneous environment on persistence and extinction of the phytoplankton species, and thereby suggest important implications for phytoplankton growth control.

  9. Single hole spectroscopic strength in 98Ru through the 99Ru(d,t) reaction

    International Nuclear Information System (INIS)

    Rodrigues, M.R.D.; Borello-Lewin, T.; Horodynski-Matsushigue, L.B.; Duarte, J.L.M.; Rodrigues, C.L.; Barbosa, M.D.L.; Silva, G.B. da; Ukita, G.M.

    2002-01-01

    The 99 Ru(d,t) 98 Ru reaction was measured for the first time at 16 MeV incident energy with the Sao Paulo Pelletron-Enge-spectrograph facility employing the nuclear emulsion technique. In all, up to 3.5 MeV, 23 levels were detected, eight of them new; angular distributions are presented for all of them. Least squares fits of distorted wave Born approximation one-neutron pickup predictions to the rather well structured experimental angular distributions enabled the determination of l transfers and of the corresponding spectroscopic factors for 19 of these states, some being tentative attributions. Only transfers of l=0, 2, and 4 were observed. Several states were populated through single l transfers. A pure l=2 transfer is associated with the 2 1 + level and with several other states which are considered collective, as well as with the (4 + ) state at 2.277 MeV, which presents the highest spectroscopic strength. Considering five valence neutrons above the N=50 core, only 41% of the spectroscopic strength expected for 99 Ru was detected

  10. Reaction

    African Journals Online (AJOL)

    abp

    19 oct. 2017 ... Axillary block is an easy and recommended technique in children. Its use in children with acute hepatitis A is not risk free especially when associated with sedation using remifentanil and propofol. Similarly, the presence of a single hydatid cyst allows general anesthesia with mono- pulmonary ventilation.

  11. Single nanowire resistive nano-heater for highly localized thermo-chemical reactions: localized hierarchical heterojunction nanowire growth.

    Science.gov (United States)

    Yeo, Junyeob; Kim, Gunho; Hong, Sukjoon; Lee, Jinhwan; Kwon, Jinhyeong; Lee, Habeom; Park, Heeseung; Manoroktul, Wanit; Lee, Ming-Tsang; Lee, Bong Jae; Grigoropoulos, Costas P; Ko, Seung Hwan

    2014-12-29

    A single nanowire resistive nano-heater (RNH) is fabricated, and it is demonstrated that the RNH can induce highly localized temperature fields, which can trigger highly localized thermo-chemical reactions to grow hierarchical nanowires directly at the desired specific spot such as ZnO nanowire branch growth on a single Ag nanowire. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The incidence of perioperative hypersensitivity reactions: a single-center, prospective, cohort study.

    Science.gov (United States)

    Berroa, Felicia; Lafuente, Alberto; Javaloyes, Gracia; Cabrera-Freitag, Paula; de la Borbolla, Juan M; Moncada, Rafael; Goikoetxea, Maria J; Sanz, Maria L; Ferrer, Marta; Gastaminza, Gabriel

    2015-07-01

    The incidence of perioperative hypersensitivity reactions, which can be life-threatening, ranges from 1 in 20,000 to 1 in 1361. These reactions are usually classified as IgE or non-IgE mediated. The aim of this study was to determine the incidence of allergic reactions during general anesthesia in our hospital, to establish the incidence of the allergic reactions for each drug used, to assess the frequency of IgE-mediated reactions in even mild reactions, and to compare the degree of agreement between anesthesiologist suspicion and allergy diagnosis. We included patients diagnosed with a clinical hypersensitivity reaction during a procedure under general anesthesia over a 30-month period (February 2008 to August 2010). Plasma histamine and serum tryptase concentrations were determined in these patients. We performed skin tests to diagnose the causative agent. Data from the hospital electronic prescribing system were collected to determine the ratio of reactions for each drug. During the study period, 16,946 anesthetic procedures were performed (53% involved males; mean age, 51.6 years). Forty-four perianesthetic reactions were recorded, and the ratio of reactions was 1 in 385 operations (95% confidence interval, 1/529-1/287). Twenty-five reactions (25/44; 57%) occurred during the induction of anesthesia. Twenty-one reactions (21/44; 48%) were mild, involving only skin, and 23 of 44 (52%) were anaphylactic reactions. Four of 10 patients who had only a rash experienced IgE-mediated reactions. Five surgeries (11%) were suspended because of the severity of the reactions. Fifteen reactions (15/30; 50%) were IgE mediated, and, in 2 of 30 (7%), a non-IgE agent was found (cold urticaria and nonsteroidal anti-inflammatory drug intolerance). The ratio of reactions for each drug was as follows: protamine, 1 in 468; cisatracurium, 1 in 1388; amoxicillin-clavulanate, 1 in 1968; atracurium, 1 in 2039; and dipyrone, 1 in 3159. Perioperative reactions are more common than

  13. Reaction-time-resolved measurements of laser-induced fluorescence in a shock tube with a single laser pulse

    Science.gov (United States)

    Zabeti, S.; Fikri, M.; Schulz, C.

    2017-11-01

    Shock tubes allow for the study of ultra-fast gas-phase reactions on the microsecond time scale. Because the repetition rate of the experiments is low, it is crucial to gain as much information as possible from each individual measurement. While reaction-time-resolved species concentration and temperature measurements with fast absorption methods are established, conventional laser-induced fluorescence (LIF) measurements with pulsed lasers provide data only at a single reaction time. Therefore, fluorescence methods have rarely been used in shock-tube diagnostics. In this paper, a novel experimental concept is presented that allows reaction-time-resolved LIF measurements with one single laser pulse using a test section that is equipped with several optical ports. After the passage of the shock wave, the reactive mixture is excited along the center of the tube with a 266-nm laser beam directed through a window in the end wall of the shock tube. The emitted LIF signal is collected through elongated sidewall windows and focused onto the entrance slit of an imaging spectrometer coupled to an intensified CCD camera. The one-dimensional spatial resolution of the measurement translates into a reaction-time-resolved measurement while the species information can be gained from the spectral axis of the detected two-dimensional image. Anisole pyrolysis was selected as the benchmark reaction to demonstrate the new apparatus.

  14. Three-dimensional on-chip continuous-flow polymerase chain reaction employing a single heater.

    Science.gov (United States)

    Wu, Wenming; Lee, Nae Yoon

    2011-06-01

    Multi-step temperature control in a polymerase chain reaction (PCR) is a limiting factor in device miniaturization and portability. In this study, we propose the fabrication of a three-dimensional (3D) microdevice employing a single heater to minimize temperature control required for an on-chip continuous-flow PCR as well as the overall footprint by stacking the device in multi-layers. Two poly(dimethylsiloxane) (PDMS) layers with differing thicknesses are vertically stacked with their microchannel-engraved sides facing down. Through-holes are made in the thicker PDMS layer, which is sandwiched between a glass substrate at the bottom and the thinner PDMS layer at the top. In this way, a fluidic conduit is realized in a 3D configuration. The assembled 3D microdevice is then placed onto a heater glass-side down. The interface of the two PDMS layers displays a relatively lower temperature than that of the PDMS and glass layers due to the low thermal conductivity of the PDMS and its physical distance from the heater. The denaturation temperature can be controlled by adjusting the temperature of the heater, while the annealing/extension temperature can be controlled automatically by molding the thicker bottom PDMS layer into the appropriate thickness calculated using a numerical derivation proposed in this study. In this way, a cumbersome temperature measurement step is eliminated. DNA amplification was successfully carried out using the proposed 3D fluidic microdevice, and the intensity of the resulting amplicon was comparable to that obtained using a thermal cycler. This novel concept of adopting a single heating source greatly simplifies the temperature control issue present in an on-chip continuous-flow PCR. It also allows the use of a commercialized hot plate as a potential heat source, paving the way for device miniaturization and portability in a highly cost-effective manner. In this study, a simple and facile technique to make arrays of through-holes for the

  15. Evaluation of canine adverse food reactions by patch testing with single proteins, single carbohydrates and commercial foods.

    Science.gov (United States)

    Johansen, Cornelia; Mariani, Claire; Mueller, Ralf S

    2017-10-01

    Adverse food reaction (AFR) is an important differential diagnosis for the pruritic dog. It is usually diagnosed by feeding an elimination diet with a novel protein and carbohydrate source for eight weeks followed by subsequent food provocation. A previous study demonstrated that patch testing dogs with foods had a high sensitivity and negative predictability for selection of elimination diet ingredients. The aim of this study was to investigate patch testing with proteins, carbohydrates and dry commercial dog food in dogs to determine whether there was value in patch testing to aid the diagnosis of canine adverse food reaction. Twenty five privately owned dogs, with confirmed AFR, underwent provocation trials with selected food antigens and patch testing. For proteins, carbohydrates and dry dog food the sensitivity of patch testing was 100%, 70% and 22.2%, respectively; the negative predictive values of patch testing were 100%, 79% and 72%. The positive predictive values of patch testing for proteins and carbohydrates were 75% and 74%, respectively. This study confirmed that patch testing may be useful for the selection of a suitable protein source for an elimination diet in dogs with suspected AFR, but not as a diagnostic tool for canine AFR. Results for proteins are more reliable than for carbohydrates and the majority of positive patch test reactions were observed with raw protein. Patch testing with commercial dog food does not seem to be useful. © 2017 ESVD and ACVD.

  16. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  17. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  18. Using Multiorder Time-Correlation Functions (TCFs) To Elucidate Biomolecular Reaction Pathways from Microsecond Single-Molecule Fluorescence Experiments.

    Science.gov (United States)

    Phelps, Carey; Israels, Brett; Marsh, Morgan C; von Hippel, Peter H; Marcus, Andrew H

    2016-12-29

    Recent advances in single-molecule fluorescence imaging have made it possible to perform measurements on microsecond time scales. Such experiments have the potential to reveal detailed information about the conformational changes in biological macromolecules, including the reaction pathways and dynamics of the rearrangements involved in processes, such as sequence-specific DNA "breathing" and the assembly of protein-nucleic acid complexes. Because microsecond-resolved single-molecule trajectories often involve "sparse" data, that is, they contain relatively few data points per unit time, they cannot be easily analyzed using the standard protocols that were developed for single-molecule experiments carried out with tens-of-millisecond time resolution and high "data density." Here, we describe a generalized approach, based on time-correlation functions, to obtain kinetic information from microsecond-resolved single-molecule fluorescence measurements. This approach can be used to identify short-lived intermediates that lie on reaction pathways connecting relatively long-lived reactant and product states. As a concrete illustration of the potential of this methodology for analyzing specific macromolecular systems, we accompany the theoretical presentation with the description of a specific biologically relevant example drawn from studies of reaction mechanisms of the assembly of the single-stranded DNA binding protein of the T4 bacteriophage replication complex onto a model DNA replication fork.

  19. The Pan-AC assay: a single-reaction real-time PCR test for quantitative detection of a broad range of Aspergillus and Candida species.

    Science.gov (United States)

    Basková, Lenka; Landlinger, Christine; Preuner, Sandra; Lion, Thomas

    2007-09-01

    In view of the growing incidence and the high mortality of invasive aspergillosis and candidiasis, adequate diagnostic techniques permitting timely onset of treatment are of paramount importance. More than 90 % of all invasive fungal infections in immunocompromised individuals can be attributed to Candida and Aspergillus species. To date, standardized techniques permitting rapid, sensitive and, no less importantly, economic screening for the clinically most relevant fungi are lacking. In the present report, a real-time quantitative PCR assay, developed for the detection of the most common pathogenic Candida and Aspergillus species, is described. The single-reaction PCR assay targets a judiciously selected region of the 28S subunit of the fungal rDNA gene. The unique design of the universal primer/probe system, including a pan-Aspergillus and pan-Candida (Pan-AC) hydrolysis probe, facilitates the detection of numerous Aspergillus species (e.g. Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus, Aspergillus versicolor and Aspergillus nidulans) and Candida species (e.g. Candida albicans, Candida glabrata, Candida krusei, Candida tropicalis, Candida parapsilosis, Candida kefyr, Candida guilliermondii, Candida lusitaniae and Candida dubliniensis). The assay permits highly reproducible detection of 10 fg fungal DNA, which corresponds to a fraction of a fungal genome, and facilitates accurate quantification of fungal load across a range of at least five logs. Upon standardization of the technique using cultured fungal strains, the applicability in the clinical setting was assessed by investigating a series of clinical specimens from patients with documented fungal infections (n=17). The Pan-AC assay provides an attractive and economic approach to the screening and monitoring of invasive aspergillosis and candidiasis, which is readily applicable to routine clinical diagnosis.

  20. Fast and quantitative differentiation of single-base mismatched DNA by initial reaction rate of catalytic hairpin assembly.

    Science.gov (United States)

    Li, Chenxi; Li, Yixin; Xu, Xiao; Wang, Xinyi; Chen, Yang; Yang, Xiaoda; Liu, Feng; Li, Na

    2014-10-15

    The widely used catalytic hairpin assembly (CHA) amplification strategy generally needs several hours to accomplish one measurement based on the prevailingly used maximum intensity detection mode, making it less practical for assays where high throughput or speed is desired. To make the best use of the kinetic specificity of toehold domain for circuit reaction initiation, we developed a mathematical model and proposed an initial reaction rate detection mode to quantitatively differentiate the single-base mismatch. Using the kinetic mode, assay time can be reduced substantially to 10 min for one measurement with the comparable sensitivity and single-base mismatch differentiating ability as were obtained by the maximum intensity detection mode. This initial reaction rate based approach not only provided a fast and quantitative differentiation of single-base mismatch, but also helped in-depth understanding of the CHA system, which will be beneficial to the design of highly sensitive and specific toehold-mediated hybridization reactions. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  2. Enrichment of semiconducting single-walled carbon nanotubes by carbothermic reaction for use in all-nanotube field effect transistors.

    Science.gov (United States)

    Li, Shisheng; Liu, Chang; Hou, Peng-Xiang; Sun, Dong-Ming; Cheng, Hui-Ming

    2012-11-27

    Selective removal of metallic single-walled carbon nanotubes (SWCNTs) and consequent enrichment of semiconducting SWCNTs were achieved through an efficient carbothermic reaction with a NiO thin film at a relatively low temperature of 350 °C. All-SWCNT field effect transistors (FETs) were fabricated with the aid of a patterned NiO mask, in which the as-grown SWCNTs behaving as source/drain electrodes and the remaining semiconducting SWCNTs that survive in the carbothermic reaction as a channel material. The all-SWCNT FETs demonstrate improved current ON/OFF ratios of ∼10(3).

  3. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  4. Detection of three honeybee viruses simultaneously by a single ...

    African Journals Online (AJOL)

    A single multiplex reverse transcriptase (RT) polymerase chain reaction (PCR) assay was developed for the simultaneous detection of three honeybee viruses: acute bee paralysis virus (ABPV), sacbrood virus (SBV) and black queen cell virus (BQCV). Unique PCR primers were designed from the complete genome ...

  5. Study of Reaction Forces in a Single Sided Linear Induction Motor (SLIM)

    Science.gov (United States)

    1974-01-01

    SLIM reaction forces were measured on a laboratory model having aluminum and aluminum-iron secondaries and the results were correlated with the theoretical forces derived for different idealized SLIM models. The first part of the report discusses wav...

  6. Enhancement of cutaneous delayed hypersensitivity reactions by a single exposure to UV-A or PUVA

    International Nuclear Information System (INIS)

    Moberg, S.; Mobacken, H.

    1982-01-01

    The influence of irradiation with UV-A and PUVA (8-methoxy-psoralen and UV-A) on delayed hypersensitivity reactions to microbial antigens was studied in healthy human individuals. Skin reactions to Candida albicans antigen and PPD were enhanced by UV-A als well as by PUVA compared with nonirradiated tests. A statistically significant difference was reached with UV-A for both antigens. For PUVA, erythemogenic doses to Candida tests produced a significant increase of response. (orig.)

  7. [Molecular identification of Mentha haplocalyx and Mentha spicata with specific primers multi-PCR system].

    Science.gov (United States)

    Cao, Liang; Qin, Shuang-shuang; Yuan, Yuan; Zhu, Xiao-qi

    2014-01-01

    To screen specific SNPs loci of Mentha haplocalyx and Mentha spicata,and then specific primers were designed to identify the two species and their mixture rapidly. PsbA-trnH sequences of Mentha haplocalyx and Mentha spicata were obtained by PCR product sequencing and downloading from GenBank. SNPs in the psbA-trnH sequences of Mentha haplocalyx and Mentha spicata were found by ClustulW program and Bioedit software. Primers for authentication of the two species were designed according to the SNP loci, and PCR reaction system was optimized to identify the original plants. Multi-PCR reaction system was constructed. The 181 bp identification band for Mentha haplocalyx or(and) 288 bp identification band for Mentha spicata could be produced by a single PCR reaction,which showed good identification ability to the two species. The multi-PCR reaction system can be applied to identify Mentha haplocalyx and Mentha spicata as well as their mixture.

  8. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Comparative evaluation of the GP5+/6+, MY09/11 and PGMY09/11 primer sets for HPV detection by PCR in oral squamous cell carcinomas.

    Science.gov (United States)

    Erhart, Sibele Morais Miyata; Rivero, Elena Riet Correa; Bazzo, Maria Luiza; Onofre, Alexandre Sherlley Casimiro

    2016-02-01

    The aim of this study was to evaluate the use of GP5+/6+, MY09/11 and PGMY09/11 primer sets for the detection of human papillomavirus (HPV) DNA by single step polymerase chain reaction (PCR) and nested PCR in formalin-fixed and paraffin-embedded (FFPE) tissues from oral squamous cell carcinomas (OSCCs). DNA extracted from FFPE tissues were tested for amplification of the human beta globin gene with PCO3/4 primers. Positive samples for this gene were tested for HPV DNA using single step PCR with GP5+/6+, MY09/11 and PGMY09/11 primer sets. All negative samples at single step PCR with MY09/11 and PGMY09/11 were subjected to a further PCR with GP5+/6+ primers using the non-amplified product in the previously reactions (nested PCR) as samples. Among 26 samples, 23 were positive for the human beta globin gene and were considered viable for HPV DNA detection by PCR. Single step PCR with GP5+/6+ and MY09/11 primers and MY/GP+ nested PCR did not amplify HPV DNA in any samples. PGMY09/11 primers detected HPV DNA in 13.0% of OSCC cases and this rate was raise to 17.4% with the use of PGMY/GP+ nested PCR. According to our results the PGMY/GP+ nested PCR is the most appropriate primer set for the detection of HPV DNA using FFPE samples from OSCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. [Incidence rate of adverse reaction/event by Qingkailing injection: a Meta-analysis of single rate].

    Science.gov (United States)

    Ai, Chun-ling; Xie, Yan-ming; Li, Ming-quan; Wang, Lian-xin; Liao, Xing

    2015-12-01

    To systematically review the incidence rate of adverse drug reaction/event by Qingkailing injection. Such databases as the PubMed, EMbase, the Cochrane library, CNKI, VIP WanFang data and CBM were searched by computer from foundation to July 30, 2015. Two reviewers independently screened literature according to the inclusion and exclusion criteria, extracted data and cross check data. Then, Meta-analysis was performed by using the R 3.2.0 software, subgroup sensitivity analysis was performed based on age, mode of medicine, observation time and research quality. Sixty-three studies involving 9,793 patients with Qingkailing injection were included, 367 cases of adverse reactions/events were reported in total. The incidence rate of adverse reaction in skin and mucosa group was 2% [95% CI (0.02; 0.03)]; the digestive system adverse reaction was 6% [95% CI(0.05; 0.07); the injection site adverse reaction was 4% [95% CI (0.02; 0.07)]. In the digestive system as the main types of adverse reactions/events, incidence of children and adults were 4.6% [0.021 1; 0.097 7] and 6.9% [0.053 5; 0.089 8], respectively. Adverse reactions to skin and mucous membrane damage as the main performance/event type, the observation time > 7 days and ≤ 7 days incidence of 3% [0.012 9; 0.068 3] and 1.9% [0.007 8; 0.046 1], respectively. Subgroup analysis showed that different types of adverse reactions, combination in the incidence of adverse reactions/events were higher than that of single drug, the difference was statistically significant (P reactions occur, and clinical rational drug use, such as combination, age and other fators, and the influence factors vary in different populations. Therefore, clinical doctors for children and the elderly use special care was required for a clear and open spirit injection, the implementation of individualized medication.

  12. Mass transfer with complex reversible chemical reactions—I. Single reversible chemical reaction

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1989-01-01

    An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass

  13. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  14. Reaction of the (111) faces of single-crystal indium phosphide with alkylating agents: evidence for selective reaction of the p-rich face

    Energy Technology Data Exchange (ETDEWEB)

    Spool, A.M.; Daube, K.A.; Mallouk, T.E.; Belmont, J.A.; Wrighton, M.S.

    1986-05-28

    We wish to report that the P-rich, (111)B, face of single-crystal InP, but not the In-rich, (111)A, face of the same crystal, reacts with molecular reagents to yield surface-bound material derived from the apparent alkylation of a surface P atom. Exploitation of surface functional groups has been demonstrated to be very important in the attachment of molecular reagents and polymers to electrode surfaces. Electrodes derivatized with molecules have potential uses in analysis, fuel cells, electrosynthetic cells, and photoelectrochemical cells. We now wish to present evidence showing that an important photoelectrode material, InP, can be functionalized with molecules by reaction of the P-rich, (111)B, face with alkylating reagents.

  15. Molecular electronics of a single photosystem I reaction center: Studies with scanning tunneling microscopy and spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, I.; Lee, J.W.; Warmack, R.J.; Allison, D.P.; Greenbaum, E. [Oak Ridge National Lab., TN (United States)

    1995-03-14

    Thylakoids and photosystem I (PSI) reaction centers were imaged by scanning tunneling microscopy. The thylakoids were isolated from spinach chloroplasts, and PSI reaction centers were extracted from thylakoid membranes. Because thylakoids are relatively thick nonconductors, they were sputter-coated with Pd/Au before imaging. PSI photosynthetic centers and chemically platinized PSI were investigated without sputter-coating. They were mounted on flat gold substrates that had been treated with mercaptoacetic acid to help bind the proteins. With tunneling spectroscopy, the PSI centers displayed a semiconductor-like response with a band gap of 1.8 eV. Lightly platinized (platinized for 1 hr) centers displayed diode-like conduction that resulted in dramatic contrast changes between images taken with opposite bias voltages. The electronic properties of this system were stable under long-term storage. 42 refs., 7 figs.

  16. Stop-Frame Filming and Discovery of Reactions at the Single-Molecule Level by Transmission Electron Microscopy

    Science.gov (United States)

    2017-01-01

    We report an approach, named chemTEM, to follow chemical transformations at the single-molecule level with the electron beam of a transmission electron microscope (TEM) applied as both a tunable source of energy and a sub-angstrom imaging probe. Deposited on graphene, disk-shaped perchlorocoronene molecules are precluded from intermolecular interactions. This allows monomolecular transformations to be studied at the single-molecule level in real time and reveals chlorine elimination and reactive aryne formation as a key initial stage of multistep reactions initiated by the 80 keV e-beam. Under the same conditions, perchlorocoronene confined within a nanotube cavity, where the molecules are situated in very close proximity to each other, enables imaging of intermolecular reactions, starting with the Diels–Alder cycloaddition of a generated aryne, followed by rearrangement of the angular adduct to a planar polyaromatic structure and the formation of a perchlorinated zigzag nanoribbon of graphene as the final product. ChemTEM enables the entire process of polycondensation, including the formation of metastable intermediates, to be captured in a one-shot “movie”. A molecule with a similar size and shape but with a different chemical composition, octathio[8]circulene, under the same conditions undergoes another type of polycondensation via thiyl biradical generation and subsequent reaction leading to polythiophene nanoribbons with irregular edges incorporating bridging sulfur atoms. Graphene or carbon nanotubes supporting the individual molecules during chemTEM studies ensure that the elastic interactions of the molecules with the e-beam are the dominant forces that initiate and drive the reactions we image. Our ab initio DFT calculations explicitly incorporating the e-beam in the theoretical model correlate with the chemTEM observations and give a mechanism for direct control not only of the type of the reaction but also of the reaction rate. Selection of the

  17. Stop-Frame Filming and Discovery of Reactions at the Single-Molecule Level by Transmission Electron Microscopy.

    Science.gov (United States)

    Chamberlain, Thomas W; Biskupek, Johannes; Skowron, Stephen T; Markevich, Alexander V; Kurasch, Simon; Reimer, Oliver; Walker, Kate E; Rance, Graham A; Feng, Xinliang; Müllen, Klaus; Turchanin, Andrey; Lebedeva, Maria A; Majouga, Alexander G; Nenajdenko, Valentin G; Kaiser, Ute; Besley, Elena; Khlobystov, Andrei N

    2017-03-28

    We report an approach, named chemTEM, to follow chemical transformations at the single-molecule level with the electron beam of a transmission electron microscope (TEM) applied as both a tunable source of energy and a sub-angstrom imaging probe. Deposited on graphene, disk-shaped perchlorocoronene molecules are precluded from intermolecular interactions. This allows monomolecular transformations to be studied at the single-molecule level in real time and reveals chlorine elimination and reactive aryne formation as a key initial stage of multistep reactions initiated by the 80 keV e-beam. Under the same conditions, perchlorocoronene confined within a nanotube cavity, where the molecules are situated in very close proximity to each other, enables imaging of intermolecular reactions, starting with the Diels-Alder cycloaddition of a generated aryne, followed by rearrangement of the angular adduct to a planar polyaromatic structure and the formation of a perchlorinated zigzag nanoribbon of graphene as the final product. ChemTEM enables the entire process of polycondensation, including the formation of metastable intermediates, to be captured in a one-shot "movie". A molecule with a similar size and shape but with a different chemical composition, octathio[8]circulene, under the same conditions undergoes another type of polycondensation via thiyl biradical generation and subsequent reaction leading to polythiophene nanoribbons with irregular edges incorporating bridging sulfur atoms. Graphene or carbon nanotubes supporting the individual molecules during chemTEM studies ensure that the elastic interactions of the molecules with the e-beam are the dominant forces that initiate and drive the reactions we image. Our ab initio DFT calculations explicitly incorporating the e-beam in the theoretical model correlate with the chemTEM observations and give a mechanism for direct control not only of the type of the reaction but also of the reaction rate. Selection of the

  18. A single residue controls electron transfer gating in photosynthetic reaction centers

    Czech Academy of Sciences Publication Activity Database

    Shlyk, O.; Samish, I.; Matěnová, M.; Dulebo, A.; Poláková, H.; Kaftan, David; Scherz, A.

    2017-01-01

    Roč. 7, MAR 16 (2017), s. 1-13, č. článku 44580. ISSN 2045-2322 R&D Projects: GA ČR GA15-00703S; GA MŠk(CZ) LO1416 Institutional support: RVO:61388971 Keywords : BACTERIAL REACTION CENTERS * INDUCED STRUCTURAL-CHANGES * ATOMIC-FORCE MICROSCOPE Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.259, year: 2016

  19. Understanding the Oxygen Reduction Reaction on a Y/Pt(111) Single Crystal

    DEFF Research Database (Denmark)

    Ulrikkeholm, Elisabeth Therese; Johansson, Tobias Peter; Malacrida, Paolo

    2014-01-01

    was significantly different from our initial expectations. In order to understand this phenomenon, we investigated a Y/Pt(111) single crystal, formed by depositing large amounts of Y om Pt(111) under ultra-high vacuum (UHV) conditions and annealing to high temperatures. We subsequently characterised the surface...

  20. Single Cobalt Atoms with Precise N-Coordination as Superior Oxygen Reduction Reaction Catalysts.

    Science.gov (United States)

    Yin, Peiqun; Yao, Tao; Wu, Yuen; Zheng, Lirong; Lin, Yue; Liu, Wei; Ju, Huanxin; Zhu, Junfa; Hong, Xun; Deng, Zhaoxiang; Zhou, Gang; Wei, Shiqiang; Li, Yadong

    2016-08-26

    A new strategy for achieving stable Co single atoms (SAs) on nitrogen-doped porous carbon with high metal loading over 4 wt % is reported. The strategy is based on a pyrolysis process of predesigned bimetallic Zn/Co metal-organic frameworks, during which Co can be reduced by carbonization of the organic linker and Zn is selectively evaporated away at high temperatures above 800 °C. The spherical aberration correction electron microscopy and extended X-ray absorption fine structure measurements both confirm the atomic dispersion of Co atoms stabilized by as-generated N-doped porous carbon. Surprisingly, the obtained Co-Nx single sites exhibit superior ORR performance with a half-wave potential (0.881 V) that is more positive than commercial Pt/C (0.811 V) and most reported non-precious metal catalysts. Durability tests revealed that the Co single atoms exhibit outstanding chemical stability during electrocatalysis and thermal stability that resists sintering at 900 °C. Our findings open up a new routine for general and practical synthesis of a variety of materials bearing single atoms, which could facilitate new discoveries at the atomic scale in condensed materials. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Rutherford backscattering, nuclear reaction and channeling studies of nitrogen implanted single-crystal stainless steel

    International Nuclear Information System (INIS)

    Ferguson, M.M.; Ewan, G.T.; Mitchell, I.V.; Plattner, H.H.

    1983-01-01

    The three different methods were used to investigate a single crystal of stainless steel implanted to different doses by 40 keV 15 N 2 + ions. Conclusions are drawn on the position of nitrogen; comparison is made with implantation of deuterium and neon. (G.Q.)

  2. Effective Natural PCR-RFLP Primer Design for SNP Genotyping Using Teaching-Learning-Based Optimization With Elite Strategy.

    Science.gov (United States)

    Cheng, Yu-Huei; Kuo, Che-Nan; Lai, Ching-Ming

    2016-10-01

    SNP (single nucleotide polymorphism) genotyping is the determination of genetic variations of SNPs between members of a species. In many laboratories, PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) is a usually used biotechnology for SNP genotyping, especially in small-scale basic research studies of complex genetic diseases. PCR-RFLP requires an available restriction enzyme at least for identify a target SNP and an effective primer pair conforms numerous constraints. However, the lots of restriction enzymes, tedious sequence and complicated constraints make the mining of available restriction enzymes and the design of effective primer pairs become a major challenge. In the study, we propose a novel and available CI (Computation Intelligence)-based method called TLBO (teaching-learning-based optimization) and introduce the elite strategy to design effective primer pairs. Three common melting temperature computations are available in the method. REHUNT (Restriction Enzymes HUNTing) is first combined with the method to mine available restriction enzymes. Robust in silico simulations for the GA (genetic algorithm), the PSO (particle swarm optimization), and the method for natural PCR-RFLP primer design in the SLC6A4 gene with two hundred and eighty-eight SNPs had been performed and compared. These methods had been implemented in JAVA and they are freely available at https://sites.google.com/site/yhcheng1981/tlbonpd-elite for users of academic and non-commercial interests.

  3. Studies of Nuclei Close to 132Sn Using Single-Neutron Transfer Reactions

    International Nuclear Information System (INIS)

    Jones, K.L.; Pain, S.D.; Kozub, R.L.; Adekola, Aderemi S.; Bardayan, Daniel W.; Blackmon, Jeff C.; Catford, Wilton N.; Chae, K.Y.; Chipps, K.; Cizewski, J.A.; Erikson, Luke; Gaddis, A.L.; Greife, U.; Grzywacz, R.K.; Harlin, Christopher W.; Hatarik, Robert; Howard, Joshua A.; James, J.; Kapler, R.; Krolas, W.; Liang, J. Felix; Ma, Zhanwen; Matei, Catalin; Moazen, Brian; Nesaraja, Caroline D.; O'Malley, Patrick; Patterson, N.P.; Paulauskas, Stanley; Shapira, Dan; Shriner, J.F. Jr.; Sikora, M.; Sissom, D.J.; Smith, Michael Scott; Swan, T.P.; Thomas, J.S.; Wilson, Gemma L.

    2009-01-01

    Neutron transfer reactions were performed in inverse kinematics using radioactive ion beams of 132Sn, 130Sn, and 134Te and deuterated polyethylene targets. Preliminary results are presented. The Q-value spectra for 133Sn, 131Sn and 135Te reveal a number of previously unobserved peaks. The angular distributions are compatible with the expected lf7/2 nature of the ground state of 133Sn, and 2p3/2 for the 3.4 MeV state in 131Sn.

  4. Reactions and single-particle structure of nuclei near the drip lines

    International Nuclear Information System (INIS)

    Hansen, P.G.; Sherrill, B.M.

    2001-01-01

    The techniques that have allowed the study of reactions of nuclei situated at or near the neutron or proton drip line are described. Nuclei situated just inside the drip line have low nucleon separation energies and, at most, a few bound states. If the angular momentum in addition is small, large halo states are formed where the wave function of the valency nucleon extends far beyond the nuclear radius. We begin with examples of the properties of nuclear halos and of their study in radioactive-beam experiments. We then turn to the continuum states existing above the particle threshold and also discuss the possibility of exciting them from the halo states in processes that may be thought of as 'collateral damage'. Finally, we show that the experience from studies of halo states has pointed to knockout reactions as a new way to perform spectroscopic studies of more deeply bound non-halo states. Examples are given of measurements of l values and spectroscopic factors

  5. Homogenous, real-time duplex loop-mediated isothermal amplification using a single fluorophore-labeled primer and an intercalator dye: Its application to the simultaneous detection of Shiga toxin genes 1 and 2 in Shiga toxigenic Escherichia coli isolates.

    Science.gov (United States)

    Kouguchi, Yoshihiro; Fujiwara, Takako; Teramoto, Miki; Kuramoto, Mika

    2010-08-01

    We developed a completely homogeneous duplex loop-mediated isothermal amplification (LAMP) method. The present LAMP method employed a combination of a 6-carboxyfluorescein (FAM)-labeled primer (donor) for one target gene, a non-labeled primer for the other, and an intercalator ethidium bromide (EtBr) dye (acceptor) on the basis of fluorescence resonance energy transfer (FRET) between the FAM donor and EtBr acceptor. Measuring changes in fluorescence of FAM enabled the LAMP method to detect two different genes simultaneously. This method was used to detect Shiga toxin genes in Shiga toxigenic Escherichia coli isolates, demonstrating simultaneous detection of two different genes with rapidity and accuracy. Copyright 2010 Elsevier Ltd. All rights reserved.

  6. Assessment of primers designed for the subspecies-specific discrimination among Babesia canis canis, Babesia canis vogeli and Babesia canis rossi by PCR assay.

    Science.gov (United States)

    Duarte, Sabrina Castilho; Linhares, Guido Fontgalland Coelho; Romanowsky, Tatiana Nunes; da Silveira Neto, Osvaldo José; Borges, Ligia Miranda Ferreira

    2008-03-25

    Canine babesiosis is an infectious disease caused by either Babesia gibsoni or Babesia canis protozoans. The latter is also classified under three different phylogenetic groups, referred to as subspecies B. canis canis, B. canis vogeli and B. canis rossi. The objective of the present study was to validate and standardize a PCR assay to discriminate the organisms at the subspecies level. First, the reference sequences of the 18S rRNA, 5.8S rRNA and 28S rRNA genes, including the internal transcribed spacer 1 (ITS1) and 2 (ITS2) of the most common species and subspecies of the genus Babesia were retrieved from the GenBank database. Subspecies-specific primers (BAB3, BAB4 and BAB5) and one genus-specific primer were designed from the alignment of the sequences. The PCR assays were evaluated in three different combinations of primer pairs in order to assure complete specificity for each reaction. The results of the tests had demonstrated effectiveness of the novel primer pairs BAB1/BAB3, BAB1/BAB4 and BAB1/BAB5 for the amplification of the subspecies-specific target fragments of 746 bp (B. c. canis), 546 bp (B. c. vogeli) and 342 bp (B. c. rossi) by PCR. The original enzymatic amplification assays with novel primers reported in this paper were confirmed to be a reliable tool for the specific discrimination among B. canis subspecies by single-step PCR assays.

  7. An Immunofluorescence-Assisted Microfluidic Single Cell Quantitative Reverse Transcription Polymerase Chain Reaction Analysis of Tumour Cells Separated from Blood

    Directory of Open Access Journals (Sweden)

    Kazunori Hoshino

    2015-11-01

    Full Text Available Circulating tumour cells (CTCs are important indicators of metastatic cancer and may provide critical information for individualized treatment. As CTCs are usually very rare, the techniques to obtain information from very small numbers of cells are crucial. Here, we propose a method to perform a single cell quantitative reverse transcription polymerase chain reaction (qPCR analysis of rare tumour cells. We utilized a microfluidic immunomagnetic assay to separate cancer cells from blood. A combination of detailed immunofluorescence and laser microdissection enabled the precise selection of individual cells. Cancer cells that were spiked into blood were successfully separated and picked up for a single cell PCR analysis. The breast cancer cell lines MCF7, SKBR3 and MDAMB231 were tested with 10 different genes. The result of the single cell analysis matched the results from a few thousand cells. Some markers (e.g., ER, HER2 that are commonly used for cancer identification showed relatively large deviations in expression levels. However, others (e.g., GRB7 showed deviations that are small enough to supplement single cell disease profiling.

  8. Reaction of ethane with deuterium over platinum(111) single-crystal surfaces

    International Nuclear Information System (INIS)

    Zaera, F.; Somorhai, G.A.

    1985-01-01

    Deuterium exchange and hydrogenolysis of ethane were studied over (111) platinum surfaces under atmospheric pressures and a temperature range of 475-625 K. Activation energies of 19 kcal/mol for exchange and 34 kcal/mol for hydrogenolysis were obtained. The exchange reaction rates displayed kinetic orders with respect to deuterium and ethane partial pressures of -0.55 and 1.2, respectively. The exchange production distribution was U-shaped, peaking at one and six deuterium atoms per ethane molecule, similar to results reported for other forms of platinum, e.g., supported, films, and foils. The pressure of ethylidyne moieties on the surface was inferred from low-energy electron diffraction and thermal desorption spectroscopy. A mechanism is proposed to explain the experimental results, in which ethylidyne constitutes an intermediate in one of two competitive pathways. 31 references, 9 figures, 3 tables

  9. The reaction of lithium metal vapor with single walled carbon nanotubes of large diameters

    Czech Academy of Sciences Publication Activity Database

    Kalbáč, Martin; Kavan, Ladislav; Dunsch, L.

    2009-01-01

    Roč. 246, 11-12 (2009), s. 2428-2431 ISSN 0370-1972 R&D Projects: GA AV ČR IAA400400911; GA AV ČR KAN200100801; GA AV ČR IAA400400804; GA ČR GC203/07/J067; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : lithium * single walled carbon nanotubes * Raman spectroscopy Subject RIV: CG - Electrochemistry Impact factor: 1.150, year: 2009

  10. Ligand-tailored single-site silica supported titanium catalysts: Synthesis, characterization and towards cyanosilylation reaction

    Science.gov (United States)

    Xu, Wei; Li, Yani; Yu, Bo; Yang, Jindou; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    A successive anchoring of Ti(NMe2)4, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1‧-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on silica was conducted by SOMC strategy in moderate conditions. The silica, monitored by in-situ Fourier transform infrared spectroscopy (in-situ FT-IR), was pretreated at different temperatures (200, 500 and 800 °C). The ligand tailored silica-supported titanium complexes were characterized by in-situ FT-IR, 13C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) and elemental analysis in detail, verifying that the surface titanium species are single sited. The catalytic activity of the ligand tailored single-site silica supported titanium complexes was evaluated by a cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the dehydroxylation temperatures of silica and the configuration of the ligands.

  11. Versatile Gap Mode Plasmon under ATR Geometry towards Single Molecule Raman, Laser Trapping and Photocatalytic Reactions.

    Science.gov (United States)

    Futamata, Masayuki; Akai, Keitaro; Iida, Chiaki; Akiba, Natsumi

    2017-01-01

    We have investigated various aspects of a gap mode plasmon to establish it as an analytical tool. First, markedly large (10 7 - 10 9 ) enhancement factors for the Raman scattering intensity from a thiophenol (TP) monolayer sandwiched by Ag films on a prism and silver nanoparticles (AgNPs) were obtained under attenuated total reflection (ATR) geometry. Second, AgNPs with a radius of ∼20 nm were optically trapped and immobilized on TP-covered Ag films under a gap mode resonance with extremely weak laser power density of ∼1 μW/μm 2 at 532 nm. The observed optical trapping and immobilization were theoretically rationalized using a dipole-dipole coupling and van der Waals interaction between AgNPs and Ag films. Third, p-alkyl TP molecules such as p-methyl TP, p-ethyl TP, p-isopropyl TP, and p-tertiary butyl TP were photocatalytically oxidized into p-carboxyl TP, whereas o- and m-methyl TP did not show such reactions.

  12. Single-site SBA-15 supported zirconium catalysts. Synthesis, characterization and toward cyanosilylation reaction

    International Nuclear Information System (INIS)

    Xu, Wei; Yu, Bo; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    Graphical abstract: Ligand-modified signal-site SBA-15 supported zirconium catalysts were synthesized by SOMC method and characterized by a variety of techniques. The zirconium surface complexes show high catalytic efficiency for cyanosilylation of benzaldehyde. - Highlights: • Some Zr active species have been anchored on the surface of SBA-15 by SOMC technique. • The structures of the Zr species have been characterized by a variety of techniques. • The anchored Zr species are single-sited surface complexes. • The Zr surface complexes are catalytic active for cyanosilylation of benzaldehyde. - Abstract: A successive anchoring of Zr(NMe 2 ) 4 , cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on dehydroxylated SBA-15 pretreated at 500 °C for 16 h (SBA-15 -500 ) was conducted by SOMC strategy in moderate conditions. The dehydoxylation of SBA-15 was monitored by in situ Fourier transform infrared spectroscopy (in situ FT-IR). The ligand-modified SBA-15 -500 supported zirconium complexes were characterized by in situ FT-IR, 13 C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), inductively coupled plasma mass spectrometry (ICP-MAS) and elemental analysis in detail, verifying that the surface zirconium species are single-sited. The catalytic activity of these complexes was evaluated by cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the structure of surface species and the configuration of the ligands

  13. Single-site SBA-15 supported zirconium catalysts. Synthesis, characterization and toward cyanosilylation reaction

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Yu, Bo; Zhang, Ying; Chen, Xi; Zhang, Guofang, E-mail: gfzhang@snnu.edu.cn; Gao, Ziwei, E-mail: zwgao@snnu.edu.cn

    2015-01-15

    Graphical abstract: Ligand-modified signal-site SBA-15 supported zirconium catalysts were synthesized by SOMC method and characterized by a variety of techniques. The zirconium surface complexes show high catalytic efficiency for cyanosilylation of benzaldehyde. - Highlights: • Some Zr active species have been anchored on the surface of SBA-15 by SOMC technique. • The structures of the Zr species have been characterized by a variety of techniques. • The anchored Zr species are single-sited surface complexes. • The Zr surface complexes are catalytic active for cyanosilylation of benzaldehyde. - Abstract: A successive anchoring of Zr(NMe{sub 2}){sub 4}, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on dehydroxylated SBA-15 pretreated at 500 °C for 16 h (SBA-15{sub -500}) was conducted by SOMC strategy in moderate conditions. The dehydoxylation of SBA-15 was monitored by in situ Fourier transform infrared spectroscopy (in situ FT-IR). The ligand-modified SBA-15{sub -500} supported zirconium complexes were characterized by in situ FT-IR, {sup 13}C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), inductively coupled plasma mass spectrometry (ICP-MAS) and elemental analysis in detail, verifying that the surface zirconium species are single-sited. The catalytic activity of these complexes was evaluated by cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the structure of surface species and the configuration of the ligands.

  14. Evaluation of the Cortical Bone Reaction Around of Implants Using a Single-Use Final Drill: A Histologic Study.

    Science.gov (United States)

    Gehrke, Sergio Alexandre

    2015-07-01

    This study was designed to compare the cortical bone reaction following traditional osteotomy or the use of a single-use final drill in the osseointegration of implants in the tibia of rabbits. For this study, 48 conical implants, of standard surface type and design and manufactured by the same company, were inserted into the tibiae of 12 rabbits and removed after 30 or 60 days for histologic analysis. Two test groups were prepared according to the drill sequence used for the osteotomy at the preparation sites: in the control group was used a conventional drill sequence with several uses, whereas the test group (tesG) used a single-use final drill. The bone-to-implant contact and qualitative factors of the resulting cortical bone were assessed. Both techniques produced good implant integration. Differences in the linear bone-to-implant contact were observed between the drilling procedures as time elapsed in vivo, with the tesG appearing to have clinical advantages. Both groups exhibited new bone in quantity and in quality; however, the tesG exhibited a higher level of new bone deposition than the control group. Within the limitations of this study, the findings suggest that the use of a single-use final drill leads to better and faster organization of the cortical bone area during the evaluated period and may avoid the possible problems that can be caused by worn drills.

  15. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    Energy Technology Data Exchange (ETDEWEB)

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  16. Single-site SBA-15 supported zirconium catalysts. Synthesis, characterization and toward cyanosilylation reaction

    Science.gov (United States)

    Xu, Wei; Yu, Bo; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    A successive anchoring of Zr(NMe2)4, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1‧-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on dehydroxylated SBA-15 pretreated at 500 °C for 16 h (SBA-15-500) was conducted by SOMC strategy in moderate conditions. The dehydoxylation of SBA-15 was monitored by in situ Fourier transform infrared spectroscopy (in situ FT-IR). The ligand-modified SBA-15-500 supported zirconium complexes were characterized by in situ FT-IR, 13C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), inductively coupled plasma mass spectrometry (ICP-MAS) and elemental analysis in detail, verifying that the surface zirconium species are single-sited. The catalytic activity of these complexes was evaluated by cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the structure of surface species and the configuration of the ligands.

  17. Evaluation of the single radiosensitivity in patients subjected to medical exposure that show severe skin reactions

    International Nuclear Information System (INIS)

    Di Giorgio, M.; Vallerga, M.B.; Portas, M.; Perez, M.R.

    2006-01-01

    The Burnt Hospital of the Buenos Aires City Government (HQGCBA) it is a hospital of reference of the Net of Medical Responses in Radiological Emergencies of the Argentine Republic. In the mark of an agreement among the HQGCBA and the Authority Regulatory Nuclear (ARN), it is in execution a study protocol for the one boarding diagnoses and therapeutic of radioinduced cutaneous leisure. They exist individual variations that can condition the response to the ionizing radiations (IR), so much in accidental exposures as having programmed (radiotherapy, radiology interventionist). In this context, the individual radiosensitivity is evaluated in the patients signed up in this protocol that presented sharp or late cutaneous reactions, with grades of severity 3-4 (approaches EORTC/RTOG). The capacity of repair of the DNA was evaluated in outlying blood lymphocytes irradiated in vitro (2 Gy, gamma of Co-60) by means of the micronucleus techniques and comet essay in alkaline conditions. In this work two cases in those that is applied this study protocol, the therapeutic answer and its correlate with the discoveries of the radiosensitivity tests is presented. Case 1: patient of feminine sex, subjected to external radiotherapy by a breast infiltrating ductal carcinoma; developed sharp cutaneous radiotoxicity grade 3 (confluent humid epithelitis) that motivate the interruption of the treatment. Case 2: patient of masculine sex, subjected to a coronary angioplasty (interventionist radiology); developed late cutaneous radiotoxicity grade 4 (ulceration in dorsal region). Both patients were treated with topical trolamine associated to systemic administration of pentoxiphiline and antioxidants. The therapeutic answer is evaluated by means of clinical pursuit, photographic serial register and complementary exams (thermography and ultrasonography of high frequency). In the case 1 the answer was very favorable, with precocious local improvement and complete remission of symptoms and

  18. Compact Ag@Fe3O4 Core-shell Nanoparticles by Means of Single-step Thermal Decomposition Reaction

    Science.gov (United States)

    Brollo, Maria Eugênia F.; López-Ruiz, Román; Muraca, Diego; Figueroa, Santiago J. A.; Pirota, Kleber R.; Knobel, Marcelo

    2014-10-01

    A temperature pause introduced in a simple single-step thermal decomposition of iron, with the presence of silver seeds formed in the same reaction mixture, gives rise to novel compact heterostructures: brick-like Ag@Fe3O4 core-shell nanoparticles. This novel method is relatively easy to implement, and could contribute to overcome the challenge of obtaining a multifunctional heteroparticle in which a noble metal is surrounded by magnetite. Structural analyses of the samples show 4 nm silver nanoparticles wrapped within compact cubic external structures of Fe oxide, with curious rectangular shape. The magnetic properties indicate a near superparamagnetic like behavior with a weak hysteresis at room temperature. The value of the anisotropy involved makes these particles candidates to potential applications in nanomedicine.

  19. Fully automated radiosynthesis of [18F]Fluoromisonidazole with single neutral alumina column purification: optimization of reaction parameters

    International Nuclear Information System (INIS)

    Nandy, S.K.; Rajan, M.G.R.

    2010-01-01

    1-H-1-(3-[ 18 F]fluoro-2-hydroxypropyl)-2-nitroimidazole ([ 18 F]FMISO), is the most used hypoxia-imaging agent in oncology and we have recently reported a fully automated procedure for its synthesis using the Nuclear Interface FDG module and a single neutral alumina column for purification. Using 1-(2'-nitro-1'-imidazolyl)-2-O-tetra-hydropyranyl-3-O- toluenesulfonylpropanediol (NITTP) as the precursor, we have investigated the yield of [ 18 F]FMISO using different reaction times, temperatures, and the amount of precursor. The overall yield was 48.4 ± 1.2% (n = 3), (without decay correction) obtained using 10 mg NITTP with the radio-fluorination carried out at 145 deg C for 3 min followed by acid hydrolysis for 3 min at 125 deg C in a total synthesis time of 32 ± 1 min. Increasing the precursor amount to 25 mg did not improve the overall yield under identical reaction conditions, with the decay uncorrected yield being 46.8 ± 1.6% (n = 3), but rather made the production less economical. It was also observed that the yield increased linearly with the amount of NITTP used, from 2.5 to 10 mg and plateaued from 10 to 25 mg. Radio-fluorination efficiency at four different conditions was also compared. It was also observed by radio thin layer chromatography (radio-TLC) that the duration of radio-fluorination of NITTP, not the radio-fluorination temperature favoured the formation of labeled thermally degraded product, but the single neutral alumina column purification was sufficient enough to obtain [ 18 F]FMISO devoid of any radiochemical as well as cold impurities. (author)

  20. Electrochemistry of single nanobubbles. Estimating the critical size of bubble-forming nuclei for gas-evolving electrode reactions.

    Science.gov (United States)

    German, Sean R; Edwards, Martin A; Chen, Qianjin; Liu, Yuwen; Luo, Long; White, Henry S

    2016-12-12

    In this article, we address the fundamental question: "What is the critical size of a single cluster of gas molecules that grows and becomes a stable (or continuously growing) gas bubble during gas evolving reactions?" Electrochemical reactions that produce dissolved gas molecules are ubiquitous in electrochemical technologies, e.g., water electrolysis, photoelectrochemistry, chlorine production, corrosion, and often lead to the formation of gaseous bubbles. Herein, we demonstrate that electrochemical measurements of the dissolved gas concentration, at the instant prior to nucleation of an individual nanobubble of H 2 , N 2 , or O 2 at a Pt nanodisk electrode, can be analyzed using classical thermodynamic relationships (Henry's law and the Young-Laplace equation - including non-ideal corrections) to provide an estimate of the size of the gas bubble nucleus that grows into a stable bubble. We further demonstrate that this critical nucleus size is independent of the radius of the Pt nanodisk employed (gas. For example, the measured critical surface concentration of H 2 of ∼0.23 M at the instant of bubble formation corresponds to a critical H 2 nucleus that has a radius of ∼3.6 nm, an internal pressure of ∼350 atm, and contains ∼1700 H 2 molecules. The data are consistent with stochastic fluctuations in the density of dissolved gas, at or near the Pt/solution interface, controlling the rate of bubble nucleation. We discuss the growth of the nucleus as a diffusion-limited process and how that process is affected by proximity to an electrode producing ∼10 11 gas molecules per second. Our study demonstrates the advantages of studying a single-entity, i.e., an individual nanobubble, in understanding and quantifying complex physicochemical phenomena.

  1. Single determinantal reaction theory as a Schroedinger analog: the time-dependent S-matrix Hartree-Fock method

    International Nuclear Information System (INIS)

    Griffin, J.J.; Lichtner, P.C.; Dworzecka, M.; Kan, K.K.

    1979-01-01

    It is suggested that the TDHF method be viewed, not as an approximation to but as a model of the exact Schroedinger system; that is, as a gedanken many-body experiment whose analysis with digital computers provides data worthy in itself of theoretical study. From such a viewpoint attention is focused on the structural analogies of the TDHF system with the exact theory rather than upon its quantitative equivalence, and the TDHF many-body system is studied as a challenge of its own which, although much simpler than the realistic problem, may still offer complexity enough to educate theorists in the present state of knowledge. In this spirit, the TDHF description of continuum reactions can be restructured from an initial-value problem into a form analogous to the S-matrix version of the Schroedinger theory. The resulting TD-S-HF theory involves only self-consistent single determinantal solutions of the TDHF equations and invokes time averaging to obtain a consistent interpretation of the TDHF analogs of quantities which are constant in the exact theory, such as the S-matrix and the asymptotic reaction channel characteristics. Periodic solutions then play the role of stationary eigenstates in the construction of suitable asymptotic reaction channels. If these periodic channel states occur only at discrete energies, then the resulting channels are mutually orthogonal (on the time average) and the theory exhibits a structure fully analogous to the exact theory. In certain special cases where the periodic solutions are known to occur as an energy continuum, the requirement that the periodicity of the channel solutions be gauge invariant provides a natural requantization condition which (suggestively) turns out to be identical with the Bohr-Sommerfeld quantization rule. 11 references

  2. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  3. A primer on metagenomics.

    Directory of Open Access Journals (Sweden)

    John C Wooley

    2010-02-01

    Full Text Available Metagenomics is a discipline that enables the genomic study of uncultured microorganisms. Faster, cheaper sequencing technologies and the ability to sequence uncultured microbes sampled directly from their habitats are expanding and transforming our view of the microbial world. Distilling meaningful information from the millions of new genomic sequences presents a serious challenge to bioinformaticians. In cultured microbes, the genomic data come from a single clone, making sequence assembly and annotation tractable. In metagenomics, the data come from heterogeneous microbial communities, sometimes containing more than 10,000 species, with the sequence data being noisy and partial. From sampling, to assembly, to gene calling and function prediction, bioinformatics faces new demands in interpreting voluminous, noisy, and often partial sequence data. Although metagenomics is a relative newcomer to science, the past few years have seen an explosion in computational methods applied to metagenomic-based research. It is therefore not within the scope of this article to provide an exhaustive review. Rather, we provide here a concise yet comprehensive introduction to the current computational requirements presented by metagenomics, and review the recent progress made. We also note whether there is software that implements any of the methods presented here, and briefly review its utility. Nevertheless, it would be useful if readers of this article would avail themselves of the comment section provided by this journal, and relate their own experiences. Finally, the last section of this article provides a few representative studies illustrating different facets of recent scientific discoveries made using metagenomics.

  4. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  5. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  6. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  7. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  8. Single-shot characterization of enzymatic reaction constants Km and kcat by an acoustic-driven, bubble-based fast micromixer

    Science.gov (United States)

    Xie, Yuliang; Ahmed, Daniel; Lapsley, Michael Ian; Lin, Sz-Chin Steven; Nawaz, Ahmad Ahsan; Wang, Lin; Huang, Tony Jun

    2014-01-01

    In this work we present an acoustofluidic approach for rapid, single-shot characterization of enzymatic reaction constants Km and kcat. The acoustofluidic design involves a bubble anchored in a horseshoe structure which can be stimulated by a piezoelectric transducer to generate vortices in the fluid. The enzyme and substrate can thus be mixed rapidly, within 100 ms, by the vortices to yield the product. Enzymatic reaction constants Km and kcat can then be obtained from the reaction rate curves for different concentrations of substrate while holding the enzyme concentration constant. We studied the enzymatic reaction for β-galactosidase and its substrate (resorufin β-D-galactopyranoside) and found Km and kcat to be 333±130 =M and 64±8 s−1 respectively, which are in agreement with published data. Our approach is valuable for studying the kinetics of high-speed enzymatic reactions and other chemical reactions. PMID:22880882

  9. Low-temperature synthesis of single-domain Sr-hexaferrite particles by solid-state reaction route

    Energy Technology Data Exchange (ETDEWEB)

    Soezeri, Hueseyin [TUBITAK-UME, National Metrology Institute, PO Box 54, 41470, Gebze-Kocaeli (Turkey); Baykal, Abduelhadi [Department of Chemistry, Fatih University, B. Cekmece, 34500 Istanbul (Turkey); BioNanoTechnology R and D Center, Fatih University, B. Cekmece, 34500 Istanbul (Turkey); Uenal, Bayram [BioNanoTechnology R and D Center, Fatih University, B. Cekmece, 34500 Istanbul (Turkey); Department of Electrical and Electronics Engineering, Fatih University, B. Cekmece, 34500 Istanbul (Turkey)

    2012-10-15

    Sr-hexaferrite particles have been synthesized by conventional solid-state reaction route at low temperatures by boron addition that is used as an inhibitor for crystal growth. The effect of boron concentration on the structural, magnetic and electrical properties of Sr-hexaferrite particles are investigated by X-ray crystallography, scanning electron microscopy, magnetization and conductivity measurements. Saturation magnetization of Sr-hexaferrite increases up to 1 wt% boron addition, while coercivity becomes maximum with a boron amount of 2 wt%. Then, both magnetic parameters start to decrease with higher boron concentrations. Single-domain and single-phase powders have been obtained in the sample containing 1 wt% of boron that is sintered at 1050 C. Impedance spectroscopies reveal that the dc conductivity increases tremendously with boron addition, while the ac conductivity increases with elevated temperature. The ac conductivity obeys roughly the power law of angular frequency in which tendencies change with temperature at low and medium temperature. Furthermore, higher contents of the dopant over approximately 2.0 wt% cause its temperature independency at higher frequencies. These are due to the grain size and secondary phase of hexaferrites that increases with the increase in boron amount. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. Single-Atom Au/NiFe Layered Double Hydroxide Electrocatalyst: Probing the Origin of Activity for Oxygen Evolution Reaction.

    Science.gov (United States)

    Zhang, Jingfang; Liu, Jieyu; Xi, Lifei; Yu, Yifu; Chen, Ning; Sun, Shuhui; Wang, Weichao; Lange, Kathrin M; Zhang, Bin

    2018-03-21

    A fundamental understanding of the origin of oxygen evolution reaction (OER) activity of transition-metal-based electrocatalysts, especially for single precious metal atoms supported on layered double hydroxides (LDHs), is highly required for the design of efficient electrocatalysts toward further energy conversion technologies. Here, we aim toward single-atom Au supported on NiFe LDH ( s Au/NiFe LDH) to clarify the activity origin of LDHs system and a 6-fold OER activity enhancement by 0.4 wt % s Au decoration. Combining with theoretical calculations, the active behavior of NiFe LDH results from the in situ generated NiFe oxyhydroxide from LDH during the OER process. With the presence of s Au, s Au/NiFe LDH possesses an overpotential of 0.21 V in contrast to the calculated result (0.18 V). We ascribe the excellent OER activity of s Au/NiFe LDH to the charge redistribution of active Fe as well as its surrounding atoms causing by the neighboring s Au on NiFe oxyhydroxide stabilized by interfacial CO 3 2- and H 2 O interfacing with LDH.

  11. Low dose endotoxin priming is accountable for coagulation abnormalities and organ damage observed in the Shwartzman reaction. A comparison between a single-dose endotoxemia model and a double-hit endotoxin-induced Shwartzman reaction

    Directory of Open Access Journals (Sweden)

    Cate Hugo

    2006-08-01

    Full Text Available Abstract The clinical response of sepsis to a systemic inflammatory infection may be complicated by disseminated intravascular coagulation or DIC. In order to experimentally study the syndrome of DIC, we aimed for a severe sepsis model complicated by disseminated coagulation. Most -simplified- experimental models describing coagulation abnormalities as a consequence of sepsis are based on single dose endotoxemia. The so called-Shwartzman reaction contrarily, is elicited by a low dose endotoxin priming followed by an LPS challenge and is characterized by pathological manifestations that represent the syndrome of DIC. In order to investigate whether the Shwartzman reaction is superior to a single endotoxin challenge as a model for sepsis-induced DIC and to determine what the pathological effect is of an encounter of low endotoxin prior to an LPS challenge, we undertook the present study. In this study we demonstrate that low-dose endotoxin priming prior to an LPS challenge in the Shwartzman reaction is accountable for micro-vascular thrombosis in lung and liver and subsequent (multi- organ failure, not observed after a single-dose endotoxin challenge, which indicates that the Shwartzman reaction is well suited-model to study sepsis-induced DIC adversities. Remarkably, only minor differences in the innate immune response were established between the single-dose endotoxin challenge and the Shwartzman reaction.

  12. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  13. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. RecJ-like protein from Pyrococcus furiosus has 3′–5′ exonuclease activity on RNA: implications for proofreading of 3′-mismatched RNA primers in DNA replication

    Science.gov (United States)

    Yuan, Hui; Liu, Xi-Peng; Han, Zhong; Allers, Thorsten; Hou, Jing-Li; Liu, Jian-Hua

    2013-01-01

    Replicative DNA polymerases require an RNA primer for leading and lagging strand DNA synthesis, and primase is responsible for the de novo synthesis of this RNA primer. However, the archaeal primase from Pyrococcus furiosus (Pfu) frequently incorporates mismatched nucleoside monophosphate, which stops RNA synthesis. Pfu DNA polymerase (PolB) cannot elongate the resulting 3′-mismatched RNA primer because it cannot remove the 3′-mismatched ribonucleotide. This study demonstrates the potential role of a RecJ-like protein from P. furiosus (PfRecJ) in proofreading 3′-mismatched ribonucleotides. PfRecJ hydrolyzes single-stranded RNA and the RNA strand of RNA/DNA hybrids in the 3′–5′ direction, and the kinetic parameters (Km and Kcat) of PfRecJ during RNA strand digestion are consistent with a role in proofreading 3′-mismatched RNA primers. Replication protein A, the single-stranded DNA–binding protein, stimulates the removal of 3′-mismatched ribonucleotides of the RNA strand in RNA/DNA hybrids, and Pfu DNA polymerase can extend the 3′-mismatched RNA primer after the 3′-mismatched ribonucleotide is removed by PfRecJ. Finally, we reconstituted the primer-proofreading reaction of a 3′-mismatched ribonucleotide RNA/DNA hybrid using PfRecJ, replication protein A, Proliferating cell nuclear antigen (PCNA) and PolB. Given that PfRecJ is associated with the GINS complex, a central nexus in archaeal DNA replication fork, we speculate that PfRecJ proofreads the RNA primer in vivo. PMID:23605041

  15. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  16. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  17. A simple procedure eliminating multiple optimization steps required in developing multiplex PCR reactions

    Energy Technology Data Exchange (ETDEWEB)

    Grondin, V.; Roskey, M.; Klinger, K.; Shuber, T. [Integrated Genetics, Framingham, MA (United States)

    1994-09-01

    The PCR technique is one of the most powerful tools in modern molecular genetics and has achieved widespread use in the analysis of genetic diseases. Typically, a region of interest is amplified from genomic DNA or cDNA and examined by various methods of analysis for mutations or polymorphisms. In cases of small genes and transcripts, amplification of single, small regions of DNA are sufficient for analysis. However, when analyzing large genes and transcripts, multiple PCRs may be required to identify the specific mutation or polymorphism of interest. Ever since it has been shown that PCR could simultaneously amplify multiple loci in the human dystrophin gene, multiplex PCR has been established as a general technique. The properities of multiplex PCR make it a useful tool and preferable to simultaneous uniplex PCR in many instances. However, the steps for developing a multiplex PCR can be laborious, with significant difficulty in achieving equimolar amounts of several different amplicons. We have developed a simple method of primer design that has enabled us to eliminate a number of the standard optimization steps required in developing a multiplex PCR. Sequence-specific oligonucleotide pairs were synthesized for the simultaneous amplification of multiple exons within the CFTR gene. A common non-complementary 20 nucleotide sequence was attached to each primer, thus creating a mixture of primer pairs all containing a universal primer sequence. Multiplex PCR reactions were carried out containing target DNA, a mixture of several chimeric primer pairs and primers complementary to only the universal portion of the chimeric primers. Following optimization of conditions for the universal primer, limited optimization was needed for successful multiplex PCR. In contrast, significant optimization of the PCR conditions were needed when pairs of sequence specific primers were used together without the universal sequence.

  18. Pesquisaje activo de sospechas de reacciones adversas a medicamentos en el Hospital "Dr. Salvador Allende: Primer semestre 2006 Active screening of suspicions of adverse reactions to drugs in "Dr. Salvador Allende" Hospital: First semester 2006

    Directory of Open Access Journals (Sweden)

    José de Jesús Rego Hernández

    2007-12-01

    Full Text Available Se realizó un estudio descriptivo mediante la revisión diaria del movimiento hospitalario, obtenido en el Departamento de Registros Médicos del Hospital "Dr. Salvador Allende" desde enero hasta junio de 2006 a fin de poder identificar los ingresos susceptibles de ser reacciones adversas a medicamentos, con el objetivo de detectar la frecuencia de ingresos por sospechas de reacciones adversas a medicamentos, así como de caracterizar a estos pacientes. Se llenó una planilla de notificación para cada sospecha de reacción adversa y se analizaron los datos contenidos en las historias clínicas respectivas. Se utilizó una base de Excel diseñada al efecto por el Centro para el Desarrollo de la Farmacoepidemiología. Ingresaron 6 201 pacientes, de los cuales 384 eran susceptibles de tener una reacción adversa a medicamentos (6,2 % y finalmente, se consideraron 57 pacientes cuyo motivo de ingreso se relacionó con algún medicamento (0,9 %. El 66,7 % de los casos eran mayores de 60 años de edad, sin diferencias en cuanto al sexo. Los grupos farmacológicos con mayores afectaciones fueron los analgésicos no opiodes (59,7 % y los antibacterianos (19,4 %. El sangramiento digestivo alto resultó la reacción adversa que más se encontró (57,9 %, con predominio en mayores de 60 años de edad (72,7 %; el ácido acetilsalicílico estuvo presente en el 66,7 % de los casos con este diagnóstico. En el75,5 % de los casos la reacción se consideró como graveA descriptive study was conducted by the daily revision of hospital movement obtained in the Department of Medical Registries of "Dr. Salvador Allende" Hospital from January to June, 2006, aimed at identifying the admissions susceptible to adverse reactions to drugs to detect the frequency of admissions due to suspicions of adverse reactions to drugs, as well as to characterize these patients. A notification form was filled in per each suspicion of adverse reaction, and the data contained in the

  19. Factors associated with acute oral mucosal reaction induced by radiotherapy in head and neck squamous cell carcinoma: A retrospective single-center experience.

    Science.gov (United States)

    Tao, Zhenchao; Gao, Jin; Qian, Liting; Huang, Yifan; Zhou, Yan; Yang, Liping; He, Jian; Yang, Jing; Wang, Ru; Zhang, Yangyang

    2017-12-01

    To investigate risk factors for acute oral mucosal reaction during head and neck squamous cell carcinoma radiotherapy.A retrospective study of patients with head and neck squamous cell carcinoma who underwent radiotherapy from November 2013 to May 2016 in Anhui Provincial Cancer Hospital was conducted. Data on the occurrence and severity of acute oral mucositis were extracted from clinical records. Based on the Radiation Therapy Oncology Group (RTOG) grading of acute radiation mucosal injury, the patients were assigned into acute reaction (grades 2-4) and minimum reaction (grades 0-1) groups. Preradiotherapy characteristics and treatment factors were compared between the 2 groups. Multivariate logistic regression analysis was used to detect the independent factors associated with acute oral mucosal reactions.Eighty patients completed radiotherapy during the study period. Oral mucosal reactions were recorded as 25, 31, and 24 cases of grades 1, 2, and 3 injuries, respectively. Significant differences between acute reaction and minimum reaction groups were detected in cancer lymph node (N) staging, smoking and diabetes history, pretreatment platelet count and T-Helper/T-Suppressor lymphocyte (Th/Ts) ratio, concurrent chemotherapy, and total and single irradiation doses.Multivariate analysis showed that N stage, smoking history, single dose parapharyngeal irradiation, and pretreatment platelet count were independent risk factors for acute radiation induced oral mucosal reaction. Smoking history, higher grading of N stage, higher single dose irradiation, and lower preirradiation platelet count may increase the risk and severity of acute radiation oral mucosal reaction in radiotherapy of head and neck cancer patients. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  20. Application of noncatalytic gas-solid reactions for a single pellet of changing size to the modeling of fluidized-bed combustion of coal char containing sulfur

    Energy Technology Data Exchange (ETDEWEB)

    Rehmat, A.; Saxena, S.C.; Land, R.H.

    1980-09-01

    A mechanistic model is developed for coal char combustion, with sulfur retention by limestone or dolomite sorbent, in a gas fluidized bed employing noncatalytic single pellet gas-solid reactions. The shrinking core model is employed to describe the kinetics of chemical reactions taking place on a single pellet; changes in pellet size as the reaction proceeds are considered. The solids are assumed to be in back-mix condition whereas the gas flow is regarded to be in plug flow. Most char combustion occurs near the gas distributor plate (at the bottom of the bed), where the bubbles are small and consequently the mass transfer rate is high. For such a case, the analysis is considerably simplified by ignoring the bubble phase since it plays an insignificant role in the overall rate of carbon conversion. Bubble-free operation is also encounterd in the turbulent regime, where the gas flow is quite high and classical bubbles do not exist. Formulation of the model includes setting up heat and mass balance equations pertaining to a single particle (1) exposed to a varying reactant concentration along the height of the bed and (2) whose size changes during reaction. These equations are then solved numerically to account for particles of all sizes in the bed in obtaining the overall carbon conversion efficiency and resultant sulfur retention. In particular, the influence on sorbent requirement of several fluid-bed variables such as oxygen concentration profile, particle size, reaction rate for sulfation reaction, and suflur adsorption efficiency are examined.

  1. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  2. A single-stage polymerase-based protocol for the introduction of deletions and insertions without subcloning.

    Science.gov (United States)

    Salerno, John C; Jones, Rachel J; Erdogan, Eda; Smith, Susan M E

    2005-03-01

    A single-stage polymerase-based procedure is described that allows extensive modifications of DNA. The version described here uses the QuikChange Site-Directed Mutagenesis System kit supplied by Stratagene. The original protocol is replaced by a single-stage method in which linear production of complementary strands is accomplished in separate single primer reactions. This has proved effective in introducing insertions and deletions into large gene/vector combinations without subcloning.

  3. Rational Design of Single Molybdenum Atoms Anchored on N-Doped Carbon for Effective Hydrogen Evolution Reaction.

    Science.gov (United States)

    Chen, Wenxing; Pei, Jiajing; He, Chun-Ting; Wan, Jiawei; Ren, Hanlin; Zhu, Youqi; Wang, Yu; Dong, Juncai; Tian, Shubo; Cheong, Weng-Chon; Lu, Siqi; Zheng, Lirong; Zheng, Xusheng; Yan, Wensheng; Zhuang, Zhongbin; Chen, Chen; Peng, Qing; Wang, Dingsheng; Li, Yadong

    2017-12-11

    The highly efficient electrochemical hydrogen evolution reaction (HER) provides a promising pathway to resolve energy and environment problems. An electrocatalyst was designed with single Mo atoms (Mo-SAs) supported on N-doped carbon having outstanding HER performance. The structure of the catalyst was probed by aberration-corrected scanning transmission electron microscopy (AC-STEM) and X-ray absorption fine structure (XAFS) spectroscopy, indicating the formation of Mo-SAs anchored with one nitrogen atom and two carbon atoms (Mo 1 N 1 C 2 ). Importantly, the Mo 1 N 1 C 2 catalyst displayed much more excellent activity compared with Mo 2 C and MoN, and better stability than commercial Pt/C. Density functional theory (DFT) calculation revealed that the unique structure of Mo 1 N 1 C 2 moiety played a crucial effect to improve the HER performance. This work opens up new opportunities for the preparation and application of highly active and stable Mo-based HER catalysts. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Examining the rudimentary steps of the oxygen reduction reaction on single-atomic Pt using Ti-based non-oxide supports

    DEFF Research Database (Denmark)

    Tak, Young Joo; Yang, Sungeun; Lee, Hyunjoo

    2018-01-01

    In the attempt to reduce the high-cost and improve the overall durability of Pt-based electrocatalysts for the oxygen reduction reaction (ORR), density-functional theory (DFT) calculations have been performed to study the energetics of the elementary steps that occur during ORR on TiN(100)- and T...... of the single-atom Pt catalyst, and directly influences the rudimentary ORR steps on these single-atom platinized supports....

  5. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  6. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  7. Developments in Analytical Chemistry: Acoustically Levitated Drop Reactors for Enzyme Reaction Kinetics and Single-Walled Carbon Nanotube-Based Sensors for Detection of Toxic Organic Phosphonates

    Science.gov (United States)

    Field, Christopher Ryan

    2009-01-01

    Developments in analytical chemistry were made using acoustically levitated small volumes of liquid to study enzyme reaction kinetics and by detecting volatile organic compounds in the gas phase using single-walled carbon nanotubes. Experience gained in engineering, electronics, automation, and software development from the design and…

  8. 48Ca(d,n)49Sc reaction at E/sub d/=20 MeV; proton single-particle states in 49Sc

    International Nuclear Information System (INIS)

    Iwasaki, Y.; Galonsky, A.; Weber, D.J.

    1980-01-01

    The 48 Ca(d,n) 49 Sc reaction has been studied at E/sub d/=20 MeV. Angular distributions of differential cross sections have been obtained for 14 transitions to states in 49 Sc up to an excitation energy of 7.1 MeV. A distorted-wave Born-approximation analysis has been made of the experimental data. With respect to states corresponding to the same proton single-particle orbital, relative values of derived spectroscopic factors are generally in good agreement with those obtained from ( 3 He,d) reaction data. There are remarkable differences between the results from the 48 Ca(d,n) 49 Sc reaction and the 48 Ca( 3 He,d) 49 Sc, however, regarding the dependence of the relative spectroscopic factors on proton single-particle orbitals

  9. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  10. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  11. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  12. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  13. Effect of PVP as a capping agent in single reaction synthesis of nanocomposite soft/hard ferrite nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, H.A. [Department of Physics, Faculty of Science, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia); Saiden, N.M., E-mail: nlaily@upm.edu.my [Department of Physics, Faculty of Science, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia); Saion, E.; Azis, R.S.; Mamat, M.S. [Department of Physics, Faculty of Science, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia); Hashim, M. [Advanced Material and Nanotechnology Laboratory, Institute of Advanced Technology, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia)

    2017-04-15

    Nanocomposite magnets consist of soft and hard ferrite phases are known as an exchange spring magnet when they are sufficiently spin exchange coupled. Hard and soft ferrites offer high value of coercivity, H{sub c} and saturation magnetization, M{sub s} respectively. In order to obtain a better permanent magnet, both soft and hard ferrite phases need to be “exchange coupled”. The nanoparticles were prepared by a simple one-pot technique of 80% soft phase and 20% hard phase. This technique involves a single reaction mixture of metal nitrates and aqueous solution of varied amounts of polyvinylpyrrolidone (PVP). The heat treatment applied was at 800 °C for 3 h. The synthesized composites were characterized by Transmission Electron Microscope (TEM), Fourier Transform Infra-red (FT-IR), Energy Dispersive X-Ray (EDX), X-ray diffraction (XRD) and Vibrating sample magnetometer (VSM). The coexistence of two phases, Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2}O{sub 4} and SrFe{sub 12}O{sub 19} were observed by XRD patterns. It also verified by the EDX that no impurities detected. The magnetic properties of nanocomposite ferrites for 0.06 g/ml PVP gives a better properties of H{sub c} 932 G and M{sub s} 39.0 emu/g with average particle size obtained from FESEM was 49.2 nm. The concentration of PVP used gives effect on the magnetic properties of the samples. - Highlights: • Amount of PVP play important roles in controlling the particle size distribution and magnetic properties. • This is a novel technique to produce nanocomposite ferrites effectively. • This study contributes better understanding on magnetic properties in nanoparticle composite magnets.

  14. The use of a single inertial sensor to estimate 3-dimensional ground reaction force during accelerative running tasks.

    Science.gov (United States)

    Gurchiek, Reed D; McGinnis, Ryan S; Needle, Alan R; McBride, Jeffrey M; van Werkhoven, Herman

    2017-08-16

    The purpose of this investigation was to determine the feasibility of using a single inertial measurement unit (IMU) placed on the sacrum to estimate 3-dimensional ground reaction force (F) during linear acceleration and change of direction tasks. Force plate measurements of F and estimates from the proposed IMU method were collected while subjects (n=15) performed a standing sprint start (SS) and a 45° change of direction task (COD). Error in the IMU estimate of step-averaged component and resultant F was quantified by comparison to estimates from the force plate using Bland-Altman 95% limits of agreement (LOA), root mean square error (RMSE), Pearson's product-moment correlation coefficient (r), and the effect size (ES) of the differences between the two systems. RMSE of the IMU estimate of step-average F ranged from 37.70 N to 77.05 N with ES between 0.04 and 0.47 for SS while for COD, RMSE was between 54.19 N to 182.92 N with ES between 0.08 and 1.69. Correlation coefficients between the IMU and force plate measurements were significant (p≤0.05) for all values (r=0.53 to 0.95) except the medio-lateral component of step-average F. The average angular error in the IMU estimate of the orientation of step-average F was ≤10° for all tasks. The results of this study suggest the proposed IMU method may be used to estimate sagittal plane components and magnitude of step-average F during a linear standing sprint start as well as the vertical component and magnitude of step-average F during a 45° change of direction task. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis.

    Science.gov (United States)

    Wang, M; Park, J S; Ishiai, M; Hurwitz, J; Lee, S H

    2000-12-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) alpha and delta. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol alpha-primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis.

  16. Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

    Science.gov (United States)

    Koester, Meike; Gergs, René

    2017-10-05

    Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

  17. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species

    OpenAIRE

    Sánchez Robles, José Manuel; Talavera Lozano, Salvador; García Castaño, Juan Luis; Terrab Benjelloun, Anass; Navarro Sampedro, Laura; Balao Robles, Francisco J.

    2012-01-01

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other ...

  18. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  19. Detection of BK virus and JC virus in urine and brain tissue by the polymerase chain reaction.

    OpenAIRE

    Arthur, R R; Dagostin, S; Shah, K V

    1989-01-01

    DNAs of the human polyomaviruses BK virus (BKV) and JC virus (JCV) were amplified by the polymerase chain reaction (PCR) by using a single pair of 20-base oligonucleotide primers that were complementary to the same regions of both viruses. The sequences flanked by the primers were unique for each virus and could be differentiated by hybridization with 40-base, 32P-labeled oligonucleotide probes or by cleavage with BamHI. The DNA fragments resulting from amplification of BKV and JCV were 176 a...

  20. Kinetic modelling of hydrocracking catalytic reactions by the single events theory; Modelisation cinetique des reactions catalytiques d`hydrocraquage par la theorie des evenements constitutifs

    Energy Technology Data Exchange (ETDEWEB)

    Schweitzer, J.M.

    1998-11-23

    Kinetic modelling of petroleum hydrocracking is particularly difficult given the complexity of the feedstocks. There are two distinct classes of kinetics models: lumped empirical models and detailed molecular models. The productivity of lumped empirical models is generally not very accurate, and the number of kinetic parameters increases rapidly with the number of lumps. A promising new methodology is the use of kinetic modelling based on the single events theory. Due to the molecular approach, a finite and limited number of kinetic parameters can describe the kinetic behaviour of the hydrocracking of heavy feedstock. The parameters are independent of the feedstock. However, the available analytical methods are not able to identify the products on the molecular level. This can be accounted for by means of an posteriori lamping technique, which incorporates the detailed knowledge of the elementary step network. Thus, the lumped kinetic parameters are directly calculated from the fundamental kinetic coefficients and the single event model is reduced to a re-lumped molecular model. Until now, the ability of the method to extrapolate to higher carbon numbers had not been demonstrated. In addition, no study had been published for three phase (gas-liquid-solid) systems and a complex feedstock. The objective of this work is to validate the `single events` method using a paraffinic feedstock. First of all, a series of experiments was conducted on a model compound (hexadecane) in order to estimate the fundamental kinetic parameters for acyclic molecules. To validate the single event approach, these estimated kinetic coefficients were used to simulate hydrocracking of a paraffinic mixture ranging from C11 to C18. The simulation results were then compared to the results obtained from the hydrocracking experiments. The comparison allowed to validate the model for acyclic molecules and to demonstrate that the model is applicable to compounds with higher carbon numbers. (author

  1. Single-shot characterization of enzymatic reaction constants Km and kcat by an acoustic-driven, bubble-based fast micromixer.

    Science.gov (United States)

    Xie, Yuliang; Ahmed, Daniel; Lapsley, Michael Ian; Lin, Sz-Chin Steven; Nawaz, Ahmad Ahsan; Wang, Lin; Huang, Tony Jun

    2012-09-04

    In this work we present an acoustofluidic approach for rapid, single-shot characterization of enzymatic reaction constants K(m) and k(cat). The acoustofluidic design involves a bubble anchored in a horseshoe structure which can be stimulated by a piezoelectric transducer to generate vortices in the fluid. The enzyme and substrate can thus be mixed rapidly, within 100 ms, by the vortices to yield the product. Enzymatic reaction constants K(m) and k(cat) can then be obtained from the reaction rate curves for different concentrations of substrate while holding the enzyme concentration constant. We studied the enzymatic reaction for β-galactosidase and its substrate (resorufin-β-D-galactopyranoside) and found K(m) and k(cat) to be 333 ± 130 μM and 64 ± 8 s(-1), respectively, which are in agreement with published data. Our approach is valuable for studying the kinetics of high-speed enzymatic reactions and other chemical reactions.

  2. Free-Propagator Reweighting Integrator for Single-Particle Dynamics in Reaction-Diffusion Models of Heterogeneous Protein-Protein Interaction Systems

    Directory of Open Access Journals (Sweden)

    Margaret E. Johnson

    2014-09-01

    Full Text Available We present a new algorithm for simulating reaction-diffusion equations at single-particle resolution. Our algorithm is designed to be both accurate and simple to implement, and to be applicable to large and heterogeneous systems, including those arising in systems biology applications. We combine the use of the exact Green’s function for a pair of reacting particles with the approximate free-diffusion propagator for position updates to particles. Trajectory reweighting in our free-propagator reweighting (FPR method recovers the exact association rates for a pair of interacting particles at all times. FPR simulations of many-body systems accurately reproduce the theoretically known dynamic behavior for a variety of different reaction types. FPR does not suffer from the loss of efficiency common to other path-reweighting schemes, first, because corrections apply only in the immediate vicinity of reacting particles and, second, because by construction the average weight factor equals one upon leaving this reaction zone. FPR applications include the modeling of pathways and networks of protein-driven processes where reaction rates can vary widely and thousands of proteins may participate in the formation of large assemblies. With a limited amount of bookkeeping necessary to ensure proper association rates for each reactant pair, FPR can account for changes to reaction rates or diffusion constants as a result of reaction events. Importantly, FPR can also be extended to physical descriptions of protein interactions with long-range forces, as we demonstrate here for Coulombic interactions.

  3. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  4. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  5. Lack of correlation between reaction speed and analytical sensitivity in isothermal amplification reveals the value of digital methods for optimization: validation using digital real-time RT-LAMP.

    Science.gov (United States)

    Khorosheva, Eugenia M; Karymov, Mikhail A; Selck, David A; Ismagilov, Rustem F

    2016-01-29

    In this paper, we asked if it is possible to identify the best primers and reaction conditions based on improvements in reaction speed when optimizing isothermal reactions. We used digital single-molecule, real-time analyses of both speed and efficiency of isothermal amplification reactions, which revealed that improvements in the speed of isothermal amplification reactions did not always correlate with improvements in digital efficiency (the fraction of molecules that amplify) or with analytical sensitivity. However, we observed that the speeds of amplification for single-molecule (in a digital device) and multi-molecule (e.g. in a PCR well plate) formats always correlated for the same conditions. Also, digital efficiency correlated with the analytical sensitivity of the same reaction performed in a multi-molecule format. Our finding was supported experimentally with examples of primer design, the use or exclusion of loop primers in different combinations, and the use of different enzyme mixtures in one-step reverse-transcription loop-mediated amplification (RT-LAMP). Our results show that measuring the digital efficiency of amplification of single-template molecules allows quick, reliable comparisons of the analytical sensitivity of reactions under any two tested conditions, independent of the speeds of the isothermal amplification reactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Study of the reaction between methyl 4-nitrobenzenesulfonate and bromide ions in mixed single-chain-gemini micellar solutions: kinetic evidence for morphological transitions.

    Science.gov (United States)

    del Mar Graciani, María; Rodríguez, Amalia; Moyá, María Luisa

    2008-12-15

    The reaction between methyl 4-nitrobenzenesulfonate and bromide ions has been studied in mixed single-chain-gemini micellar solutions of n-dodecyltrimethylammonium bromide, DTAB, and dodecyl tricosaoxyethylene glycol ether, Brij(35), with alkanediyl-alpha-omega-bis(dodecyldimethylammonium) bromide, 12-s-12,2Br(-) (s=3,4,5). Kinetic micellar effects show that an increase in the solution mole fraction of the single-chain surfactant, X(single-chain), results in a diminution of the mixed micelles tendency to form spherocylindrical aggregates upon increasing surfactant concentration. The dependence of the surfactant concentration at which the sphere-to-rod transition occurs, C(*), on X(single-chain) showed through kinetic data was in agreement with results obtained by means of fluorescence measurements.

  7. Do voluntary step reactions in dual task conditions have an added value over single task for fall prediction? A prospective study.

    Science.gov (United States)

    Melzer, Itshak; Kurz, Ilan; Shahar, Danit; Oddsson, Lars I E

    2010-01-01

    Stepping reactions play a critical role in responding to balance perturbations, whether they are a consequence of external perturbation or self-induced in nature. The aim of the present study was to determine prospectively the capacity of voluntary stepping performance in singleand dual-task conditions, to predict future falls among older community-dwelling persons. We also aimed to assess whether dual task conditions have an added value over single tasks for fall prediction. A total of 100 healthy old volunteers (mean age 78.4±5.7 yrs), from two self-care protected retirement homes for older adults, performed the Voluntary Step Execution Test in single- and dual-task conditions as a reaction time task while standing on a single force platform. Step initiation, preparatory and swing phases, and foot-contact time were extracted from data on center of pressure and ground reaction force. One-year fall incidences were monitored. Ninety-eight subjects completed the one-year follow-up, 49 non-fallers, 32 one-time fallers, and 17 recurrent fallers (two or more falls). Recurrent fallers had significantly slower voluntary step execution times in both single- and dual-task conditions, especially due to a slower preparation phase. Two stepwise (backward) logistic regression models showed that longer step execution times have strong predictive value for falls in both single- and dual-task conditions (odds ratio (OR) 8.7 and 5.4, respectively, ppredict future falls, with no added value to dual- over single-task condition.

  8. Orientation dependence in the four-atom reaction of OH + HBr using the single-state oriented OH radical beam.

    Science.gov (United States)

    Tsai, Po-Yu; Che, Dock-Chil; Nakamura, Masaaki; Lin, King-Chuen; Kasai, Toshio

    2010-03-20

    The orientation dependence for the Br atom formation in the reaction of the oriented OH radicals with HBr molecules at 0.26 eV collision energy has been observed for the first time using the hexapole electric field, and we found that the reaction cross-section for O-end attack is more favorable than that for H-end attack by a factor of 3.4 +/- 2.3.

  9. Spectroscopy of low-lying single-particle states in $^{81}$Zn populated in the $^{80}$Zn(d,p) reaction

    CERN Multimedia

    The aim of this proposal is the study of single-particle states of $^{81}$Zn via the $^{80}$Zn(d,p) reaction in inverse kinematics. $^{81}$Zn will be produced by means of a laser-ionized, 5.5 MeV/u HIE-Isolde $^{80}$Zn beam impinging on a deuterated-polyethylene target. The protons and $\\gamma$-rays emitted in the reaction will be studied using the Miniball + T-REX setup. This experiment will constitute the first spectroscopic study of $^{81}$Zn, which is critically important to determine the energy and ordering of neutron single-particle orbits above the N=50 gap and the properties of $^{78}$Ni.

  10. Randomised clinical trial on the effect of a single oral administration of l-tryptophan, at three dose rates, on reaction speed, plasma concentration and haemolysis in horses.

    Science.gov (United States)

    Noble, Glenys K; Li, Xiuhua; Zhang, Dagong; Sillence, Martin N

    2016-07-01

    Tryptophan (TRP) is marketed as a calmative for horses despite reservations about its efficacy. The aim of this study was to measure the effect of oral TRP administration on the reaction speed of horses. Sixty mature horses were used in a two stage randomised, blind, cross-over study, receiving a placebo and an oral dose of TRP (30, 60 or 120 mg/kg body weight), before undergoing a reaction speed test. Blood samples were taken up to 96 h after TRP administration, to identify signs of acute haemolytic anaemia. Plasma TRP concentrations were increased (P reaction speed of horses when startled. There was no evidence of alterations in clinical pathology parameters in 432 blood samples. While the safety of these doses of TRP can be confirmed, there was no evidence to suggest that a single dose of TRP is an effective calmative for horses. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Experimental Determination of the Possible Deuterium - Deuterium Fusion Reaction Originated in a Single Cavitation Bubble Luminescence System Using CDCL3 and D2 O

    International Nuclear Information System (INIS)

    Barbaglia, Mario; Florido, Pablo; Mayer, Roberto; Bonetto, Fabian

    2003-01-01

    We focus this work on the measurement of the possible Deuterium - Deuterium reaction in a SCBL (Single Cavitation Bubble Luminescence) system.We measure the possible reaction at the bubble generation time and at the bubble collapse time. We use a Nd:YAG laser and CDCl 3 and D 2 O as a medium to generate the bubble. Since CDCl 3 accommodation coefficient is best than that of D 2 O, it is expected a greater collapse force than using D 2 O.To benefit the bubble collapse violence, we diminish the temperature of the liquids.To avoid false neutron detection, we developed a measuring system with high background reject using the characteristic experiment times.No neutrons attributable to Deuterium - Deuterium fusion reaction were measured

  12. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  13. Self-Assembly of Single-Layer CoAl-Layered Double Hydroxide Nanosheets on 3D Graphene Network Used as Highly Efficient Electrocatalyst for Oxygen Evolution Reaction.

    Science.gov (United States)

    Ping, Jianfeng; Wang, Yixian; Lu, Qipeng; Chen, Bo; Chen, Junze; Huang, Ying; Ma, Qinglang; Tan, Chaoliang; Yang, Jian; Cao, Xiehong; Wang, Zhijuan; Wu, Jian; Ying, Yibin; Zhang, Hua

    2016-09-01

    A non-noble metal based 3D porous electrocatalyst is prepared by self-assembly of the liquid-exfoliated single-layer CoAl-layered double hydroxide nanosheets (CoAl-NSs) onto 3D graphene network, which exhibits higher catalytic activity and better stability for electrochemical oxygen evolution reaction compared to the commercial IrO2 nanoparticle-based 3D porous electrocatalyst. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. A primer for electroweak induced low-energy nuclear reactions

    Indian Academy of Sciences (India)

    A common element in all these applications is that the electromagnetic energy stored in .... which reached Earth. Our theoretical flux agrees quite nicely with the experimental data from the L3+C Collaboration at LEP through their observation of high- .... For a cylindrical geometry, we can again rewrite it in a useful form.

  15. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  16. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  17. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  18. Influence of reactions heats on variation of radius, temperature, pressure and chemical species amounts within a single acoustic cavitation bubble.

    Science.gov (United States)

    Kerboua, Kaouther; Hamdaoui, Oualid

    2018-03-01

    The scientific interest toward the study of acoustic bubble is mainly explained by its practical benefit in providing a reactional media favorable to the rapid evolution of chemical mechanism. The evolution of this mechanism is related to the simultaneous and dependent variation of the volume, temperature and pressure within the bubble, retrieved by the resolution of a differential equations system, including among others the thermal balance. This last one is subject to different assumptions, some authors deem simply that the temperature varies adiabatically during the collapsing phase, without considering the reactions heat of the studied mechanism. This paper aims to evaluate the pertinence of neglecting reactions heats in the thermal balance, by analyzing their effect on the variation of radius, temperature, pressure and chemical species amounts. The results show that the introduction of reactions heats conducts to a decrease of the temperature, an increase of the pressure and a reduction of the bubble volume. As a consequence, this leads to a drop of the quantities of free radicals produced by the chemical mechanism evolving within the bubble. This paper also proved that the impact of the consideration of reactions heats is dependent of the frequency and the acoustic amplitude of the ultrasonic wave. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu. Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  20. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Directory of Open Access Journals (Sweden)

    Fernando Bastida-González

    2016-01-01

    Full Text Available Nucleoprotein (N gene from rabies virus (RABV is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs via indirect fluorescent antibody (IFA test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers, for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  1. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  2. Quasiclassical trajectory study of the Cl +CH4 reaction dynamics on a quadratic configuration interaction with single and double excitation interpolated potential energy surface

    Science.gov (United States)

    Castillo, J. F.; Aoiz, F. J.; Bañares, L.

    2006-09-01

    An ab initio interpolated potential energy surface (PES) for the Cl +CH4 reactive system has been constructed using the interpolation method of Collins and co-workers [J. Chem. Phys. 102, 5647 (1995); 108, 8302 (1998); 111, 816 (1999); Theor. Chem. Acc. 108, 313 (2002)]. The ab initio calculations have been performed using quadratic configuration interaction with single and double excitation theory to build the PES. A simple scaling all correlation technique has been used to obtain a PES which yields a barrier height and reaction energy in good agreement with high level ab initio calculations and experimental measurements. Using these interpolated PESs, a detailed quasiclassical trajectory study of integral and differential cross sections, product rovibrational populations, and internal energy distributions has been carried out for the Cl +CH4 and Cl +CD4 reactions, and the theoretical results have been compared with the available experimental data. It has been shown that the calculated total reaction cross sections versus collision energy for the Cl +CH4 and Cl +CD4 reactions is very sensitive to the barrier height. Besides, due to the zero-point energy (ZPE) leakage of the CH4 molecule to the reaction coordinate in the quasiclassical trajectory (QCT) calculations, the reaction threshold falls below the barrier height of the PES. The ZPE leakage leads to CH3 and HCl coproducts with internal energy below its corresponding ZPEs. We have shown that a Gaussian binning (GB) analysis of the trajectories yields excitation functions in somehow better agreement with the experimental determinations. The HCl(v'=0) and DCl(v'=0) rotational distributions are as well very sensitive to the ZPE problem. The GB correction narrows and shifts the rotational distributions to lower values of the rotational quantum numbers. However, the present QCT rotational distributions are still hotter than the experimental distributions. In both reactions the angular distributions shift from

  3. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  4. Probing the Energy Transfer Dynamics of Photosynthetic Reaction Center Complexes Through Hole-Burning and Single-Complex Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Kerry Joseph [Iowa State Univ., Ames, IA (United States)

    2007-01-01

    Photosynthesis is the process by which light energy is used to drive reactions that generate sugars to supply energy for cellular processes. It is one of the most important fundamental biological reactions and occurs in both prokaryotic (e.g. bacteria) and eukaryotic (e.g. plants and algae) organisms. Photosynthesis is also remarkably intricate, requiring the coordination of many different steps and reactions in order to successfully transform absorbed solar energy into a biochemical usable form of energy. However, the net reaction for all photosynthetic organisms can be reduced to the following, deceptively general, equation developed by Van Niel[1] H2 - D + Aimplieshv A - H2 + D where H2-D is the electron donor, e.g. H2O, H2S. A is the electron acceptor, e.g. CO2, and A-H2 is the synthesized sugar. Amazingly, this simple net equation is responsible for creating the oxidizing atmosphere of Earth and the recycling of CO2, both of which are necessary for the sustainment of the global ecosystem.

  5. Lower limb muscle pre-motor time measures during a choice reaction task associate with knee abduction loads during dynamic single leg landings.

    Science.gov (United States)

    McLean, Scott G; Borotikar, Bhushan; Lucey, Sarah M

    2010-07-01

    Female neuromuscular control during dynamic landings is considered central to their increased ACL injury risk relative to males. There is limited insight, however, into the neuromuscular parameters governing this risk, which may hinder prevention success. This study targeted a new screenable and potentially trainable neuromuscular risk factor. Specifically, we examined whether lower limb muscle pre-motor times, being the time between stimulus presentation and initiation of the muscle EMG burst, elicited during a simple choice reaction task correlated with knee abduction loads during separate single leg landings. Twenty female NCAA athletes had muscle (n=8) pre-motor time and knee biomechanics data recorded bilaterally during a choice reaction task. Knee biomechanics were also quantified during anticipated and unanticipated single (dominant and non-dominant) leg landings. Mean peak knee abduction loads during landings were submitted to a two-way ANOVA to test for limb and decision effects. Individual regression coefficients were initially computed between-limb-based muscle pre-motor times and peak abduction moments elicited during both the choice reaction and landing tasks. Limb-based linear stepwise regression coefficients were also computed between muscle PMT's demonstrating significant (Pmuscle pre-motor times during a specific choice reaction task are associated with peak knee abduction loads during separate single leg landings. These muscles appear critical in stabilizing the knee against the extreme dynamic load states associated with such tasks. Targeted screening and training of supraspinal processes governing these muscle pre-motor times may ultimately enable external knee loads associated with landings to be more effectively countered by the overarching neuromuscular strategy. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  6. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  7. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  8. Single-Tube Reaction Using Perfluorocarbons: A Prerequisite Step Leading to the Whole-Slide In Situ Technique on Histopathological Slides.

    Directory of Open Access Journals (Sweden)

    Yi-Chang Chen

    Full Text Available Developing a robust, novel method for performing multiple reactions in a single tube is not only time- and cost-saving but also critical for future high-throughput whole-slide in situ techniques on diseased tissues. In this study, we introduce the use of perfluorocarbons and compound-coated magnetic particles to create pseudochambers in a single tube, allowing different reactions to be performed in different phases. Perfluorocarbons also serve as cell lysis buffer and polymerase chain reaction (PCR buffer owing to their highly penetrating, repellent and emulsifiable properties. Using this method, nucleic acids can be isolated and purified from various sample types and sizes, followed by PCR, real-time PCR, or multiplex PCR in the same tube. No incubation or enzyme digesting time is needed and the risk of cross-contamination is reduced. Tests can be performed in microemulsions (water-in-oil droplets containing sequence-specific captures and probes for further high-throughput detection. We present a simple, quick, and robust procedure as a prerequisite step to future high-throughput in situ techniques.

  9. Preparation of single-crystal spherical γ-Mo2N by temperature-programmed reaction between β-MoO3 and NH3

    Science.gov (United States)

    Wang, Lu; Zhang, Guo-Hua; Chou, Kuo-Chih

    2017-10-01

    In the present wok, single-crystalline spherical γ-Mo2N powders was successfully prepared by the temperature-programmed reaction of single-crystal spherical β-MoO3 with NH3 in the temperature ranges of 1013-1073 K. Herein, the Mo source used was monoclinic system, β-MoO3, a metastable phase of MoO3. It is found that the characterizations of the as-prepared γ-Mo2N powders are strongly depended on the selection of the MoO3 precursor. In other words, the as-prepared γ-Mo2N powders inherited the shape, size and structure of the used β-MoO3 precursors upon reaction with NH3. In order to make a comparison, β-MoO3 was also reduced by the mixed gases of N2 and H2 with the flow rate ratio of 1:3 at the identical conditions. It was found that pure β-Mo2N polycrystalline can be obtained when the temperature was 1013 K; while further increasing the reaction temperature, metal Mo powder will be turned up.

  10. Digital Microfluidics Assisted Sealing of Individual Magnetic Particles in Femtoliter-Sized Reaction Wells for Single-Molecule Detection.

    Science.gov (United States)

    Decrop, Deborah; Ruiz, Elena Pérez; Kumar, Phalguni Tewari; Tripodi, Lisa; Kokalj, Tadej; Lammertyn, Jeroen

    2017-01-01

    Digital microfluidics has emerged in the last years as a promising liquid handling technology for a variety of applications. Here, we describe in detail how to build up an electrowetting-on-dielectric-based digital microfluidic chip with unique advantages for performing single-molecule detection. We illustrate how superparamagnetic particles can be printed with very high loading efficiency (over 98 %) and single-particle resolution in the microwell array patterned in the Teflon-AF ® surface of the grounding plate of the chip. Finally, the potential of the device for its application to single-molecule detection is demonstrated by the ultrasensitive detection of the biotinylated enzyme β-Galactosidase captured on streptavidin-coated particles in the described platform.

  11. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  12. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  13. Sequencing Angiosperm Plastid Genomes Made Easy: A Complete Set of Universal Primers and a Case Study on the Phylogeny of Saxifragales

    Science.gov (United States)

    Dong, Wenpan; Xu, Chao; Cheng, Tao; Lin, Kui; Zhou, Shiliang

    2013-01-01

    Plastid genomes are an invaluable resource for plant biological studies. However, the number of completely sequenced plant plastid genomes is still small compared with the vast number of species. To provide an alternative generalized approach, we designed a set of 138 pairs of universal primers for amplifying (termed “short-range PCR”) and sequencing the entire genomes of the angiosperm plastid genomes. The universality of the primers was tested by using species from the basal to asterid angiosperms. The polymerase chain reaction (PCR) success rate was higher than 96%. We sequenced the complete chloroplast genome of Liquidambar formosana as an example using this method and compared it to the genomes independently determined by long-range PCR (from 6.3 kb to 13.3 kb) and next-generation sequencing methods. The three genomes showed that they were completely identical. To test the phylogenetic efficiency of this method, we amplified and sequenced 18 chloroplast regions of 19 Saxifragales and Saxifragales-related taxa, as a case study, to reconstruct the phylogeny of all families of the order. Phylograms based on a combination of our data, together with those from GenBank, clearly indicate three family groups and three single families within the order. This set of universal primers is expected to accelerate the accumulation of angiosperm plastid genomes and to make faster mass data collection of plastid genomes for molecular systematics. PMID:23595020

  14. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  15. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    Science.gov (United States)

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  16. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  17. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  18. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  19. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  20. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  1. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  2. Untangling reaction pathways through modern approaches to high-throughput single-molecule force-spectroscopy experiments

    NARCIS (Netherlands)

    Dulin, D.; Berghuis, B.A.; Depken, S.M.; Dekker, N.H.

    2015-01-01

    Single-molecule experiments provide a unique means for real-time observation of the activity of individual biomolecular machines. Through such techniques, insights into the mechanics of for example, polymerases, helicases, and packaging motors have been gleaned. Here we describe the recent advances

  3. An Immunofluorescence-assisted Microfluidic Single Cell Quantitative Reverse Transcription Polymerase Chain Reaction Analysis of Tumour Cells Separated from Blood

    Directory of Open Access Journals (Sweden)

    Kazunori Hoshino

    2015-11-01

    matched the results from a few thousand cells. Some markers (e.g., ER, HER2 that are commonly used for cancer identification showed relatively large deviations in expres‐ sion levels. However, others (e.g., GRB7 showed devia‐ tions that are small enough to supplement single cell disease profiling.

  4. Combined gradient projection/single component artificial force induced reaction (GP/SC-AFIR) method for an efficient search of minimum energy conical intersection (MECI) geometries

    Science.gov (United States)

    Harabuchi, Yu; Taketsugu, Tetsuya; Maeda, Satoshi

    2017-04-01

    We report a new approach to search for structures of minimum energy conical intersection (MECIs) automatically. Gradient projection (GP) method and single component artificial force induced reaction (SC-AFIR) method were combined in the present approach. As case studies, MECIs of benzene and naphthalene between their ground and first excited singlet electronic states (S0/S1-MECIs) were explored. All S0/S1-MECIs reported previously were obtained automatically. Furthermore, the number of force calculations was reduced compared to the one required in the previous search. Improved convergence in a step in which various geometrical displacements are induced by SC-AFIR would contribute to the cost reduction.

  5. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  6. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  7. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... A set of ten diverse mulberry accessions was used for screening the primers and standardizing PCR conditions. The PCR amplifications were carried out in 10 µl reaction volume, containing 10 ng template DNA, 1X DreamTaqTM Green Buffer (ThermoFisher. Scientific, Lithuania), 0.1 mM of each dNTPs, ...

  8. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  9. Evaluation of new multiplex PCR primers for the identification ofPlasmodium species found in Sabah, Malaysia.

    Science.gov (United States)

    Stanis, Cheronie Shely; Song, Beng Kah; Chua, Tock Hing; Lau, Yee Ling; Jelip, Jenarun

    2016-01-05

    Malaria is a major public health problem, especially in the Southeast Asia region, caused by 5 species of Plasmodium (P. falciparum, P. vivax, P. malariae, P. ovale, and P. knowlesi). The aim of this study was to compare parasite species identification methods using the new multiplex polymerase chain reaction (PCR) against nested PCR and microscopy. Blood samples on filter papers were subject to conventional PCR methods using primers designed by us in multiplex PCR and previously designed primers of nested PCR. Both sets of results were compared with microscopic identification. Of the 129 samples identified as malaria-positive by microscopy, 15 samples were positive for P. falciparum, 14 for P. vivax, 6 for P. knowlesi, 72 for P. malariae, and 2 for mixed infection of P. falciparum/P. malariae. Both multiplex and nested PCR identified 12 P. falciparum single infections. For P. vivax, 9 were identified by multiplex and 12 by nested PCR. For 72 P. malariae cases, multiplex PCR identified 58 as P. knowlesi and 10 as P. malariae compared to nested PCR, which identified 59 as P. knowlesi and 7 as P. malariae. Multiplex PCR could be used as alternative molecular diagnosis for the identification of all Plasmodium species as it requires a shorter time to screen a large number of samples.

  10. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  11. Increasing cDNA yields from single-cell quantities of mRNA in standard laboratory reverse transcriptase reactions using acoustic microstreaming.

    Science.gov (United States)

    Boon, Wah Chin; Petkovic-Duran, Karolina; Zhu, Yonggang; Manasseh, Richard; Horne, Malcolm K; Aumann, Tim D

    2011-07-11

    Correlating gene expression with cell behavior is ideally done at the single-cell level. However, this is not easily achieved because the small amount of labile mRNA present in a single cell (1-5% of 1-50 pg total RNA, or 0.01-2.5 pg mRNA, per cell) mostly degrades before it can be reverse transcribed into a stable cDNA copy. For example, using standard laboratory reagents and hardware, only a small number of genes can be qualitatively assessed per cell. One way to increase the efficiency of standard laboratory reverse transcriptase (RT) reactions (i.e. standard reagents in microliter volumes) comprising single-cell amounts of mRNA would be to more rapidly mix the reagents so the mRNA can be converted to cDNA before it degrades. However this is not trivial because at microliter scales liquid flow is laminar, i.e. currently available methods of mixing (i.e. shaking, vortexing and trituration) fail to produce sufficient chaotic motion to effectively mix reagents. To solve this problem, micro-scale mixing techniques have to be used. A number of microfluidic-based mixing technologies have been developed which successfully increase RT reaction yields. However, microfluidics technologies require specialized hardware that is relatively expensive and not yet widely available. A cheaper, more convenient solution is desirable. The main objective of this study is to demonstrate how application of a novel "micromixing" technique to standard laboratory RT reactions comprising single-cell quantities of mRNA significantly increases their cDNA yields. We find cDNA yields increase by approximately 10-100-fold, which enables: greater numbers of genes to be analyzed per cell; more quantitative analysis of gene expression; and better detection of low-abundance genes in single cells. The micromixing is based on acoustic microstreaming, a phenomenon where sound waves propagating around a small obstacle create a mean flow near the obstacle. We have developed an acoustic microstreaming

  12. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  13. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  14. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification.

    Science.gov (United States)

    Baransel, Aysun; Dulger, Hikmet E; Tokdemir, Mehmet

    2004-06-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5'-CGCGCCGG-3' and 5'-TGCCGAGCTG-3') and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers.

  15. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  16. Selection of single grain seeds by 14N(n, γ)15N nuclear reaction for protein improvement

    International Nuclear Information System (INIS)

    Andras, L.; Balint, A.; Csoke, A.; Nagy, A.Z.

    1978-05-01

    A new, non-destructive screening technique was developed for determining the protein (total nitrogen) content of single grain seeds. Here, our first experiment is described where, in the case of maize samples, 300 s was used to perform one measurement on a seed with a semi-automatic device. This work was started in 1976 at the HFR reactor. Grenoble, in the Institut Max von Laue-Paul Langevin and is now continued in the framework of the scientific cooperation between the ILL and KFKI. (author)

  17. Mechanical unfolding of proteins: reduction to a single-reaction coordinate unfolding potential, and an application of the Jarzynski Relation

    Science.gov (United States)

    Olmsted, Peter; West, Daniel; Paci, Emanuele

    2007-03-01

    Single molecule force spectroscopy (AFM, optical tweezers, etc) has revolutionized the study of many biopolymers, including DNA, RNA, and proteins. In this talk I will discuss recent work on modelling of mechanical unfolding of proteins, as often probed by AFM. I will address two issues in obtaining a coarse-grained description of protein unfolding: how to project the entire energy landscape onto an effective one dimensional unfolding potential, and how to apply the Jarzynski Relation to extract equilibrium free energies from nonequilibrium unfolding experiments.

  18. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    Science.gov (United States)

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  19. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  20. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  1. A model of reaction field in gas-injected arc-in-water method to synthesize single-walled carbon nanohorns: Influence of water temperature

    International Nuclear Information System (INIS)

    Poonjarernsilp, Chantamanee; Sano, Noriaki; Tamon, Hajime; Charinpanitkul, Tawatchai

    2009-01-01

    The method to synthesize single-walled carbon nanohorns (SWCNHs) using gas-injected arc in water (GI-AIW) has been experimentally studied. GI-AIW is known as one of the cost-effective methods to obtain SWCNHs. It was revealed that the yield of SWCNHs significantly decreases with the increase in water temperature although the purity of SWCNHs is not dependent on the temperature change. Then the model of relevant reactions in the GI-AIW system was proposed by accounting the emission of carbon vapor, formation of SWCNHs, and diffusion of water vapor in three zones inside the cathode hole (arc plasma zone, quenching zone, and downstream zone). The side reaction between H 2 O and C produces H 2 gas and consumes a certain amount of carbon vapor, resulting in the hindered SWCNH formation. Moreover the observation of the optical spectra emitting from the arc plasma zone strongly supported that the H 2 generating reaction does not occur at arc plasma zone since N 2 flow can purge H 2 O out. The model proposed in this study can precisely explain the correlation between H 2 gas production and water temperature.

  2. Emaravirus-specific degenerate PCR primers allowed the identification of partial RNA-dependent RNA polymerase sequences of Maize red stripe virus and Pigeonpea sterility mosaic virus.

    Science.gov (United States)

    Elbeaino, Toufic; Whitfield, Anna; Sharma, Mamta; Digiaro, Michele

    2013-03-01

    Emaravirus is a recently established viral genus that includes two approved virus species: European mountain ash ringspot-associated virus (EMARaV) and Fig mosaic virus (FMV). Other described but unclassified viruses appear to share biological characteristics similar to emaraviruses, including segmented, negative-single stranded RNA genomes with enveloped virions approximately 80-200nm in diameter. Sequence analysis of emaravirus genomes revealed the presence of conserved amino acid sequences in the RNA-dependent RNA polymerase gene (RdRp) denoted as pre-motif A, motifs A and C. Degenerate oligonucleotide primers were developed to these conserved sequences and were shown to amplify in reverse transcription-polymerase chain reaction assay (RT-PCR) DNA fragments of 276bp and 360bp in size. These primers efficiently detected emaraviruses with known sequences available in the database (FMV and EMARaV); they also detected viruses with limited sequence information such as Pigeonpea sterility mosaic virus (PPSMV) and Maize red stripe virus (MRSV). The degenerate primers designed on pre-motif A and motif A sequences successfully amplified the four species used as positive controls (276bp), whereas those of motifs A and C failed to detect only MRSV. The amino acid sequences obtained from PPSMV and MRSV shared the highest identity with those of two other tentative species of the Emaravirus genus, Rose rosette virus (RRV) (69%) and Redbud yellow ringspot virus (RYRV) (60%), respectively. The phylogenetic tree constructed with 92 amino acid-long portions of polypeptide putatively encoded by RNA1 of definitive and tentative emaravirus species clustered PPSMV and MRSV in two separate clades close to RRV and Raspberry leaf blotch virus (RLBV), respectively. The newly developed degenerate primers have proved their efficacy in amplifying new emaravirus-specific sequences; accordingly, they could be useful in identifying new emaravirus-like species in nature. Copyright © 2012

  3. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis

    Science.gov (United States)

    Wang, Mu; Park, Jang-Su; Ishiai, Masamichi; Hurwitz, Jerard; Lee, Suk-Hee

    2000-01-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) α and δ. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol α–primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis. PMID:11095685

  4. Developing single-molecule TPM experiments for direct observation of successful RecA-mediated strand exchange reaction.

    Science.gov (United States)

    Fan, Hsiu-Fang; Cox, Michael M; Li, Hung-Wen

    2011-01-01

    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5'-to-3' fashion, using a synapse segment with a wide and continuous size distribution.

  5. PAH formation under single collision conditions: reaction of phenyl radical and 1,3-butadiene to form 1,4-dihydronaphthalene.

    Science.gov (United States)

    Kaiser, R I; Parker, D S N; Zhang, F; Landera, A; Kislov, V V; Mebel, A M

    2012-05-03

    The crossed beam reactions of the phenyl radical (C(6)H(5), X(2)A(1)) with 1,3-butadiene (C(4)H(6), X(1)A(g)) and D6-1,3-butadiene (C(4)D(6), X(1)A(g)) as well as of the D5-phenyl radical (C(6)D(5), X(2)A(1)) with 2,3-D2-1,3-butadiene and 1,1,4,4-D4-1,3-butadiene were carried out under single collision conditions at collision energies of about 55 kJ mol(-1). Experimentally, the bicyclic 1,4-dihydronaphthalene molecule was identified as a major product of this reaction (58 ± 15%) with the 1-phenyl-1,3-butadiene contributing 34 ± 10%. The reaction is initiated by a barrierless addition of the phenyl radical to the terminal carbon atom of the 1,3-butadiene (C1/C4) to form a bound intermediate; the latter underwent hydrogen elimination from the terminal CH(2) group of the 1,3-butadiene molecule leading to 1-phenyl-trans-1,3-butadiene through a submerged barrier. The dominant product, 1,4-dihydronaphthalene, is formed via an isomerization of the adduct by ring closure and emission of the hydrogen atom from the phenyl moiety at the bridging carbon atom through a tight exit transition state located about 31 kJ mol(-1) above the separated products. The hydrogen atom was found to leave the decomposing complex almost parallel to the total angular momentum vector and perpendicularly to the rotation plane of the decomposing intermediate. The defacto barrierless formation of the 1,4-dihydronaphthalene molecule involving a single collision between a phenyl radical and 1,3-butadiene represents an important step in the formation of polycyclic aromatic hydrocarbons (PAHs) and their partially hydrogenated counterparts in combustion and interstellar chemistry.

  6. Formation of 6-methyl-1,4-dihydronaphthalene in the reaction of the p-tolyl radical with 1,3-butadiene under single-collision conditions.

    Science.gov (United States)

    Parker, Dorian S N; Dangi, Beni B; Kaiser, Ralf I; Jamal, Adeel; Ryazantsev, Mikhail; Morokuma, Keiji

    2014-12-26

    Crossed molecular beam reactions of p-tolyl (C7H7) plus 1,3-butadiene (C4H6), p-tolyl (C7H7) plus 1,3-butadiene-d6 (C4D6), and p-tolyl-d7 (C7D7) plus 1,3-butadiene (C4H6) were carried out under single-collision conditions at collision energies of about 55 kJ mol(-1). 6-Methyl-1,4-dihydronaphthalene was identified as the major reaction product formed at fractions of about 94% with the monocyclic isomer (trans-1-p-tolyl-1,3-butadiene) contributing only about 6%. The reaction is initiated by barrierless addition of the p-tolyl radical to the terminal carbon atom of the 1,3-butadiene via a van der Waals complex. The collision complex isomerizes via cyclization to a bicyclic intermediate, which then ejects a hydrogen atom from the bridging carbon to form 6-methyl-1,4-dihydronaphthalene through a tight exit transition state located about 27 kJ mol(-1) above the separated products. This is the dominant channel under the present experimental conditions. Alternatively, the collision complex can also undergo hydrogen ejection to form trans-1-p-tolyl-1,3-butadiene; this is a minor contributor to the present experiment. The de facto barrierless formation of a methyl-substituted aromatic hydrocarbons by dehydrogenation via a single event represents an important step in the formation of polycyclic aromatic hydrocarbons (PAHs) and their partially hydrogenated analogues in combustion flames and the interstellar medium.

  7. A 2D Coordination Network That Detects Nitro Explosives in Water, Catalyzes Baylis-Hillman Reactions, and Undergoes Unusual 2D→3D Single-Crystal to Single-Crystal Transformation.

    Science.gov (United States)

    Sharma, Vivekanand; De, Dinesh; Pal, Sanchari; Saha, Prithwidip; Bharadwaj, Parimal K

    2017-08-07

    The solvothermal reaction of Zn(NO 3 ) 2 ·6H 2 O and a linear dicarboxylate ligand H 2 L, in the presence of urotropine in N,N'-dimethylformamide (DMF), gives rise to a new porous two-dimensional (2D) coordination network, {[Zn 3 (L) 3 (urotropine) 2 ]·2DMF·3H 2 O} n (1), with hxl topology. Interestingly, framework 1 exhibits excellent emission properties owing to the presence of naphthalene moiety in the linker H 2 L, that can be efficiently suppressed by subtle quantity of nitro explosives in aqueous medium. Furthermore, presence of urotropine molecules bound to the metal centers, 1 is found to be an excellent heterogeneous catalyst meant for atom-economical C-C bond-forming Baylis-Hillman reactions. Additionally, crystals of 1 undergo complete transmetalation with Cu(II) to afford isostructural 1 Cu . Moreover, the 2D framework of 1 allows replacement of urotropine molecules by 4,4'-azopyridine (azp) linker resulting in a three-dimensional (3D) metal-organic framework, {[Zn(L)(azp)]·4DMF 2H 2 O} n (2). The 1→2 transformation takes place in single-crystal-to-single crystal manner supported by powder X-ray diffraction, atomic force microscopy, high-resolution transmission electron microscopy, and morphological studies. Remarkably, during this 2D→3D transformation, the original trinuclear [Zn 3 (COO) 6 ] secondary building unit changes to a mononuclear node, which is unprecedented.

  8. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  9. Acrosome Reaction and Ca2+ Imaging in Single Human Spermatozoa: New Regulatory Roles of [Ca2+]i1

    Science.gov (United States)

    Sánchez-Cárdenas, Claudia; Servín-Vences, Martha Rocio; José, Omar; Treviño, Claudia Lydia; Hernández-Cruz, Arturo; Darszon, Alberto

    2014-01-01

    ABSTRACT The spermatozoa acrosome reaction (AR) is essential for mammalian fertilization. Few methods allow visualization of AR in real time together with Ca2+ imaging. Here, we show that FM4-64, a fluorescent dye used to follow exocytosis, reliably reports AR progression induced by ionomycin and progesterone in human spermatozoa. FM4-64 clearly delimits the spermatozoa contour and reports morphological cell changes before, during, and after AR. This strategy unveiled the formation of moving tubular appendages, emerging from acrosome-reacted spermatozoa, which was confirmed by scanning electron microscopy. Alternate wavelength illumination allowed concomitant imaging of FM4-64 and Fluo-4, a Ca2+ indicator. These AR and intracellular Ca2+ ([Ca2+]i) recordings revealed that the presence of [Ca2+]i oscillations, both spontaneous and progesterone induced, prevents AR in human spermatozoa. Notably, the progesterone-induced AR is preceded by a second [Ca2+]i peak and ∼40% of reacting spermatozoa also manifest a slow [Ca2+]i rise ∼2 min before AR. Our findings uncover new AR features related to [Ca2+]i. PMID:25100708

  10. Non-adiabatic effects within a single thermally averaged potential energy surface: thermal expansion and reaction rates of small molecules.

    Science.gov (United States)

    Alonso, J L; Castro, A; Clemente-Gallardo, J; Echenique, P; Mazo, J J; Polo, V; Rubio, A; Zueco, D

    2012-12-14

    At non-zero temperature and when a system has low-lying excited electronic states, the ground-state Born-Oppenheimer approximation breaks down and the low-lying electronic states are involved in any chemical process. In this work, we use a temperature-dependent effective potential for the nuclei which can accommodate the influence of an arbitrary number of electronic states in a simple way, while at the same time producing the correct Boltzmann equilibrium distribution for the electronic part. With the help of this effective potential, we show that thermally activated low-lying electronic states can have a significant effect in molecular properties for which electronic excitations are oftentimes ignored. We study the thermal expansion of the Manganese dimer, Mn(2), where we find that the average bond length experiences a change larger than the present experimental accuracy upon the inclusion of the excited states into the picture. We also show that, when these states are taken into account, reaction-rate constants are modified. In particular, we study the opening of the ozone molecule, O(3), and show that in this case the rate is modified as much as a 20% with respect to the ground-state Born-Oppenheimer prediction.

  11. Single and multinucleon transfer in {sup 19}F,{sup 16}O,{sup 12}C+{sup 232}Th reactions at near barrier energies

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, D.C.; Choudhury, R.K.; Nayak, B.K.; Nadkarni, D.M. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400 085 (India); Ramamurthy, V.S. [Department of Science and Technology, New Delhi 110 016 (India)

    1997-10-01

    Cross sections for single (1p) and multinucleon (2p,{sup 4}He, and p{sup 4}He) transfer reactions have been measured in {sup 19}F, {sup 16}O, {sup 12}C+{sup 232}Th systems at beam energies around the Coulomb barrier. Angular distributions and energy spectra of the projectilelike particles exhibit characteristics of direct transfer reactions. The ratio of the transfer to total reaction (transfer+fusion-fission) cross section is observed to be significantly smaller for the {sup 12}C projectile, as compared to that for {sup 19}F and {sup 16}O projectiles. All the systems show large transfer cross sections relative to the total reaction cross section at subbarrier energies. The angular distribution data were analyzed in terms of transfer probabilities to derive the slope parameter ({alpha}) for the stripping of 1p and 2p in the case of {sup 16}O and {sup 12}C projectiles and for 1p, {sup 4}He and correlated (p{sup 4}He) stripping in the case of {sup 19}F projectile, for comparison with the semiclassical calculations. It is observed that the semiclassical picture is valid for 1p transfer at energies near the Coulomb barrier, whereas for correlated 2p, {sup 4}He, and (p{sup 4}He) multinucleon transfers, the experimental values of {alpha} are anomalously small as compared to the semiclassical calculations even at subbarrier energies. At the above-barrier energies, the slope anomaly can be explained after inclusion of the nuclear effects in semiclassical calculations. {copyright} {ital 1997} {ital The American Physical Society}

  12. Dynamic and reversible self-assembly of photoelectrochemical complexes based on lipid bilayer disks, photosynthetic reaction centers, and single-walled carbon nanotubes.

    Science.gov (United States)

    Boghossian, Ardemis A; Choi, Jong Hyun; Ham, Moon-Ho; Strano, Michael S

    2011-03-01

    An aqueous solution containing photosynthetic reaction centers (RCs), membrane scaffold proteins (MSPs), phospholipids, and single-walled carbon nanotubes (SWCNTs) solubilized with the surfactant sodium cholate (SC) reversibly self-assembles into a highly ordered structure upon dialysis of the latter. The resulting structure is photoelectrochemically active and consists of 4-nm-thick lipid bilayer disks (nanodisks, NDs) arranged parallel to the surface of the SWCNT with the RC housed within the bilayer such that its hole injecting site faces the nanotube surface. The structure can be assembled and disassembled autonomously with the addition or removal of surfactant. We model the kinetic and thermodynamic forces that drive the dynamics of this reversible self-assembly process. The assembly is monitored using spectrofluorimetry during dialysis and subsequent surfactant addition and used to fit a kinetic model to determine the forward and reverse rate constants of ND and ND-SWCNT formation. The calculated ND and ND-SWCNT forward rate constants are 79 mM(-1) s(-1) and 5.4 × 10(2) mM(-1) s(-1), respectively, and the reverse rate constants are negligible over the dialysis time scale. We find that the reaction is not diffusion-controlled since the ND-SWCNT reaction, which consists of entities with smaller diffusion coefficients, has a larger reaction rate constant. Using these rate parameters, we were able to develop a kinetic phase diagram for the formation of ND-SWCNT complexes, which indicates an optimal dialysis rate of approximately 8 × 10(-4) s(-1). We also fit the model to cyclic ND-SWCNT assembly and disassembly experiments and hence mimic the thermodynamic forces used in regeneration processes detailed previously. Such forces may form the basis of both synthetic and natural photoelectrochemical complexes capable of dynamic component replacement and repair.

  13. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  14. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  15. Meaurement of the target single-spin asymmetry in quasi-elastic region from the reaction {sup 3}He{up_arrow}(e,e')

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yawei [Rutgers

    2013-10-01

    A measurement of the inclusive target single-spin asymmetry has been performed using the quasi-elastic {sup 3}He{up_arrow}(e,e') reaction with a vertically polarized {sup 3}He target at Q{sup 2} values of 0.13, 0.46 and 0.97 GeV{sup 2}. This asymmetry vanishes under the one photon exchange assumption. But the interference between two-photon exchange and one-photon exchange gives rise to an imaginary amplitude, so that a non-zero A{sub y} is allowed. The experiment, conducted in Hall A of Jefferson Laboratory in 2009, used two independent spectrometers to simultaneously measure the target single-spin asymmetry. Using the effective polarization approximation, the neutron single-spin asymmetries were extracted from the measured {sup 3}He asymmetries. The measurement is to establish a non-vanishing A{sub y}. Non-zero asymmetries were observed at all Q{sup 2} points, and the overall precision is an order of magnitude improved over the existing proton data. The data provide new constraints on Generalized Parton Distribution (GPD) models and new information on the dynamics of the two-photon exchange process.

  16. Study of single particle properties of nuclei in the region of the "island of inversion" by means of neutron-transfer reactions

    CERN Multimedia

    Kruecken, R; Voulot, D

    2007-01-01

    We are aiming at the investigation of single particle properties of neutron-rich nuclei in the region of the "island of inversion" where intruder states from the $\\{fp}$-shell favour deformed ground states instead of the normal spherical $\\textit{sd}$-shell states. As first experiment, we propose to study single particle states in the neutron-rich isotope $^{31}$Mg. The nucleus will be populated by a one-neutron transfer reaction with a $^{30}$Mg beam at 3 MeV/u obtained from REX-ISOLDE impinging on a CD$_{2}$ target. The $\\gamma$-rays will be detected by the MINIBALL array and the particles by a newly built set-up of segmented Si detectors with a angular coverage of nearly 4$\\pi$. Relative spectroscopic factors extracted from the cross sections will enable us to pin down the configurations of the populated states. These will be compared to recent shell model calculations involving new residual interactions. This will shed new light on the evolution of single particle structure leading to the breaking of the ...

  17. High-Pressure Catalytic Reactions of C6 Hydrocarbons on PlatinumSingle-Crystals and nanoparticles: A Sum Frequency Generation VibrationalSpectroscopic and Kinetic Study

    Energy Technology Data Exchange (ETDEWEB)

    Bratlie, Kaitlin [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Catalytic reactions of cyclohexene, benzene, n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene on platinum catalysts were monitored in situ via sum frequency generation (SFG) vibrational spectroscopy and gas chromatography (GC). SFG is a surface specific vibrational spectroscopic tool capable of monitoring submonolayer coverages under reaction conditions without gas-phase interference. SFG was used to identify the surface intermediates present during catalytic processes on Pt(111) and Pt(100) single-crystals and on cubic and cuboctahedra Pt nanoparticles in the Torr pressure regime and at high temperatures (300K-450K). At low pressures (<10-6 Torr), cyclohexene hydrogenated and dehydrogenates to form cyclohexyl (C6H11) and π-allyl C6H9, respectively, on Pt(100). Increasing pressures to 1.5 Torr form cyclohexyl, π-allyl C6H9, and 1,4-cyclohexadiene, illustrating the necessity to investigate catalytic reactions at high-pressures. Simultaneously, GC was used to acquire turnover rates that were correlated to reactive intermediates observed spectroscopically. Benzene hydrogenation on Pt(111) and Pt(100) illustrated structure sensitivity via both vibrational spectroscopy and kinetics. Both cyclohexane and cyclohexene were produced on Pt(111), while only cyclohexane was formed on Pt(100). Additionally, π-allyl c-C6H9 was found only on Pt(100), indicating that cyclohexene rapidly dehydrogenates on the (100) surface. The structure insensitive production of cyclohexane was found to exhibit a compensation effect and was analyzed using the selective energy transfer (SET) model. The SET model suggests that the Pt-H system donates energy to the E2u mode of free benzene, which leads to catalysis. Linear C6 (n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene) hydrocarbons were also investigated in the presence and absence of excess hydrogen on Pt

  18. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  19. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  20. The effect of defects on the catalytic activity of single Au atom supported carbon nanotubes and reaction mechanism for CO oxidation.

    Science.gov (United States)

    Ali, Sajjad; Fu Liu, Tian; Lian, Zan; Li, Bo; Sheng Su, Dang

    2017-08-23

    The mechanism of CO oxidation by O 2 on a single Au atom supported on pristine, mono atom vacancy (m), di atom vacancy (di) and the Stone Wales defect (SW) on single walled carbon nanotube (SWCNT) surface is systematically investigated theoretically using density functional theory. We determine that single Au atoms can be trapped effectively by the defects on SWCNTs. The defects on SWCNTs can enhance both the binding strength and catalytic activity of the supported single Au atom. Fundamental aspects such as adsorption energy and charge transfer are elucidated to analyze the adsorption properties of CO and O 2 and co-adsorption of CO and O 2 molecules. It is found that CO binds stronger than O 2 on Au supported SWCNT. We clearly demonstrate that the defected SWCNT surface promotes electron transfer from the supported single Au atom to O 2 molecules. On the other hand, this effect is weaker for pristine SWCNTs. It is observed that the high density of spin-polarized states are localized in the region of the Fermi level due to the strong interactions between Au (5d orbital) and the adjacent carbon (2p orbital) atoms, which influence the catalytic performance. In addition, we elucidate both the Langmuir-Hinshelwood (LH) and Eley-Rideal (ER) mechanisms of CO oxidation by O 2 . For the LH pathway, the barriers of the rate-limiting step are calculated to be 0.02 eV and 0.05 eV for Au/m-SWCNT and Au/di-SWCNT, respectively. To regenerate the active sites, an ER-like reaction occurs to form a second CO 2 molecule. The ER pathway is observed on Au/m-SWCNT, Au/SW-SWCNT and Au/SWCNT in which the Au/m-SWCNT has a smaller barrier. The comparison with a previous study (Lu et al., J. Phys. Chem. C, 2009, 113, 20156-20160.) indicates that the curvature effect of SWCNTs is important for the catalytic property of the supported single Au. Overall, Au/m-SWCNT is identified as the most active catalyst for CO oxidation compared to pristine SWCNT, SW-SWCNT and di-SWCNT. Our findings give a

  1. Guanine radical reaction processes: a computational description of proton transfer in X-irradiated 9-ethylguanine single crystals.

    Science.gov (United States)

    Jayatilaka, Nayana; Nelson, William H

    2008-12-25

    Computational methods based on DFT procedures have been used to investigate proton-transfer processes in irradiated 9-ethylguanine crystals. Previous experimental results from X-irradiation and study of this system at 10 K found significant concentrations of two main products, R1, formed by N7-hydrogenation of the purine ring, and R2, the primary one-electron oxidation product (Jayatilaka, N.; Nelson, W. H. J. Phys. Chem. B 2007, 111, 7887). The objective of this work is to describe the processes leading to these products using computational methods that take into account molecular packing and bulk dielectric properties. The basic concept is that a proton will transfer following ionization if the net electronic energy of the system, consisting of the donor plus the acceptor plus any intervening molecules, becomes lower. Three approaches were used to investigate this concept, two based on energies computed for single molecules and one based on energies computed for two-molecule clusters arranged as in the crystals. The results are that the methods successfully predict the observed behavior, that it is energetically favorable on one-electron reduction for proton H1 to transfer from a neutral molecule to N7 of the neighbor, forming the N7-hydrogenated product, and that there is virtually no energy advantage for a proton to transfer upon one-electron oxidation. The results also support the proposal that the C8 H-addition radical, found only upon irradiation at 300 K, was the product of intramolecular transfer of the H7 proton to C8 in a process apparently requiring sufficient thermal energy for activation. Finally, the computations predict hyperfine couplings and tensors in very good agreement with those from experiment, thereby providing additional evidence for the success of the computations in describing the experimental observations.

  2. Optimised padlock probe ligation and microarray detection of multiple (non-authorised GMOs in a single reaction

    Directory of Open Access Journals (Sweden)

    Schoen Cor D

    2008-12-01

    Full Text Available Abstract Background To maintain EU GMO regulations, producers of new GM crop varieties need to supply an event-specific method for the new variety. As a result methods are nowadays available for EU-authorised genetically modified organisms (GMOs, but only to a limited extent for EU-non-authorised GMOs (NAGs. In the last decade the diversity of genetically modified (GM ingredients in food and feed has increased significantly. As a result of this increase GMO laboratories currently need to apply many different methods to establish to potential presence of NAGs in raw materials and complex derived products. Results In this paper we present an innovative method for detecting (approved GMOs as well as the potential presence of NAGs in complex DNA samples containing different crop species. An optimised protocol has been developed for padlock probe ligation in combination with microarray detection (PPLMD that can easily be scaled up. Linear padlock probes targeted against GMO-events, -elements and -species have been developed that can hybridise to their genomic target DNA and are visualised using microarray hybridisation. In a tenplex PPLMD experiment, different genomic targets in Roundup-Ready soya, MON1445 cotton and Bt176 maize were detected down to at least 1%. In single experiments, the targets were detected down to 0.1%, i.e. comparable to standard qPCR. Conclusion Compared to currently available methods this is a significant step forward towards multiplex detection in complex raw materials and derived products. It is shown that the PPLMD approach is suitable for large-scale detection of GMOs in real-life samples and provides the possibility to detect and/or identify NAGs that would otherwise remain undetected.

  3. Defect-induced Catalysis toward the Oxygen Reduction Reaction in Single-walled Carbon Nanotube: Nitrogen doped and Non-nitrogen doped

    International Nuclear Information System (INIS)

    Lu, Di; Wu, Dan; Jin, Jian; Chen, Liwei

    2016-01-01

    Single-walled carbon nanotubes (SWNTs) are post-treated by argon (Ar) or ammonia (NH 3 ) plasma irradiation to introduce defects that are potentially related to catalysis towards the oxygen reduction reaction (ORR). Electrochemical characterization in alkali medium suggests that the plasma irradiated SWNTs demonstrate enhanced catalytic activity toward the ORR with a positively shifted threshold potential. Moreover the enhanced desired four-electron pathway catalytic activity, which exhibited as the positive shifted threshold potential, is independent of the nitrogen dopant. The nature of the defects is probed with Raman and X-ray photoelectron spectroscopy. The results indicate that the non-nitrogen doped defects of SWNTs contribute to the actual active site for the ORR.

  4. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain ReactionSingle Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain ReactionSingle Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  5. Dynamic disorder in single-molecule Michaelis-Menten kinetics: The reaction-diffusion formalism in the Wilemski-Fixman approximation

    Science.gov (United States)

    Chaudhury, Srabanti; Cherayil, Binny J.

    2007-09-01

    Single-molecule equations for the Michaelis-Menten [Biochem. Z. 49, 333 (1913)] mechanism of enzyme action are analyzed within the Wilemski-Fixman [J. Chem. Phys. 58, 4009 (1973); 60, 866 (1974)] approximation after the effects of dynamic disorder—modeled by the anomalous diffusion of a particle in a harmonic well—are incorporated into the catalytic step of the reaction. The solution of the Michaelis-Menten equations is used to calculate the distribution of waiting times between successive catalytic turnovers in the enzyme β-galactosidase. The calculated distribution is found to agree qualitatively with experimental results on this enzyme obtained at four different substrate concentrations. The calculations are also consistent with measurements of correlations in the fluctuations of the fluorescent light emitted during the course of catalysis, and with measurements of the concentration dependence of the randomness parameter.

  6. Single-molecule Imaging Analysis of Elementary Reaction Steps of Trichoderma reesei Cellobiohydrolase I (Cel7A) Hydrolyzing Crystalline Cellulose Iα and IIII*

    Science.gov (United States)

    Shibafuji, Yusuke; Nakamura, Akihiko; Uchihashi, Takayuki; Sugimoto, Naohisa; Fukuda, Shingo; Watanabe, Hiroki; Samejima, Masahiro; Ando, Toshio; Noji, Hiroyuki; Koivula, Anu; Igarashi, Kiyohiko; Iino, Ryota

    2014-01-01

    Trichoderma reesei cellobiohydrolase I (TrCel7A) is a molecular motor that directly hydrolyzes crystalline celluloses into water-soluble cellobioses. It has recently drawn attention as a tool that could be used to convert cellulosic materials into biofuel. However, detailed mechanisms of action, including elementary reaction steps such as binding, processive hydrolysis, and dissociation, have not been thoroughly explored because of the inherent challenges associated with monitoring reactions occurring at the solid/liquid interface. The crystalline cellulose Iα and IIII were previously reported as substrates with different crystalline forms and different susceptibilities to hydrolysis by TrCel7A. In this study, we observed that different susceptibilities of cellulose Iα and IIII are highly dependent on enzyme concentration, and at nanomolar enzyme concentration, TrCel7A shows similar rates of hydrolysis against cellulose Iα and IIII. Using single-molecule fluorescence microscopy and high speed atomic force microscopy, we also determined kinetic constants of the elementary reaction steps for TrCel7A against cellulose Iα and IIII. These measurements were performed at picomolar enzyme concentration in which density of TrCel7A on crystalline cellulose was very low. Under this condition, TrCel7A displayed similar binding and dissociation rate constants for cellulose Iα and IIII and similar fractions of productive binding on cellulose Iα and IIII. Furthermore, once productively bound, TrCel7A processively hydrolyzes and moves along cellulose Iα and IIII with similar translational rates. With structural models of cellulose Iα and IIII, we propose that different susceptibilities at high TrCel7A concentration arise from surface properties of substrate, including ratio of hydrophobic surface and number of available lanes. PMID:24692563

  7. A modified molecular beacons-based multiplex real-time PCR assay for simultaneous detection of eight foodborne pathogens in a single reaction and its application.

    Science.gov (United States)

    Hu, Qinghua; Lyu, Dongyue; Shi, Xiaolu; Jiang, Yixiang; Lin, Yiman; Li, Yinghui; Qiu, Yaqun; He, Lianhua; Zhang, Ran; Li, Qingge

    2014-03-01

    Foodborne disease outbreaks are often caused by one of the major pathogens. Early identification of the causal pathogen is crucial for disease control and prevention. We describe a real-time polymerase chain reaction (rtPCR) assay that can identify, in a single reaction, up to eight common foodborne bacterial pathogens, including Salmonella enterica subsp. enterica, Listeria monocytogenes, Escherichia coli O157, Vibrio parahaemolyticus, V. vulnificus, Campylobacter jejuni, Enterobacter sakazakii, and Shigella spp. This multiplex rtPCR assay takes advantage of modified molecular beacons and the multicolor combinational probe coding strategy to discriminate each pathogen and the homo-tag assisted non-dimer (HAND) system to prevent dimer formation. The detection limits of the assay ranged from 1.3×10(3) colony-forming units (CFU)/g stool (L. monocytogenes) to 1.6×10(4) CFU/g stool (Shigella spp.). The target genes were 100% specific as assessed on 986 reference strains covering 41 species since no cross-reactions were observed. The assay was applied to the detection of foodborne pathogens in 11,167 clinical samples and the results were compared with culture methods for further validation. The sensitivity and specificity of the rtPCR were 100% and 99%, respectively. When performed in a 96-well rtPCR system, more than 90 samples could be analyzed within 3 h. Given the high accuracy, sensitivity, specificity, and short turn-around time, the established assay could be used for the rapid and reliable identification of the causative pathogens responsible for a certain foodborne disease outbreak and rapid screening of these major foodborne pathogens in laboratory-based surveillance of outpatient clinical samples or even food samples.

  8. Investigations of Spectroscopic Factors and Sum Rules from the Single Neutron Transfer Reaction 111Cd(d→$\\overrightarrow {\\rm{d}} $,p112Cd

    Directory of Open Access Journals (Sweden)

    Jamieson D.S.

    2014-03-01

    Full Text Available Cadmium isotopes have been presented for decades as excellent examples of vibrational nuclei, with low-lying levels interpreted as multi-phonon quadrupole, octupole, and mixed-symmetry states. A large amount of spectroscopic data has been obtained through various experimental studies of cadmiumisotopes. In the present work, the 111Cd(d→$\\overrightarrow {\\rm{d}} $,p112Cd reaction was used to investigate the single-particle structure of the 112Cd nucleus. A 22 MeV beam of polarized deuterons was obtained at the Maier-Leibnitz laboratory in Garching, Germany. The reaction ejectiles were momentum analyzed using a Q3D spectrograph, and 130 levels have been identified up to 4.2 MeV of excitation energy. Using DWBA analysis with optical model calculations, spin-parity assignments have been made for observed levels, and spectroscopic factors have been extracted from the experimental angular distributions of differential cross section and analyzing power. In this high energy resolution investigation, many additional levels have been observed compared with the previous (d,p study using 8 MeV deuterons [1]. There were a total of 44 new levels observed, and the parity assignments of 34 levels were improved.

  9. Zinc Enolate/Sulfinate Prepared from a Single-Run Reaction Using Zinc Dust with O-Tosylated 4-Hydroxy Coumarin and Pyrone

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ueon Sang; Joo, Seong-Ryu; Kim, Seung-Hoi [Dankook University, Cheonan (Korea, Republic of)

    2016-07-15

    We demonstrated the preparation of new zinc complexes, 2-oxo-2H-chromen-4-yloxy tosylzinc (I), and 6-methyl-2-oxo-2H-pyran-4-yloxy tosylzinc (II), by the oxidative addition of readily available zinc dust into the corresponding 4-tosylated coumarin (A) and pyrone (B), respectively. Of special interest, the thus-obtained zinc complexes showed an electrophile-dependent reactivity. The subsequent coupling reactions of I and II with a variety of acid chlorides provided the O-acylation product in moderate yields. More interestingly, it should be emphasized that the thus-prepared zinc complexes (I and II) functioned both as zinc enolate and zinc sulfinate, providing C(3)-disubstituted product (b) and sulfone (c), respectively, from a single-run reaction when I or II was treated with benzyl halides. Even though somewhat low yields were achieved under the nonoptimized conditions, the novel zinc complexes present another potential application for zinc reagents. Versatile applications of this discovery are currently underway.

  10. Single Electron Transfer-Promoted Photochemical Reactions of Secondary N-Trimethylsilylmethyl-N-benzylamines Leading to Aminomethylation of Fullerene C60.

    Science.gov (United States)

    Lim, Suk Hyun; Jeong, Ho Cheol; Sohn, Youngku; Kim, Young-Il; Cho, Dae Won; Woo, Hee-Jae; Shin, Ik-Soo; Yoon, Ung Chan; Mariano, Patrick S

    2016-03-18

    Photoreactions between C60 and secondary N-trimethylsilylmethyl-N-benzylamines were explored to evaluate the feasibility of a new method for secondary aminomethylation of electron acceptors. The results show that photoreactions of C60 with these secondary amines in 10% EtOH-toluene occur to form aminomethyl-1,2-dihydrofullerenes predominantly through a pathway involving single electron transfer (SET)-promoted formation of secondary aminium radicals followed by preferential loss of the α-trimethylsilyl group. The aminomethyl radicals formed in this manner then couple with C60 or C60(•-) to form radical or anion precursors of the aminomethyl-1,2-dihydrofullerenes. In contrast to thermal and photochemical strategies developed previously, the new SET photochemical approach using α-trimethylsilyl-substituted secondary amines is both mild and efficient, and as a result, it should be useful in broadening the library of substituted fullerenes. Moreover, the results should have an impact on the design of SET-promoted C-C bond forming reactions. Specifically, introduction of an α-trimethylsilyl group leads to a change in the chemoselectivity of SET-promoted reactions of secondary amines with acceptors that typically favor aminium radical N-H deprotonation, leading to N-C bond formation. Finally, symmetric and unsymmetric fulleropyrrolidines are also generated in yields that are highly dependent on the electronic properties of arene ring substituents in amines, irradiation time, and solvent.

  11. The relation between executive functioning, reaction time, naming speed, and single word reading in children with typical development and language impairments.

    Science.gov (United States)

    Messer, David; Henry, Lucy A; Nash, Gilly

    2016-09-01

    Few investigations have examined the relationship between a comprehensive range of executive functioning (EF) abilities and reading. Our investigation identified components of EF that independently predicted single word reading, and determined whether their predictive role remained when additional variables were included in the regression analyses. This provided information about the EF processes that are related to reading, and the unity and diversity of EF. This study consisted of 160 children: 88 were typically developing with no language difficulties; 72 had language impairments. The assessments involved decoding, 10 measures of EF, reaction time, naming speed, non-verbal and verbal age-equivalent scores. In the first regression analysis, which only concerned the EF variables, the following verbal forms of EF had significant relationships with decoding: working memory, fluency, planning, and inhibition. Further regression analyses included additional predictor variables: reaction time, naming speed, and age-equivalent scores. These analyses indicated that most of the EF variables continued to predict decoding even when entered with competitor variables. Furthermore, after the entry of EF variables, there were no group differences in decoding (typical vs. language difficulties). We discuss the contribution of EF and other variables to reading abilities. © 2016 The British Psychological Society.

  12. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  13. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  14. Geographic exchange standard and primer

    Energy Technology Data Exchange (ETDEWEB)

    1978-10-01

    The ANSI Draft Proposal Specifications for an Information Interchange Data Descriptive File, X3L5.SEP, contains some Guidelines for Implementation (Appendix D). However, some additional guidelines should be provided specifically for the more commonly used systems of coding locational data, and referring thematic data to those codes. While there is no consensus that a single, preferred representation of geographical files can be specified as a standard for exchange, there is agreement on the generic form of record structures for commonly used, two-dimensional files. This report surveys by example common practice and illustrates the use of geocodes as thematic data pointers. It defines the elements of the structures as a subsystem within the interchange standard. An implementation within the Levels of Implementation of the basic IWGDE Standard is proposed and examples for some of the defined file types are presented in numerical form to aid in understanding. The problem of referring thematic data to a geographic file when these data reside in a physically distinct exchange file is discussed. 14 figures, 1 table. (RWR)

  15. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  16. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  17. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  18. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  19. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  20. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  1. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  3. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  4. Study of single particle properties of neutron-rich Na isotopes on the "shore of the island of inversion" by means of neutron-transfer reactions

    CERN Multimedia

    Reiter, P; Blazhev, A A; Riisager, K; Bastin, B; Tengborn, E A; Kruecken, R; Voulot, D; Jeppesen, H B; Hadinia, B; Gernhaeuser, R A; Fynbo, H O U; Georgiev, G P; Habs, D; Fraile prieto, L M; Chapman, R; Nilsson, T; Diriken, J V J; Jenkins, D G; Kroell, T; Leske, J; Huyse, M L; Patronis, N

    We aim at the investigation of single particle properties of neutron-rich Na isotopes around the "shore of the island of inversion". As first experiment of this programme, we propose to study excited states in the isotope $^{29}$Na by a one-neutron transfer reaction with a $^{28}$Na beam at 3 MeV/u obtained from REX-ISOLDE impinging on a CD$_{2}$-target. The $\\gamma$-rays will be detected by the MINIBALL array and the particles by the T-REX array of segmented Si detectors. The main physics aims are to extract from the relative spectroscopic factors information on the configurations contributing to the wave functions of the populated states and, secondly, to identify and characterize negative parity states whose excitation energies reflect directly the N= 28 gap in this region. The results will be compared to recent shell model calculations involving new residual interactions. This will shed new light on the evolution of single particle structure and help to understand the underlying physics relevant for the f...

  5. Development of pGEMINI, a Plant Gateway Destination Vector Allowing the Simultaneous Integration of Two cDNA via a Single LR-Clonase Reaction.

    Science.gov (United States)

    Exposito-Rodriguez, Marino; Laissue, Philippe P; López-Calcagno, Patricia E; Mullineaux, Philip M; Raines, Christine A; Simkin, Andrew J

    2017-11-12

    Gateway technology has been used to facilitate the generation of a large number of constructs for the modification of plants for research purposes. However, many of the currently available vectors only allow the integration of a single cDNA of interest into an expression clone. The ability to over-express multiple genes in combination is essential for the study of plant development where several transcripts have a role to play in one or more metabolic processes. The tools to carry out such studies are limited, and in many cases rely on the incorporation of cDNA into expression systems via conventional cloning, which can be both time consuming and laborious. To our knowledge, this study reports on the first development of a vector allowing the simultaneous integration of two independent cDNAs via a single LR-clonase reaction. This vector " pGEMINI " represents a powerful molecular tool offering the ability to study the role of multi-cDNA constructs on plant development, and opens up the process of gene stacking and the study of gene combinations through transient or stable transformation procedures.

  6. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    Science.gov (United States)

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  7. Increased reaction time variability in attention-deficit hyperactivity disorder as a response-related phenomenon: evidence from single-trial event-related potentials.

    Science.gov (United States)

    Saville, Christopher W N; Feige, Bernd; Kluckert, Christian; Bender, Stephan; Biscaldi, Monica; Berger, Andrea; Fleischhaker, Christian; Henighausen, Klaus; Klein, Christoph

    2015-07-01

    Increased intra-subject variability (ISV) in reaction times (RTs) is a promising endophenotype for attention-deficit hyperactivity disorder (ADHD) and among the most robust hallmarks of the disorder. ISV has been assumed to represent an attentional deficit, either reflecting lapses in attention or increased neural noise. Here, we use an innovative single-trial event-related potential approach to assess whether the increased ISV associated with ADHD is indeed attributable to attention, or whether it is related to response-related processing. We measured electroencephalographic responses to working memory oddball tasks in patients with ADHD (N = 20, aged 11.3 ± 1.1) and healthy controls (N = 25, aged 11.7 ± 1.1), and analysed these data with a recently developed method of single-trial event-related potential analysis. Estimates of component latency variability were computed for the stimulus-locked and response-locked forms of the P3b and the lateralised readiness potential (LRP). ADHD patients showed significantly increased ISV in behavioural ISV. This increased ISV was paralleled by an increase in variability in response-locked event-related potential latencies, while variability in stimulus-locked latencies was equivalent between groups. This result held across the P3b and LRP. Latency of all components predicted RTs on a single-trial basis, confirming that all were relevant for speed of processing. These data suggest that the increased ISV found in ADHD could be associated with response-end, rather than stimulus-end processes, in contrast to prevailing conceptions about the endophenotype. This mental chronometric approach may also be useful for exploring whether the existing lack of specificity of ISV to particular psychiatric conditions can be improved upon. © 2014 Association for Child and Adolescent Mental Health.

  8. Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries.

    Science.gov (United States)

    Shagin, Dmitriy A; Turchaninova, Maria A; Shagina, Irina A; Shugay, Mikhail; Zaretsky, Andrew R; Zueva, Olga I; Bolotin, Dmitriy A; Lukyanov, Sergey; Chudakov, Dmitriy M

    2017-06-05

    Recently we proposed efficient method to exclude undesirable primers at any stage of amplification reaction, here termed NOPE (NOnsense-mediated Primer Exclusion). According to this method, added oligonucleotide overlapping with the 3'-end of unwanted amplification primer (NOPE oligo) simultaneously provides a template for its elongation. This elongation disrupts specificity of unwanted primer, preventing its further participation in PCR. The suggested approach allows to rationally manage the course of PCR reactions in order to facilitate analysis of complex DNA mixtures as well as to perform multistage PCR bypassing intermediate purification steps. Here we apply NOPE method to DNA library preparation for the high-throughput sequencing (HTS) with the PCR-based introduction of unique molecular identifiers (UMI). We show that NOPE oligo efficiently neutralizes UMI-containing oligonucleotides after introduction of UMI into sample DNA molecules, thus allowing to proceed with further amplification steps without purification and associated loss of starting material. At the same time, NOPE oligo does not affect the efficiency of target PCR amplification. We describe a simple, robust and cheap modification of UMI-labeled HTS libraries preparation procedure, that allows to bypass purification step and thus to preserve starting material which may be limited, e.g. circulating tumor DNA, circulating fetal DNA, or small amounts of isolated cells of interest. Furthermore, demonstrated simplicity and robustness of NOPE method should make it popular in various PCR protocols.

  9. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    Science.gov (United States)

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  10. Polymerase chain reaction: Theory, practice and application: A review

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension ...

  11. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  12. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  13. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  14. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  15. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  16. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  17. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  18. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Two-dimensional iron-phthalocyanine (Fe-Pc) monolayer as a promising single-atom-catalyst for oxygen reduction reaction: a computational study

    Science.gov (United States)

    Wang, Yu; Yuan, Hao; Li, Yafei; Chen, Zhongfang

    2015-07-01

    Searching for low-cost non-Pt catalysts for oxygen reduction reaction (ORR) has been a key scientific issue in the development of fuel cells. In this work, the potential of utilizing the experimentally available two-dimensional (2D) Fe-phthalocyanine (Fe-Pc) monolayer with precisely-controlled distribution of Fe atoms as a catalyst of ORR was systematically explored by means of comprehensive density functional theory computations. The computations revealed that O2 molecules can be sufficiently activated on the surface of the Fe-Pc monolayer, and the subsequent ORR steps prefer to proceed on the Fe-Pc monolayer through a more efficient 4e pathway with a considerable limiting potential of 0.68 V. Especially, the Fe-Pc monolayer is more stable than the Fe-Pc molecule in acidic medium, and can present good catalytic performance for ORR on the addition of axial ligands. Therefore, the Fe-Pc monolayer is quite a promising single-atom-catalyst with high efficiency for ORR in fuel cells.Searching for low-cost non-Pt catalysts for oxygen reduction reaction (ORR) has been a key scientific issue in the development of fuel cells. In this work, the potential of utilizing the experimentally available two-dimensional (2D) Fe-phthalocyanine (Fe-Pc) monolayer with precisely-controlled distribution of Fe atoms as a catalyst of ORR was systematically explored by means of comprehensive density functional theory computations. The computations revealed that O2 molecules can be sufficiently activated on the surface of the Fe-Pc monolayer, and the subsequent ORR steps prefer to proceed on the Fe-Pc monolayer through a more efficient 4e pathway with a considerable limiting potential of 0.68 V. Especially, the Fe-Pc monolayer is more stable than the Fe-Pc molecule in acidic medium, and can present good catalytic performance for ORR on the addition of axial ligands. Therefore, the Fe-Pc monolayer is quite a promising single-atom-catalyst with high efficiency for ORR in fuel cells. Electronic

  20. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  1. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  2. Kinetic Study on Peptide-Bound Pyrraline Formation and Elimination in the Maillard Reaction Using Single- and Multiple-Response Models.

    Science.gov (United States)

    Liang, Zhili; Li, Lin; Qi, Haiping; Zhang, Zhenbo Xu Xia; Li, Bing

    2016-10-01

    Pyrraline, an advanced glycation end product (AGE), is related to some chronic diseases and can be employed as an indicator for heat damage in food processing. In this study, the impact of changing the reactant concentration and ratio on the kinetic parameters describing peptide-bound pyrraline (pep-pyr) formation and elimination was evaluated in the Lys-Gly/glucose model systems, with microwave heating treatment ranging from 120 to 200 °C. The maximum pep-pyr concentration increased as follows: 200 °C ˂ 180 °C ˂ 160 °C ˂ 120 °C ˂ 140 °C. First, the pep-pyr formation and elimination was modeled by using a single-response modelling. The formation rate constant (k F ) of pep-pyr was independent of the initial concentration of the reactants and ratios. However, the elimination rate constant of pep-pyr (k E ) increased with increasing reactant concentrations. Second, a multiresponse modelling was performed to illustrate the pathways of pep-pyr formation and elimination. Two adapted models can fit to the experimental data with the goodness-of-fit ranging from 0.663 to 0.920. Glucose-to-fructose isomerization rather than glucose-to-mannose epimerization was detected in an equimolar model system and the model system with an excess of any of the reactants. The caramelization reaction was negligible in the equimolar systems and the model systems with an excess of peptide. The reaction rate constant of glucose-to-fructose isomerization was independent of the initial reactant ratios. It was more difficult for pep-pyr elimination in the model system with an excess of peptide than that in the other 2 model systems (the equimolar system and the system with an excess of glucose), whereas a reverse result in pep-pyr formation was obtained. © 2016 Institute of Food Technologists®.

  3. Quantitative Single-letter Sequencing: a method for simultaneously monitoring numerous known allelic variants in single DNA samples

    Directory of Open Access Journals (Sweden)

    Duborjal Hervé

    2008-02-01

    Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized

  4. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

  5. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  6. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  7. [Aging effect of one bottle-type ceramic primer on bonding efficacy of resin cement].

    Science.gov (United States)

    Goto, Haruhiko

    2008-04-01

    To understand the degradation mechanisms of commercially available one bottle-type ceramic primer, we prepared one bottle-type experimental ceramic primer consisting of gamma-methacryloxy-propyl-trimethoxysilane, gamma-MPTS, and 90% ethanol solution. The effects of aging of the experimental primer on the hydrolysis and condensation behavior of gamma -MPTS and on the bonding efficacy of gamma-MPTS at the interface between cement and ceramic were studied. We used two lamina bond porcelain primers (LB), that had been aged for 20 months and newly purchased. Experimental primer was aged at 20 degrees C. After aging, we measured 29Si NMR spectrum of the gamma-MPTS and the shear bond strength of the cement to silane-treated ceramic by varying aging periods. When the LB was aged for 20 months, the mean bond strength decreased from 26 to 11 MPa. To understand the degradation mechanism in the bond strength, the effects of aging of experimental primer on molecular species of gamma-MPTS were examined. With prolonging its aging period, the methoxy group of the silicone functional portion in the gamma-MPTS hydrolyzed and the hydrolyzed gamma-MPTS species condensed together. The molecular weight of condensed gamma-MPTS species increased. On the other hand, when the dimer species of gamma-MPTS were produced, a maximum mean bond strength of 28 MPa was observed. Thereafter, the bond strength dropped down and leveled off at 16 MPa. When the LB was aged for 20 months, the bond strength dramatically decreased. This decrease in the mean bond strength was probably attributed to ester exchange reaction of the methoxyl group in the gamma-MPTS by the ethanol used as diluent solvent.

  8. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  9. Chemistry with an Artificial Primer of Polyhydroxybutyrate Synthase Suggests a Mechanism for Chain Termination

    Science.gov (United States)

    2015-01-01

    Polyhydroxybutyrate (PHB) synthases (PhaCs) catalyze the conversion of 3-(R)-hydroxybutyryl CoA (HBCoA) to PHB, which is deposited as granules in the cytoplasm of microorganisms. The class I PhaC from Caulobacter crescentus (PhaCCc) is a highly soluble protein with a turnover number of 75 s–1 and no lag phase in coenzyme A (CoA) release. Studies with [1-14C]HBCoA and PhaCCc monitored by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and autoradiography reveal that the rate of elongation is much faster than the rate of initiation. Priming with the artificial primer [3H]sTCoA and monitoring for CoA release reveal a single CoA/PhaC, suggesting that the protein is uniformly loaded and that the elongation process could be studied. Reaction of sT-PhaCCc with [1-14C]HBCoA revealed that priming with sTCoA increased the uniformity of elongation, allowing distinct polymerization species to be observed by SDS–PAGE and autoradiography. However, in the absence of HBCoA, [3H]sT-PhaC unexpectedly generates [3H]sDCoA with a rate constant of 0.017 s–1. We propose that the [3H]sDCoA forms via attack of CoA on the oxoester of the [3H]sT-PhaC chain, leaving the synthase attached to a single HB unit. Comparison of the relative rate constants of thiolysis by CoA and elongation by PhaCCc, and the size of the PHB polymer generated in vivo, suggests a mechanism for chain termination and reinitiation. PMID:25741756

  10. Cultural Resources Management in the United States Air Force: Development of a Planning Primer.

    Science.gov (United States)

    1992-09-01

    but one of the final Expert Panel responded with either written or verbal comments. Although the overall reaction to the primer was favorable, each of...directive requires each Air Force insallation to prelpe and adopt a Cultura Resources Management Plan. This plan will incude an inventoy of all cultual...geophysical components of the Legacy program. Specific to cultura resources, the task areas were developed as a general program for improving management of all

  11. Non-destructive testing of proteins in single seeds using the 14N(d,p)15N and 14N(d,∝)12C reactions

    International Nuclear Information System (INIS)

    Moreno B, E.

    1986-01-01

    A non-destructive nuclear technique aimed for the analysis of proteins in single seeds using the 14 N(d,p) 15 N and 14 N(d,∝) 12 C reactions is implemented. This work was performed at the ININ's Tandem Van der Graaff facility, using a 6 MeV deuteron beam and a surface barrier solid state detector with its associated electronics for the pulse height analysis of the charged particles backscattered from the samples. Well defined populations of five varieties of wheat, and four of corn were used as samples in order to optimize the experimental conditions for the analysis, these results were compared with those obtained using an analytical chemical method (Kjeldahl). The linear regression coefficient (''r'') obtained from the results of these two methods was: r = 0.9 in the case of wheat, and r = 0.7 in the case of corn, which we consider adequate figures for using the non-destructive nuclear technique as an aid or support in agricultural seed protein improvement programs. In adequate geometrical conditions the analysis per seed can take a few seconds, and the exposure to the germ can be as low as ≅1 Rad. (author)

  12. Measurement of the Target-Normal Single-Spin Asymmetry in Deep-Inelastic Scattering from the Reaction 3He{uparrow}(e,e')X

    Energy Technology Data Exchange (ETDEWEB)

    Katich, Joseph; Qian, Xin; Zhao, Yuxiang; Allada, Kalyan; Aniol, Konrad; Annand, John; Averett, Todd; Benmokhtar, Fatiha; Bertozzi, William; Bradshaw, Elliott; Bosted, Peter; Camsonne, Alexandre; Canan, Mustafa; Cates, Gordon; Chen, Chunhua; Chen, Jian-Ping; Chen, Wei; Chirapatpimol, Khem; Chudakov, Eugene; Cisbani, Evaristo; Cornejo, Juan; Cusanno, Francesco; Dalton, Mark; Deconinck, Wouter; De Jager, Cornelis; De Leo, Raffaele; Deng, Xiaoyan; Deur, Alexandre; Ding, Huaibo; Dolph, Peter; Dutta, Chiranjib; Dutta, Dipangkar; El Fassi, Lamiaa; Frullani, Salvatore; Gao, Haiyan; Garibaldi, Franco; Gaskell, David; Gilad, Gilad; Gilman, Ronald; Glamazdin, Oleksandr; Golge, Serkan; Guo, Lei; Hamilton, David; Hansen, Jens-Ole; Higinbotham, Douglas; Holmstrom, Timothy; Huang, Jijun; Huang, Min; Ibrahim Abdalla, Hassan; Iodice, Mauro; Jin, Ge; Jones, Mark; Kelleher, Aidan; Kim, Wooyoung; Kolarkar, Ameya; Korsch, Wolfgang; LeRose, John; Li, Xiaomei; Li, Y; Lindgren, Richard; Liyanage, Nilanga; Long, Elena; Lu, Hai-jiang; Margaziotis, Demetrius; Markowitz, Pete; Marrone, Stefano; McNulty, Dustin; Meziani, Zein-Eddine; Michaels, Robert; Moffit, Bryan; Munoz Camacho, Carlos; Nanda, Sirish; Narayan, Amrendra; Nelyubin, Vladimir; Norum, Blaine; Oh, Yoomin; Osipenko, Mikhail; Parno, Diana; Peng, Jen-chieh; Phillips, Sarah; Posik, Matthew; Puckett, Andrew; Qiang, Yi; Rakhman, Abdurahim; Ransome, Ronald; Riordan, Seamus; Saha, Arunava; Sawatzky, Bradley; Schulte, Elaine; Shahinyan, Albert; Hashemi Shabestari, Mitra; Sirca, Simon; Stepanyan, Stepan; Subedi, Ramesh; Sulkosky, Vincent; Tang, Liguang; Tobias, William; Urciuoli, Guido; Vilardi, Ignazio; Wang, Kebin; Wang, Y; Wojtsekhowski, Bogdan; Yan, X; Yao, Huan; Ye, Yunxiu; Ye, Z; Yuan, Lulin; Zhan, Xiaohui; Zhang, Yi; Zhang, Y -W; Zhao, Bo; Zheng, Xiaochao; Zhu, Lingyan; Zhu, Xiaofeng; Zong, Xing

    2014-07-01

    We report the first measurement of the target single-spin asymmetry in deep-inelastic scattering from the inclusive reaction 3He{uparrow}(e,e')X on a 3He gas target polarized normal to the lepton plane. Assuming time-reversal invariance, this asymmetry is strictly zero in the Born approximation. The experiment, conducted at Jefferson Lab using a 5.89 GeV electron beam, covers a range of 1.72 GeV, which is non-zero at the 2.75sigma level. Theoretical calculations, which assume two-photon exchange with quasi-free quarks, predict a neutron asymmetry of O(10−4) when both photons couple to one quark, and O(10−2) for the photons coupling to different quarks. Our measured asymmetry agrees both in sign and magnitude with the prediction that uses input based on the Sivers transverse momentum distribution obtained from semi-inclusive deep-inelastic scattering.

  13. Ultradispersed and Single-Layered MoS2 Nanoflakes Strongly Coupled with Graphene: An Optimized Structure with High Kinetics for the Hydrogen Evolution Reaction.

    Science.gov (United States)

    Huang, Haoliang; Huang, Junying; Liu, Weipeng; Fang, Yueping; Liu, Yingju

    2017-11-15

    As one of the most promising Pt alternatives for cost-effective hydrogen production, molybdenum disulfide (MoS 2 ), although has been studied extensively to improve its electrocatalytic activity, suffers from scarce active sites, low conductivity, and lack of interaction with substrates. To this end, we anchor ultradispersed and single-layered MoS 2 nanoflakes on graphene sheets via a hybrid intermediate (MoO x -cysteine-graphene oxide), which not only confines the subsequent growth of MoS 2 on the graphene surface but also ensures the intimate interaction between Mo species and graphene at the initial stage. Mo-O-C bond and a possible residual MoO 3-x layer are proposed to comprise the interface bridging the two inherent incompatible phases, MoS 2 and graphene. This strongly coupled structure together with the highly exposed MoS 2 morphology accelerates the electron injection from graphene to the active sites of MoS 2 , and thus the hydrogen evolution reaction (HER) can achieve an overpotential of ∼275 mV at ∼-740 mA cm -2 , and a Pt-like Tafel slope of ∼35 mV dec -1 . Our results shed light on the indispensable role of interfacial interaction within semiconducting material-nanocarbon composites and provide a new insight into the actual activity of MoS 2 toward the HER.

  14. Ultrasensitive electrochemical detection of microRNA-21 combining layered nanostructure of oxidized single-walled carbon nanotubes and nanodiamonds by hybridization chain reaction.

    Science.gov (United States)

    Liu, Lingzhi; Song, Chao; Zhang, Zhang; Yang, Juan; Zhou, Lili; Zhang, Xing; Xie, Guoming

    2015-08-15

    Measurement of microRNA (miRNA) levels in body fluids is a crucial tool for the early diagnosis and prognosis of cancers. In this study, we developed an electrochemical assay to detect miRNA-21 by fabricating the electrode with layer-by-layer assembly of oxidized single-walled carbon nanotubes and nanodiamonds. Tetrahedron-structured probes with free-standing probe on the top served as receptors to hybridize with target miRNA directly. The probes were immobilized on the deposited gold nanoparticles through a well-established strong Au-S bond. The electrochemical signal was mainly derived from an ultrasensitive pattern by combining hybridization chain reaction with DNA-functionalized AuNPs, which provided DNAzyme to catalyze H2O2 reduction. Differential pulse voltammetry was applied to record the electrochemical signals, which was increased linearly with the target miRNA-21, and the linear detection range was 10 fM to 1.0 nM. The limit of detection reached 1.95 fM (S/N=3), and the proposed biosensor exhibited good reproducibility and stability, as well as high sensitivity. Hence, this biosensor has a promising potential in clinical application. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  16. Simple and reliable procedure for PCR amplification of genomic DNA from yeast cells using short sequencing primers

    DEFF Research Database (Denmark)

    Haaning, J; Oxvig, C; Overgaard, Michael Toft

    1997-01-01

    by means of PCR without any prior DNA purification steps. This method involves a simple boiling step of whole yeast cells in the presence of detergent, and subsequent amplification of genomic DNA using short sequencing primers in a polymerase chain reaction assay with a decreasing annealing temperature...

  17. The effect of white or grey PVC pipe and its joint solvents (primer and cement) on odour problems in drinking water distribution systems.

    Science.gov (United States)

    Wiesenthal, K E; Suffet, I H

    2007-01-01

    A study of the production of odour-causing compounds was conducted from the leaching of polyvinylchloride (PVC) pipe and its joints, primer and cement, into drinking water distribution systems. Flavour Profile Analysis (FPA), closed-loop stripping analysis--gas chromatography/mass spectrometry (CLSA-GC/MS) and sensory-GC analysis of white or grey PVC alone found no odour-causing compounds produced during the leaching experiments. FPA analysis of the PVC's primer and cement leached alone and/or when applied to grey or white PVC pipes produced a glue/varnish odour. A sweet/phenolic odour replaced the glue/varnish odour after the leached media were diluted with Milli-Q water to threshold odour intensity. Three compounds were responsible for the sweet/phenolic odour and were observed by sensoryGC analysis. The leaching study of the PVC pipe with its joint solvents (primer and cement) concluded that the original solvent compounds, and their reaction products that formed during the bonding process on the PVC pipe, were a primary source of the glue/varnish odour. The original compounds of the PVC primer and cement were not detected by CLSA-GC/MS, due to their high volatility during the CLSA extraction method and/or these compounds appeared in a solvent peak of the GC/MS analysis. However, the original primer and cement chemicals (acetone, tetrahydrofuran, methyl ethyl ketone, and cyclohexanone) had a glue/varnish odour. A total of nine odorous GC peaks were produced as reaction products from leaching of primer in water and white or grey PVC pipe with primer and cement, and white or grey PVC with primer only. None of these compounds were among the chemical ingredients in the original primer or cement. Four GC peaks with a sweet/phenolic odour were present due to the reaction products of the cement leached with white or grey PVC. None of these compounds were positively identified.

  18. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  19. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  20. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  1. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  2. Comparative analysis on surface property in anodic oxidation polishing of reaction-sintered silicon carbide and single-crystal 4H silicon carbide

    Science.gov (United States)

    Shen, Xinmin; Tu, Qunzhang; Deng, Hui; Jiang, Guoliang; He, Xiaohui; Liu, Bin; Yamamura, Kazuya

    2016-04-01

    For effective machining of difficult-to-machine materials, such as reaction-sintered silicon carbide (RS-SiC) and single-crystal 4H silicon carbide (4H-SiC), a novel polishing technique named anodic oxidation polishing was proposed, which combined with the anodic oxidation of substrate and slurry polishing of oxide. By scanning electron microscopy/energy-dispersive X-ray spectroscopy (SEM-EDX) observation and atomic force microscopy analysis, both the anodic oxidation behaviors of RS-SiC and 4H-SiC were investigated. Through comparison of the surfaces before and after hydrofluoric acid etching of the oxidized samples by the scanning white light interferometry (SWLI) measurement, the relationships between oxidation depth and oxidation time were obtained, and the calculated oxidation rate for RS-SiC was 5.3 nm/s and that for 4H-SiC was 5.8 nm/s based on the linear Deal-Grove model. Through anodic oxidation polishing of RS-SiC substrate and 4H-SiC substrate, respectively, the surface roughness rms obtained by SWLI was improved to 2.103 nm for RS-SiC and to 0.892 nm for 4H-SiC. Experimental results indicate that anodic oxidation polishing is an effective method for the machining of RS-SiC and 4H-SiC samples, which would improve the process level of SiC substrates and promote the application of SiC products in the fields of optics, ceramics, semiconductors, electronics, and so on.

  3. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  4. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... (Islam and Shepherd, 1992). But these markers were not considered suitable for large scale mapping. With the recent introduction of molecular biology, DNA based markers including polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), single nucleotide polymorphisms ...

  5. Effect of Metal Primers on Bond Strength of a Composite Resin to Nickel-Chrome Metal Alloy.

    Science.gov (United States)

    Nima, Gabriel; Ferreira, Paulo Vitor Campos; Paula, Andreia Bolzan de; Consani, Simonides; Giannini, Marcelo

    2017-01-01

    This study evaluated the effects of three metal primers and one multi-mode adhesive system on the shear bond strength (SBS) of a flowable composite resin to nickel-chrome metal alloy (Ni-Cr). Ninety plates were cast from Ni-Cr and divided in nine groups (n=10). The surfaces were sandblasted with Al2O3 and primed with three adhesive primers: Alloy Primer (AP), Universal Primer (TP) and RelyX Ceramic Primer (CP), and a multi-mode adhesive (Scotchbond Universal, SU). The Adper Single Bond Plus (SB) and SU adhesives were also combined with adhesive primers. Control group did not have any surface treatment. The groups were: AP, AP+SB, AP+SU, TP+SB, TP+SU, CP+SB, CP+SU and SU. Composite cylinders were built on alloy surface. After 24 h, half the specimens were subjected to SBS and the other half to thermal cycling before testing. Data were analyzed by two-way ANOVA and Tukey's test (a=0.05). Failure modes were assessed by SEM observation. Higher SBS were obtained with AP and TP combined with adhesives at 24 h and the lowest one for control group. Thermocycling reduced SBS for AP, CP+SU and SU. Combination between TP and SU resulted in the highest SBS after the thermocycling. TP groups showed all types of failures and high incidence of mixed failures. The use of AP and UP metal primers before application of SU and SB adhesive systems increased the SBS of composite to Ni-Cr. These combinations between metal primers and adhesives had the highest SBS after thermocycling.

  6. High speed single nucleotide polymorphism typing of a hereditary haemochromatosis mutation with capillary array electrophoresis microplates.

    Science.gov (United States)

    Medintz, I; Wong, W W; Sensabaugh, G; Mathies, R A

    2000-07-01

    A single nucleotide polymorphism (SNP) typing assay is developed and evaluated on a microfabricated capillary array electrophoresis system. Using fluorescently labeled allele-specific primers, the S65C (193A-->T) substitution associated with hereditary haemochromatosis in the HFE gene is genotyped. The covalently labeled polymerase chain reaction (PCR) products are separated on a microfabricated radial capillary array electrophoresis microplate using nondenaturing gel media in under two minutes. Detection is accomplished with a laser-excited rotary confocal scanner. The Rox-labeled A-allele specific amplicon (211 bp) is differentiated from the R110-labeled T-allele specific amplicon (201 bp) by both size and color. This study demonstrates the feasibility of using allele-specific PCR with covalently labeled primers for high speed fluorescent SNP typing on microfabricated radial capillary array electrophoresis microplates.

  7. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers.

    Directory of Open Access Journals (Sweden)

    In-Cheol Baek

    Full Text Available Major histocompatibility complex (MHC class I chain-related gene B (MICB encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI, whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024 present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations.

  9. Oxidative Catalysis Using the Stoichiometric Oxidant as a Reagent: An Efficient Strategy for Single-Electron-Transfer-Induced Tandem Anion-Radical Reactions

    Czech Academy of Sciences Publication Activity Database

    Kafka, František; Holan, Martin; Hidasová, Denisa; Pohl, Radek; Císařová, I.; Klepetářová, Blanka; Jahn, Ullrich

    2014-01-01

    Roč. 53, č. 37 (2014), s. 9944-9948 ISSN 1433-7851 R&D Projects: GA ČR GA13-40188S Institutional support: RVO:61388963 Keywords : cyclization * domino reactions * electron transfer * Michael addition * radical reactions Subject RIV: CC - Organic Chemistry Impact factor: 11.261, year: 2014

  10. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Directory of Open Access Journals (Sweden)

    Nora Scarcelli

    Full Text Available Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC. Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon and non-coding regions (intron and intergenic spacer. They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC and 15 in the Inverted Repeat region (IR. Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae, Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae, Digitaria excilis and Pennisetum glaucum (Poaceae. The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR. We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies.

  11. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  12. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  14. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  15. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  16. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  17. Some Calculated (p,α Cross-Sections Using the Alpha Particle Knock-On and Triton Pick-Up Reaction Mechanisms: An Optimisation of the Single-Step Feshbach–Kerman–Koonin (FKK Theory

    Directory of Open Access Journals (Sweden)

    Felix S. Olise

    2016-04-01

    Full Text Available The Feshbach–Kerman–Koonin (FKK multi-step direct (MSD theory of pre-equilibrium reactions has been used to compute the single-step cross-sections for some (p,α reactions using the knock-on and pick-up reaction mechanisms at two incident proton energies. For the knock-on mechanism, the reaction was assumed to have taken place by the direct ejection of a preformed alpha cluster in a shell-model state of the target. But the reaction was assumed to have taken place by the pick-up of a preformed triton cluster (also bound in a shell-model state of the target core by the incident proton for the pick-up mechanism. The Yukawa forms of potential were used for the proton-alpha (for the knock-on process and proton-triton (for the pick-up process interaction and several parameter sets for the proton and alpha-particle optical potentials. The calculated cross-sections for both mechanisms gave satisfactory fits to the experimental data. Furthermore, it has been shown that some combinations of the calculated distorted wave Born approximation cross-sections for the two reaction mechanisms in the FKK MSD theory are able to give better fits to the experimental data, especially in terms of range of agreement. In addition, the theory has been observed to be valid over a wider range of energy.

  18. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  19. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  20. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  1. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    Science.gov (United States)

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  2. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  3. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  4. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  5. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  6. Mechanism of HIV reverse transcriptase inhibition by zinc: formation of a highly stable enzyme-(primer-template) complex with profoundly diminished catalytic activity.

    Science.gov (United States)

    Fenstermacher, Katherine J; DeStefano, Jeffrey J

    2011-11-25

    Several physiologically relevant cations including Ca(2+), Mn(2+), and Zn(2+) have been shown to inhibit HIV reverse transcriptase (RT), presumably by competitively displacing one or more Mg(2+) ions bound to RT. We analyzed the effects of Zn(2+) on reverse transcription and compared them to Ca(2+) and Mn(2+). Using nucleotide extension efficiency as a readout, Zn(2+) showed significant inhibition of reactions with 2 mM Mg(2+), even when present at only ∼5 μM. Mn(2+) and Ca(2+) were also inhibitory but at higher concentrations. Both Mn(2+) and Zn(2+) (but not Ca(2+)) supported RT incorporation in the absence of Mg(2+) with Mn(2+) being much more efficient. The maximum extension rates with Zn(2+), Mn(2+), and Mg(2+) were ∼0.1, 1, and 3.5 nucleotides per second, respectively. Zinc supported optimal RNase H activity at ∼25 μM, similar to the optimal for nucleotide addition in the presence of low dNTP concentrations. Surprisingly, processivity (average number of nucleotides incorporated in a single binding event with enzyme) during reverse transcription was comparable with Zn(2+) and Mg(2+), and single RT molecules were able to continue extension in the presence of Zn(2+) for several hours on the same template. Consistent with this result, the half-life for RT-Zn(2+)-(primer-template) complexes was 220 ± 60 min and only 1.7 ± 1 min with Mg(2+), indicating ∼130-fold more stable binding with Zn(2+). Essentially, the presence of Zn(2+) promotes the formation of a highly stable slowly progressing RT-(primer-template) complex.

  7. Differentiation of Naegleria fowleri and other Naegleriae by polymerase chain reaction and hybridization methods.

    Science.gov (United States)

    Sparagano, O

    1993-07-01

    In order to detect and identify Naegleria fowleri strains an assay based on the Polymerase Chain Reaction (PCR) was evaluated. The amplified DNA fragments were detected by gel electrophoresis and ethidium bromide staining, followed by Southern blot hybridization with an internal digoxigenin-labeled probe. A set of primers (B1B2) which flank a 678-bp region within a virulence-associated gene, allowed for the highly specific identification of N. fowleri, since Naegleriae (N. lovaniensis, N. australiensis, N. gruberi, N. andersoni and N. jadini) and other Protozoa did not react. These primers did not detect amplification products from various organisms: Gram-positive bacteria, Gram-negative bacteria, algae, yeasts and human DNA. Whereas a second set of primers (A1A2), which flank a different sequence, detected various Naegleriae and Acanthamoebae strains. After 40 amplification cycles, the limit of detection was a single cell (cyst or trophozoite). Thus, the PCR appears to be a rapid and powerful tool for identification and detection of N. fowleri.

  8. Variance-corrected Michaelis-Menten equation predicts transient rates of single-enzyme reactions and response times in bacterial gene-regulation

    Science.gov (United States)

    Pulkkinen, Otto; Metzler, Ralf

    2015-12-01

    Many chemical reactions in biological cells occur at very low concentrations of constituent molecules. Thus, transcriptional gene-regulation is often controlled by poorly expressed transcription-factors, such as E.coli lac repressor with few tens of copies. Here we study the effects of inherent concentration fluctuations of substrate-molecules on the seminal Michaelis-Menten scheme of biochemical reactions. We present a universal correction to the Michaelis-Menten equation for the reaction-rates. The relevance and validity of this correction for enzymatic reactions and intracellular gene-regulation is demonstrated. Our analytical theory and simulation results confirm that the proposed variance-corrected Michaelis-Menten equation predicts the rate of reactions with remarkable accuracy even in the presence of large non-equilibrium concentration fluctuations. The major advantage of our approach is that it involves only the mean and variance of the substrate-molecule concentration. Our theory is therefore accessible to experiments and not specific to the exact source of the concentration fluctuations.

  9. Changes in ground reaction force during a rebound-jump task after hip strength training for single-sided ankle dorsiflexion restriction.

    Science.gov (United States)

    Kondo, Hitoshi; Someya, Fujiko

    2016-01-01

    [Purpose] Lateral ankle sprains are common injuries suffered while playing sports, and abnormal forward- and inward-directed ground reaction force occurs during a jumping task. However, the influence of hip muscle strength training on jumping performance after ankle injuries has not been fully examined. This study thus examined changes in ground reaction force during a rebound-jump task after training to strengthen hip muscles. [Subjects and Methods] Ten of 30 female high school basketball players were assigned as subjects who showed a difference of 7 or more degrees in dorsiflexion ranges between the bilateral ankles. The subjects underwent 12 weeks of training to strengthen hip abductors and external rotators. Comparisons between before and after training were made regarding ground reaction force components, hip and knee joint angles, percentage of maximum voluntary contraction in leg muscles, and muscle strength of hip muscles during the rebound-jump task. [Results] After training, the subjects showed increased strength of external rotator muscles, increased percentage of maximum voluntary contraction in the gluteus medius muscle, decreased inward ground reaction force, and increased flexion angles of the hip and knee joints. [Conclusion] This study suggests that training to strengthen hip muscles may ameliorate the inward ground reaction force in athletes with ankle dorsiflexion restriction.

  10. Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, N.A.; Wood, H.G.

    1986-05-01

    Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and the /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.

  11. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  12. Individual risk assessment in the diagnosis of immediate type drug hypersensitivity reactions to betalactam and non-betalactam antibiotics using basophil activation test: a single center experience.

    Science.gov (United States)

    Thinnes, A; Merk, H F; Wurpts, G; Röseler, S; Lehmann, S; Tenbrock, K; Baron, J M; Balakirski, G

    2018-03-06

    Drug hypersensitivity reactions of immediate type pose a challenging problem, especially, if standard diagnostic procedures do not lead to conclusive results. The aim of this investigation is to identify, whether basophil activation test (BAT) is able to provide additional benefit in the diagnostic evaluation of immediate type drug hypersensitivity reactions to antibiotics in comparison to the routine allergological diagnostic methods. We investigated patients, which presented to the Department of Dermatology and Allergology of the University Hospital of RWTH Aachen in Germany for diagnostic workup of type I allergic reactions to antibiotics during the period from 2009 to 2012. The analysis was performed retrospectively based on patient records. The inclusion criteria were performed standard allergological in vivo diagnostic and a basophil activation test (BAT) as a part of diagnostic workup. 82 diagnostic investigations were performed in 52 patients. BAT was positive in 9 of 12 cases with a positive clinical history but negative skin test results. Furthermore, all patients who reported severe drug hypersensitivity reactions (anaphylactic reaction grade 2 and above) showed positive BAT (5/5), while only 3 of these 5 cases demonstrated a positive skin testing that led to the conclusion of possible immediate type drug hypersensitivity. Although skin tests remain the most important part of the primary diagnostic investigation, BAT is an additional valuable and sensitive in vitro test in the diagnostic procedure of immediate type allergic reactions to antibiotics. However, further standardized investigations are needed in order to calculate exact sensitivity and specificity of this diagnostic tool in both, adult and pediatric populations.

  13. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro

    2012-11-01

    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  14. Nuclear microsatellite primers for the endangered relict fir, Abies pinsapo (Pinaceae) and cross-amplification in related Mediterranean Species.

    Science.gov (United States)

    Sánchez-Robles, Jose M; Balao, Francisco; García-Castaño, Juan L; Terrab, Anass; Navarro-Sampedro, Laura; Talavera, Salvador

    2012-11-05

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  15. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    Science.gov (United States)

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  16. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers.

    Science.gov (United States)

    Takahashi, Hirokazu; Yamamoto, Kimiko; Ohtani, Toshio; Sugiyama, Shigeru

    2009-07-01

    The predominant method for DNA cloning is by propagation in biological hosts, but this method has limitations because certain sequences are difficult to clone using any combination of available hosts or vectors. Recently, multiply-primed rolling circle amplification (MPRCA) has been applied to overcome the problems of the DNA cloning via host cells. However, when MPRCA is used to amplify from minute quantities of DNA template, the products are mostly by-product DNA molecules generated by false priming and primer dimer formation. This study demonstrates that MPRCA using random RNA primers[#x02014]instead of DNA primers[#x02014]blocked the synthesis of by-products and succeeded in amplifying one copy of a circular DNA molecule more than 1012-fold to give microgram quantities of amplification product without using submicroliter reaction volumes. Furthermore, a ligation strategy was elaborated to circularize only the desired DNA sequence and eliminate undesired ligation-products. A combination of these methods was able to amplify and ligate a large construct without undesired DNA sequences and at microgram quantities within one day. Therefore, these methods have the possibility to improve DNA cloning techniques that have been restricted by the limitations of PCR methods or by the host cell.

  17. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  18. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  19. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  20. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  1. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  2. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples.

    Science.gov (United States)

    Chen, Yi-Lin; Lee, Chuan-Chun; Lin, Ya-Lan; Yin, Kai-Min; Ho, Chung-Liang; Liu, Tsunglin

    2015-01-01

    Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry.

  3. Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

    Science.gov (United States)

    Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

    2016-01-01

    Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

  4. Development of 112 unique expressed sequence tags from chicken liver using an arbitrarily primed reserve transcriptase-polymerase chain reaction and single strand conformation gel purification method

    NARCIS (Netherlands)

    Carré, W.; Diot, C.; Fillon, V.; Crooijmans, R.P.M.A.; Lagarrique, S.; Morrisson, M.; Vignal, A.; Groenen, M.A.M.; Douai, M.

    2001-01-01

    In order to provide information on chicken genome expression, expressed sequence tags (ESTs) were developed from chicken liver RNAs using a method based on arbitrarily primed reverse transcription-polymerase chain reaction (RT-PCR) of total RNAs. The method is similar to differential display, using

  5. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  6. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  7. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  8. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  9. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  10. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  11. Reversible conversion of valence-tautomeric copper metal-organic frameworks dependent single-crystal-to-single-crystal oxidation/reduction: a redox-switchable catalyst for C-H bonds activation reaction.

    Science.gov (United States)

    Huang, Chao; Wu, Jie; Song, Chuanjun; Ding, Ran; Qiao, Yan; Hou, Hongwei; Chang, Junbiao; Fan, Yaoting

    2015-06-28

    Upon single-crystal-to-single-crystal (SCSC) oxidation/reduction, reversible structural transformations take place between the anionic porous zeolite-like Cu(I) framework and a topologically equivalent neutral Cu(I)Cu(II) mixed-valent framework. The unique conversion behavior of the Cu(I) framework endowed it as a redox-switchable catalyst for the direct arylation of heterocycle C-H bonds.

  12. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  13. Single step synthesis of gold-amino acid composite, with the evidence of the catalytic hydrogen atom transfer (HAT) reaction, for the electrochemical recognition of Serotonin

    Science.gov (United States)

    Choudhary, Meenakshi; Siwal, Samarjeet; Nandi, Debkumar; Mallick, Kaushik

    2016-03-01

    A composite architecture of amino acid and gold nanoparticles has been synthesized using a generic route of 'in-situ polymerization and composite formation (IPCF)' [1,2]. The formation mechanism of the composite has been supported by a model hydrogen atom (H•≡H++e-) transfer (HAT) type of reaction which belongs to the proton coupled electron transfer (PCET) mechanism. The 'gold-amino acid composite' was used as a catalyst for the electrochemical recognition of Serotonin.

  14. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  15. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  16. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Directory of Open Access Journals (Sweden)

    Lina Marcela Villa

    2013-11-01

    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  17. Effect of Dangguibohyul-Tang, a Mixed Extract of Astragalus membranaceus and Angelica sinensis, on Allergic and Inflammatory Skin Reaction Compared with Single Extracts of Astragalus membranaceus or Angelica sinensis

    Directory of Open Access Journals (Sweden)

    You Yeon Choi

    2016-01-01

    Full Text Available Dangguibohyul-tang (DBT, herbal formula composed of Astragalus membranaceus (AM and Angelica sinensis (AS at a ratio of 5 : 1, has been used for the treatment of various skin diseases in traditional medicine. We investigated the effect of DBT on allergic and inflammatory skin reaction in atopic dermatitis-like model compared to the single extract of AM or AS. DBT treatment showed the remission of clinical symptoms, including decreased skin thickness and scratching behavior, the total serum IgE level, and the number of mast cells compared to DNCB group as well as the single extract of AM- or AS-treated group. Levels of cytokines (IL-4, IL-6, IFN-γ, TNF-α, and IL-1β and inflammatory mediators (NF-κB, phospho-IκBα, and phospho-MAPKs were significantly decreased in AM, AS, and DBT groups. These results demonstrated that AM, AS, and DBT may have the therapeutic property on atopic dermatitis by inhibition of allergic and inflammatory mediators and DBT formula; a mixed extract of AM and AS based on the herb pairs theory especially might be more effective on antiallergic reaction as compared with the single extract of AM or AS.

  18. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  19. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  20. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  1. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  2. Reaction Automata

    OpenAIRE

    Okubo, Fumiya; Kobayashi, Satoshi; Yokomori, Takashi

    2011-01-01

    Reaction systems are a formal model that has been introduced to investigate the interactive behaviors of biochemical reactions. Based on the formal framework of reaction systems, we propose new computing models called reaction automata that feature (string) language acceptors with multiset manipulation as a computing mechanism, and show that reaction automata are computationally Turing universal. Further, some subclasses of reaction automata with space complexity are investigated and their la...

  3. The steric gate amino acid tyrosine 112 is required for efficient mismatched-primer extension by human DNA polymerase kappa.

    Science.gov (United States)

    Niimi, Naoko; Sassa, Akira; Katafuchi, Atsushi; Grúz, Petr; Fujimoto, Hirofumi; Bonala, Radha-Rani; Johnson, Francis; Ohta, Toshihiro; Nohmi, Takehiko

    2009-05-26

    Human DNA is continuously damaged by exogenous and endogenous genotoxic insults. To counteract DNA damage and ensure the completion of DNA replication, cells possess specialized DNA polymerases (Pols) that bypass a variety of DNA lesions. Human DNA polymerase kappa (hPolkappa) is a member of the Y-family of DNA Pols and a direct counterpart of DinB in Escherichia coli. hPolkappa is characterized by its ability to bypass several DNA adducts [e.g., benzo[a]pyrene diolepoxide-N(2)-deoxyguanine (BPDE-N(2)-dG) and thymine glycol] and efficiently extend primers with mismatches at the termini. hPolkappa is structurally distinct from E. coli DinB in that it possesses an approximately 100-amino acid extension at the N-terminus. Here, we report that tyrosine 112 (Y112), the steric gate amino acid of hPolkappa, which distinguishes dNTPs from rNTPs by sensing the 2'-hydroxy group of incoming nucleotides, plays a crucial role in extension reactions with mismatched primer termini. When Y112 was replaced with alanine, the amino acid change severely reduced the catalytic constant, i.e., k(cat), of the extending mismatched primers and lowered the efficiency, i.e., k(cat)/K(m), of this process by approximately 400-fold compared with that of the wild-type enzyme. In contrast, the amino acid replacement did not reduce the insertion efficiency of dCMP opposite BPDE-N(2)-dG in template DNA, nor did it affect the ability of hPolkappa to bind strongly to template-primer DNA with BPDE-N(2)-dG/dCMP. We conclude that the steric gate of hPolkappa is a major fidelity factor that regulates extension reactions from mismatched primer termini.

  4. Obtaining the neutron time-of-flight instrument response function for a single D-T neutron utilizing n-alpha coincidence from the d(t, α) n nuclear reaction

    Science.gov (United States)

    Styron, Jedediah; Ruiz, Carlos; Hahn, Kelly; Cooper, Gary; Chandler, Gordon; Jones, Brent; McWatters, Bruce; Smith, Jenny; Vaughan, Jeremy

    2017-10-01

    A measured neutron time-of-flight (nTOF) signal is a convolution of the neutron reaction history and the instrument response function (IRF). For this work, the IRF was obtained by measuring single, D-T neutron events by utilizing n-alpha coincidence. The d(t, α) n nuclear reaction was produced at Sandia National Laboratories' Ion Beam Laboratory using a 300-keV Cockroft-Walton generator to accelerate a 2- μA beam, of 175-keV D + ions, into a stationary, 2.6- μm, ErT2 target. Comparison of these results to those obtained using cosmic-rays and photons will be discussed. Sandia National Laboratories.

  5. Optimization of genetic analysis for single cell

    Directory of Open Access Journals (Sweden)

    hussein mouawia

    2012-03-01

    Full Text Available The molecular genetic analysis of microdissected cells by laser, a method for selecting a starting material of pure DNA or RNA uncontaminated. Our study focuses on technical pre-PCR (polymerase chain reaction for the amplification of DNA from a single cell (leukocyte isolated from human blood after laser microdissection and aims to optimize the yield of DNA extracted of this cell to be amplified without errors and provide reliable genetic analyzes. This study has allowed us to reduce the duration of cell lysis in order to perform the step of expanding genomic PEP (primer extension preamplification directly after lysis the same day and the quality of genomic amplification and eliminate purification step of the product PEP, step with a risk of contamination and risk of loss of genetic material related to manipulation. This approach has shown that the combination of at least 3 STR (short tandem repeat markers for genetic analysis of single cell improves the efficiency and accuracy of PCR and minimizes the loss of allele (allele drop out; ADO. This protocol can be applied to large scale and an effective means suitable for genetic testing for molecular diagnostic from isolated single cell (cancerous - fetal.

  6. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  7. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  8. Time series of ground reaction forces following a single leg drop jump landing in elite youth soccer players consist of four distinct phases

    NARCIS (Netherlands)

    Fransz, Duncan P.; Huurnink, Arnold; de Boode, Vosse A.; Kingma, Idsart; van Dieën, Jaap H.

    2016-01-01

    The single leg drop jump landing test may assess dynamic and static balance abilities in different phases of the landing. However objective definitions of different phases following landing and associated reliability are lacking. Therefore, we determined the existence of possible distinct phases of

  9. One single catalyst, Pd(OAc)2, for two sequential very different steps: allylic alcohol oxidation-Heck reaction. Access to functionalised alpha,beta-unsaturated ketones.

    Science.gov (United States)

    Batt, Frédéric; Gozzi, Christel; Fache, Fabienne

    2008-11-30

    A single addition of the catalyst, Pd(OAc)(2), was realised to mediate two transformations as different as allylic alcohol oxidation under O(2) and C-C bond formation of the Heck type, to give substituted alpha,beta-unsaturated ketones without intermediate purification.

  10. A new single nucleotide polymorphisms typing method and device by bioluminometric assay coupled with a photodiode array

    Science.gov (United States)

    Kamahori, Masao; Harada, Kunio; Kambara, Hideki

    2002-11-01

    Easy and inexpensive single nucleotide polymorphisms (SNPs) typing systems are required for the practice of genetic testing as well as genetic medicine. Most of the SNPs typing systems use laser-induced fluorescence detection coupled with fluorophore tagging on DNA, which are expensive. A new simple and inexpensive SNPs typing system is presented. It uses a bioluminometric assay coupled with modified primer extension reactions and an inexpensive photodiode array for the luminometric detection. The reagents consumed in the assay are also inexpensive. Although the system is very small, simple and inexpensive, it gives enough sensitivity for detecting target DNAs as small as 10 fmol, which is good enough for SNPs typing.

  11. Development of a tetra-primer ARMS-PCR for detecting the E198A SNP in the isotype-1 β-tubulin gene of Haemonchus contortus populations in China.

    Science.gov (United States)

    Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu

    2018-03-15

    The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. On-slide detection of enzymatic activities in selected single cells.

    Science.gov (United States)

    Keller, Josephine Geertsen; Tesauro, Cinzia; Coletta, Andrea; Graversen, Astrid Damgaard; Ho, Yi-Ping; Kristensen, Peter; Stougaard, Magnus; Knudsen, Birgitta Ruth

    2017-09-21

    With increasing recognition of the importance in addressing cell-to-cell heterogeneity for the understanding of complex biological systems, there is a growing need for assays capable of single cell analyses. In the current study, we describe the measurement of human topoisomerase I activity in single CD44 positive Caco2 cells specifically captured from a mixed population on glass slides, which were dual functionalized with anti-CD44-antibodies and specific DNA primers. On-slide lysis of captured CD44 positive cells, resulted in the release of human topoisomerase I, allowing the enzyme to circularize a specific linear DNA substrate added to the slides. The generated circles hybridized to the anchored DNA primers and acted as templates for a solid support rolling circle amplification reaction leading to the generation of long tandem repeat products that were detected at the single molecule level in a fluorescent microscope upon hybridization of fluorescent labelled probes. The on-slide detection system was demonstrated to be directly quantitative and specific towards CD44 positive cells. Moreover, it allowed reproducible detection of human topoisomerase I activity in single cells.

  13. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets.

    Science.gov (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S; Kerudi, Veerendra V; Patil, Harshal Ashok; Bonde, Prasad Vasudeo; Jaltare, Pratik; Dolas, Siddhesh G

    2016-12-01

    The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (p<0.001) of bond strength with surface roughness of enamel. All groups might show clinically useful SBS values and Transbond XT can be successfully used

  14. Affinity and sequence specificity of DNA binding and site selection for primer synthesis by Escherichia coli primase.

    Science.gov (United States)

    Khopde, Sujata; Biswas, Esther E; Biswas, Subhasis B

    2002-12-17

    Primase is an essential DNA replication enzyme in Escherichia coli and responsible for primer synthesis during lagging strand DNA replication. Although the interaction of primase with single-stranded DNA plays an important role in primer RNA and Okazaki fragment synthesis, the mechanism of DNA binding and site selection for primer synthesis remains unknown. We have analyzed the energetics of DNA binding and the mechanism of site selection for the initiation of primer RNA synthesis on the lagging strand of the replication fork. Quantitative analysis of DNA binding by primase was carried out using a number of oligonucleotide sequences: oligo(dT)(25) and a 30 bp oligonucleotide derived from bacteriophage G4 origin (G4ori-wt). Primase bound both sequences with moderate affinity (K(d) = 1.2-1.4 x 10(-)(7) M); however, binding was stronger for G4ori-wt. G4ori-wt contained a CTG trinucleotide, which is a preferred site for initiation of primer synthesis. Analysis of DNA binding isotherms derived from primase binding to the oligonucleotide sequences by fluorescence anisotropy indicated that primase bound to DNA as a dimer, and this finding was further substantiated by electrophoretic mobility shift assays (EMSAs) and UV cross-linking of the primase-DNA complex. Dissection of the energetics involved in the primase-DNA interaction revealed a higher affinity of primase for DNA sequences containing the CTG triplet. This sequence preference of primase may likely be responsible for the initiation of primer synthesis in the CTG triplet sites in the E. coli lagging strand as well as in the origin of replication of bacteriophage G4.

  15. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    Reverse transcription of RNA is an invaluable method for gene expression analysis by real-time PCR or microarray methods. Random primers of varying lengths were compared with respect to their efficiency of priming reverse transcription reactions. The results showed that l5-nucleotide-long random...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...

  16. Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots.

    Science.gov (United States)

    Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Shinjiro

    2004-10-01

    Contamination with plastid small subunit (SSU) rDNA is a major drawback when analyzing the bacterial communities of plant roots using culture-independent methods. In this study, a polymerase chain reaction (PCR) primer, 783r, was designed and tested to specifically amplify the SSU rDNA of various bacterial species without amplifying the SSU rDNA of plant plastids. To confirm how useful the community analysis of rhizobacteria is using 783r, the terminal restriction fragment length polymorphism (T-RFLP) method was performed with wheat (Triticum aestivum) and spinach (Spinacea oleracea) root samples. Using the standard T-RFLP method, a large T-RF peak of plant plastid SSU rDNA interfered with the bacterial community analysis. In contrast, the T-RFLP method using the 783r primer was able to detect the bacterial DNA while directly eliminating the influence of the plant-derived DNA extracted from the plant roots. Primer 783r might, therefore, be a useful PCR primer for the culture-independent analysis of bacterial communities in plant roots using SSU rDNA.

  17. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    containing 100 μg ml -1 of ampicillin. White colonies were screened for the presence of insert by single colony lysis PCR with M13 forward and reverse primers. PCR protocol included an initial hot start incubation (5 min at 94 o C) followed by 34 cycles... and ambiguously aligned sequences were removed from the further analyses. A phylogenetic analysis was conducted using distance setting maximum likelihood (ML) in MEGA 5.03 (Kumar et al, 2008) with 1000 bootstrap replicates. Individual phylogenetic trees were...

  18. In-situ Studies of the Reactions of Bifunctional and Heterocyclic Molecules over Noble Metal Single Crystal and Nanoparticle Catalysts Studied with Kinetics and Sum-Frequency Generation Vibrational Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kliewer, Christopher J. [Univ. of California, Berkeley, CA (United States)

    2009-06-30

    Sum frequency generation surface vibrational spectroscopy (SFG-VS) in combination with gas chromatography (GC) was used in-situ to monitor surface bound reaction intermediates and reaction selectivities for the hydrogenation reactions of pyrrole, furan, pyridine, acrolein, crotonaldehyde, and prenal over Pt(111), Pt(100), Rh(111), and platinum nanoparticles under Torr reactant pressures and temperatures of 300K to 450K. The focus of this work is the correlation between the SFG-VS observed surface bound reaction intermediates and adsorption modes with the reaction selectivity, and how this is affected by catalyst structure and temperature. Pyrrole hydrogenation was investigated over Pt(111) and Rh(111) single crystals at Torr pressures. It was found that pyrrole adsorbs to Pt(111) perpendicularly by cleaving the N-H bond and binding through the nitrogen. However, over Rh(111) pyrrole adsorbs in a tilted geometry binding through the {pi}-aromatic orbitals. A surface-bound pyrroline reaction intermediate was detected over both surfaces with SFG-VS. It was found that the ring-cracking product butylamine is a reaction poison over both surfaces studied. Furan hydrogenation was studied over Pt(111), Pt(100), 10 nm cubic platinum nanoparticles and 1 nm platinum nanoparticles. The product distribution was observed to be highly structure sensitive and the acquired SFG-VS spectra reflected this sensitivity. Pt(100) exhibited more ring-cracking to form butanol than Pt(111), while the nanoparticles yielded higher selectivities for the partially saturated ring dihydrofuran. Pyridine hydrogenation was investigated over Pt(111) and Pt(100). The α-pyridyl surface adsorption mode was observed with SFG-VS over both surfaces. 1,4-dihydropyridine was seen as a surface intermediate over Pt(100) but not Pt(111). Upon heating the surfaces to 350K, the adsorbed pyridine changes to a flat-lying adsorption mode. No evidence was found for the pyridinium cation. The hydrogenation of the

  19. Single-Crystal to Single-Crystal Transformation of a Nonporous Fe(II) Metal-Organic Framework into a Porous Metal-Organic Framework via a Solid-State Reaction.

    Science.gov (United States)

    Spirkl, Sebastian; Grzywa, Maciej; Reschke, Stephan; Fischer, Jonas K H; Sippel, Pit; Demeshko, Serhiy; Krug von Nidda, Hans-Albrecht; Volkmer, Dirk

    2017-10-16

    We report the synthesis of an air-stable nonporous coordination compound based on iron(II) centers, formate anions, and a 4,4'-bipyrazole (H 2 BPZ) ligand. Upon thermal treatment, a porous metal-organic framework (MOF) formed due to decomposition of the incorporated formate anions. This decomposition step and the following structural changes constituted a single-crystal to single-crystal transformation. The resulting [Fe(BPZ)] framework contained tetrahedrally coordinated iron(II) metal centers. The framework was sensitive toward oxidation by molecular oxygen even at temperatures of 183 K, as followed by oxygen sorption measurements and a color change from colorless to metallic black. The semiconductor properties of the oxidized material were studied by diffuse reflectance UV/vis/NIR spectroscopy and dielectric spectroscopy.

  20. Single site silica supported tetramethyl niobium by the SOMC strategy: synthesis, characterization and structure-activity relationship in the ethylene oligomerization reaction.

    Science.gov (United States)

    Hamieh, Ali; Dey, Raju; Nekoueishahraki, Bijan; Samantaray, Manoja K; Chen, Yin; Abou-Hamad, Edy; Basset, Jean-Marie

    2017-06-27

    A silica supported tetramethyl niobium complex [([triple bond, length as m-dash]SiO)NbMe 4 ] 2 has been isolated by the surface alkylation of [([triple bond, length as m-dash]SiO-)NbCl 3 Me] 1 with dimethyl zinc in pentane. 1 can be easily synthesized by grafting NbCl 3 Me 2 onto the surface of partially dehydroxylated silica by the SOMC strategy. Precise structural analysis was carried out using FTIR, advanced solid state NMR, elemental analysis and mass balance techniques (gas quantification after treating 2 with degassed water). Complex 1 was found to be active in the ethylene oligomerization reaction, producing up to C 30 , whereas to our surprise complex 2 selectively dimerized ethylene into 1-butene in the absence of a co-catalyst at the same conversion level.

  1. Primer Dependent and Independent Forms of Soluble Starch Synthetase from Developing Barley Endosperms

    DEFF Research Database (Denmark)

    Kreis, M.

    1980-01-01

    The activity of soluble starch synthetase (ADP-glucose: agr-1,4-glucan agr-4-glucosyltransferase) in the non-purified extract from 16 day-old Bomi barley endosperms (Hordeum vulgare L.) was low and the reaction was non-linear when plotted against protein concentration. Starch synthetase was purif......The activity of soluble starch synthetase (ADP-glucose: agr-1,4-glucan agr-4-glucosyltransferase) in the non-purified extract from 16 day-old Bomi barley endosperms (Hordeum vulgare L.) was low and the reaction was non-linear when plotted against protein concentration. Starch synthetase...... was purified by ammonium sulfate precipitation and DEAE-cellulose chromatography and separated into four fractions. In the absence of an added carbohydrate primer two of the four fractions catalized the synthesis of a methanol-precipitable agr-glucan when high concentrations of sodium citrate and bovine serum...... albumim were added. The rate of agr-glucan synthesis by the unprimed reaction was higher than for the primed reaction. The four enzyme fractions were active with ADP-Glc, but not with UDP-Glc, both in the primed and in the unprimed reaction....

  2. A genome editing primer for the hematologist

    OpenAIRE

    Hoban, Megan D.; Bauer, Daniel E.

    2016-01-01

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand ...

  3. The effect of different skin-ankle brace application pressures with and without shoes on single-limb balance, electromyographic activation onset and peroneal reaction time of lower limb muscles.

    Science.gov (United States)

    Papadopoulos, E S; Nikolopoulos, C S; Athanasopoulos, S

    2008-12-01

    Several studies have been carried out in order to investigate the effect of ankle bracing on ankle joint function and performance. However, no study so far has examined the role of skin-brace interface pressure in neuromuscular control. The aim of this study was to investigate the effect of different skin-ankle brace interface pressures, with and without shoes, on quiet single-limb balance and the electromyographic (EMG) activation sequence of four lower limb muscles. Twelve male physical education students who volunteered to take part in the study were measured with and without shoes under three ankle brace conditions: (i) without brace, (ii) with brace and 30 kilopascals (kPa) application pressure and (iii) with brace and 60 kPa application pressure. Single-limb balance (anteroposterior and mediolateral parameter) was assessed on the dominant lower limb, with open and closed eyes, on a force platform, simultaneously with the EMG recording of four lower lower limb muscles' (gastrocnemius, peroneus longus, rectus femoris and biceps femoris) activation onset. Peroneus longus reaction time was also measured by provoking a sudden subtalar inversion stress test using a trap-door. The results showed that the application of athletic footwear resulted in a significant difference between the condition with shoes and without shoes, with a significantly increased anteroposterior sway and sway velocity, in all three ankle brace application conditions with shoes (F=50.9, d.f.=1, plower limb muscles. Lastly, ankle brace application with 30 and 60 kPa application pressures, with and without athletic footwear, led to a significant delay in the peroneus longus reaction time (F=9.71, d.f.=2, plimb balance, and peroneal reaction time. The application of athletic footwear, further adversely affects these parameters significantly. Further research is needed in this area with more dynamic and functional measurements, before the safe use of ankle bracing can be widely recommended.

  4. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  5. Large scale collective modeling the final 'freeze out' stages of energetic heavy ion reactions and calculation of single particle measurables from these models

    International Nuclear Information System (INIS)

    Nyiri, Agnes

    2005-01-01

    -relativistic heavy ion reactions is an important hadronic observable sensitive to the early stages of system evolution. The flow analysis involves the particles, which have already been frozen out. Therefore, to perform realistic flow computations from the Multi Module Model we need a complete freeze out description and a well identified freeze out surface. However, the freeze out module is still not ready. Although we have not yet been able to evaluate collective flow using the Multi Module Model, the method and code for the calculation of flow components has been worked out in an independent module. This module is completed and can be coupled to the previous modules when those are ready for use. In order to test the code, we have calculated directed and elliptic flow from a tilted, ellipsoidally expanding source using a simple, blast wave type of model. This model was developed directly for this aim based on Buda-Lund hydro models. Although, this oversimplified blast wave model is not suitable to reproduce the experimental data -which will be an important task in the future to check our Multi Module Model-, it has provided us with important information. We have found that the directed flow, is very sensitive to the correct identification of the reaction plane included the determination of the impact parameter vector, and can be misinterpreted by some experimental methods. We have shown that misidentification of the reaction plane may even set the directed flow to zero by construction. We have presented results of the rapidity dependence of the directed flow, v1, and elliptic flow, v2, furthermore, the transverse momentum dependence of v2. We have also investigated the dependence of the flow pattern on the initial geometry of the fireball by calculating flow components from two ellipsoidal sources with the same thermodynamical properties but different shape. The code determining the freeze out hypersurface should still be improved in order to avoid inaccuracies in the further

  6. A Primer of Middle Eastern Leadership Culture

    Directory of Open Access Journals (Sweden)

    Sheldon Greaves

    2012-01-01

    Full Text Available It is natural for someone looking in on a foreign culture from the outside to interpret what they see and frame their reactions based on their own background and assumptions. With cultures as a different as those of the Middle East and the West, the potential for blunders increases dramatically, made worse by the high political, diplomatic, military, and commercial stakes involved. Leadership culture in this region has been shaped over centuries through a variety of factors, such as reputation, family, and religion, which continue to influence decision making. The present study posits that an understanding of these factors and how they work is crucial for intelligence analysts, policy and decision makers, strategists, and scholars who must find their way through a very unfamiliar cultural landscape in the Middle East. It is hoped that this discussion will in some way assist in the creation of more effective interaction, policies, and analysis associated with the Middle East.

  7. Calcination and solid state reaction of ceramic-forming components to provide single-phase superconducting materials having fine particle size

    Science.gov (United States)

    Balachandran, Uthamalingam; Poeppel, Roger B.; Emerson, James E.; Johnson, Stanley A.

    1992-01-01

    An improved method for the preparation of single phase, fine grained ceramic materials from precursor powder mixtures where at least one of the components of the mixture is an alkali earth carbonate. The process consists of heating the precursor powders in a partial vacuum under flowing oxygen and under conditions where the partial pressure of CO.sub.2 evolved during the calcination is kept to a very low level relative to the oxygen. The process has been found particularly suitable for the preparation of high temperature copper oxide superconducting materials such as YBa.sub.2 Cu.sub.3 O.sub.x "123" and YBa.sub.2 Cu.sub.4 O.sub.8 "124".

  8. Universal primer-multiplex PCR approach for simultaneous detection of Escherichia coli, Listeria monocytogenes, and Salmonella spp. in food samples.

    Science.gov (United States)

    Yuan, Yanfang; Xu, Wentao; Zhai, Zhifang; Shi, Hui; Luo, Yunbo; Chen, Zhuojun; Huang, Kunlun

    2009-10-01

    Escherichia coli, Listeria monocytogenes, and Salmonella spp. are 3 kinds of the most important food-borne human pathogens. Traditional microbiological analysis is labor-intensive, time-consuming, and easily contaminated, thus producing false positive signals; it also involves much subjectivity judgments. Multiplex-PCR could be applied to detect multiple target organisms simultaneously to save time and labor, but there is always disproportionate amplification resulting from the disparity of different primers. To gain a rapid and sensitive method, a universal primer-multiplex PCR system (UP-M-PCR) was developed and applied for simultaneous detection of the 3 organisms. This method simplified traditional multiplex-PCR reaction system and overcame its amplification disparities among different primers; moreover, it got a high specificity and sensitivity (85, 155, and 104 copies/reaction for E. coli O157, L. monocytogenes, and Salmonella spp., respectively). Compared with the time-consuming and laborious microbiological analysis, UP-M-PCR had a lower risk of cross-contamination without inoculation and incubation. Test results for 36 food samples showed that UP-M-PCR method got a relative accuracy of 91.77% when compared with traditional microbiological analysis. It could serve as a rapid screening method for pathogen detection and could detect target genes even in dead pathogenic cells. In addition, it has the potential to be performed in an automation mode and might find broader application in simultaneous detection of other multiple pathogens.

  9. QuantPrime – a flexible tool for reliable high-throughput primer design for quantitative PCR

    Directory of Open Access Journals (Sweden)

    Kwasniewski Miroslaw

    2008-11-01

    Full Text Available Abstract Background Medium- to large-scale expression profiling using quantitative polymerase chain reaction (qPCR assays are becoming increasingly important in genomics research. A major bottleneck in experiment preparation is the design of specific primer pairs, where researchers have to make several informed choices, often outside their area of expertise. Using currently available primer design tools, several interactive decisions have to be made, resulting in lengthy design processes with varying qualities of the assays. Results Here we present QuantPrime, an intuitive and user-friendly, fully automated tool for primer pair design in small- to large-scale qPCR analyses. QuantPrime can be used online through the internet http://www.quantprime.de/ or on a local computer after download; it offers design and specificity checking with highly customizable parameters and is ready to use with many publicly available transcriptomes of important higher eukaryotic model organisms and plant crops (currently 295 species in total, while benefiting from exon-intron border and alternative splice variant information in available genome annotations. Experimental results with the model plant Arabidopsis thaliana, the crop Hordeum vulgare and the model green alga Chlamydomonas reinhardtii show success rates of designed primer pairs exceeding 96%. Conclusion QuantPrime constitutes a flexible, fully automated web application for reliable primer design for use in larger qPCR experiments, as proven by experimental data. The flexible framework is also open for simple use in other quantification applications, such as hydrolyzation probe design for qPCR and oligonucleotide probe design for quantitative in situ hybridization. Future suggestions made by users can be easily implemented, thus allowing QuantPrime to be developed into a broad-range platform for the design of RNA expression assays.

  10. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  11. Long-Gradient Separations Coupled with Selected Reaction Monitoring for Highly Sensitive, Large Scale Targeted Protein Quantification in a Single Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Tujin; Fillmore, Thomas L.; Gao, Yuqian; Zhao, Rui; He, Jintang; Schepmoes, Athena A.; Nicora, Carrie D.; Wu, Chaochao; Chambers, Justin L.; Moore, Ronald J.; Kagan, Jacob; Srivastava, Sudhir; Liu, Alvin Y.; Rodland, Karin D.; Liu, Tao; Camp, David G.; Smith, Richard D.; Qian, Weijun

    2013-10-01

    Long-gradient separations coupled to tandem MS were recently demonstrated to provide a deep proteome coverage for global proteomics; however, such long-gradient separations have not been explored for targeted proteomics. Herein, we investigate the potential performance of the long-gradient separations coupled with selected reaction monitoring (LG-SRM) for targeted protein quantification. Direct comparison of LG-SRM (5 h gradient) and conventional LC-SRM (45 min gradient) showed that the long-gradient separations significantly reduced background interference levels and provided an 8- to 100-fold improvement in LOQ for target proteins in human female serum. Based on at least one surrogate peptide per protein, an LOQ of 10 ng/mL was achieved for the two spiked proteins in non-depleted human serum. The LG-SRM detection of seven out of eight endogenous plasma proteins expressed at ng/mL or sub-ng/mL levels in clinical patient sera was also demonstrated. A correlation coefficient of >0.99 was observed for the results of LG-SRM and ELISA measurements for prostate-specific antigen (PSA) in selected patient sera. Further enhancement of LG-SRM sensitivity was achieved by applying front-end IgY14 immunoaffinity depletion. Besides improved sensitivity, LG-SRM offers at least 3 times higher multiplexing capacity than conventional LC-SRM due to ~3-fold increase in average peak widths for a 300-min gradient compared to a 45-min gradient. Therefore, LG-SRM holds great potential for bridging the gap between global and targeted proteomics due to its advantages in both sensitivity and multiplexing capacity.

  12. Large scale collective modeling the final 'freeze out' stages of energetic heavy ion reactions and calculation of single particle measurables from these models

    Energy Technology Data Exchange (ETDEWEB)

    Nyiri, Agnes

    2005-07-01

    -relativistic heavy ion reactions is an important hadronic observable sensitive to the early stages of system evolution. The flow analysis involves the particles, which have already been frozen out. Therefore, to perform realistic flow computations from the Multi Module Model we need a complete freeze out description and a well identified freeze out surface. However, the freeze out module is still not ready. Although we have not yet been able to evaluate collective flow using the Multi Module Model, the method and code for the calculation of flow components has been worked out in an independent module. This module is completed and can be coupled to the previous modules when those are ready for use. In order to test the code, we have calculated directed and elliptic flow from a tilted, ellipsoidally expanding source using a simple, blast wave type of model. This model was developed directly for this aim based on Buda-Lund hydro models. Although, this oversimplified blast wave model is not suitable to reproduce the experimental data--which will be an important task in the future to check our Multi Module Model--it has provided us with important information. We have found that the directed flow, is very sensitive to the correct identification of the reaction plane included the determination of the impact parameter vector, and can be misinterpreted by some experimental methods. We have shown that misidentification of the reaction plane may even set the directed flow to zero by construction. We have presented results of the rapidity dependence of the directed flow, v1, and elliptic flow, v2, furthermore, the transverse momentum dependence of v2. We have also investigated the dependence of the flow pattern on the initial geometry of the fireball by calculating flow components from two ellipsoidal sources with the same thermodynamical properties but different shape. The code determining the freeze out hypersurface should still be improved in order to avoid inaccuracies in the further

  13. Mechanism and stoichiometry of interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer synthesis.

    Science.gov (United States)

    Mitkova, Atanaska V; Khopde, Sujata M; Biswas, Subhasis B

    2003-12-26

    Initiation and synthesis of RNA primers in the lagging strand of the replication fork in Escherichia coli requires the replicative DnaB helicase and the DNA primase, the DnaG gene product. In addition, the physical interaction between these two replication enzymes appears to play a role in the initiation of chromosomal DNA replication. In vitro, DnaB helicase stimulates primase to synthesize primers on single-stranded (ss) oligonucleotide templates. Earlier studies hypothesized that multiple primase molecules interact with each DnaB hexamer and single-stranded DNA. We have examined this hypothesis and determined the exact stoichiometry of primase to DnaB hexamer. We have also demonstrated that ssDNA binding activity of the DnaB helicase is necessary for directing the primase to the initiator trinucleotide and synthesis of 11-20-nucleotide long primers. Although, association of these two enzymes determines the extent and rate of synthesis of the RNA primers in vitro, direct evidence of the formation of primase-DnaB complex has remained elusive in E. coli due to the transient nature of their interaction. Therefore, we stabilized this complex using a chemical cross-linker and carried out a stoichiometric analysis of this complex by gel filtration. This allowed us to demonstrate that the primase-helicase complex of E. coli is comprised of three molecules of primase bound to one DnaB hexamer. Fluorescence anisotropy studies of the interaction of DnaB with primase, labeled with the fluorescent probe Ru(bipy)3, and Scatchard analysis further supported this conclusion. The addition of DnaC protein, leading to the formation of the DnaB-DnaC complex, to the simple priming system resulted in the synthesis of shorter primers. Therefore, interactions of the DnaB-primase complex with other replication factors might be critical for determining the physiological length of the RNA primers in vivo and the overall kinetics of primer synthesis.

  14. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  15. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  16. Utility of a multiplex reverse transcriptasepolymerase chain reaction assay (HemaVision in the evaluation of genetic abnormalities in Korean children with acute leukemia: a single institution study

    Directory of Open Access Journals (Sweden)

    Hye-Jin kim

    2013-06-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; In children with acute leukemia, bone marrow genetic abnormalities (GA have prognostic significance, and may be the basis for minimal residual disease monitoring. Since April 2007, we have used a multiplex reverse transcriptase-polymerase chain reaction tool (HemaVision to detect of GA. &lt;b&gt;Methods:&lt;/b&gt; In this study, we reviewed the results of HemaVision screening in 270 children with acute leukemia, newly diagnosed at The Catholic University of Korea from April 2007 to December 2011, and compared the results with those of fluorescence in situ hybridization (FISH, and G-band karyotyping. &lt;b&gt;Results:&lt;/b&gt; Among the 270 children (153 males, 117 females, 187 acute lymphoblastic leukemia and 74 acute myeloid leukemia patients were identified. Overall, GA was detected in 230 patients (85.2%. HemaVision, FISH, and G-band karyotyping identified GA in 125 (46.3%, 126 (46.7%, and 215 patients (79.6%, respectively. TEL-AML1 (20.9%, 39/187 and AML1-ETO (27%, 20/74 were the most common GA in ALL and AML, respectively. Overall sensitivity of HemaVision was 98.4%, with false-negative results in 2 instances: 1 each for TEL-AML1 and MLL-AF4 . An aggregate of diseasesspecific FISH showed 100% sensitivity in detection of GA covered by HemaVision for actual probes utilized. G-band karyotype revealed GA other than those covered by HemaVison screening in 133 patients (49.3%. Except for hyperdiplody and hypodiploidy, recurrent GA as defined by the World Health Organizationthat were not screened by HemaVision, were absent in the karyotype. &lt;b&gt;Conclusion:&lt;/b&gt; HemaVision, supported by an aggregate of FISH tests for important translocations, may allow for accurate diagnosis of GA in Korean children with acute leukemia.

  17. Nuclear reactions

    International Nuclear Information System (INIS)

    Lane, A.M.

    1980-01-01

    In reviewing work at Harwell over the past 25 years on nuclear reactions it is stated that a balance has to be struck in both experiment and theory between work on cross-sections of direct practical relevance to reactors and on those relevant to an overall understanding of reaction processes. The compound nucleus and direct process reactions are described. Having listed the contributions from AERE, Harwell to developments in nuclear reaction research in the period, work on the optical model, neutron capture theory, reactions at doorway states with fine structure, and sum-rules for spectroscopic factors are considered in more detail. (UK)

  18. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    Science.gov (United States)

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  19. The emergence of consensus: a primer

    Science.gov (United States)

    Baronchelli, Andrea

    2018-02-01

    The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges `spontaneously' in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems.

  20. A mathematical primer on quantum mechanics

    CERN Document Server

    Teta, Alessandro

    2018-01-01

    This book offers a rigorous yet elementary approach to quantum mechanics that will meet the needs of Master’s-level Mathematics students and is equally suitable for Physics students who are interested in gaining a deeper understanding of the mathematical structure of the theory. Throughout the coverage, which is limited to single-particle quantum mechanics, the focus is on formulating theory and developing applications in a mathematically precise manner. Following a review of selected key concepts in classical physics and the historical background, the basic elements of the theory of operators in Hilbert spaces are presented and used to formulate the rules of quantum mechanics. The discussion then turns to free particles, harmonic oscillators, delta potential, and hydrogen atoms, providing rigorous proofs of the corresponding dynamical properties. Starting from an analysis of these applications, readers are subsequently introduced to more advanced topics such as the classical limit, scattering theory, and s...