WorldWideScience

Sample records for single primer reaction

  1. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  2. Easy assessment of diversity in Jatropha curcas L. plants using two single-primer amplification reaction (SPAR) methods

    Energy Technology Data Exchange (ETDEWEB)

    Ranade, Shirish A; Srivastava, Anuj P; Srivastava, Jyoti; Tuli, Rakesh [PMB Division, National Botanical Research Institute, Rana Pratap Marg, Lucknow 226 001, U.P. (India); Rana, Tikam S [Plant Biodiversity and Conservation Biology Division, National Botanical Research Institute, Rana Pratap Marg, Lucknow 226 001, U.P. (India)

    2008-06-15

    Jatropha curcas L. (physic nut) has drawn attention in recent years as a source of seed oil that can provide an economically viable substitute for diesel. Very little work on provenance trials and genetic resources of J. curcas L. has been reported so far. Though J. curcas grows widely in India and several collections of the plant are also maintained, pedigree and provenance records are not always available. This article reports our studies on the diversity amongst the accessions of J. curcas L., both amongst already held collections as well as from a few locations in the wild. Two single-primer amplification reaction (SPAR) methods were used for this purpose. The accessions from the North East were most distant from all other accessions in UPGMA analysis. The NBRI, Bhubaneshwar and Lalkuan accessions were more related to each other. The UPGMA tree clearly shows well-separated accession groups: NBRI, Bhubaneshwar, North East, Lalkuan and Outgroup. The study suggests that this relatively recently introduced plant species shows adequate genetic diversity in India and that the SPAR methods are useful for a rapid assessment of the same. The methods provide important tools for analyzing the diversity within the available collections to shortlist the parental lines for adaptability trials and further improvement of Jatropha plants. (author)

  3. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  4. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  5. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  6. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  7. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  8. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  9. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  11. A primer for electroweak induced low-energy nuclear reactions

    Indian Academy of Sciences (India)

    paper is devoted to delineating the unifying features and to an overall synthesis of .... reaction e− + p → n + νe for electrons and protons of very low kinetic energy ..... of Z protons and N = (A − Z) neutrons where A is the total number of nucleons.

  12. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  13. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  14. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  15. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  16. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  17. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  18. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    Despite economic importance, the origin and domestication of mulberry has not ..... The numbers at the nodes in each tree are the bootstrap percent values (only values greater than or equal to 50 are shown) for the ..... Dandin S B 1998 Mulberry: A versatile biosource in the service of mankind; Acta Sericologica Sinica 24 ...

  19. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  20. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  1. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  2. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  3. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  4. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...

  5. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  6. Amalgam shear bond strength to dentin using single-bottle primer/adhesive systems.

    Science.gov (United States)

    Cobb, D S; Denehy, G E; Vargas, M A

    1999-10-01

    To evaluate the in vitro shear bond strengths (SBS) of a spherical amalgam alloy (Tytin) to dentin using several single-bottle primer/adhesive systems both alone: Single Bond (SB), OptiBond Solo (Sol), Prime & Bond 2.1 (PB), One-Step (OS) and in combination with the manufacturer's supplemental amalgam bonding agent: Single Bond w/3M RelyX ARC (SBX) and Prime & Bond 2.1 w/Amalgam Bonding Accessory Kit (PBA). Two, three-component adhesive systems, Scotchbond Multi-Purpose (SBMP) and Scotchbond Multi-Purpose Plus w/light curing (S + V) and w/o light curing (S+) were used for comparison. One hundred eight extracted human third molars were mounted lengthwise in phenolic rings with acrylic resin. The proximal surfaces were ground to expose a flat dentin surface, then polished to 600 grit silicon carbide paper. The teeth were randomly assigned to 9 groups (n = 12), and dentin surfaces in each group were treated with an adhesive system according to the manufacturer's instructions, except for S + V specimens, where the adhesive was light cured for 10 s before placing the amalgam. Specimens were then secured in a split Teflon mold, having a 3 mm diameter opening and amalgam was triturated and condensed onto the treated dentin surfaces. Twenty minutes after condensation, the split mold was separated. Specimens were placed in distilled water for 24 hrs, then thermocycled (300 cycles, between 5 degrees C and 55 degrees C, with 12 s dwell time). All specimens were stored in 37 degrees C distilled water for 7 days, prior to shear strength testing using a Zwick Universal Testing Machine at a cross-head speed of 0.5 mm/min. The highest to the lowest mean dentin shear bond strength values (MPa) for the adhesive systems tested were: S + V (10.3 +/- 2.3), SBX (10.2 +/- 3.5), PBA, (6.4 +/- 3.6), SOL (5.8 +/- 2.5), SBMP (5.7 +/- 1.8), S+ (4.8 +/- 2.3), PB (2.7 +/- 2.6), SB (2.7 +/- 1.1) and OS (2.5 +/- 1.8). One-way ANOVA and Duncan's Multiple Range Test indicated significant

  7. Enzyme Treatment-Free and Ligation-Independent Cloning Using Caged Primers in Polymerase Chain Reactions

    Directory of Open Access Journals (Sweden)

    Akinori Kuzuya

    2011-12-01

    Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.

  8. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  9. Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.

    Science.gov (United States)

    Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe

    2018-04-19

    To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.

  10. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  11. From cutting-edge pointwise cross-section to groupwise reaction rate: A primer

    Science.gov (United States)

    Sublet, Jean-Christophe; Fleming, Michael; Gilbert, Mark R.

    2017-09-01

    The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviations derived from Monte Carlo simulations, to the local and total uncertainty in the simulated reactions rates (RRs), which usually only apply to one application at a time. This paper identifies deficiencies in the traditional treatment, and discusses correct handling of the RR uncertainty quantification and propagation, including details of the cross section components in the RR uncertainty estimates, which are verified for relevant applications. The methodology that rigorously captures the spectral shift and cross section contributions to the uncertainty in the RR are discussed with quantified examples that demonstrate the importance of the proper treatment of the spectrum profile and cross section contributions to the uncertainty in the RR and subsequent response functions. The recently developed inventory code FISPACT-II, when connected to the processed nuclear data libraries TENDL-2015, ENDF/B-VII.1, JENDL-4.0u or JEFF-3.2, forms an enhanced multi-physics platform providing a wide variety of advanced simulation methods for modelling activation, transmutation, burnup protocols and simulating radiation damage sources terms. The system has extended cutting-edge nuclear data forms, uncertainty quantification and propagation methods, which have been the subject of recent integral and differential, fission, fusion and accelerators validation efforts. The simulation system is used to accurately and predictively probe, understand and underpin a modern and sustainable understanding

  12. From cutting-edge pointwise cross-section to groupwise reaction rate: A primer

    Directory of Open Access Journals (Sweden)

    Sublet Jean-Christophe

    2017-01-01

    Full Text Available The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviations derived from Monte Carlo simulations, to the local and total uncertainty in the simulated reactions rates (RRs, which usually only apply to one application at a time. This paper identifies deficiencies in the traditional treatment, and discusses correct handling of the RR uncertainty quantification and propagation, including details of the cross section components in the RR uncertainty estimates, which are verified for relevant applications. The methodology that rigorously captures the spectral shift and cross section contributions to the uncertainty in the RR are discussed with quantified examples that demonstrate the importance of the proper treatment of the spectrum profile and cross section contributions to the uncertainty in the RR and subsequent response functions. The recently developed inventory code FISPACT-II, when connected to the processed nuclear data libraries TENDL-2015, ENDF/B-VII.1, JENDL-4.0u or JEFF-3.2, forms an enhanced multi-physics platform providing a wide variety of advanced simulation methods for modelling activation, transmutation, burnup protocols and simulating radiation damage sources terms. The system has extended cutting-edge nuclear data forms, uncertainty quantification and propagation methods, which have been the subject of recent integral and differential, fission, fusion and accelerators validation efforts. The simulation system is used to accurately and predictively probe, understand and underpin a modern and

  13. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  14. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    Directory of Open Access Journals (Sweden)

    Dong Chen

    Full Text Available Genotyping of thiopurine S-methyltransferase (TPMT is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR, termed competitive real-time fluorescent AS-PCR (CRAS-PCR was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques.

  15. Human Platelet Antigen Alleles in 998 Taiwanese Blood Donors Determined by Sequence-Specific Primer Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Shun-Chung Pai

    2013-01-01

    Full Text Available Polymorphism of human platelet antigens (HPAs leads to alloimmunizations and immune-mediated platelet disorders including fetal-neonatal alloimmune thrombocytopenia (FNAIT, posttransfusion purpura (PTP, and platelet transfusion refractoriness (PTR. HPA typing and knowledge of antigen frequency in a population are important in particular for the provision of HPA-matched blood components for patients with PTR. We have performed allele genotyping for HPA-1 through -6 and -15 among 998 platelet donors from 6 blood centers in Taiwan using sequence-specific primer polymerase chain reaction. The HPA allele frequency was 99.55, and 0.45% for HPA-1a and -1b; 96.49, and 3.51% for HPA-2a and -2b; 55.81, and 44.19% for HPA-3a and -3b; 99.75, and 0.25% for HPA-4a and -4b; 98.50, and 1.50% for HPA-5a and -5b; 97.75 and 2.25% for HPA-6a and -6b; 53.71 and 46.29% for HPA-15a and -15b. HPA-15b and HPA-3a, may be considered the most important, followed by HPA-2, -6, -1, -5, and -4 systems, as a cause of FNAIT, PTP, and PTR based on allele frequency. HPA-4b and HPA-5b role cannot be excluded based on their immunogenicity. A larger-scale study will now be conducted to confirm these hypotheses and to establish an apheresis donor database for the procurement of HPA-matched apheresis platelets for patients with PTR.

  16. Single-Atom Catalysts of Precious Metals for Electrochemical Reactions.

    Science.gov (United States)

    Kim, Jiwhan; Kim, Hee-Eun; Lee, Hyunjoo

    2018-01-10

    Single-atom catalysts (SACs), in which metal atoms are dispersed on the support without forming nanoparticles, have been used for various heterogeneous reactions and most recently for electrochemical reactions. In this Minireview, recent examples of single-atom electrocatalysts used for the oxygen reduction reaction (ORR), hydrogen oxidation reaction (HOR), hydrogen evolution reaction (HER), formic acid oxidation reaction (FAOR), and methanol oxidation reaction (MOR) are introduced. Many density functional theory (DFT) simulations have predicted that SACs may be effective for CO 2 reduction to methane or methanol production while suppressing H 2 evolution, and those cases are introduced here as well. Single atoms, mainly Pt single atoms, have been deposited on TiN or TiC nanoparticles, defective graphene nanosheets, N-doped covalent triazine frameworks, graphitic carbon nitride, S-doped zeolite-templated carbon, and Sb-doped SnO 2 surfaces. Scanning transmission electron microscopy, extended X-ray absorption fine structure measurement, and in situ infrared spectroscopy have been used to detect the single-atom structure and confirm the absence of nanoparticles. SACs have shown high mass activity, minimizing the use of precious metal, and unique selectivity distinct from nanoparticle catalysts owing to the absence of ensemble sites. Additional features that SACs should possess for effective electrochemical applications were also suggested. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Promoting Barrier Performance and Cathodic Protection of Zinc-Rich Epoxy Primer via Single-Layer Graphene

    Directory of Open Access Journals (Sweden)

    Jingrong Liu

    2018-05-01

    Full Text Available The effect of single-layer graphene sheets (Gr on the corrosion protection of zinc-rich epoxy primers (ZRPs was investigated. Scanning electron microscopy (SEM with an energy dispersive spectrometer (EDS were used to characterize morphology and composition of the coatings after immersion for 25 days. The cross-sectional SEM images and X-ray photoelectron spectroscopy (XPS confirmed that the addition of single-layer graphene facilitated assembling of zinc oxides on the interface between the coating and the steel. The open circuit potential (OCP, electrochemical impedance spectroscopy (EIS measurements revealed that both the cathodic protection and barrier performance of the ZRP were enhanced after addition of 0.6 wt. % Gr (Gr0.6-ZRP. In addition, the cathodic protection property of the Gr0.6-ZRP was characterized quantitatively by localized electrochemical impedance spectroscopy (LEIS in the presence of an artificial scratch on the coating. The results demonstrate that moderate amounts of single-layer graphene can significantly improve corrosion resistance of ZRP, due to the barrier protection and cathodic protection effects.

  18. Direct single-molecule dynamic detection of chemical reactions.

    Science.gov (United States)

    Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng

    2018-02-01

    Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.

  19. Chemical reaction between single hydrogen atom and graphene

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakamura, Hiroaki; Takayama, Arimichi

    2007-04-01

    We study chemical reaction between a single hydrogen atom and a graphene, which is the elemental reaction between hydrogen and graphitic carbon materials. In the present work, classical molecular dynamics simulation is used with modified Brenner's empirical bond order potential. The three reactions, that is, absorption reaction, reflection reaction and penetration reaction, are observed in our simulation. Reaction rates depend on the incident energy of the hydrogen atom and the graphene temperature. The dependence can be explained by the following mechanisms: (1) The hydrogen atom receives repulsive force by π-electrons in addition to nuclear repulsion. (2) Absorbing the hydrogen atom, the graphene transforms its structure to the 'overhand' configuration such as sp 3 state. (3) The hexagonal hole of the graphene is expanded during the penetration of the hydrogen atom. (author)

  20. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  1. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  3. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  4. High performance platinum single atom electrocatalyst for oxygen reduction reaction

    Science.gov (United States)

    Liu, Jing; Jiao, Menggai; Lu, Lanlu; Barkholtz, Heather M.; Li, Yuping; Wang, Ying; Jiang, Luhua; Wu, Zhijian; Liu, Di-Jia; Zhuang, Lin; Ma, Chao; Zeng, Jie; Zhang, Bingsen; Su, Dangsheng; Song, Ping; Xing, Wei; Xu, Weilin; Wang, Ying; Jiang, Zheng; Sun, Gongquan

    2017-07-01

    For the large-scale sustainable implementation of polymer electrolyte membrane fuel cells in vehicles, high-performance electrocatalysts with low platinum consumption are desirable for use as cathode material during the oxygen reduction reaction in fuel cells. Here we report a carbon black-supported cost-effective, efficient and durable platinum single-atom electrocatalyst with carbon monoxide/methanol tolerance for the cathodic oxygen reduction reaction. The acidic single-cell with such a catalyst as cathode delivers high performance, with power density up to 680 mW cm-2 at 80 °C with a low platinum loading of 0.09 mgPt cm-2, corresponding to a platinum utilization of 0.13 gPt kW-1 in the fuel cell. Good fuel cell durability is also observed. Theoretical calculations reveal that the main effective sites on such platinum single-atom electrocatalysts are single-pyridinic-nitrogen-atom-anchored single-platinum-atom centres, which are tolerant to carbon monoxide/methanol, but highly active for the oxygen reduction reaction.

  5. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  6. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  7. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  8. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  9. Single Turnover at Molecular Polymerization Catalysts Reveals Spatiotemporally Resolved Reactions.

    Science.gov (United States)

    Easter, Quinn T; Blum, Suzanne A

    2017-10-23

    Multiple active individual molecular ruthenium catalysts have been pinpointed within growing polynorbornene, thereby revealing information on the reaction dynamics and location that is unavailable through traditional ensemble experiments. This is the first single-turnover imaging of a molecular catalyst by fluorescence microscopy and allows detection of individual monomer reactions at an industrially important molecular ruthenium ring-opening metathesis polymerization (ROMP) catalyst under synthetically relevant conditions (e.g. unmodified industrial catalyst, ambient pressure, condensed phase, ca. 0.03 m monomer). These results further establish the key fundamentals of this imaging technique for characterizing the reactivity and location of active molecular catalysts even when they are the minor components. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  11. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

  12. Flexible single molecule simulation of reaction-diffusion processes

    International Nuclear Information System (INIS)

    Hellander, Stefan; Loetstedt, Per

    2011-01-01

    An algorithm is developed for simulation of the motion and reactions of single molecules at a microscopic level. The molecules diffuse in a solvent and react with each other or a polymer and molecules can dissociate. Such simulations are of interest e.g. in molecular biology. The algorithm is similar to the Green's function reaction dynamics (GFRD) algorithm by van Zon and ten Wolde where longer time steps can be taken by computing the probability density functions (PDFs) and then sample from the distribution functions. Our computation of the PDFs is much less complicated than GFRD and more flexible. The solution of the partial differential equation for the PDF is split into two steps to simplify the calculations. The sampling is without splitting error in two of the coordinate directions for a pair of molecules and a molecule-polymer interaction and is approximate in the third direction. The PDF is obtained either from an analytical solution or a numerical discretization. The errors due to the operator splitting, the partitioning of the system, and the numerical approximations are analyzed. The method is applied to three different systems involving up to four reactions. Comparisons with other mesoscopic and macroscopic models show excellent agreement.

  13. Claustral single cell reactions to tooth pulp stimulation in cats.

    Science.gov (United States)

    Jastreboff, P; Sikora, M; Frydrychowski, A; Słoniewski, P

    1983-01-01

    Single unit activity in the central region of the claustrum, evoked by electrical stimulation of tooth pulp or paws was studied on cats under chloralose anesthesia. The majority of cells responded in similar manner to stimulation of tooth pulp or paws, but there were cells with clear preference to a given type of stimulation. Latencies of reactions evoked by tooth pulp stimulation were significantly shorter than those for limb stimulation. In the former case latencies as short as 8 rns were observed. It is postulated that the central region of the claustrum receives a projection from the tooth pulp, and that in those cases with very short latency the projection is direct and does not involve the cerebral cortex.

  14. Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification.

    Directory of Open Access Journals (Sweden)

    Yohei Nishikawa

    Full Text Available Whole genome amplification (WGA is essential for obtaining genome sequences from single bacterial cells because the quantity of template DNA contained in a single cell is very low. Multiple displacement amplification (MDA, using Phi29 DNA polymerase and random primers, is the most widely used method for single-cell WGA. However, single-cell MDA usually results in uneven genome coverage because of amplification bias, background amplification of contaminating DNA, and formation of chimeras by linking of non-contiguous chromosomal regions. Here, we present a novel MDA method, termed droplet MDA, that minimizes amplification bias and amplification of contaminants by using picoliter-sized droplets for compartmentalized WGA reactions. Extracted DNA fragments from a lysed cell in MDA mixture are divided into 105 droplets (67 pL within minutes via flow through simple microfluidic channels. Compartmentalized genome fragments can be individually amplified in these droplets without the risk of encounter with reagent-borne or environmental contaminants. Following quality assessment of WGA products from single Escherichia coli cells, we showed that droplet MDA minimized unexpected amplification and improved the percentage of genome recovery from 59% to 89%. Our results demonstrate that microfluidic-generated droplets show potential as an efficient tool for effective amplification of low-input DNA for single-cell genomics and greatly reduce the cost and labor investment required for determination of nearly complete genome sequences of uncultured bacteria from environmental samples.

  15. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    Directory of Open Access Journals (Sweden)

    Vanessa Suin

    2014-01-01

    Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  16. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    Science.gov (United States)

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  17. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  18. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    Science.gov (United States)

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  19. Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

    Science.gov (United States)

    Henry, Kevin A

    2018-01-01

    Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

  20. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  1. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  2. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  3. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  4. Single proton transfer reactions on odd-even nuclei

    International Nuclear Information System (INIS)

    Blasi, N.

    1984-01-01

    This thesis is devoted to the study of one proton transfer reactions, performed with the use of the magnetic spectrograph QMG/2 of the KVI, in two regions of the mass table. Stripping and pickup reactions on the odd-A target nuclei 193 Ir and 197 Au are described in the first part. The experimental spectroscopic factors obtained are used to test several collective models that are based on coupling between bosons (phonons) and fermions. In the second part, the proton stripping reactions on 113 In and 115 In are studied. Shell model calculations are performed and applied to the experimental results. (Auth.)

  5. Single-molecule stochastic times in a reversible bimolecular reaction

    Science.gov (United States)

    Keller, Peter; Valleriani, Angelo

    2012-08-01

    In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.

  6. Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

    Science.gov (United States)

    Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

    2015-09-01

    Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  7. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  8. Designing primers and evaluation of the efficiency of propidium monoazide - Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius.

    Science.gov (United States)

    Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang

    2017-07-01

    The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.

  9. Designing primers and evaluation of the efficiency of propidium monoazide – Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius

    Directory of Open Access Journals (Sweden)

    Chieh-Hsien Lai

    2017-07-01

    Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.

  10. Single-particle and collective states in transfer reactions

    International Nuclear Information System (INIS)

    Lhenry, I.; Suomijaervi, T.; Giai, N. van

    1993-01-01

    The possibility to excite collective states in transfer reactions induced by heavy ions is studied. Collective states are described within the Random Phase Approximation (RPA) and the collectivity is defined according to the number of configurations contributing to a given state. The particle transfer is described within the Distorted Wave Born Approximation (DWBA). Calculations are performed for two different stripping reactions: 207 Pb( 20 Ne, 19 Ne) 208 Pb and 59 Co( 20 Ne, 19 F) 60 Ni at 48 MeV/nucleon for which experimental data are available. The calculation shows that a sizeable fraction of collective strength can be excited in these reactions. The comparison with experiment shows that this parameter-free calculation qualitatively explains the data. (author) 19 refs.; 10 figs

  11. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  12. Observing single molecule chemical reactions on metal nanoparticles.

    Energy Technology Data Exchange (ETDEWEB)

    Emory, S. R. (Steven R.); Ambrose, W. Patrick; Goodwin, P. M. (Peter M); Keller, Richard A.

    2001-01-01

    We report the study of the photodecomposition of single Rhodamine 6G (R6G) dye molecules adsorbed on silver nanoparticles. The nanoparticles were immobilized and spatially isolated on polylysine-derivatized glass coverslips, and confocal laser microspectroscopy was used to obtain surface-enhanced Raman scattering (SERS) spectra from individual R6G molecules. The photodecomposition of these molecules was observed with 150-ms temporal resolution. The photoproduct was identified as graphitic carbon based on the appearance of broad SERS vibrational bands at 1592 cm{sup -1} and 1340 cm{sup -1} observed in both bulk and averaged single-molecule photoproduct spectra. In contrast, when observed at the single-molecule level, the photoproduct yielded sharp SERS spectra. The inhomogeneous broadening of the bulk SERS spectra is due to a variety of photoproducts in different surface orientations and is a characteristic of ensemble-averaged measurements of disordered systems. These single-molecule studies indicate a photodecomposition pathway by which the R6G molecule desorbs from the metal surface, an excited-state photoreaction occurs, and the R6G photoproduct(s) readsorbs to the surface. A SERS spectrum is obtained when either the intact R6G or the R6G photoproduct(s) are adsorbed on a SERS-active site. This work further illustrates the power of single-molecule spectroscopy (SMS) to reveal unique behaviors of single molecules that are not discernable with bulk measurements.

  13. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  14. Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

    Science.gov (United States)

    Pierce, Kenneth E; Wangh, Lawrence J

    2007-01-01

    Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

  15. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  16. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

    Science.gov (United States)

    Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

    2017-05-01

    Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

  17. Single nucleon emission in relativistic nucleus-nucleus reactions

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Significant discrepancies between theory and experiment have previously been noted for nucleon emission via electromagnetic processes in relativistic nucleus-nucleus collisions. The present work investigates the hypothesis that these discrepancies have arisen due to uncertainties about how to deduce the experimental electromagnetic cross section from the total measured cross section. An optical-model calculation of single neutron removal is added to electromagnetic cross sections and compared to the total experimental cross sections. Good agreement is found thereby resolving some of the earlier noted discrepancies. A detailed comparison to the recent work of Benesh, Cook, and Vary is made for both the impact parameter and the nuclear cross section. Good agreement is obtained giving an independent confirmation of the parameterized formulas developed by those authors

  18. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    Science.gov (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  19. Single-Site Palladium(II) Catalyst for Oxidative Heck Reaction: Catalytic Performance and Kinetic Investigations

    Energy Technology Data Exchange (ETDEWEB)

    Duan, Hui; Li, Mengyang; Zhang, Guanghui; Gallagher, James R.; Huang, Zhiliang; Sun, Yu; Luo, Zhong; Chen, Hongzhong; Miller, Jeffrey T.; Zou, Ruqiang; Lei, Aiwen; Zhao, Yanli

    2015-01-01

    ABSTRACT: The development of organometallic single-site catalysts (SSCs) has inspired the designs of new heterogeneous catalysts with high efficiency. Nevertheless, the application of SSCs in certain modern organic reactions, such as C-C bond formation reactions, has still been less investigated. In this study, a single-site Pd(II) catalyst was developed, where 2,2'-bipyridine-grafted periodic mesoporous organosilica (PMO) was employed as the support of a Pd(II) complex. The overall performance of the single-site Pd(II) catalyst in the oxidative Heck reaction was then investigated. The investigation results show that the catalyst displays over 99% selectivity for the product formation with high reaction yield. Kinetic profiles further confirm its high catalytic efficiency, showing that the rate constant is nearly 40 times higher than that for the free Pd(II) salt. X-ray absorption spectroscopy reveals that the catalyst has remarkable lifetime and recyclability.

  20. Single-Atom Catalyst of Platinum Supported on Titanium Nitride for Selective Electrochemical Reactions.

    Science.gov (United States)

    Yang, Sungeun; Kim, Jiwhan; Tak, Young Joo; Soon, Aloysius; Lee, Hyunjoo

    2016-02-05

    As a catalyst, single-atom platinum may provide an ideal structure for platinum minimization. Herein, a single-atom catalyst of platinum supported on titanium nitride nanoparticles were successfully prepared with the aid of chlorine ligands. Unlike platinum nanoparticles, the single-atom active sites predominantly produced hydrogen peroxide in the electrochemical oxygen reduction with the highest mass activity reported so far. The electrocatalytic oxidation of small organic molecules, such as formic acid and methanol, also exhibited unique selectivity on the single-atom platinum catalyst. A lack of platinum ensemble sites changed the reaction pathway for the oxygen-reduction reaction toward a two-electron pathway and formic acid oxidation toward direct dehydrogenation, and also induced no activity for the methanol oxidation. This work demonstrates that single-atom platinum can be an efficient electrocatalyst with high mass activity and unique selectivity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

    Science.gov (United States)

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

    2014-09-15

    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Reaction kinetics of oxygen on single-phase alloys, oxidation of nickel and niobium alloys

    International Nuclear Information System (INIS)

    Lalauze, Rene

    1973-01-01

    This research thesis first addresses the reaction kinetics of oxygen on alloys. It presents some generalities on heterogeneous reactions (conventional theory, theory of jumps), discusses the core reaction (with the influence of pressure), discusses the influence of metal self-diffusion on metal oxidation kinetics (equilibrium conditions at the interface, hybrid diffusion regime), reports the application of the hybrid diffusion model to the study of selective oxidation of alloys (Wagner model, hybrid diffusion model) and the study of the oxidation kinetics of an alloy forming a solid solution of two oxides. The second part reports the investigation of the oxidation of single phase nickel and niobium alloys (phase α, β and γ)

  3. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  4. Single-Molecule Sensing with Nanopore Confinement: from Chemical Reactions to Biological Interactions.

    Science.gov (United States)

    Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao

    2018-03-25

    The nanopore can generate an electrochemical confinement for single-molecule sensing which help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this concept, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The mechanism distinguishability problem in biochemical kinetics: the single-enzyme, single-substrate reaction as a case study.

    Science.gov (United States)

    Schnell, Santiago; Chappell, Michael J; Evans, Neil D; Roussel, Marc R

    2006-01-01

    A theoretical analysis of the distinguishability problem of two rival models of the single enzyme-single substrate reaction, the Michaelis-Menten and Henri mechanisms, is presented. We also outline a general approach for analysing the structural indistinguishability between two mechanisms. The approach involves constructing, if possible, a smooth mapping between the two candidate models. Evans et al. [N.D. Evans, M.J. Chappell, M.J. Chapman, K.R. Godfrey, Structural indistinguishability between uncontrolled (autonomous) nonlinear analytic systems, Automatica 40 (2004) 1947-1953] have shown that if, in addition, either of the mechanisms satisfies a particular criterion then such a transformation always exists when the models are indistinguishable from their experimentally observable outputs. The approach is applied to the single enzyme-single substrate reaction mechanism. In principle, mechanisms can be distinguished using this analysis, but we show that our ability to distinguish mechanistic models depends both on the precise measurements made, and on our knowledge of the system prior to performing the kinetics experiments.

  6. Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

    Science.gov (United States)

    Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

    2017-04-01

    The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

  7. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Reaction of single-standard DNA with hydroxyl radical generated by iron(II)-ethylenediaminetetraacetic acid

    International Nuclear Information System (INIS)

    Prigodich, R.V.; Martin, C.T.

    1990-01-01

    This study demonstrates that the reaction of Fe(II)-EDTA and hydrogen peroxide with the single-stranded nucleic acids d(pT) 70 and a 29-base sequence containing a mixture of bases results in substantial damage which is not directly detected by gel electrophoresis. Cleavage of the DNA sugar backbone is enhanced significantly after the samples are incubated at 90 degree C in the presence of piperidine. The latter reaction is used in traditional Maxam-Gilbert DNA sequencing to detect base damage, and the current results are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction with sugar may also produce adducts that are uncleaved but labile to cleavage by piperidine). We the authors propose that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction of the sugars in dsDNA is dominant because the bases are sequestered within the double helix. These results have implications both for the study of single-stranded DNA binding protein binding sites and for the interpretation of experiments using the hydroxyl radical to probe DNA structure or to footprint double-stranded DNA binding protein binding sites

  9. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  10. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  11. Tuning Catalytic Performance through a Single or Sequential Post-Synthesis Reaction(s) in a Gas Phase

    Energy Technology Data Exchange (ETDEWEB)

    Shan, Junjun [Department; Department; Zhang, Shiran [Department; Department; Choksi, Tej [Department; Nguyen, Luan [Department; Department; Bonifacio, Cecile S. [Department; Li, Yuanyuan [Department; Zhu, Wei [Department; Department; College; Tang, Yu [Department; Department; Zhang, Yawen [College; Yang, Judith C. [Department; Greeley, Jeffrey [Department; Frenkel, Anatoly I. [Department; Tao, Franklin [Department; Department

    2016-12-05

    Catalytic performance of a bimetallic catalyst is determined by geometric structure and electronic state of the surface or even the near-surface region of the catalyst. Here we report that single and sequential postsynthesis reactions of an as-synthesized bimetallic nanoparticle catalyst in one or more gas phases can tailor surface chemistry and structure of the catalyst in a gas phase, by which catalytic performance of this bimetallic catalyst can be tuned. Pt–Cu regular nanocube (Pt–Cu RNC) and concave nanocube (Pt–Cu CNC) are chosen as models of bimetallic catalysts. Surface chemistry and catalyst structure under different reaction conditions and during catalysis were explored in gas phase of one or two reactants with ambient-pressure X-ray photoelectron spectroscopy (AP-XPS) and extended X-ray absorption fine structure (EXAFS) spectroscopy. The newly formed surface structures of Pt–Cu RNC and Pt–Cu CNC catalysts strongly depend on the reactive gas(es) used in the postsynthesis reaction(s). A reaction of Pt–Cu RNC-as synthesized with H2 at 200 °C generates a near-surface alloy consisting of a Pt skin layer, a Cu-rich subsurface, and a Pt-rich deep layer. This near-surface alloy of Pt–Cu RNC-as synthesized-H2 exhibits a much higher catalytic activity in CO oxidation in terms of a low activation barrier of 39 ± 4 kJ/mol in contrast to 128 ± 7 kJ/mol of Pt–Cu RNC-as synthesized. Here the significant decrease of activation barrier demonstrates a method to tune catalytic performances of as-synthesized bimetallic catalysts. A further reaction of Pt–Cu RNC-as synthesized-H2 with CO forms a Pt–Cu alloy surface, which exhibits quite different catalytic performance in CO oxidation. It suggests the capability of generating a different surface by using another gas. The capability of tuning surface chemistry and structure of bimetallic catalysts was also demonstrated in restructuring of Pt–Cu CNC-as synthesized.

  12. Scope and Limitations of the Nicking Enzyme Amplification Reaction for the Synthesis of Base-Modified Oligonucleotides and Primers for PCR

    Czech Academy of Sciences Publication Activity Database

    Ménová, Petra; Raindlová, Veronika; Hocek, Michal

    2013-01-01

    Roč. 24, č. 6 (2013), s. 1081-1093 ISSN 1043-1802 R&D Projects: GA ČR GA203/09/0317 Institutional support: RVO:61388963 Keywords : isothermal DNA amplification * cross - coupling reactions * nucleoside triphosphates * polymerase incorporation * functionalized DNA * nucleic-acids Subject RIV: CC - Organic Chemistry Impact factor: 4.821, year: 2013

  13. Delay-induced wave instabilities in single-species reaction-diffusion systems

    Science.gov (United States)

    Otto, Andereas; Wang, Jian; Radons, Günter

    2017-11-01

    The Turing (wave) instability is only possible in reaction-diffusion systems with more than one (two) components. Motivated by the fact that a time delay increases the dimension of a system, we investigate the presence of diffusion-driven instabilities in single-species reaction-diffusion systems with delay. The stability of arbitrary one-component systems with a single discrete delay, with distributed delay, or with a variable delay is systematically analyzed. We show that a wave instability can appear from an equilibrium of single-species reaction-diffusion systems with fluctuating or distributed delay, which is not possible in similar systems with constant discrete delay or without delay. More precisely, we show by basic analytic arguments and by numerical simulations that fast asymmetric delay fluctuations or asymmetrically distributed delays can lead to wave instabilities in these systems. Examples, for the resulting traveling waves are shown for a Fisher-KPP equation with distributed delay in the reaction term. In addition, we have studied diffusion-induced instabilities from homogeneous periodic orbits in the same systems with variable delay, where the homogeneous periodic orbits are attracting resonant periodic solutions of the system without diffusion, i.e., periodic orbits of the Hutchinson equation with time-varying delay. If diffusion is introduced, standing waves can emerge whose temporal period is equal to the period of the variable delay.

  14. Detection of subgenomic mRNA of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (P-sg-QPCR).

    Science.gov (United States)

    Hornyák, Akos; Bálint, Adám; Farsang, Attila; Balka, Gyula; Hakhverdyan, Mikhayil; Rasmussen, Thomas Bruun; Blomberg, Jonas; Belák, Sándor

    2012-05-01

    Feline infectious peritonitis is one of the most severe devastating diseases of the Felidae. Upon the appearance of clinical signs, a cure for the infected animal is impossible. Therefore rapid and proper diagnosis for both the presence of the causative agent, feline coronavirus (FCoV) and the manifestation of feline infectious peritonitis is of paramount importance. In the present work, a novel real-time RT-PCR method is described which is able to detect FCoV and to determine simultaneously the quantity of the viral RNA. The new assay combines the M gene subgenomic messenger RNA (sg-mRNA) detection and the quantitation of the genome copies of FCoV. In order to detect the broadest spectrum of potential FCoV variants and to achieve the most accurate results in the detection ability the new assay is applying the primer-probe energy transfer (PriProET) principle. This technology was chosen since PriProET is very robust to tolerate the nucleotide substitutions in the target area. Therefore, this technology provides a very broad-range system, which is able to detect simultaneously many variants of the virus(es) even if the target genomic regions show large scale of variations. The detection specificity of the new assay was proven by positive amplification from a set of nine different FCoV strains and negative from the tested non-coronaviral targets. Examination of faecal samples of healthy young cats, organ samples of perished animals, which suffered from feline infectious peritonitis, and cat leukocytes from uncertain clinical cases were also subjected to the assay. The sensitivity of the P-sg-QPCR method was high, since as few as 10 genome copies of FCoV were detected. The quantitative sg-mRNA detection method revealed more than 10-50,000 times increase of the M gene sg-mRNA in organ materials of feline infectious peritonitis cases, compared to those of the enteric FCoV variants present in the faeces of normal, healthy cats. These results indicate the applicability of

  15. Modeling of the interplay between single-file diffusion and conversion reaction in mesoporous systems

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jing [Iowa State Univ., Ames, IA (United States)

    2013-01-11

    We analyze the spatiotemporal behavior of species concentrations in a diffusion-mediated conversion reaction which occurs at catalytic sites within linear pores of nanometer diameter. A strict single-file (no passing) constraint occurs in the diffusion within such narrow pores. Both transient and steady-state behavior is precisely characterized by kinetic Monte Carlo simulations of a spatially discrete lattice–gas model for this reaction–diffusion process considering various distributions of catalytic sites. Exact hierarchical master equations can also be developed for this model. Their analysis, after application of mean-field type truncation approximations, produces discrete reaction–diffusion type equations (mf-RDE). For slowly varying concentrations, we further develop coarse-grained continuum hydrodynamic reaction–diffusion equations (h-RDE) incorporating a precise treatment of single-file diffusion (SFD) in this multispecies system. Noting the shortcomings of mf-RDE and h-RDE, we then develop a generalized hydrodynamic (GH) formulation of appropriate gh-RDE which incorporates an unconventional description of chemical diffusion in mixed-component quasi-single-file systems based on a refined picture of tracer diffusion for finite-length pores. The gh-RDE elucidate the non-exponential decay of the steady-state reactant concentration into the pore and the non-mean-field scaling of the reactant penetration depth. Then an extended model of a catalytic conversion reaction within a functionalized nanoporous material is developed to assess the effect of varying the reaction product – pore interior interaction from attractive to repulsive. The analysis is performed utilizing the generalized hydrodynamic formulation of the reaction-diffusion equations which can reliably capture the complex interplay between reaction and restricted transport for both irreversible and reversible reactions.

  16. Improved single particle potential for transport model simulations of nuclear reactions induced by rare isotope beams

    International Nuclear Information System (INIS)

    Xu Chang; Li Baoan

    2010-01-01

    Taking into account more accurately the isospin dependence of nucleon-nucleon interactions in the in-medium many-body force term of the Gogny effective interaction, new expressions for the single-nucleon potential and the symmetry energy are derived. Effects of both the spin (isospin) and the density dependence of nuclear effective interactions on the symmetry potential and the symmetry energy are examined. It is shown that they both play a crucial role in determining the symmetry potential and the symmetry energy at suprasaturation densities. The improved single-nucleon potential will be useful for more accurate simulation of nuclear reactions induced by rare-isotope beams within transport models.

  17. CCl 4 chemistry on the magnetite selvedge of single-crystal hematite: competitive surface reactions

    Science.gov (United States)

    Adib, K.; Camillone, N., III; Fitts, J. P.; Rim, K. T.; Flynn, G. W.; Joyce, S. A.; Osgood, R. M., Jr.

    2002-01-01

    Temperature programmed reaction/desorption (TPR/D) studies were undertaken to characterize the surface chemistry which occurs between CCl 4 and the Fe 3O 4 (1 1 1) selvedge of single crystal α-Fe 2O 3 (0 0 0 1). Six separate desorption events are clearly observed and four desorbing species are identified: CCl 4, OCCl 2, C 2Cl 4 and FeCl 2. It is proposed that OCCl 2, CCl 4 and C 2Cl 4 are produced in reactions involving the same precursor, CCl 2. Three reaction paths compete for the CCl 2 precursor: oxygen atom abstraction (for OCCl 2), molecular recombinative desorption (for CCl 4) and associative desorption (for C 2Cl 4). During the TPR/D temperature ramp, the branching ratio is observed to depend upon temperature and the availability of reactive sites. The data are consistent with a rich site-dependent chemistry.

  18. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  19. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  20. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  1. Catalytic conversion reactions mediated by single-file diffusion in linear nanopores: hydrodynamic versus stochastic behavior.

    Science.gov (United States)

    Ackerman, David M; Wang, Jing; Wendel, Joseph H; Liu, Da-Jiang; Pruski, Marek; Evans, James W

    2011-03-21

    We analyze the spatiotemporal behavior of species concentrations in a diffusion-mediated conversion reaction which occurs at catalytic sites within linear pores of nanometer diameter. Diffusion within the pores is subject to a strict single-file (no passing) constraint. Both transient and steady-state behavior is precisely characterized by kinetic Monte Carlo simulations of a spatially discrete lattice-gas model for this reaction-diffusion process considering various distributions of catalytic sites. Exact hierarchical master equations can also be developed for this model. Their analysis, after application of mean-field type truncation approximations, produces discrete reaction-diffusion type equations (mf-RDE). For slowly varying concentrations, we further develop coarse-grained continuum hydrodynamic reaction-diffusion equations (h-RDE) incorporating a precise treatment of single-file diffusion in this multispecies system. The h-RDE successfully describe nontrivial aspects of transient behavior, in contrast to the mf-RDE, and also correctly capture unreactive steady-state behavior in the pore interior. However, steady-state reactivity, which is localized near the pore ends when those regions are catalytic, is controlled by fluctuations not incorporated into the hydrodynamic treatment. The mf-RDE partly capture these fluctuation effects, but cannot describe scaling behavior of the reactivity.

  2. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  3. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  4. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  5. Highly Durable Platinum Single-Atom Alloy Catalyst for Electrochemical Reactions

    DEFF Research Database (Denmark)

    Kim, Jiwhan; Roh, Chi-Woo; Sahoo, Suman Kalyan

    2018-01-01

    Single atomic Pt catalyst can offer efficient utilization of the expensive platinum and provide unique selectivity because it lacks ensemble sites. However, designing such a catalyst with high Pt loading and good durability is very challenging. Here, single atomic Pt catalyst supported on antimony...... functional theory calculations show that replacing Sb sites with Pt atoms in the bulk phase or at the surface of SbSn or ATO is energetically favorable. The Pt1/ATO shows superior activity and durability for formic acid oxidation reaction, compared to a commercial Pt/C catalyst. The single atomic Pt...... structure is retained even after a harsh durability test, which is performed by repeating cyclic voltammetry in the range of 0.05–1.4 V for 1800 cycles. A full cell is fabricated for direct formic acid fuel cell using the Pt1/ATO as an anode catalyst, and an order of magnitude higher cell power is obtained...

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  8. Kinetics of Single-Enzyme Reactions on Vesicles: Role of Substrate Aggregation

    Science.gov (United States)

    Zhdanov, Vladimir P.

    2015-03-01

    Enzymatic reactions occurring in vivo on lipid membranes can be influenced by various factors including macromolecular crowding in general and substrate aggregation in particular. In academic studies, the role of these factors can experimentally be clarified by tracking single-enzyme kinetics occurring on individual lipid vesicles. To extend the conceptual basis for such experiments, we analyze herein the corresponding kinetics mathematically with emphasis on the role of substrate aggregation. In general, the aggregation may occur on different length scales. Small aggregates may e.g. contain a few proteins or peptides while large aggregates may be mesoscopic as in the case of lipid domains which can be formed in the membranes composed of different lipids. We present a kinetic model describing comprehensively the effect of aggregation of the former type on the dependence of the reaction rate on substrate membrane concentration. The results obtained with physically reasonable parameters indicate that the aggregation-related deviations from the conventional Michaelis-Menten kinetics may be appreciable. Special Issue Comments: This theoretical article is focused on single-enzyme reactions occurring in parallel with substrate aggregation on individual vesicles. This subject is related to a few Special Issue articles concerning enzyme dynamics6,7 and function8 and mathematical aspects of stochastic kinetics.9

  9. Single-collision studies of hot atom energy transfer and chemical reaction

    International Nuclear Information System (INIS)

    Valentini, J.J.

    1991-01-01

    This report discusses research in the collision dynamics of translationally hot atoms, with funding with DOE for the project ''Single-Collision Studies of Hot Atom Energy Transfer and Chemical Reaction,'' Grant Number DE-FG03-85ER13453. The work reported here was done during the period September 9, 1988 through October 31, 1991. During this period this DOE-funded work has been focused on several different efforts: (1) experimental studies of the state-to-state dynamics of the H + RH → H 2 R reactions where RH is CH 4 , C 2 H 6 , or C 3 H 8 , (2) theoretical (quasiclassical trajectory) studies of hot hydrogen atom collision dynamics, (3) the development of photochemical sources of translationally hot molecular free radicals and characterization of the high resolution CARS spectroscopy of molecular free radicals, (4) the implementation of stimulated Raman excitation (SRE) techniques for the preparation of vibrationally state-selected molecular reactants

  10. Force-induced chemical reactions on the metal centre in a single metalloprotein molecule

    Science.gov (United States)

    Zheng, Peng; Arantes, Guilherme M.; Field, Martin J.; Li, Hongbin

    2015-01-01

    Metalloproteins play indispensable roles in biology owing to the versatile chemical reactivity of metal centres. However, studying their reactivity in many metalloproteins is challenging, as protein three-dimensional structure encloses labile metal centres, thus limiting their access to reactants and impeding direct measurements. Here we demonstrate the use of single-molecule atomic force microscopy to induce partial unfolding to expose metal centres in metalloproteins to aqueous solution, thus allowing for studying their chemical reactivity in aqueous solution for the first time. As a proof-of-principle, we demonstrate two chemical reactions for the FeS4 centre in rubredoxin: electrophilic protonation and nucleophilic ligand substitution. Our results show that protonation and ligand substitution result in mechanical destabilization of the FeS4 centre. Quantum chemical calculations corroborated experimental results and revealed detailed reaction mechanisms. We anticipate that this novel approach will provide insights into chemical reactivity of metal centres in metalloproteins under biologically more relevant conditions. PMID:26108369

  11. Single-particle states in ^112Cd probed with the ^111Cd(d,p) reaction

    Science.gov (United States)

    Garrett, P. E.; Jamieson, D.; Demand, G. A.; Finlay, P.; Green, K. L.; Leach, K. G.; Phillips, A. A.; Sumithrarachchi, C. S.; Svensson, C. E.; Triambak, S.; Wong, J.; Ball, G. C.; Hertenberger, R.; Wirth, H.-F.; Kr"Ucken, R.; Faestermann, T.

    2009-10-01

    As part of a program of detailed spectroscopy of the Cd isotopes, the single-particle neutron states in ^112Cd have been probed with the ^111Cd(d,p) reaction. Beams of polarized 22 MeV deuterons, obtained from the LMU/TUM Tandem Accelerator, bombarded a target of ^111Cd. The protons from the reaction, corresponding to excitation energies up to 3 MeV in ^112Cd, were momentum analyzed with the Q3D spectrograph. Cross sections and analyzing powers were fit to results of DWBA calculations, and spectroscopic factors were determined. The results from the experiment, and implications for the structure of ^112Cd, will be presented.

  12. Studying Chemical Reactions, One Bond at a Time, with Single Molecule AFM Techniques

    Science.gov (United States)

    Fernandez, Julio M.

    2008-03-01

    The mechanisms by which mechanical forces regulate the kinetics of a chemical reaction are unknown. In my lecture I will demonstrate how we use single molecule force-clamp spectroscopy and protein engineering to study the effect of force on the kinetics of thiol/disulfide exchange. Reduction of disulfide bond via the thiol/disulfide exchange chemical reaction is crucial in regulating protein function and is of common occurrence in mechanically stressed proteins. While reduction is thought to proceed through a substitution nucleophilic bimolecular (SN2) reaction, the role of a mechanical force in modulating this chemical reaction is unknown. We apply a constant stretching force to single engineered disulfide bonds and measure their rate of reduction by dithiothreitol (DTT). We find that while the reduction rate is linearly dependent on the concentration of DTT, it is exponentially dependent on the applied force, increasing 10-fold over a 300 pN range. This result predicts that the disulfide bond lengthens by 0.34 å at the transition state of the thiol/disulfide exchange reaction. In addition to DTT, we also study the reduction of the engineered disulfide bond by the E. coli enzyme thioredoxin (Trx). Thioredoxins are enzymes that catalyze disulfide bond reduction in all organisms. As before, we apply a mechanical force in the range of 25-450 pN to the engineered disulfide bond substrate and monitor the reduction of these bonds by individual enzymes. In sharp contrast with the data obtained with DTT, we now observe two alternative forms of the catalytic reaction, the first requiring a reorientation of the substrate disulfide bond, causing a shortening of the substrate polypeptide by 0.76±0.07 å, and the second elongating the substrate disulfide bond by 0.21±0.01 å. These results support the view that the Trx active site regulates the geometry of the participating sulfur atoms, with sub-ångström precision, in order to achieve efficient catalysis. Single molecule

  13. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  14. Structure around the island of inversion with single-neutron knockout reactions at GANIL

    CERN Document Server

    Fernández-Domínguez, B; Patterson, N; Thomas, J S; Orr, N; Chartier, M; Catford, W; Achouri, N L; Angélique, J-C; Ashwood, N I; Banu, A; Bastin,B; Brown, J; Borcea, R; Franchoo, S; Freer, M; Gaudefroy, L; Laurent, B; Labiche, M; Lemmon, R C; Negoita, F; Paschalis, S; Paul, E S; Petri, M; Roussel-Chomaz, P; Staniou, M; Taylor, M J; Trache, L

    2010-01-01

    The nuclear structure of the 31Mg nucleus has been studied with the singleneutron knockout reaction. We report on the preliminary results of an experiment performed with the EXOGAM array coupled, for the first time, to the SPEG spectrometer at GANIL.We present a provisional result for the inclusive single-neutron knockout cross section of σinc= 90(5) mb. Preliminary exclusive cross sections for the measured bound states, including the ground state, are also presented. Finally, preliminary longitudinal momentum distributions for the ground state and first excited state are also shown. These results are compared to Monte Carlo Shell-Model calculations in the sd-pf region.

  15. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  16. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  17. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  18. Ligand-tailored single-site silica supported titanium catalysts: Synthesis, characterization and towards cyanosilylation reaction

    International Nuclear Information System (INIS)

    Xu, Wei; Li, Yani; Yu, Bo; Yang, Jindou; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    A successive anchoring of Ti(NMe 2 ) 4 , cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on silica was conducted by SOMC strategy in moderate conditions. The silica, monitored by in-situ Fourier transform infrared spectroscopy (in-situ FT-IR), was pretreated at different temperatures (200, 500 and 800 °C). The ligand tailored silica-supported titanium complexes were characterized by in-situ FT-IR, 13 C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) and elemental analysis in detail, verifying that the surface titanium species are single sited. The catalytic activity of the ligand tailored single-site silica supported titanium complexes was evaluated by a cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the dehydroxylation temperatures of silica and the configuration of the ligands. - Graphical abstract: The ligand-tailored silica supported “single site” titanium complexes were synthesized by SOMC strategy and fully characterized. Their catalytic activity were evaluated by benzaldehyde silylcyanation. - Highlights: • Single-site silica supported Ti active species was prepared by SOMC technique. • O-donor ligand tailored Ti surface species was synthesized. • The surface species was characterized by XPS, 13 C CP-MAS NMR, XANES etc. • Catalytic activity of the Ti active species in silylcyanation reaction was evaluated

  19. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  20. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  1. Spectroscopic Factors from the Single Neutron Transfer Reaction 111Cd(d,p)112Cd

    Science.gov (United States)

    Jamieson, D. S.; Garrett, P. E.; Demand, G. A.; Finlay, P.; Green, K. L.; Leach, K. G.; Phillips, A. A.; Svensson, C. E.; Sumithrarachchi, C. S.; Triambak, S.; Wong, J.; Ball, G.; Faestermann, T.; Krücken, R.; Hertenberger, R.; Wirth, H.-F.

    2013-03-01

    The cadmium isotopes have been cited as excellent examples of vibrational nuclei for decades, with multi-phonon quadrupole, quadrupole-octupole, and mixed-symmetry states proposed. From a variety of experimental studies, a large amount of spectroscopic data has been obtained, recently focused on γ-ray studies. In the present work, the single-particle structure of 112Cd has been investigated using the 111Cd(ěcd, p)112Cd reaction. The investigation was carried out using a 22 MeV beam of polarized deuterons obtained from the Maier-Leibnitz Laboratory at Garching, Germany. The reaction ejectiles were momentum analyzed using a Q3D spectrograph, and 115 levels have been identified up to 4.2 MeV of excitation energy. Spin-parity has been assigned to each analyzed level, and angular distributions for the reaction cross sections and analyzing powers were obtained. Many additional levels have been observed compared with the previous (d,p) study performed with 8 MeV deuterons,1 including strongly populated 5- and 6- states. The former was previously assigned as a member of the quadrupole-octupole quintuplet, based on a strongly enhanced B(E2) value to the 3- state, but is now re-assigned as being predominately s1/2 ⊗ h11/2 configuration.

  2. Microfluidic Fabrication of Porous Polymer Microspheres: Dual Reactions in Single Droplets

    KAUST Repository

    Gong, Xiuqing

    2009-06-16

    We report the microfluidic fabrication of macroporous polymer microspheres via the simultaneous reactions within single droplets, induced by LTV irradiation. The aqueous phase of the reaction is the decomposition of H 2O2 to yield oxygen, whereas the organic phase is the polymerization of NO A 61, ethylene glycol dimethacrylate (EGDMA), and tri (propylene glycol) diacrylate (TPGDA) precursors. We first used a liquid polymer precursor to encapsulate a multiple number of magnetic Fe3O 4 colloidal suspension (MCS) droplets in a core-shell structure, for the purpose of studying the number of such encapsulated droplets that can be reliably controlled through the variation of flow rates. It was found that the formation of one shell with one, two, three, or more encapsulated droplets is possible. Subsequently, the H2O2 solution was encapsulated in the same way, after which we investigated its decomposition under UV irradiation, which simultaneously induces the polymerization of the encapsulating shell. Because the H2O2 decomposition leads to the release of oxygen, porous microspheres were obtained from a combined H2O2 decomposition/polymer precursor polymerization reaction. The multiplicity of the initially encapsulated H2O 2 droplets ensures the homogeneous distribution of the pores. The pores inside the micrometer-sized spheres range from several micrometers to tens of micrometers, and the maximum internal void volume fraction can attain 70%, similar to that of high polymerized high internal phase emulsion (polyHIPE). © 2009 American Chemical Society.

  3. Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

    Science.gov (United States)

    Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

    2012-04-01

    Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  5. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  6. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  7. Ligand-tailored single-site silica supported titanium catalysts: Synthesis, characterization and towards cyanosilylation reaction

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Li, Yani; Yu, Bo; Yang, Jindou; Zhang, Ying; Chen, Xi; Zhang, Guofang, E-mail: gfzhang@snnu.edu.cn; Gao, Ziwei, E-mail: zwgao@snnu.edu.cn

    2015-01-15

    A successive anchoring of Ti(NMe{sub 2}){sub 4}, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on silica was conducted by SOMC strategy in moderate conditions. The silica, monitored by in-situ Fourier transform infrared spectroscopy (in-situ FT-IR), was pretreated at different temperatures (200, 500 and 800 °C). The ligand tailored silica-supported titanium complexes were characterized by in-situ FT-IR, {sup 13}C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) and elemental analysis in detail, verifying that the surface titanium species are single sited. The catalytic activity of the ligand tailored single-site silica supported titanium complexes was evaluated by a cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the dehydroxylation temperatures of silica and the configuration of the ligands. - Graphical abstract: The ligand-tailored silica supported “single site” titanium complexes were synthesized by SOMC strategy and fully characterized. Their catalytic activity were evaluated by benzaldehyde silylcyanation. - Highlights: • Single-site silica supported Ti active species was prepared by SOMC technique. • O-donor ligand tailored Ti surface species was synthesized. • The surface species was characterized by XPS, {sup 13}C CP-MAS NMR, XANES etc. • Catalytic activity of the Ti active species in silylcyanation reaction was evaluated.

  8. Quasifree (p , 2 p ) Reactions on Oxygen Isotopes: Observation of Isospin Independence of the Reduced Single-Particle Strength

    Science.gov (United States)

    Atar, L.; Paschalis, S.; Barbieri, C.; Bertulani, C. A.; Díaz Fernández, P.; Holl, M.; Najafi, M. A.; Panin, V.; Alvarez-Pol, H.; Aumann, T.; Avdeichikov, V.; Beceiro-Novo, S.; Bemmerer, D.; Benlliure, J.; Boillos, J. M.; Boretzky, K.; Borge, M. J. G.; Caamaño, M.; Caesar, C.; Casarejos, E.; Catford, W.; Cederkall, J.; Chartier, M.; Chulkov, L.; Cortina-Gil, D.; Cravo, E.; Crespo, R.; Dillmann, I.; Elekes, Z.; Enders, J.; Ershova, O.; Estrade, A.; Farinon, F.; Fraile, L. M.; Freer, M.; Galaviz Redondo, D.; Geissel, H.; Gernhäuser, R.; Golubev, P.; Göbel, K.; Hagdahl, J.; Heftrich, T.; Heil, M.; Heine, M.; Heinz, A.; Henriques, A.; Hufnagel, A.; Ignatov, A.; Johansson, H. T.; Jonson, B.; Kahlbow, J.; Kalantar-Nayestanaki, N.; Kanungo, R.; Kelic-Heil, A.; Knyazev, A.; Kröll, T.; Kurz, N.; Labiche, M.; Langer, C.; Le Bleis, T.; Lemmon, R.; Lindberg, S.; Machado, J.; Marganiec-Gałązka, J.; Movsesyan, A.; Nacher, E.; Nikolskii, E. Y.; Nilsson, T.; Nociforo, C.; Perea, A.; Petri, M.; Pietri, S.; Plag, R.; Reifarth, R.; Ribeiro, G.; Rigollet, C.; Rossi, D. M.; Röder, M.; Savran, D.; Scheit, H.; Simon, H.; Sorlin, O.; Syndikus, I.; Taylor, J. T.; Tengblad, O.; Thies, R.; Togano, Y.; Vandebrouck, M.; Velho, P.; Volkov, V.; Wagner, A.; Wamers, F.; Weick, H.; Wheldon, C.; Wilson, G. L.; Winfield, J. S.; Woods, P.; Yakorev, D.; Zhukov, M.; Zilges, A.; Zuber, K.; R3B Collaboration

    2018-01-01

    Quasifree one-proton knockout reactions have been employed in inverse kinematics for a systematic study of the structure of stable and exotic oxygen isotopes at the R3B /LAND setup with incident beam energies in the range of 300 - 450 MeV /u . The oxygen isotopic chain offers a large variation of separation energies that allows for a quantitative understanding of single-particle strength with changing isospin asymmetry. Quasifree knockout reactions provide a complementary approach to intermediate-energy one-nucleon removal reactions. Inclusive cross sections for quasifree knockout reactions of the type O A (p ,2 p )N-1A have been determined and compared to calculations based on the eikonal reaction theory. The reduction factors for the single-particle strength with respect to the independent-particle model were obtained and compared to state-of-the-art ab initio predictions. The results do not show any significant dependence on proton-neutron asymmetry.

  9. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  10. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  11. Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)

    2010-03-15

    With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

  12. Single particle transfer reactions: what can they tell us about vibrational states

    International Nuclear Information System (INIS)

    Hering, W.R.

    1975-01-01

    The topic discussed concerns single particle transfer reactions (SPTR) which are, in general, used to study SP states. However, good SP states are rare objects in nature and people who try to look for them have often to settle with something less than ideal. Indeed the picture of a pure SP state is physically not even reasonable. It means that a nucleon is moving around a core nucleus which stays in its ground state: a process which one could call equivalent to elastic scattering of a nucleon which is not free but rather in a bound state. However it is shown that inelastic scattering is a very strong competitor to elastic scattering if the nucleus possesses states of high collectivity. Thus one would expect inelastic scattering to happen also while the nucleon is bound. This is a very intuitive picture of what is called the fragmentation of SP states. A final state psi sub(B) is populated by the transfer reaction A + a → B + b where psi sub(B) = α 1 phi 1 phi sub(A)(0) + α 2 phi 2 phi sub(A)(lambda). Hence the population of psi sub(B) automatically involves the collective state phi sub(A)(lambda). A discussion of how one can get information about phi sub(A)(lambda) out of the experimental data is given. (Auth.)

  13. Prospects of Optical Single Atom Detection in Noble Gas Solids for Measurements of Rare Nuclear Reactions

    Science.gov (United States)

    Singh, Jaideep; Bailey, Kevin G.; Lu, Zheng-Tian; Mueller, Peter; O'Connor, Thomas P.; Xu, Chen-Yu; Tang, Xiaodong

    2013-04-01

    Optical detection of single atoms captured in solid noble gas matrices provides an alternative technique to study rare nuclear reactions relevant to nuclear astrophysics. I will describe the prospects of applying this approach for cross section measurements of the ^22Ne,,),25Mg reaction, which is the crucial neutron source for the weak s process inside of massive stars. Noble gas solids are a promising medium for the capture, detection, and manipulation of atoms and nuclear spins. They provide stable and chemically inert confinement for a wide variety of guest species. Because noble gas solids are transparent at optical wavelengths, the guest atoms can be probed using lasers. We have observed that ytterbium in solid neon exhibits intersystem crossing (ISC) which results in a strong green fluorescence (546 nm) under excitation with blue light (389 nm). Several groups have observed ISC in many other guest-host pairs, notably magnesium in krypton. Because of the large wavelength separation of the excitation light and fluorescence light, optical detection of individual embedded guest atoms is feasible. This work is supported by DOE, Office of Nuclear Physics, under contract DE-AC02-06CH11357.

  14. Monitoring mass transport in heterogeneously catalyzed reactions by field-gradient NMR for assessing reaction efficiency in a single pellet

    Science.gov (United States)

    Buljubasich, L.; Blümich, B.; Stapf, S.

    2011-09-01

    An important aspect in assessing the performance of a catalytically active reactor is the accessibility of the reactive sites inside the individual pellets, and the mass transfer of reactants and products to and from these sites. Optimal design often requires a suitable combination of micro- and macropores in order to facilitate mass transport inside the pellet. In an exothermic reaction, fluid exchange between the pellet and the surrounding medium is enhanced by convection, and often by the occurrence of gas bubbles. Determining mass flow in the vicinity of a pellet thus represents a parameter for quantifying the reaction efficiency and its dependence on time or external reaction conditions. Field gradient Nuclear Magnetic Resonance (NMR) methods are suggested as a tool for providing parameters sensitive to this mass flow in a contact-free and non-invasive way. For the example of bubble-forming hydrogen peroxide decomposition in an alumina pellet, the dependence of the mean-squared displacement of fluid molecules on spatial direction, observation time and reaction time is presented, and multi-pulse techniques are employed in order to separate molecular displacements from coherent and incoherent motion on the timescale of the experiment. The reaction progress is followed until the complete decomposition of H 2O 2.

  15. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per

    2012-01-01

    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  16. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  17. Reaction

    African Journals Online (AJOL)

    abp

    19 oct. 2017 ... Reaction to Mohamed Said Nakhli et al. concerning the article: "When the axillary block remains the only alternative in a 5 year old child". .... Bertini L1, Savoia G, De Nicola A, Ivani G, Gravino E, Albani A et al ... 2010;7(2):101-.

  18. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  19. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  20. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  1. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  2. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  3. Applications of a single-molecule detection in early disease diagnosis and enzymatic reaction study

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jiangwei [Iowa State Univ., Ames, IA (United States)

    2008-01-01

    Various single-molecule techniques were utilized for ultra-sensitive early diagnosis of viral DNA and antigen and basic mechanism study of enzymatic reactions. DNA of human papilloma virus (HPV) served as the screening target in a flow system. Alexa Fluor 532 (AF532) labeled single-stranded DNA probes were hybridized to the target HPV-16 DNA in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell and had a linear dynamic range of over 6 orders of magnitude. In the dual-color mode, fluorescence resonance energy transfer (FRET) was employed to achieve zero false-positive count. We also showed that DNA extracts from Pap test specimens did not interfere with the system. A surface-based method was used to improve the throughput of the flow system. HPV-16 DNA was hybridized to probes on a glass surface and detected with a total internal reflection fluorescence (TIRF) microscope. In the single-probe mode, the whole genome and target DNA were fluorescently labeled before hybridization, and the detection limit is similar to the flow system. In the dual-probe mode, a second probe was introduced. The linear dynamic range covers 1.44-7000 copies/cell, which is typical of early infection to near-cancer stages. The dual-probe method was tested with a crudely prepared sample. Even with reduced hybridization efficiency caused by the interference of cellular materials, we were still able to differentiate infected cells from healthy cells. Detection and quantification of viral antigen with a novel single-molecule immunosorbent assay (SMISA) was achieved. Antigen from human immunodeficiency virus type 1(HIV-1) was chosen to be the target in this study. The target was sandwiched between a monoclonal capture antibody and a

  4. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  5. Risk Evaluation of Endoscopic Retrograde Cholangiopancreatography-Related Contrast Media Allergic-Like Reaction: A Single Centre Experience

    Directory of Open Access Journals (Sweden)

    Félix Trottier-Tellier

    2018-01-01

    Full Text Available Background and Aims. Few cases of endoscopic retrograde cholangiopancreatography- (ERCP- related contrast media (CM adverse reactions have been reported in the current literature. There is a lack of standardisation in practice regarding premedication prophylaxis for at-risk patients undergoing ERCP and there are few data to guide the practitioners. Our goal is to evaluate the risk of CM adverse reaction in a group of patients with a past history of allergic-like reaction to iodine product undergoing ERCP. Methods. A retrospective chart review study was performed of patients who underwent ERCP at our single centre from January 2010 to December 2015. Results. 2295 ERCPs were performed among 1766 patients. No anaphylactoid or severe adverse reaction occurred. One (0.04% ERCP-related CM benign reaction was reported in a patient known for penicillin allergy. Among 127 ERCPs performed on patients with a prior adverse reaction to iodine, 121 procedures were done without and 6 with a premedication prophylaxis. In both groups, no ERCP-related CM reaction occurred. Conclusions. To our knowledge, we report the largest cohort of iodine allergic patients undergoing ERCP ever published. These results suggest that ERCP-related CM adverse reactions are very rare even among patients at risk for CM reaction.

  6. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  7. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  8. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Science.gov (United States)

    Zhu, Jie; Feng, Xiaolu; Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  9. The Reaction Mechanism of Claisen Rearrangement Obtained by Transition State Spectroscopy and Single Direct-Dynamics Trajectory

    Directory of Open Access Journals (Sweden)

    Takayoshi Kobayashi

    2013-02-01

    Full Text Available Chemical bond breaking and formation during chemical reactions can be observed using “transition state spectroscopy”. Comparing the measurement result of the transition state spectroscopy with the simulation result of single direct-dynamics trajectory, we have elucidated the reaction dynamics of Claisen rearrangement of allyl vinyl ether. Observed the reaction of the neat sample liquid, we have estimated the time constants of transformation from straight-chain structure to aromatic-like six-membered ring structure forming the C1-C6 bond. The result clarifies that the reaction proceeds via three steps taking longer time than expected from the gas phase calculation. This finding provides new hypothesis and discussions, helping the development of the field of reaction mechanism analysis.

  10. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    Science.gov (United States)

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  11. Spectroscopic Factors from the Single Neutron Pickup Reaction ^64Zn(d,t)

    Science.gov (United States)

    Leach, Kyle; Garrett, P. E.; Ball, G. C.; Bangay, J. C.; Bianco, L.; Demand, G. A.; Faestermann, T.; Finlay, P.; Green, K. L.; Hertenberger, R.; Krücken, R.; Phillips, A. A.; Rand, E. T.; Sumithrarachchi, C. S.; Svensson, C. E.; Triambak, S.; Wirth, H.-F.; Wong, J.

    2009-10-01

    A great deal of attention has recently been paid towards high-precision superallowed β-decay Ft values. With the availability of extremely high-precision (<0.1%) experimental data, precision on the individual Ft values are now dominated by the ˜1% theoretical corrections^[1]. This limitation is most evident in heavier superallowed nuclei (e.g. ^62Ga) where the isospin-symmetry-breaking (ISB) correction calculations become more difficult due to the truncated model space. Experimental spectroscopic factors for these nuclei are important for the identification of the relevant orbitals that should be included in the model space of the calculations. Motivated by this need, the single-nucleon transfer reaction ^64Zn(d,t)^63Zn was conducted at the Maier-Leibnitz-Laboratory (MLL) of TUM/LMU in Munich, Germany, using a 22 MeV polarized deuteron beam from the tandem Van de Graaff accelerator and the TUM/LMU Q3D magnetic spectrograph, with angular distributions from 10^o to 60^o. Results from this experiment will be presented and implications for calculations of ISB corrections in the superallowed &+circ; decay of ^62Ga will be discussed.^[1] I.S. Towner and J.C. Hardy, Phys. Rev. C 77, 025501 (2008).

  12. Unveiling the high-activity origin of single-atom iron catalysts for oxygen reduction reaction.

    Science.gov (United States)

    Yang, Liu; Cheng, Daojian; Xu, Haoxiang; Zeng, Xiaofei; Wan, Xin; Shui, Jianglan; Xiang, Zhonghua; Cao, Dapeng

    2018-06-26

    It is still a grand challenge to develop a highly efficient nonprecious-metal electrocatalyst to replace the Pt-based catalysts for oxygen reduction reaction (ORR). Here, we propose a surfactant-assisted method to synthesize single-atom iron catalysts (SA-Fe/NG). The half-wave potential of SA-Fe/NG is only 30 mV less than 20% Pt/C in acidic medium, while it is 30 mV superior to 20% Pt/C in alkaline medium. Moreover, SA-Fe/NG shows extremely high stability with only 12 mV and 15 mV negative shifts after 5,000 cycles in acidic and alkaline media, respectively. Impressively, the SA-Fe/NG-based acidic proton exchange membrane fuel cell (PEMFC) exhibits a high power density of 823 mW cm -2 Combining experimental results and density-functional theory (DFT) calculations, we further reveal that the origin of high-ORR activity of SA-Fe/NG is from the Fe-pyrrolic-N species, because such molecular incorporation is the key, leading to the active site increase in an order of magnitude which successfully clarifies the bottleneck puzzle of why a small amount of iron in the SA-Fe catalysts can exhibit extremely superior ORR activity.

  13. Single hole spectroscopic strength in 98Ru through the 99Ru(d,t) reaction

    International Nuclear Information System (INIS)

    Rodrigues, M.R.D.; Borello-Lewin, T.; Horodynski-Matsushigue, L.B.; Duarte, J.L.M.; Rodrigues, C.L.; Barbosa, M.D.L.; Silva, G.B. da; Ukita, G.M.

    2002-01-01

    The 99 Ru(d,t) 98 Ru reaction was measured for the first time at 16 MeV incident energy with the Sao Paulo Pelletron-Enge-spectrograph facility employing the nuclear emulsion technique. In all, up to 3.5 MeV, 23 levels were detected, eight of them new; angular distributions are presented for all of them. Least squares fits of distorted wave Born approximation one-neutron pickup predictions to the rather well structured experimental angular distributions enabled the determination of l transfers and of the corresponding spectroscopic factors for 19 of these states, some being tentative attributions. Only transfers of l=0, 2, and 4 were observed. Several states were populated through single l transfers. A pure l=2 transfer is associated with the 2 1 + level and with several other states which are considered collective, as well as with the (4 + ) state at 2.277 MeV, which presents the highest spectroscopic strength. Considering five valence neutrons above the N=50 core, only 41% of the spectroscopic strength expected for 99 Ru was detected

  14. A nonlocal and periodic reaction-diffusion-advection model of a single phytoplankton species.

    Science.gov (United States)

    Peng, Rui; Zhao, Xiao-Qiang

    2016-02-01

    In this article, we are concerned with a nonlocal reaction-diffusion-advection model which describes the evolution of a single phytoplankton species in a eutrophic vertical water column where the species relies solely on light for its metabolism. The new feature of our modeling equation lies in that the incident light intensity and the death rate are assumed to be time periodic with a common period. We first establish a threshold type result on the global dynamics of this model in terms of the basic reproduction number R0. Then we derive various characterizations of R0 with respect to the vertical turbulent diffusion rate, the sinking or buoyant rate and the water column depth, respectively, which in turn give rather precise conditions to determine whether the phytoplankton persist or become extinct. Our theoretical results not only extend the existing ones for the time-independent case, but also reveal new interesting effects of the modeling parameters and the time-periodic heterogeneous environment on persistence and extinction of the phytoplankton species, and thereby suggest important implications for phytoplankton growth control.

  15. Effect of field size on the reaction of pig skin to single doses of X rays

    Energy Technology Data Exchange (ETDEWEB)

    Hopewell, J W; Young, C M.A. [Churchill Hospital, Oxford (UK)

    1982-05-01

    The importance of the size of the treatment area for the response of the skin to radiation has been studied in the pig. The responses of skin areas of 16 cm/sup 2/ (4 x 4 cm) and 64cm/sup 2/ (16 x 4 cm) were compared after single doses of X rays. In the initial 3-9-week period after irradiation the severity of the erythema reaction, which is associated with epidermal cell death, was not influenced by the area of skin irradiated. For the later dermal response (10-16 weeks) a similar result was obtained. The dose required to produce dermal necrosis in 50% of the fields treated (ED/sub 50/) was approximately 2070 cGy for both field sizes. Additional studies have shown that the ED/sub 50/ for dermal necrosis was not influenced by the age of animals at the time of irradiation. This was despite considerable differences in the vascular density and blood flow in pig skin with increasing age. The apparent contradiction between the results of this experimental study in the pig, which shows no effect of field size, and currently accepted clinical practice is discussed.

  16. Ground reaction forces and knee kinetics during single and repeated badminton lunges.

    Science.gov (United States)

    Lam, Wing Kai; Ding, Rui; Qu, Yi

    2017-03-01

    Repeated movement (RM) lunge that frequently executed in badminton might be used for footwear evaluation. This study examined the influence of single movement (SM) and RM lunges on the ground reaction forces (GRFs) and knee kinetics during the braking phase of a badminton lunge step. Thirteen male university badminton players performed left-forward lunges in both SM and RM sessions. Force platform and motion capturing system were used to measure GRFs and knee kinetics variables. Paired t-test was performed to determine any significant differences between SM and RM lunges regarding mean and coefficient of variation (CV) in each variable. The kinetics results indicated that compared to SM lunges, the RM lunges had shorter contact time and generated smaller maximum loading rate of impact force, peak knee anterior-posterior force, and peak knee sagittal moment but generated larger peak horizontal resultant forces (Ps < 0.05). Additionally, the RM lunges had lower CV for peak knee medial-lateral and vertical forces (Ps < 0.05). These results suggested that the RM testing protocols had a distinct loading response and adaptation pattern during lunge and that the RM protocol showed higher within-trial reliability, which may be beneficial for the knee joint loading evaluation under different interventions.

  17. Reactivity of Single-Walled Carbon Nanotubes in the Diels-Alder Cycloaddition Reaction: Distortion-Interaction Analysis along the Reaction Pathway.

    Science.gov (United States)

    Li, Yingzi; Osuna, Sílvia; Garcia-Borràs, Marc; Qi, Xiaotian; Liu, Song; Houk, Kendall N; Lan, Yu

    2016-08-26

    Diels-Alder cycloaddition is one of the most powerful tools for the functionalization of single-walled carbon nanotubes (SWCNTs). Density functional theory at the B3-LYP level of theory has been used to investigate the reactivity of different-diameter SWCNTs (4-9,5) in Diels-Alder reactions with 1,3-butadiene; the reactivity was found to decrease with increasing SWCNT diameter. Distortion/interaction analysis along the whole reaction pathway was found to be a better way to explore the reactivity of this type of reaction. The difference in interaction energy along the reaction pathway is larger than that of the corresponding distortion energy. However, the distortion energy plots for these reactions show the same trend. Therefore, the formation of the transition state can be determined from the interaction energy. A lower interaction energy leads to an earlier transition state, which indicates a lower activation energy. The computational results also indicate that the original distortion of the SWCNTs leads to an increase in the reactivity of the SWCNTs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  19. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  20. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  1. Reaction-time-resolved measurements of laser-induced fluorescence in a shock tube with a single laser pulse

    Science.gov (United States)

    Zabeti, S.; Fikri, M.; Schulz, C.

    2017-11-01

    Shock tubes allow for the study of ultra-fast gas-phase reactions on the microsecond time scale. Because the repetition rate of the experiments is low, it is crucial to gain as much information as possible from each individual measurement. While reaction-time-resolved species concentration and temperature measurements with fast absorption methods are established, conventional laser-induced fluorescence (LIF) measurements with pulsed lasers provide data only at a single reaction time. Therefore, fluorescence methods have rarely been used in shock-tube diagnostics. In this paper, a novel experimental concept is presented that allows reaction-time-resolved LIF measurements with one single laser pulse using a test section that is equipped with several optical ports. After the passage of the shock wave, the reactive mixture is excited along the center of the tube with a 266-nm laser beam directed through a window in the end wall of the shock tube. The emitted LIF signal is collected through elongated sidewall windows and focused onto the entrance slit of an imaging spectrometer coupled to an intensified CCD camera. The one-dimensional spatial resolution of the measurement translates into a reaction-time-resolved measurement while the species information can be gained from the spectral axis of the detected two-dimensional image. Anisole pyrolysis was selected as the benchmark reaction to demonstrate the new apparatus.

  2. Evaluation of canine adverse food reactions by patch testing with single proteins, single carbohydrates and commercial foods.

    Science.gov (United States)

    Johansen, Cornelia; Mariani, Claire; Mueller, Ralf S

    2017-10-01

    Adverse food reaction (AFR) is an important differential diagnosis for the pruritic dog. It is usually diagnosed by feeding an elimination diet with a novel protein and carbohydrate source for eight weeks followed by subsequent food provocation. A previous study demonstrated that patch testing dogs with foods had a high sensitivity and negative predictability for selection of elimination diet ingredients. The aim of this study was to investigate patch testing with proteins, carbohydrates and dry commercial dog food in dogs to determine whether there was value in patch testing to aid the diagnosis of canine adverse food reaction. Twenty five privately owned dogs, with confirmed AFR, underwent provocation trials with selected food antigens and patch testing. For proteins, carbohydrates and dry dog food the sensitivity of patch testing was 100%, 70% and 22.2%, respectively; the negative predictive values of patch testing were 100%, 79% and 72%. The positive predictive values of patch testing for proteins and carbohydrates were 75% and 74%, respectively. This study confirmed that patch testing may be useful for the selection of a suitable protein source for an elimination diet in dogs with suspected AFR, but not as a diagnostic tool for canine AFR. Results for proteins are more reliable than for carbohydrates and the majority of positive patch test reactions were observed with raw protein. Patch testing with commercial dog food does not seem to be useful. © 2017 ESVD and ACVD.

  3. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  4. Fast and quantitative differentiation of single-base mismatched DNA by initial reaction rate of catalytic hairpin assembly.

    Science.gov (United States)

    Li, Chenxi; Li, Yixin; Xu, Xiao; Wang, Xinyi; Chen, Yang; Yang, Xiaoda; Liu, Feng; Li, Na

    2014-10-15

    The widely used catalytic hairpin assembly (CHA) amplification strategy generally needs several hours to accomplish one measurement based on the prevailingly used maximum intensity detection mode, making it less practical for assays where high throughput or speed is desired. To make the best use of the kinetic specificity of toehold domain for circuit reaction initiation, we developed a mathematical model and proposed an initial reaction rate detection mode to quantitatively differentiate the single-base mismatch. Using the kinetic mode, assay time can be reduced substantially to 10 min for one measurement with the comparable sensitivity and single-base mismatch differentiating ability as were obtained by the maximum intensity detection mode. This initial reaction rate based approach not only provided a fast and quantitative differentiation of single-base mismatch, but also helped in-depth understanding of the CHA system, which will be beneficial to the design of highly sensitive and specific toehold-mediated hybridization reactions. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Quasifree (p, 2p) Reactions on Oxygen Isotopes: Observation of Isospin Independence of the Reduced Single-Particle Strength.

    Science.gov (United States)

    Atar, L; Paschalis, S; Barbieri, C; Bertulani, C A; Díaz Fernández, P; Holl, M; Najafi, M A; Panin, V; Alvarez-Pol, H; Aumann, T; Avdeichikov, V; Beceiro-Novo, S; Bemmerer, D; Benlliure, J; Boillos, J M; Boretzky, K; Borge, M J G; Caamaño, M; Caesar, C; Casarejos, E; Catford, W; Cederkall, J; Chartier, M; Chulkov, L; Cortina-Gil, D; Cravo, E; Crespo, R; Dillmann, I; Elekes, Z; Enders, J; Ershova, O; Estrade, A; Farinon, F; Fraile, L M; Freer, M; Galaviz Redondo, D; Geissel, H; Gernhäuser, R; Golubev, P; Göbel, K; Hagdahl, J; Heftrich, T; Heil, M; Heine, M; Heinz, A; Henriques, A; Hufnagel, A; Ignatov, A; Johansson, H T; Jonson, B; Kahlbow, J; Kalantar-Nayestanaki, N; Kanungo, R; Kelic-Heil, A; Knyazev, A; Kröll, T; Kurz, N; Labiche, M; Langer, C; Le Bleis, T; Lemmon, R; Lindberg, S; Machado, J; Marganiec-Gałązka, J; Movsesyan, A; Nacher, E; Nikolskii, E Y; Nilsson, T; Nociforo, C; Perea, A; Petri, M; Pietri, S; Plag, R; Reifarth, R; Ribeiro, G; Rigollet, C; Rossi, D M; Röder, M; Savran, D; Scheit, H; Simon, H; Sorlin, O; Syndikus, I; Taylor, J T; Tengblad, O; Thies, R; Togano, Y; Vandebrouck, M; Velho, P; Volkov, V; Wagner, A; Wamers, F; Weick, H; Wheldon, C; Wilson, G L; Winfield, J S; Woods, P; Yakorev, D; Zhukov, M; Zilges, A; Zuber, K

    2018-02-02

    Quasifree one-proton knockout reactions have been employed in inverse kinematics for a systematic study of the structure of stable and exotic oxygen isotopes at the R^{3}B/LAND setup with incident beam energies in the range of 300-450  MeV/u. The oxygen isotopic chain offers a large variation of separation energies that allows for a quantitative understanding of single-particle strength with changing isospin asymmetry. Quasifree knockout reactions provide a complementary approach to intermediate-energy one-nucleon removal reactions. Inclusive cross sections for quasifree knockout reactions of the type ^{A}O(p,2p)^{A-1}N have been determined and compared to calculations based on the eikonal reaction theory. The reduction factors for the single-particle strength with respect to the independent-particle model were obtained and compared to state-of-the-art ab initio predictions. The results do not show any significant dependence on proton-neutron asymmetry.

  6. A primer on electrocatalysis

    Directory of Open Access Journals (Sweden)

    J.O’M. BOCKRIS

    2005-03-01

    Full Text Available A short review of the development and achievement of electrocatalysis in the last 50 years is given. The need for the knowledge of the reactionmechanism and position of the rate determining step for rational choice of catalyst is particularly stressed. Fundamental aspects of electrocatalysis are elaborated in more detail on the examples of electrochemically important reactions of hydrogen evolution and oxygen reduction, as well on the reaction of electrochemical oxidation of organic fuels (e.g., methanol.

  7. Dissociation pathways of a single dimethyl disulfide on Cu(111): Reaction induced by simultaneous excitation of two vibrational modes

    Energy Technology Data Exchange (ETDEWEB)

    Motobayashi, Kenta, E-mail: kmotobayashi@cat.hokudai.ac.jp [Catalysis Research Center, Hokkaido University, Sapporo 001-0021 (Japan); Department of Advanced Materials Science, The University of Tokyo, Kashiwa 277-8561 (Japan); Surface and Interface Science Laboratory, RIKEN, Wako 351-0198 (Japan); Kim, Yousoo [Surface and Interface Science Laboratory, RIKEN, Wako 351-0198 (Japan); Arafune, Ryuichi [International Center for Materials Nanoarchitectonics, National Institute for Materials Science, Tsukuba 305-0044 (Japan); Ohara, Michiaki; Ueba, Hiromu; Kawai, Maki, E-mail: maki@k.u-tokyo.ac.jp [Department of Advanced Materials Science, The University of Tokyo, Kashiwa 277-8561 (Japan)

    2014-05-21

    We present a novel reaction mechanism for a single adsorbed molecule that proceeds via simultaneous excitation of two different vibrational modes excited by inelastic tunneling electrons from a scanning tunneling microscope. Specifically, we analyze the dissociation of a single dimethyl disulfide (DMDS, (CH{sub 3}S){sub 2}) molecule on Cu(111) by using a versatile theoretical method, which permits us to simulate reaction rates as a function of sample bias voltage. The reaction is induced by the excitation of C-H stretch and S-S stretch modes by a two-electron process at low positive bias voltages. However, at increased voltages, the dissociation becomes a single-electron process that excites a combination mode of these stretches, where excitation of the C-H stretch is the energy source and excitation of the S-S stretch mode enhances the anharmonic coupling rate. A much smaller dissociation yield (few orders of magnitude) at negative bias voltages is understood in terms of the projected density of states of a single DMDS on Cu(111), which reflects resonant excitation through the molecular orbitals.

  8. Study of Reaction Forces in a Single Sided Linear Induction Motor (SLIM)

    Science.gov (United States)

    1974-01-01

    SLIM reaction forces were measured on a laboratory model having aluminum and aluminum-iron secondaries and the results were correlated with the theoretical forces derived for different idealized SLIM models. The first part of the report discusses wav...

  9. Enhancement of cutaneous delayed hypersensitivity reactions by a single exposure to UV-A or PUVA

    International Nuclear Information System (INIS)

    Moberg, S.; Mobacken, H.

    1982-01-01

    The influence of irradiation with UV-A and PUVA (8-methoxy-psoralen and UV-A) on delayed hypersensitivity reactions to microbial antigens was studied in healthy human individuals. Skin reactions to Candida albicans antigen and PPD were enhanced by UV-A als well as by PUVA compared with nonirradiated tests. A statistically significant difference was reached with UV-A for both antigens. For PUVA, erythemogenic doses to Candida tests produced a significant increase of response. (orig.)

  10. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. TD-S-HF single determinantal reaction theory and the description of many-body processes, including fission

    International Nuclear Information System (INIS)

    Griffin, J.J.; Lichtner, P.C.; Dworzecka, M.; Kan, K.K.

    1979-01-01

    The restrictions implied for the time dependent many-body reaction theory by the (TDHF) single determinantal assumption are explored by constructive analysis. A restructured TD-S-HF reaction theory is modelled, not after the initial-value form of the Schroedinger reaction theory, but after the (fully equivalent) S-matrix form, under the conditions that only self-consistent TDHF solutions occur in the theory, every wave function obeys the fundamental statistical interpretation of quantum mechanics, and the theory reduces to the exact Schroedinger theory for exact solutions which are single determinantal. All of these conditions can be accomodated provided that the theory is interpreted on a time-averaged basis, i.e., physical constants of the Schroedinger theory which are time-dependent in the TDHF theory, are interpreted in TD-S-HF in terms of their time averaged values. The resulting reaction theory, although formulated heuristically, prescribes a well defined and unambiguous calculational program which, although somewhat more demanding technically than the conventional initial-value TDHF method, is nevertheless more consonant with first principles, structurally and mechanistically. For its physical predictions do not depend upon the precise location of the distant measuring apparatus, and are in no way influenced by the spurious cross channel correlations which arise whenever the description of many reaction channels is imposed upon one single-determinantal solution. For nuclear structure physics, the TDHF-eigenfunctions provide the first plausible description of exact eigenstates in the time-dependent framework; moreover, they are unencumbered by any restriction to small amplitudes. 14 references

  12. Synthesis of single-crystal perovskite PbCrO3 through a new reaction route at high pressure

    Science.gov (United States)

    Han, Yunxia; Wang, Shanmin; Liu, Yinjuan; Ma, Dejiang; He, Duanwei; Zhao, Yusheng

    2018-04-01

    As a new member in the family of Mott system, perovskite PbCrO3 has recently been uncovered to exhibit fantastic structural transition under pressure, coupled with magnetic, electronic, and ferromagnetic transitions, which provide many opportunities for understanding of correlated system. However, it is still challenging to synthesize high-quality single-crystal PbCrO3, leading to the limited exploration of this Mott compound. In this work, we formulate a new high-pressure reaction route for preparation of high-quality PbCrO3 crystals between PbCl2 and Na2CrO4 at high pressure of 5-10 GPa and at high temperature of 750-1500°C. Because of the formation of reaction byproduct NaCl, the final product can readily be separated by washing with water. The obtained sample is in the form of single crystal with crystallite size up to 200 μm. In addition, combined with X-ray diffraction measurement, a tentative pressure-temperature synthesis diagram of PbCrO3 is mapped out from the reaction between PbCl2 and Na2CrO4 and the reaction mechanism is also explored in detail.

  13. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  14. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  15. [Incidence rate of adverse reaction/event by Qingkailing injection: a Meta-analysis of single rate].

    Science.gov (United States)

    Ai, Chun-ling; Xie, Yan-ming; Li, Ming-quan; Wang, Lian-xin; Liao, Xing

    2015-12-01

    To systematically review the incidence rate of adverse drug reaction/event by Qingkailing injection. Such databases as the PubMed, EMbase, the Cochrane library, CNKI, VIP WanFang data and CBM were searched by computer from foundation to July 30, 2015. Two reviewers independently screened literature according to the inclusion and exclusion criteria, extracted data and cross check data. Then, Meta-analysis was performed by using the R 3.2.0 software, subgroup sensitivity analysis was performed based on age, mode of medicine, observation time and research quality. Sixty-three studies involving 9,793 patients with Qingkailing injection were included, 367 cases of adverse reactions/events were reported in total. The incidence rate of adverse reaction in skin and mucosa group was 2% [95% CI (0.02; 0.03)]; the digestive system adverse reaction was 6% [95% CI(0.05; 0.07); the injection site adverse reaction was 4% [95% CI (0.02; 0.07)]. In the digestive system as the main types of adverse reactions/events, incidence of children and adults were 4.6% [0.021 1; 0.097 7] and 6.9% [0.053 5; 0.089 8], respectively. Adverse reactions to skin and mucous membrane damage as the main performance/event type, the observation time > 7 days and ≤ 7 days incidence of 3% [0.012 9; 0.068 3] and 1.9% [0.007 8; 0.046 1], respectively. Subgroup analysis showed that different types of adverse reactions, combination in the incidence of adverse reactions/events were higher than that of single drug, the difference was statistically significant (P reactions occur, and clinical rational drug use, such as combination, age and other fators, and the influence factors vary in different populations. Therefore, clinical doctors for children and the elderly use special care was required for a clear and open spirit injection, the implementation of individualized medication.

  16. Mass transfer with complex reversible chemical reactions—I. Single reversible chemical reaction

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1989-01-01

    An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass

  17. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Reaction of the (111) faces of single-crystal indium phosphide with alkylating agents: evidence for selective reaction of the p-rich face

    Energy Technology Data Exchange (ETDEWEB)

    Spool, A.M.; Daube, K.A.; Mallouk, T.E.; Belmont, J.A.; Wrighton, M.S.

    1986-05-28

    We wish to report that the P-rich, (111)B, face of single-crystal InP, but not the In-rich, (111)A, face of the same crystal, reacts with molecular reagents to yield surface-bound material derived from the apparent alkylation of a surface P atom. Exploitation of surface functional groups has been demonstrated to be very important in the attachment of molecular reagents and polymers to electrode surfaces. Electrodes derivatized with molecules have potential uses in analysis, fuel cells, electrosynthetic cells, and photoelectrochemical cells. We now wish to present evidence showing that an important photoelectrode material, InP, can be functionalized with molecules by reaction of the P-rich, (111)B, face with alkylating reagents.

  19. Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis.

    Science.gov (United States)

    Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

    2015-03-01

    A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).

  20. Molecular electronics of a single photosystem I reaction center: Studies with scanning tunneling microscopy and spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, I.; Lee, J.W.; Warmack, R.J.; Allison, D.P.; Greenbaum, E. [Oak Ridge National Lab., TN (United States)

    1995-03-14

    Thylakoids and photosystem I (PSI) reaction centers were imaged by scanning tunneling microscopy. The thylakoids were isolated from spinach chloroplasts, and PSI reaction centers were extracted from thylakoid membranes. Because thylakoids are relatively thick nonconductors, they were sputter-coated with Pd/Au before imaging. PSI photosynthetic centers and chemically platinized PSI were investigated without sputter-coating. They were mounted on flat gold substrates that had been treated with mercaptoacetic acid to help bind the proteins. With tunneling spectroscopy, the PSI centers displayed a semiconductor-like response with a band gap of 1.8 eV. Lightly platinized (platinized for 1 hr) centers displayed diode-like conduction that resulted in dramatic contrast changes between images taken with opposite bias voltages. The electronic properties of this system were stable under long-term storage. 42 refs., 7 figs.

  1. Understanding the Oxygen Reduction Reaction on a Y/Pt(111) Single Crystal

    DEFF Research Database (Denmark)

    Ulrikkeholm, Elisabeth Therese; Johansson, Tobias Peter; Malacrida, Paolo

    2014-01-01

    Polymer electrolyte membrane fuel cells (PEMFC) hold promise as a zero-emission source of power, particularly suitable for automotive vehicles. However, the high loading of Pt required to catalyse the oxygen reduction reaction (ORR) at the PEMFC cathode, prevents the commercialisation of this tec......Polymer electrolyte membrane fuel cells (PEMFC) hold promise as a zero-emission source of power, particularly suitable for automotive vehicles. However, the high loading of Pt required to catalyse the oxygen reduction reaction (ORR) at the PEMFC cathode, prevents the commercialisation...... using electrochemical measurements, low energy electron diffraction, ion scattering spectroscopy, angle resolved X-ray photoelectron spectroscopy, temperature programmed desorption of CO, and synchrotron based X-ray absorption spectroscopy and surface sensitive X-ray diffraction. These measurements were...

  2. A single residue controls electron transfer gating in photosynthetic reaction centers

    Czech Academy of Sciences Publication Activity Database

    Shlyk, O.; Samish, I.; Matěnová, M.; Dulebo, A.; Poláková, H.; Kaftan, David; Scherz, A.

    2017-01-01

    Roč. 7, MAR 16 (2017), s. 1-13, č. článku 44580. ISSN 2045-2322 R&D Projects: GA ČR GA15-00703S; GA MŠk(CZ) LO1416 Institutional support: RVO:61388971 Keywords : BACTERIAL REACTION CENTERS * INDUCED STRUCTURAL-CHANGES * ATOMIC-FORCE MICROSCOPE Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.259, year: 2016

  3. The operation of a single-sided linear induction motor with squirrel-cage and solid-steel reaction rails

    Science.gov (United States)

    Eastham, A. R.; Katz, R. M.

    1980-09-01

    Two test programs have been conducted to evaluate the performance of a single-sided linear induction motor with a squirrel-cage reaction rail and with a solid steel reaction rail. A 1.73-m-long six-pole stator interacted with the rails mounted on the rim of a 7.6-m-diam wheel. A 64-channel data acquisition system allowed tests to be performed over a wide range of operating conditions at speeds up to 20 m/sec. Typical test results which compare and contrast the mechanical, electrical and magnetic behavior of the SLIMs are presented. The test data are being used to assess the SLIM as an integrated suspension/propulsion system and for other transportation applications.

  4. Single Cobalt Atoms with Precise N-Coordination as Superior Oxygen Reduction Reaction Catalysts.

    Science.gov (United States)

    Yin, Peiqun; Yao, Tao; Wu, Yuen; Zheng, Lirong; Lin, Yue; Liu, Wei; Ju, Huanxin; Zhu, Junfa; Hong, Xun; Deng, Zhaoxiang; Zhou, Gang; Wei, Shiqiang; Li, Yadong

    2016-08-26

    A new strategy for achieving stable Co single atoms (SAs) on nitrogen-doped porous carbon with high metal loading over 4 wt % is reported. The strategy is based on a pyrolysis process of predesigned bimetallic Zn/Co metal-organic frameworks, during which Co can be reduced by carbonization of the organic linker and Zn is selectively evaporated away at high temperatures above 800 °C. The spherical aberration correction electron microscopy and extended X-ray absorption fine structure measurements both confirm the atomic dispersion of Co atoms stabilized by as-generated N-doped porous carbon. Surprisingly, the obtained Co-Nx single sites exhibit superior ORR performance with a half-wave potential (0.881 V) that is more positive than commercial Pt/C (0.811 V) and most reported non-precious metal catalysts. Durability tests revealed that the Co single atoms exhibit outstanding chemical stability during electrocatalysis and thermal stability that resists sintering at 900 °C. Our findings open up a new routine for general and practical synthesis of a variety of materials bearing single atoms, which could facilitate new discoveries at the atomic scale in condensed materials. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Role of adsorbed surfactant in the reaction of aryl diazonium salts with single-walled carbon nanotubes.

    Science.gov (United States)

    Hilmer, Andrew J; McNicholas, Thomas P; Lin, Shangchao; Zhang, Jingqing; Wang, Qing Hua; Mendenhall, Jonathan D; Song, Changsik; Heller, Daniel A; Barone, Paul W; Blankschtein, Daniel; Strano, Michael S

    2012-01-17

    Because covalent chemistry can diminish the optical and electronic properties of single-walled carbon nanotubes (SWCNTs), there is significant interest in developing methods of controllably functionalizing the nanotube sidewall. To date, most attempts at obtaining such control have focused on reaction stoichiometry or strength of oxidative treatment. Here, we examine the role of surfactants in the chemical modification of single-walled carbon nanotubes with aryl diazonium salts. The adsorbed surfactant layer is shown to affect the diazonium derivatization of carbon nanotubes in several ways, including electrostatic attraction or repulsion, steric exclusion, and direct chemical modification of the diazonium reactant. Electrostatic effects are most pronounced in the cases of anionic sodium dodecyl sulfate and cationic cetyltrimethylammonium bromide, where differences in surfactant charge can significantly affect the ability of the diazonium ion to access the SWCNT surface. For bile salt surfactants, with the exception of sodium cholate, we find that the surfactant wraps tightly enough such that exclusion effects are dominant. Here, sodium taurocholate exhibits almost no reactivity under the explored reaction conditions, while for sodium deoxycholate and sodium taurodeoxycholate, we show that the greatest extent of reaction is observed among a small population of nanotube species, with diameters between 0.88 and 0.92 nm. The anomalous reaction of nanotubes in this diameter range seems to imply that the surfactant is less effective at coating these species, resulting in a reduced surface coverage on the nanotube. Contrary to the other bile salts studied, sodium cholate enables high selectivity toward metallic species and small band gap semiconductors, which is attributed to surfactant-diazonium coupling to form highly reactive diazoesters. Further, it is found that the rigidity of anionic surfactants can significantly influence the ability of the surfactant layer to

  6. Studies of Nuclei Close to 132Sn Using Single-Neutron Transfer Reactions

    International Nuclear Information System (INIS)

    Jones, K.L.; Pain, S.D.; Kozub, R.L.; Adekola, Aderemi S.; Bardayan, Daniel W.; Blackmon, Jeff C.; Catford, Wilton N.; Chae, K.Y.; Chipps, K.; Cizewski, J.A.; Erikson, Luke; Gaddis, A.L.; Greife, U.; Grzywacz, R.K.; Harlin, Christopher W.; Hatarik, Robert; Howard, Joshua A.; James, J.; Kapler, R.; Krolas, W.; Liang, J. Felix; Ma, Zhanwen; Matei, Catalin; Moazen, Brian; Nesaraja, Caroline D.; O'Malley, Patrick; Patterson, N.P.; Paulauskas, Stanley; Shapira, Dan; Shriner, J.F. Jr.; Sikora, M.; Sissom, D.J.; Smith, Michael Scott; Swan, T.P.; Thomas, J.S.; Wilson, Gemma L.

    2009-01-01

    Neutron transfer reactions were performed in inverse kinematics using radioactive ion beams of 132Sn, 130Sn, and 134Te and deuterated polyethylene targets. Preliminary results are presented. The Q-value spectra for 133Sn, 131Sn and 135Te reveal a number of previously unobserved peaks. The angular distributions are compatible with the expected lf7/2 nature of the ground state of 133Sn, and 2p3/2 for the 3.4 MeV state in 131Sn.

  7. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

    International Nuclear Information System (INIS)

    Mardis, E.R.; Roe, B.A.

    1989-01-01

    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

  8. Reactions and single-particle structure of nuclei near the drip lines

    International Nuclear Information System (INIS)

    Hansen, P.G.; Sherrill, B.M.

    2001-01-01

    The techniques that have allowed the study of reactions of nuclei situated at or near the neutron or proton drip line are described. Nuclei situated just inside the drip line have low nucleon separation energies and, at most, a few bound states. If the angular momentum in addition is small, large halo states are formed where the wave function of the valency nucleon extends far beyond the nuclear radius. We begin with examples of the properties of nuclear halos and of their study in radioactive-beam experiments. We then turn to the continuum states existing above the particle threshold and also discuss the possibility of exciting them from the halo states in processes that may be thought of as 'collateral damage'. Finally, we show that the experience from studies of halo states has pointed to knockout reactions as a new way to perform spectroscopic studies of more deeply bound non-halo states. Examples are given of measurements of l values and spectroscopic factors

  9. Induction of generalized Shwartzman reaction (GSR) in irradiated rabbits by a single injection of endotoxin

    International Nuclear Information System (INIS)

    Wronowski, T.; Uchanska-Dudzinska, B.; Teisseyre, E.; Kopec, M.

    1976-01-01

    Rabbits were prepared to GSR by either a single dose 30 μg/kg of Salmonella enteritidis endotoxin or by a single whole-body exposure to 850 R of x ray. After 24 hrs provocative dose of endotoxin 50 μg/kg was injected. Histological examinations of kidneys revealed that GSR occurred with equal frequency in both groups of rabbits but was more severe in the animals prepared by irradiation. Protamine gelation test detected soluble fibrin complexes in plasma in about 50% of rabbits 24 hrs after either of the preparatory procedures and virtually in 100% after the provocative endotoxin dose. During the preparatory phase of GSR the irradiation induced a profound decrease in blood lymphocyte count and in the weight of thymus and spleen. It is postulated that early postexposure lysis of lymphatic cells participates in mechanisms leading to thrombotic phenomena after irradiation

  10. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    Science.gov (United States)

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  11. Comparative studies on the pest reactions of single- and poly- crystalline MoSi2

    International Nuclear Information System (INIS)

    Chou, T.C.; Nieh, T.G.

    1992-01-01

    Molybdenum disilicide (MoSi 2 ) has many attractive properties, e.g., high melting point (2020 degrees C), relatively low density (6.28 g/cm 3 ), good thermal stability and thermal shock resistance, and excellent oxidation resistance, for potential high temperature applications. Specifically, it is oxidation resistant at temperatures up to about 1900 degrees C, resulting from the formation of a self-healing, glassy silica (SiO 2 ) surface layer. Because of its suitability for use as a high temperature coating and as heating elements, the oxidation properties of MoSi 2 have been extensively studied in the past 30 years, but mainly in the high temperature regimes. In this paper, the authors investigate the evolution and morphological characteristics of the oxidation products of both MoSi 2 single crystals and cast polycrystals. Special attention is given to addressing the nucleation of pest in single crystalline material. The results from both the single- and poly-crystalline samples are correlated with an effort to resolve the origin of MoSi 2 pest. Their implications to the early-stage formation (nucleation) of pest are discussed

  12. Reaction of ethane with deuterium over platinum(111) single-crystal surfaces

    International Nuclear Information System (INIS)

    Zaera, F.; Somorhai, G.A.

    1985-01-01

    Deuterium exchange and hydrogenolysis of ethane were studied over (111) platinum surfaces under atmospheric pressures and a temperature range of 475-625 K. Activation energies of 19 kcal/mol for exchange and 34 kcal/mol for hydrogenolysis were obtained. The exchange reaction rates displayed kinetic orders with respect to deuterium and ethane partial pressures of -0.55 and 1.2, respectively. The exchange production distribution was U-shaped, peaking at one and six deuterium atoms per ethane molecule, similar to results reported for other forms of platinum, e.g., supported, films, and foils. The pressure of ethylidyne moieties on the surface was inferred from low-energy electron diffraction and thermal desorption spectroscopy. A mechanism is proposed to explain the experimental results, in which ethylidyne constitutes an intermediate in one of two competitive pathways. 31 references, 9 figures, 3 tables

  13. A single-arm Phase II validation study of preventing oxaliplatin-induced hypersensitivity reactions by dexamethasone: the AVOID trial

    Directory of Open Access Journals (Sweden)

    Yoshida Y

    2015-11-01

    Full Text Available Yoichiro Yoshida,1 Keiji Hirata,2 Hiroshi Matsuoka,3 Shigeyoshi Iwamoto,4 Masahito Kotaka,5 Hideto Fujita,6 Naoya Aisu,1 Seiichiro Hoshino,1 Takeo Kosaka,6 Kotaro Maeda,3 Fumiaki Kiyomi,7 Yuichi Yamashita1 1Department of Gastroenterological Surgery, Fukuoka University Faculty of Medicine, Fukuoka, Japan; 2Department of Surgery, Fukuoka Sanno Hospital, Fukuoka, Japan; 3Department of Surgery, Fujita Health University School of Medicine, Toyoake, Japan; 4Department of Surgery, Kansai Medical University Hirakata Hospital, Osaka, Japan; 5Gastrointestinal Cancer Center, Sano Hospital, Kobe, Japan; 6Department of Surgical Oncology, Kanazawa Medical University, Uchinada, Japan; 7Academia, Industry and Government Collaborative Research Institute of Translational Medicine for Life Innovation, Fukuoka University, Fukuoka, Japan Background: Patients with colorectal cancer treated with oxaliplatin are at risk of hypersensitivity reactions, with the incidence estimated to be 12%–20%. Coinfusion of dexamethasone and oxaliplatin could potentially reduce the incidence of these reactions, but oxaliplatin is reported to be incompatible with alkaline compounds in solution. However, in a previous retrospective study we found that the pH of a solution of dexamethasone and oxaliplatin was less than 7.4, and that hypersensitivity to oxaliplatin could have been prevented by coinfusion of dexamethasone. We aimed to evaluate the effectiveness of coinfusion of dexamethasone and oxaliplatin to prevent oxaliplatin-induced hypersensitivity reactions.Patients and methods: The AVOID trial was a prospective, multicenter, open-label, single-arm Phase II trial conducted from January to September 2013. The study included 73 patients who received capecitabine plus oxaliplatin (XELOX or XELOX plus bevacizumab therapy for colorectal cancer. In all patients, oxaliplatin was administered in combination with dexamethasone. The primary outcome measure was the presence of

  14. The reaction of lithium metal vapor with single walled carbon nanotubes of large diameters

    Czech Academy of Sciences Publication Activity Database

    Kalbáč, Martin; Kavan, Ladislav; Dunsch, L.

    2009-01-01

    Roč. 246, 11-12 (2009), s. 2428-2431 ISSN 0370-1972 R&D Projects: GA AV ČR IAA400400911; GA AV ČR KAN200100801; GA AV ČR IAA400400804; GA ČR GC203/07/J067; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : lithium * single walled carbon nanotubes * Raman spectroscopy Subject RIV: CG - Electrochemistry Impact factor: 1.150, year: 2009

  15. Simulation of single spin asymmetry in the p↑p→π±,0X reaction

    International Nuclear Information System (INIS)

    Musul'manbekov, Zh.Zh.; Tokarev, M.V.

    1995-01-01

    Using hadronic event generator based on the Bremsstrahlung approach on hadron level, the left-right asymmetry of inclusive pions in single spin proton-proton collisions was simulated. The x F - and p T -dependencies of asymmetry for the p↑p→π ±,0 X process at E Lab =13, 18, 40 and 200 GeV have been obtained. An analysis of simulated events has been performed and it has been found that Δ-resonances play an important role in the behaviour of pion asymmetry. Some predictions for pion asymmetry are given for high x F and p T region. 14 refs., 5 figs., 2 tabs

  16. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  17. Step-to-step spatiotemporal variables and ground reaction forces of intra-individual fastest sprinting in a single session.

    Science.gov (United States)

    Nagahara, Ryu; Mizutani, Mirai; Matsuo, Akifumi; Kanehisa, Hiroaki; Fukunaga, Tetsuo

    2018-06-01

    We aimed to investigate the step-to-step spatiotemporal variables and ground reaction forces during the acceleration phase for characterising intra-individual fastest sprinting within a single session. Step-to-step spatiotemporal variables and ground reaction forces produced by 15 male athletes were measured over a 50-m distance during repeated (three to five) 60-m sprints using a long force platform system. Differences in measured variables between the fastest and slowest trials were examined at each step until the 22nd step using a magnitude-based inferences approach. There were possibly-most likely higher running speed and step frequency (2nd to 22nd steps) and shorter support time (all steps) in the fastest trial than in the slowest trial. Moreover, for the fastest trial there were likely-very likely greater mean propulsive force during the initial four steps and possibly-very likely larger mean net anterior-posterior force until the 17th step. The current results demonstrate that better sprinting performance within a single session is probably achieved by 1) a high step frequency (except the initial step) with short support time at all steps, 2) exerting a greater mean propulsive force during initial acceleration, and 3) producing a greater mean net anterior-posterior force during initial and middle acceleration.

  18. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  19. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  20. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  1. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  2. Ligand-tailored single-site silica supported titanium catalysts: Synthesis, characterization and towards cyanosilylation reaction

    Science.gov (United States)

    Xu, Wei; Li, Yani; Yu, Bo; Yang, Jindou; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    A successive anchoring of Ti(NMe2)4, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1‧-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on silica was conducted by SOMC strategy in moderate conditions. The silica, monitored by in-situ Fourier transform infrared spectroscopy (in-situ FT-IR), was pretreated at different temperatures (200, 500 and 800 °C). The ligand tailored silica-supported titanium complexes were characterized by in-situ FT-IR, 13C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) and elemental analysis in detail, verifying that the surface titanium species are single sited. The catalytic activity of the ligand tailored single-site silica supported titanium complexes was evaluated by a cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the dehydroxylation temperatures of silica and the configuration of the ligands.

  3. A primer on metagenomics.

    Directory of Open Access Journals (Sweden)

    John C Wooley

    2010-02-01

    Full Text Available Metagenomics is a discipline that enables the genomic study of uncultured microorganisms. Faster, cheaper sequencing technologies and the ability to sequence uncultured microbes sampled directly from their habitats are expanding and transforming our view of the microbial world. Distilling meaningful information from the millions of new genomic sequences presents a serious challenge to bioinformaticians. In cultured microbes, the genomic data come from a single clone, making sequence assembly and annotation tractable. In metagenomics, the data come from heterogeneous microbial communities, sometimes containing more than 10,000 species, with the sequence data being noisy and partial. From sampling, to assembly, to gene calling and function prediction, bioinformatics faces new demands in interpreting voluminous, noisy, and often partial sequence data. Although metagenomics is a relative newcomer to science, the past few years have seen an explosion in computational methods applied to metagenomic-based research. It is therefore not within the scope of this article to provide an exhaustive review. Rather, we provide here a concise yet comprehensive introduction to the current computational requirements presented by metagenomics, and review the recent progress made. We also note whether there is software that implements any of the methods presented here, and briefly review its utility. Nevertheless, it would be useful if readers of this article would avail themselves of the comment section provided by this journal, and relate their own experiences. Finally, the last section of this article provides a few representative studies illustrating different facets of recent scientific discoveries made using metagenomics.

  4. Probing adsorption phenomena on a single crystal Pt-alloy surface under oxygen reduction reaction conditions

    DEFF Research Database (Denmark)

    Bondarenko, Alexander S.; Stephens, Ifan E.L.; Bech, Lone

    2012-01-01

    The adsorption dynamics of *OH and *O species at Pt(111) and Cu/Pt(111) near-surface alloy (NSA) surfaces in oxygen-free and O2-saturated 0.1M HClO4 was investigated. Subsurface Cu modifies the electronic structure at the Pt(111) surface resulting in weaker bonding to adsorbates like *OH, *H or *O....... This provides a basis for the high oxygen reduction activity of the NSA, as predicted by density functional theory calculations. The shift in *OH adsorption of around 0.16V towards more positive potentials can be clearly monitored in absence of O2 and under the oxygen reduction reaction (ORR) conditions...... for the Cu/Pt(111) NSA. In both cases, for Pt(111) and NSA, the *OH(*O) adsorption dynamics is very similar in the absence of oxygen and under ORR conditions. Therefore, theoretical assumptions about the coverage of adsorbates in the absence of oxygen can be reasonably extrapolated to the situation when...

  5. Single-site SBA-15 supported zirconium catalysts. Synthesis, characterization and toward cyanosilylation reaction

    International Nuclear Information System (INIS)

    Xu, Wei; Yu, Bo; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    Graphical abstract: Ligand-modified signal-site SBA-15 supported zirconium catalysts were synthesized by SOMC method and characterized by a variety of techniques. The zirconium surface complexes show high catalytic efficiency for cyanosilylation of benzaldehyde. - Highlights: • Some Zr active species have been anchored on the surface of SBA-15 by SOMC technique. • The structures of the Zr species have been characterized by a variety of techniques. • The anchored Zr species are single-sited surface complexes. • The Zr surface complexes are catalytic active for cyanosilylation of benzaldehyde. - Abstract: A successive anchoring of Zr(NMe 2 ) 4 , cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on dehydroxylated SBA-15 pretreated at 500 °C for 16 h (SBA-15 -500 ) was conducted by SOMC strategy in moderate conditions. The dehydoxylation of SBA-15 was monitored by in situ Fourier transform infrared spectroscopy (in situ FT-IR). The ligand-modified SBA-15 -500 supported zirconium complexes were characterized by in situ FT-IR, 13 C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), inductively coupled plasma mass spectrometry (ICP-MAS) and elemental analysis in detail, verifying that the surface zirconium species are single-sited. The catalytic activity of these complexes was evaluated by cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the structure of surface species and the configuration of the ligands

  6. Single-site SBA-15 supported zirconium catalysts. Synthesis, characterization and toward cyanosilylation reaction

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Yu, Bo; Zhang, Ying; Chen, Xi; Zhang, Guofang, E-mail: gfzhang@snnu.edu.cn; Gao, Ziwei, E-mail: zwgao@snnu.edu.cn

    2015-01-15

    Graphical abstract: Ligand-modified signal-site SBA-15 supported zirconium catalysts were synthesized by SOMC method and characterized by a variety of techniques. The zirconium surface complexes show high catalytic efficiency for cyanosilylation of benzaldehyde. - Highlights: • Some Zr active species have been anchored on the surface of SBA-15 by SOMC technique. • The structures of the Zr species have been characterized by a variety of techniques. • The anchored Zr species are single-sited surface complexes. • The Zr surface complexes are catalytic active for cyanosilylation of benzaldehyde. - Abstract: A successive anchoring of Zr(NMe{sub 2}){sub 4}, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1′-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on dehydroxylated SBA-15 pretreated at 500 °C for 16 h (SBA-15{sub -500}) was conducted by SOMC strategy in moderate conditions. The dehydoxylation of SBA-15 was monitored by in situ Fourier transform infrared spectroscopy (in situ FT-IR). The ligand-modified SBA-15{sub -500} supported zirconium complexes were characterized by in situ FT-IR, {sup 13}C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), inductively coupled plasma mass spectrometry (ICP-MAS) and elemental analysis in detail, verifying that the surface zirconium species are single-sited. The catalytic activity of these complexes was evaluated by cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the structure of surface species and the configuration of the ligands.

  7. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  9. Probing adsorption phenomena on a single crystal Pt-alloy surface under oxygen reduction reaction conditions

    International Nuclear Information System (INIS)

    Bondarenko, Alexander S.; Stephens, Ifan E.L.; Bech, Lone; Chorkendorff, Ib

    2012-01-01

    Highlights: ► Impedance spectroscopy of Cu/Pt(1 1 1) near-surface alloy and Pt(1 1 1). ► Presence of oxygen changes little the adsorption dynamics. ► Adsorption dynamics similar on alloy and Pt(1 1 1). ► Electrosorption phenomena on alloy shifted in potential, relative to Pt(1 1 1). - Abstract: The adsorption dynamics of *OH and *O species at Pt(1 1 1) and Cu/Pt(1 1 1) near-surface alloy (NSA) surfaces in oxygen-free and O 2 -saturated 0.1 M HClO 4 was investigated. Subsurface Cu modifies the electronic structure at the Pt(1 1 1) surface resulting in weaker bonding to adsorbates like *OH, *H or *O. This provides a basis for the high oxygen reduction activity of the NSA, as predicted by density functional theory calculations. The shift in *OH adsorption of around 0.16 V towards more positive potentials can be clearly monitored in absence of O 2 and under the oxygen reduction reaction (ORR) conditions for the Cu/Pt(1 1 1) NSA. In both cases, for Pt(1 1 1) and NSA, the *OH(*O) adsorption dynamics is very similar in the absence of oxygen and under ORR conditions. Therefore, theoretical assumptions about the coverage of adsorbates in the absence of oxygen can be reasonably extrapolated to the situation when oxygen reduction takes place at the surface. A ∼5-fold improvement in the ORR activity over the Pt(1 1 1) at 0.9 V (RHE) was measured for the Cu/Pt(1 1 1) near-surface alloy.

  10. Evaluation of the Cortical Bone Reaction Around of Implants Using a Single-Use Final Drill: A Histologic Study.

    Science.gov (United States)

    Gehrke, Sergio Alexandre

    2015-07-01

    This study was designed to compare the cortical bone reaction following traditional osteotomy or the use of a single-use final drill in the osseointegration of implants in the tibia of rabbits. For this study, 48 conical implants, of standard surface type and design and manufactured by the same company, were inserted into the tibiae of 12 rabbits and removed after 30 or 60 days for histologic analysis. Two test groups were prepared according to the drill sequence used for the osteotomy at the preparation sites: in the control group was used a conventional drill sequence with several uses, whereas the test group (tesG) used a single-use final drill. The bone-to-implant contact and qualitative factors of the resulting cortical bone were assessed. Both techniques produced good implant integration. Differences in the linear bone-to-implant contact were observed between the drilling procedures as time elapsed in vivo, with the tesG appearing to have clinical advantages. Both groups exhibited new bone in quantity and in quality; however, the tesG exhibited a higher level of new bone deposition than the control group. Within the limitations of this study, the findings suggest that the use of a single-use final drill leads to better and faster organization of the cortical bone area during the evaluated period and may avoid the possible problems that can be caused by worn drills.

  11. Single-site SBA-15 supported zirconium catalysts. Synthesis, characterization and toward cyanosilylation reaction

    Science.gov (United States)

    Xu, Wei; Yu, Bo; Zhang, Ying; Chen, Xi; Zhang, Guofang; Gao, Ziwei

    2015-01-01

    A successive anchoring of Zr(NMe2)4, cyclopentadiene and a O-donor ligand, 1-hydroxyethylbenzene (PEA), 1,1‧-bi-2-naphthol (Binol) or 2,3-dihydroxybutanedioic acid diethyl ester (Tartrate), on dehydroxylated SBA-15 pretreated at 500 °C for 16 h (SBA-15-500) was conducted by SOMC strategy in moderate conditions. The dehydoxylation of SBA-15 was monitored by in situ Fourier transform infrared spectroscopy (in situ FT-IR). The ligand-modified SBA-15-500 supported zirconium complexes were characterized by in situ FT-IR, 13C CP MAS-NMR, X-ray photoelectron spectroscopy (XPS), inductively coupled plasma mass spectrometry (ICP-MAS) and elemental analysis in detail, verifying that the surface zirconium species are single-sited. The catalytic activity of these complexes was evaluated by cyanosilylation of benzaldehyde. The results showed that the catalytic activity is dependent strongly on the structure of surface species and the configuration of the ligands.

  12. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    Energy Technology Data Exchange (ETDEWEB)

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  13. Evaluation of the single radiosensitivity in patients subjected to medical exposure that show severe skin reactions

    International Nuclear Information System (INIS)

    Di Giorgio, M.; Vallerga, M.B.; Portas, M.; Perez, M.R.

    2006-01-01

    The Burnt Hospital of the Buenos Aires City Government (HQGCBA) it is a hospital of reference of the Net of Medical Responses in Radiological Emergencies of the Argentine Republic. In the mark of an agreement among the HQGCBA and the Authority Regulatory Nuclear (ARN), it is in execution a study protocol for the one boarding diagnoses and therapeutic of radioinduced cutaneous leisure. They exist individual variations that can condition the response to the ionizing radiations (IR), so much in accidental exposures as having programmed (radiotherapy, radiology interventionist). In this context, the individual radiosensitivity is evaluated in the patients signed up in this protocol that presented sharp or late cutaneous reactions, with grades of severity 3-4 (approaches EORTC/RTOG). The capacity of repair of the DNA was evaluated in outlying blood lymphocytes irradiated in vitro (2 Gy, gamma of Co-60) by means of the micronucleus techniques and comet essay in alkaline conditions. In this work two cases in those that is applied this study protocol, the therapeutic answer and its correlate with the discoveries of the radiosensitivity tests is presented. Case 1: patient of feminine sex, subjected to external radiotherapy by a breast infiltrating ductal carcinoma; developed sharp cutaneous radiotoxicity grade 3 (confluent humid epithelitis) that motivate the interruption of the treatment. Case 2: patient of masculine sex, subjected to a coronary angioplasty (interventionist radiology); developed late cutaneous radiotoxicity grade 4 (ulceration in dorsal region). Both patients were treated with topical trolamine associated to systemic administration of pentoxiphiline and antioxidants. The therapeutic answer is evaluated by means of clinical pursuit, photographic serial register and complementary exams (thermography and ultrasonography of high frequency). In the case 1 the answer was very favorable, with precocious local improvement and complete remission of symptoms and

  14. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  15. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  16. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  17. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  18. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  19. Localizing internal friction along the reaction coordinate of protein folding by combining ensemble and single-molecule fluorescence spectroscopy

    Science.gov (United States)

    Borgia, Alessandro; Wensley, Beth G.; Soranno, Andrea; Nettels, Daniel; Borgia, Madeleine B.; Hoffmann, Armin; Pfeil, Shawn H.; Lipman, Everett A.; Clarke, Jane; Schuler, Benjamin

    2012-01-01

    Theory, simulations and experimental results have suggested an important role of internal friction in the kinetics of protein folding. Recent experiments on spectrin domains provided the first evidence for a pronounced contribution of internal friction in proteins that fold on the millisecond timescale. However, it has remained unclear how this contribution is distributed along the reaction and what influence it has on the folding dynamics. Here we use a combination of single-molecule Förster resonance energy transfer, nanosecond fluorescence correlation spectroscopy, microfluidic mixing and denaturant- and viscosity-dependent protein-folding kinetics to probe internal friction in the unfolded state and at the early and late transition states of slow- and fast-folding spectrin domains. We find that the internal friction affecting the folding rates of spectrin domains is highly localized to the early transition state, suggesting an important role of rather specific interactions in the rate-limiting conformational changes. PMID:23149740

  20. Compact Ag@Fe3O4 Core-shell Nanoparticles by Means of Single-step Thermal Decomposition Reaction

    Science.gov (United States)

    Brollo, Maria Eugênia F.; López-Ruiz, Román; Muraca, Diego; Figueroa, Santiago J. A.; Pirota, Kleber R.; Knobel, Marcelo

    2014-10-01

    A temperature pause introduced in a simple single-step thermal decomposition of iron, with the presence of silver seeds formed in the same reaction mixture, gives rise to novel compact heterostructures: brick-like Ag@Fe3O4 core-shell nanoparticles. This novel method is relatively easy to implement, and could contribute to overcome the challenge of obtaining a multifunctional heteroparticle in which a noble metal is surrounded by magnetite. Structural analyses of the samples show 4 nm silver nanoparticles wrapped within compact cubic external structures of Fe oxide, with curious rectangular shape. The magnetic properties indicate a near superparamagnetic like behavior with a weak hysteresis at room temperature. The value of the anisotropy involved makes these particles candidates to potential applications in nanomedicine.

  1. Synthesis of single-crystalline hollow β-FeOOH nanorods via a controlled incomplete-reaction course

    International Nuclear Information System (INIS)

    Yu Haiyun; Song Xinyu; Yin Zhilei; Fan Weiliu; Tan Xuejie; Fan Chunhua; Sun Sixiu

    2007-01-01

    The single-crystalline β-FeOOH hollow nanorods with a diameter ranging from 20∼30 nm and length in the range of 70-110 nm have been successfully synthesized through a two-step route in the solution. The phase transformation and the morphologies of the hollow β-FeOOH nanorods were investigated with X-ray powdered diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), selected area electric diffraction (SAED), high-resolution transmission electron microscopy (HRTEM), infrared spectrum (IR) and thermo-gravimetric analysis (TGA). These studies indicate that the first step is an incomplete-reaction course. Furthermore, The formation mechanism of the hollow nanorods has been discussed. It is found that the mixed system including chitosan and n-propanol is essential for the final formation of the hollow β-FeOOH nanorods

  2. Measurements of differential cross-section ratios for single-nucleon transfer reaction pairs near A=25

    Energy Technology Data Exchange (ETDEWEB)

    Howard, A J; Moise, T S [Trinity Coll., Hartford, CT (USA). Dept. of Physics; Champagne, A E [Princeton Univ., NJ (USA). Dept. of Physics; Magnus, P V; Smith, M S [Yale Univ., New Haven, CT (USA). Wright Nuclear Structure Lab.

    1991-06-10

    Differential cross sections for the (d,p), ({sup 3}He,d), ({alpha},t) and ({alpha},{sup 3}He) reactions involving seventy-one residual states in {sup 23}Na, {sup 25}Mg, {sup 25}Al, and {sup 27}Al have been measured at a forward angle with incident energies of 17.5, 20.2, and 34.8 MeV, respectively. The ratio of cross-section pairs involving formation of the same residual state is determined for forty-five cases where both the angular momentum transfer and single-particle spectroscopic strength have been previously established. These are compared to values calculated with conventional distorted-wave Born approximation analysis, and the utility of this technique for identifying some levels which are possible s- or p-wave resonances is demonstrated and discussed for states in the vicinity of proton thresholds. An application is made involving proton threshold states in {sup 27}Al. (orig.).

  3. Electrochemistry of single nanobubbles. Estimating the critical size of bubble-forming nuclei for gas-evolving electrode reactions.

    Science.gov (United States)

    German, Sean R; Edwards, Martin A; Chen, Qianjin; Liu, Yuwen; Luo, Long; White, Henry S

    2016-12-12

    In this article, we address the fundamental question: "What is the critical size of a single cluster of gas molecules that grows and becomes a stable (or continuously growing) gas bubble during gas evolving reactions?" Electrochemical reactions that produce dissolved gas molecules are ubiquitous in electrochemical technologies, e.g., water electrolysis, photoelectrochemistry, chlorine production, corrosion, and often lead to the formation of gaseous bubbles. Herein, we demonstrate that electrochemical measurements of the dissolved gas concentration, at the instant prior to nucleation of an individual nanobubble of H 2 , N 2 , or O 2 at a Pt nanodisk electrode, can be analyzed using classical thermodynamic relationships (Henry's law and the Young-Laplace equation - including non-ideal corrections) to provide an estimate of the size of the gas bubble nucleus that grows into a stable bubble. We further demonstrate that this critical nucleus size is independent of the radius of the Pt nanodisk employed (gas. For example, the measured critical surface concentration of H 2 of ∼0.23 M at the instant of bubble formation corresponds to a critical H 2 nucleus that has a radius of ∼3.6 nm, an internal pressure of ∼350 atm, and contains ∼1700 H 2 molecules. The data are consistent with stochastic fluctuations in the density of dissolved gas, at or near the Pt/solution interface, controlling the rate of bubble nucleation. We discuss the growth of the nucleus as a diffusion-limited process and how that process is affected by proximity to an electrode producing ∼10 11 gas molecules per second. Our study demonstrates the advantages of studying a single-entity, i.e., an individual nanobubble, in understanding and quantifying complex physicochemical phenomena.

  4. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  5. Single determinantal reaction theory as a Schroedinger analog: the time-dependent S-matrix Hartree-Fock method

    International Nuclear Information System (INIS)

    Griffin, J.J.; Lichtner, P.C.; Dworzecka, M.; Kan, K.K.

    1979-01-01

    It is suggested that the TDHF method be viewed, not as an approximation to but as a model of the exact Schroedinger system; that is, as a gedanken many-body experiment whose analysis with digital computers provides data worthy in itself of theoretical study. From such a viewpoint attention is focused on the structural analogies of the TDHF system with the exact theory rather than upon its quantitative equivalence, and the TDHF many-body system is studied as a challenge of its own which, although much simpler than the realistic problem, may still offer complexity enough to educate theorists in the present state of knowledge. In this spirit, the TDHF description of continuum reactions can be restructured from an initial-value problem into a form analogous to the S-matrix version of the Schroedinger theory. The resulting TD-S-HF theory involves only self-consistent single determinantal solutions of the TDHF equations and invokes time averaging to obtain a consistent interpretation of the TDHF analogs of quantities which are constant in the exact theory, such as the S-matrix and the asymptotic reaction channel characteristics. Periodic solutions then play the role of stationary eigenstates in the construction of suitable asymptotic reaction channels. If these periodic channel states occur only at discrete energies, then the resulting channels are mutually orthogonal (on the time average) and the theory exhibits a structure fully analogous to the exact theory. In certain special cases where the periodic solutions are known to occur as an energy continuum, the requirement that the periodicity of the channel solutions be gauge invariant provides a natural requantization condition which (suggestively) turns out to be identical with the Bohr-Sommerfeld quantization rule. 11 references

  6. Detachment of CVD-grown graphene from single crystalline Ni films by a pure gas phase reaction

    Science.gov (United States)

    Zeller, Patrick; Henß, Ann-Kathrin; Weinl, Michael; Diehl, Leo; Keefer, Daniel; Lippmann, Judith; Schulz, Anne; Kraus, Jürgen; Schreck, Matthias; Wintterlin, Joost

    2016-11-01

    Despite great previous efforts there is still a high need for a simple, clean, and upscalable method for detaching epitaxial graphene from the metal support on which it was grown. We present a method based on a pure gas phase reaction that is free of solvents and polymer supports and avoids mechanical transfer steps. The graphene was grown on 150 nm thick, single crystalline Ni(111) films on Si(111) wafers with YSZ buffer layers. Its quality was monitored by using low energy electron diffraction and scanning tunneling microscopy. The gas phase etching uses a chemical transport reaction, the so-called Mond process, based on the formation of gaseous nickel tetracarbonyl in 1 bar of CO at 75 °C and by adding small amounts of sulfide catalysts. X-ray photoelectron spectroscopy, Raman spectroscopy and scanning electron microscopy were used to characterize the detached graphene. It was found that the method successfully removes the nickel from underneath the graphene layer, so that the graphene lies on the insulating oxide buffer layer. Small residual particles of nickel sulfide and cracks in the obtained graphene layer were identified. The defect concentrations were comparable to graphene samples obtained by wet chemical etching and by the bubbling transfer.

  7. Pesquisaje activo de sospechas de reacciones adversas a medicamentos en el Hospital "Dr. Salvador Allende: Primer semestre 2006 Active screening of suspicions of adverse reactions to drugs in "Dr. Salvador Allende" Hospital: First semester 2006

    Directory of Open Access Journals (Sweden)

    José de Jesús Rego Hernández

    2007-12-01

    Full Text Available Se realizó un estudio descriptivo mediante la revisión diaria del movimiento hospitalario, obtenido en el Departamento de Registros Médicos del Hospital "Dr. Salvador Allende" desde enero hasta junio de 2006 a fin de poder identificar los ingresos susceptibles de ser reacciones adversas a medicamentos, con el objetivo de detectar la frecuencia de ingresos por sospechas de reacciones adversas a medicamentos, así como de caracterizar a estos pacientes. Se llenó una planilla de notificación para cada sospecha de reacción adversa y se analizaron los datos contenidos en las historias clínicas respectivas. Se utilizó una base de Excel diseñada al efecto por el Centro para el Desarrollo de la Farmacoepidemiología. Ingresaron 6 201 pacientes, de los cuales 384 eran susceptibles de tener una reacción adversa a medicamentos (6,2 % y finalmente, se consideraron 57 pacientes cuyo motivo de ingreso se relacionó con algún medicamento (0,9 %. El 66,7 % de los casos eran mayores de 60 años de edad, sin diferencias en cuanto al sexo. Los grupos farmacológicos con mayores afectaciones fueron los analgésicos no opiodes (59,7 % y los antibacterianos (19,4 %. El sangramiento digestivo alto resultó la reacción adversa que más se encontró (57,9 %, con predominio en mayores de 60 años de edad (72,7 %; el ácido acetilsalicílico estuvo presente en el 66,7 % de los casos con este diagnóstico. En el75,5 % de los casos la reacción se consideró como graveA descriptive study was conducted by the daily revision of hospital movement obtained in the Department of Medical Registries of "Dr. Salvador Allende" Hospital from January to June, 2006, aimed at identifying the admissions susceptible to adverse reactions to drugs to detect the frequency of admissions due to suspicions of adverse reactions to drugs, as well as to characterize these patients. A notification form was filled in per each suspicion of adverse reaction, and the data contained in the

  8. Fe Isolated Single Atoms on S, N Codoped Carbon by Copolymer Pyrolysis Strategy for Highly Efficient Oxygen Reduction Reaction.

    Science.gov (United States)

    Li, Qiheng; Chen, Wenxing; Xiao, Hai; Gong, Yue; Li, Zhi; Zheng, Lirong; Zheng, Xusheng; Yan, Wensheng; Cheong, Weng-Chon; Shen, Rongan; Fu, Ninghua; Gu, Lin; Zhuang, Zhongbin; Chen, Chen; Wang, Dingsheng; Peng, Qing; Li, Jun; Li, Yadong

    2018-06-01

    Heteroatom-doped Fe-NC catalyst has emerged as one of the most promising candidates to replace noble metal-based catalysts for highly efficient oxygen reduction reaction (ORR). However, delicate controls over their structure parameters to optimize the catalytic efficiency and molecular-level understandings of the catalytic mechanism are still challenging. Herein, a novel pyrrole-thiophene copolymer pyrolysis strategy to synthesize Fe-isolated single atoms on sulfur and nitrogen-codoped carbon (Fe-ISA/SNC) with controllable S, N doping is rationally designed. The catalytic efficiency of Fe-ISA/SNC shows a volcano-type curve with the increase of sulfur doping. The optimized Fe-ISA/SNC exhibits a half-wave potential of 0.896 V (vs reversible hydrogen electrode (RHE)), which is more positive than those of Fe-isolated single atoms on nitrogen codoped carbon (Fe-ISA/NC, 0.839 V), commercial Pt/C (0.841 V), and most reported nonprecious metal catalysts. Fe-ISA/SNC is methanol tolerable and shows negligible activity decay in alkaline condition during 15 000 voltage cycles. X-ray absorption fine structure analysis and density functional theory calculations reveal that the incorporated sulfur engineers the charges on N atoms surrounding the Fe reactive center. The enriched charge facilitates the rate-limiting reductive release of OH* and therefore improved the overall ORR efficiency. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  10. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  11. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  12. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  13. Oriented nano-wire formation and selective adhesion on substrates by single ion track reaction in polysilanes

    International Nuclear Information System (INIS)

    Shu Seki; Satoshi Tsukuda, Yoichi Yoshida; Seiichi Tagawa; Masaki Sugimoto; Shigeru Tanaka

    2002-01-01

    1-D nano-sized materials such as carbon nanotubes have attracted much attention as ideal quantum wires for future manufacturing techniques of nano-scaled opto-electronic devices. However it is still difficult to control the sizes, spatial distributions, or positions of nanotubes by conventional synthetic techniques to date. The MeV order heavy ion beams causes ultra-high density energy deposition which can not be realized by any other techniques (lasers, H, etc), and penetrate the polymer target straighforward as long as 1∼100 m depth. the energy deposited area produces non-homogeneous field can be controlled by changing the energy deposition rate of incident ions (LET: linear energy transfer, eV/nm). We found that cross-linking reaction of polysilane derivatives was predominantly caused and gave nano-gel in the chemical core, unlike main chain scission occurring at the outside of the area. high density energy deposition by ion beams causes non-homogeneous crosslinking reaction of polysilane derivatives within a nano-sized cylindrical area along an ion trajectory, and gives -SiC based nano-wires of which sizes (length, thickness) and number densities are completely under control by changing the parameters of incident ion beams and molecular sizes of target polymers. based on the concept pf the single track gelation, the present study demonstrates the formation of cross-linked polysilane nano-wires with the fairly controlled sizes. Recently the techniques of position-selective single ion hitting have been developed for MeV order ion beams, however it is not sufficient to control precisely the positions of the nano-wires on the substrates within sub- m area. in the present study, we report the selective adhesion of anno-wires on Si substrates by the surface treatments before coating, which enables the patterning of planted nano-wires on substrates and/or electrodes as candidates for nano-sized field emissive cathodes or electro-luminescent devices. Some examples of

  14. Factors associated with acute oral mucosal reaction induced by radiotherapy in head and neck squamous cell carcinoma: A retrospective single-center experience.

    Science.gov (United States)

    Tao, Zhenchao; Gao, Jin; Qian, Liting; Huang, Yifan; Zhou, Yan; Yang, Liping; He, Jian; Yang, Jing; Wang, Ru; Zhang, Yangyang

    2017-12-01

    To investigate risk factors for acute oral mucosal reaction during head and neck squamous cell carcinoma radiotherapy.A retrospective study of patients with head and neck squamous cell carcinoma who underwent radiotherapy from November 2013 to May 2016 in Anhui Provincial Cancer Hospital was conducted. Data on the occurrence and severity of acute oral mucositis were extracted from clinical records. Based on the Radiation Therapy Oncology Group (RTOG) grading of acute radiation mucosal injury, the patients were assigned into acute reaction (grades 2-4) and minimum reaction (grades 0-1) groups. Preradiotherapy characteristics and treatment factors were compared between the 2 groups. Multivariate logistic regression analysis was used to detect the independent factors associated with acute oral mucosal reactions.Eighty patients completed radiotherapy during the study period. Oral mucosal reactions were recorded as 25, 31, and 24 cases of grades 1, 2, and 3 injuries, respectively. Significant differences between acute reaction and minimum reaction groups were detected in cancer lymph node (N) staging, smoking and diabetes history, pretreatment platelet count and T-Helper/T-Suppressor lymphocyte (Th/Ts) ratio, concurrent chemotherapy, and total and single irradiation doses.Multivariate analysis showed that N stage, smoking history, single dose parapharyngeal irradiation, and pretreatment platelet count were independent risk factors for acute radiation induced oral mucosal reaction. Smoking history, higher grading of N stage, higher single dose irradiation, and lower preirradiation platelet count may increase the risk and severity of acute radiation oral mucosal reaction in radiotherapy of head and neck cancer patients. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  15. Rational Design of Single Molybdenum Atoms Anchored on N-Doped Carbon for Effective Hydrogen Evolution Reaction.

    Science.gov (United States)

    Chen, Wenxing; Pei, Jiajing; He, Chun-Ting; Wan, Jiawei; Ren, Hanlin; Zhu, Youqi; Wang, Yu; Dong, Juncai; Tian, Shubo; Cheong, Weng-Chon; Lu, Siqi; Zheng, Lirong; Zheng, Xusheng; Yan, Wensheng; Zhuang, Zhongbin; Chen, Chen; Peng, Qing; Wang, Dingsheng; Li, Yadong

    2017-12-11

    The highly efficient electrochemical hydrogen evolution reaction (HER) provides a promising pathway to resolve energy and environment problems. An electrocatalyst was designed with single Mo atoms (Mo-SAs) supported on N-doped carbon having outstanding HER performance. The structure of the catalyst was probed by aberration-corrected scanning transmission electron microscopy (AC-STEM) and X-ray absorption fine structure (XAFS) spectroscopy, indicating the formation of Mo-SAs anchored with one nitrogen atom and two carbon atoms (Mo 1 N 1 C 2 ). Importantly, the Mo 1 N 1 C 2 catalyst displayed much more excellent activity compared with Mo 2 C and MoN, and better stability than commercial Pt/C. Density functional theory (DFT) calculation revealed that the unique structure of Mo 1 N 1 C 2 moiety played a crucial effect to improve the HER performance. This work opens up new opportunities for the preparation and application of highly active and stable Mo-based HER catalysts. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  17. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  18. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  19. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  20. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  1. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  2. Effect of PVP as a capping agent in single reaction synthesis of nanocomposite soft/hard ferrite nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, H.A. [Department of Physics, Faculty of Science, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia); Saiden, N.M., E-mail: nlaily@upm.edu.my [Department of Physics, Faculty of Science, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia); Saion, E.; Azis, R.S.; Mamat, M.S. [Department of Physics, Faculty of Science, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia); Hashim, M. [Advanced Material and Nanotechnology Laboratory, Institute of Advanced Technology, Universiti Putra Malaysia, UPM, 43400 Serdang, Selangor (Malaysia)

    2017-04-15

    Nanocomposite magnets consist of soft and hard ferrite phases are known as an exchange spring magnet when they are sufficiently spin exchange coupled. Hard and soft ferrites offer high value of coercivity, H{sub c} and saturation magnetization, M{sub s} respectively. In order to obtain a better permanent magnet, both soft and hard ferrite phases need to be “exchange coupled”. The nanoparticles were prepared by a simple one-pot technique of 80% soft phase and 20% hard phase. This technique involves a single reaction mixture of metal nitrates and aqueous solution of varied amounts of polyvinylpyrrolidone (PVP). The heat treatment applied was at 800 °C for 3 h. The synthesized composites were characterized by Transmission Electron Microscope (TEM), Fourier Transform Infra-red (FT-IR), Energy Dispersive X-Ray (EDX), X-ray diffraction (XRD) and Vibrating sample magnetometer (VSM). The coexistence of two phases, Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2}O{sub 4} and SrFe{sub 12}O{sub 19} were observed by XRD patterns. It also verified by the EDX that no impurities detected. The magnetic properties of nanocomposite ferrites for 0.06 g/ml PVP gives a better properties of H{sub c} 932 G and M{sub s} 39.0 emu/g with average particle size obtained from FESEM was 49.2 nm. The concentration of PVP used gives effect on the magnetic properties of the samples. - Highlights: • Amount of PVP play important roles in controlling the particle size distribution and magnetic properties. • This is a novel technique to produce nanocomposite ferrites effectively. • This study contributes better understanding on magnetic properties in nanoparticle composite magnets.

  3. Latent-time estimation for late cutaneous and subcutaneous radiation reactions in a single-follow-up clinical study

    International Nuclear Information System (INIS)

    Thames, H.D.; Bentzen, S.M.; Overgaard, M.; Danish Cancer Society, Aarhus

    1989-01-01

    In this paper, an analysis of the fractionation sensitivity and latency of subcutaneous fibrosis and telangiectasia in a clinical series is presented. The series comprised 163 breast cancer patients who, from 1978 to 1980, received postmastectomy irradiation delivered in 12 fractions, with 2 fractions per week over a period of 37 to 46 days. The total dose was specified either as a maximum absorbed dose of 51.36 Gy, or as a minimum target dose of 36.6 Gy specified at the level of the mid-axilla. from 1981 to 1982, 66 patients received a minimum target dose of 40.92 Gy in 22 fractions administered as 5 fractions per week over 29 to 35 days. Late complications were evaluated prospectively at a single follow-up after a minimum observation time of 16 months. The clinical endpoints analyzed were subcutaneous fibrosis and telangiectasia. The data were analyzed using a mixture model that incorporates both dose fractionation and latency effects. The length of time to expression of 90% of the ultimate frequency of moderate or severe complications was 3.2 years (95% confidence limits (c.l.) [2.3,3.9] years) and 4.7 years (95% c.l. [4.0,.8] years) for fibrosis and telangiectasia respectively, while the α/β ratios were 1.9 Gy (95% c.l. [0.8,3.0] Gy) and 3.7 Gy (95% c.l. [0.2,47] Gy), respectively. For subcutaneous fibrosis the time to reach a specific grade of reaction increases with the grade, thus being consistent with the clinical impression that fibrosis proresses in severity over time. If latency and censoring effects are unaccounted for, serious underestimates of the ultimate frequency of radiation complications in groups with incomplete follow-up may result. (author). 13 refs.; 4 figs.; 5 tabs

  4. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  5. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  6. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  7. Analysis of the /sup 28/Si(p,. gamma. )/sup 29/P reaction data in the region of the sub-barrier single particle resonances

    Energy Technology Data Exchange (ETDEWEB)

    Matulewicz, T; Decowski, P; Kicinska-Habior, M; Sikora, B; Toke, J

    1983-01-01

    The /sup 28/Si(p, ..gamma..)/sup 29/P reaction data have been analyzed in terms of a modified direct-semidirect capture model which accounts for the presence of broad shape (single-particle) resonances in the entrance channel. Values of the spectroscopic factors for the ground state and 1,65 MeV and 2,88 MeV resonances in /sup 29/P nuclei were extracted and found to be consistent with those obtained in other experiments. The modified theoretical analysis scheme was found to provide a convenient tool for analyzing the radiative capture reaction data.

  8. On the relationship between lower extremity muscles activation and peak vertical and posterior ground reaction forces during single leg drop landing.

    Science.gov (United States)

    Mahaki, M; Mi'mar, R; Mahaki, B

    2015-10-01

    Anterior cruciate ligament (ACL) injury continues to be an important medical issue for athletes participating in sports. Vertical and posterior ground reaction forces have received considerable attention for their potential influence on ACL injuries. The purpose of this study was to examine the relationship between electromyographic activity of lower extremity muscles and the peak vertical and posterior ground reaction forces during single leg drop landing. Thirteen physical education male students participated in this correlation study. Electromyographic activities of gluteus medius, biceps femoris, medial gastrocnemius, soleus as well as anterior tibialis muscles along with ground reaction forces were measured. Participants performed single-leg landing from a 0.3 m height on to a force platform. Landing was divided into two phases: 100 ms preceding ground contact and 100 ms proceeding ground contact. Pearson correlation test was used to determine the relationships between these muscles activity and peak vertical and posterior ground reaction forces. The results of the study indicated that the activity of soleus and tibialis anterior in pre-landing phase were positively correlated with peak vertical ground reaction force ([P≤0.04], [P≤0.008], respectively). However, no significant correlation was found between the activities of other muscles in pre-landing phase and peak vertical as well as peak posterior ground reaction forces. Also, no significant correlation was found between the activities of muscles in post-landing phase and peak vertical as well as peak posterior ground reaction forces. Soleus loading shifts the proximal tibia posterior at the knee joint and tibialis anterior prevent hyperporonation of the ankle, a mechanisms of ACL injury. Hence, neuromuscular training promoting preparatory muscle activity in these muscles may reduce the incidence of ACL injuries.

  9. Kinetic modelling of hydrocracking catalytic reactions by the single events theory; Modelisation cinetique des reactions catalytiques d`hydrocraquage par la theorie des evenements constitutifs

    Energy Technology Data Exchange (ETDEWEB)

    Schweitzer, J.M.

    1998-11-23

    Kinetic modelling of petroleum hydrocracking is particularly difficult given the complexity of the feedstocks. There are two distinct classes of kinetics models: lumped empirical models and detailed molecular models. The productivity of lumped empirical models is generally not very accurate, and the number of kinetic parameters increases rapidly with the number of lumps. A promising new methodology is the use of kinetic modelling based on the single events theory. Due to the molecular approach, a finite and limited number of kinetic parameters can describe the kinetic behaviour of the hydrocracking of heavy feedstock. The parameters are independent of the feedstock. However, the available analytical methods are not able to identify the products on the molecular level. This can be accounted for by means of an posteriori lamping technique, which incorporates the detailed knowledge of the elementary step network. Thus, the lumped kinetic parameters are directly calculated from the fundamental kinetic coefficients and the single event model is reduced to a re-lumped molecular model. Until now, the ability of the method to extrapolate to higher carbon numbers had not been demonstrated. In addition, no study had been published for three phase (gas-liquid-solid) systems and a complex feedstock. The objective of this work is to validate the `single events` method using a paraffinic feedstock. First of all, a series of experiments was conducted on a model compound (hexadecane) in order to estimate the fundamental kinetic parameters for acyclic molecules. To validate the single event approach, these estimated kinetic coefficients were used to simulate hydrocracking of a paraffinic mixture ranging from C11 to C18. The simulation results were then compared to the results obtained from the hydrocracking experiments. The comparison allowed to validate the model for acyclic molecules and to demonstrate that the model is applicable to compounds with higher carbon numbers. (author

  10. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  11. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  12. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  13. Selective scanning tunnelling microscope electron-induced reactions of single biphenyl molecules on a Si(100) surface.

    Science.gov (United States)

    Riedel, Damien; Bocquet, Marie-Laure; Lesnard, Hervé; Lastapis, Mathieu; Lorente, Nicolas; Sonnet, Philippe; Dujardin, Gérald

    2009-06-03

    Selective electron-induced reactions of individual biphenyl molecules adsorbed in their weakly chemisorbed configuration on a Si(100) surface are investigated by using the tip of a low-temperature (5 K) scanning tunnelling microscope (STM) as an atomic size source of electrons. Selected types of molecular reactions are produced, depending on the polarity of the surface voltage during STM excitation. At negative surface voltages, the biphenyl molecule diffuses across the surface in its weakly chemisorbed configuration. At positive surface voltages, different types of molecular reactions are activated, which involve the change of adsorption configuration from the weakly chemisorbed to the strongly chemisorbed bistable and quadristable configurations. Calculated reaction pathways of the molecular reactions on the silicon surface, using the nudge elastic band method, provide evidence that the observed selectivity as a function of the surface voltage polarity cannot be ascribed to different activation energies. These results, together with the measured threshold surface voltages and the calculated molecular electronic structures via density functional theory, suggest that the electron-induced molecular reactions are driven by selective electron detachment (oxidation) or attachment (reduction) processes.

  14. Spectroscopy of low-lying single-particle states in $^{81}$Zn populated in the $^{80}$Zn(d,p) reaction

    CERN Multimedia

    The aim of this proposal is the study of single-particle states of $^{81}$Zn via the $^{80}$Zn(d,p) reaction in inverse kinematics. $^{81}$Zn will be produced by means of a laser-ionized, 5.5 MeV/u HIE-Isolde $^{80}$Zn beam impinging on a deuterated-polyethylene target. The protons and $\\gamma$-rays emitted in the reaction will be studied using the Miniball + T-REX setup. This experiment will constitute the first spectroscopic study of $^{81}$Zn, which is critically important to determine the energy and ordering of neutron single-particle orbits above the N=50 gap and the properties of $^{78}$Ni.

  15. Experimental Determination of the Possible Deuterium - Deuterium Fusion Reaction Originated in a Single Cavitation Bubble Luminescence System Using CDCL3 and D2 O

    International Nuclear Information System (INIS)

    Barbaglia, Mario; Florido, Pablo; Mayer, Roberto; Bonetto, Fabian

    2003-01-01

    We focus this work on the measurement of the possible Deuterium - Deuterium reaction in a SCBL (Single Cavitation Bubble Luminescence) system.We measure the possible reaction at the bubble generation time and at the bubble collapse time. We use a Nd:YAG laser and CDCl 3 and D 2 O as a medium to generate the bubble. Since CDCl 3 accommodation coefficient is best than that of D 2 O, it is expected a greater collapse force than using D 2 O.To benefit the bubble collapse violence, we diminish the temperature of the liquids.To avoid false neutron detection, we developed a measuring system with high background reject using the characteristic experiment times.No neutrons attributable to Deuterium - Deuterium fusion reaction were measured

  16. Study on HCl Driving Force for the Reaction of NaCl-Maleic Acid Mixing Single Droplet Using Micro-FTIR Spectroscopy

    Science.gov (United States)

    He, Xiang; Zhang, Yunhong

    2016-04-01

    Chemical aging is the one of the most important physicochemical process in atmospheric aerosols. Mixing of sea salt and water-soluble organic components has profound effects on the volatile characteristic and evolving chemical composition of the anthropogenic origin aerosols, which are poorly understood. In this study, the chemical reaction behavior of the mixture of NaCl and maleic acid (H2MA) micron-level single droplet was investigated using a gas-flow system combined with microscopic Fourier transform infrared (micro-FTIR) spectrometer over the range of relative humidity (63˜95% RH) for the first time. The results showed that the mixture of NaCl and H2MA single droplet could react to form monosodium maleate salt (NaHMA) at the constant RH from the characterization of the FTIR. The reaction is a result of an acid displacement reaction R1, which is driven by high volatility of the HCl product. NaCl(aq)+H2MA(aq)=NaHMA(aq)+HCl(aq,g) (R1) According to the change tendency of the absorbance values of 1579 cm-1 COO- stretching band of the NaHMA dependent upon reaction times at different RHs, the growth range of the trend which could lead to the faster reaction rate was obvious at lower RH. The water content of the droplet was also more likely to reduce rapidly with the loss of the RH from the absorbance changes of 3400 cm-1H2O stretching band dependent upon reaction times. These may be due to irreversible evaporation of HCl gas which is the main driving force for this type of reaction and the NaHMA is a less hygroscopic component compared to H2MA. And the HCl gas is more likely to evaporate faster from the single droplet and promote the reaction rate and the consumption of water content at lower RH. These results could help in understanding the chemical conversion processes of water-soluble dicarboxylic acids to dicarboxylate salts, as well as the consumption of Cl in sea salt aerosols by organic acids in the atmosphere.

  17. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  18. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  19. Scattering of polarized electrons from polarized targets: Coincidence reactions and prescriptions for polarized half-off-shell single-nucleon cross sections

    International Nuclear Information System (INIS)

    Caballero, J.A.; Massachusetts Inst. of Tech., Cambridge, MA; Donnelly, T.W.; Massachusetts Inst. of Tech., Cambridge, MA; Poulis, G.I.; Massachusetts Inst. of Tech., Cambridge, MA

    1993-01-01

    Coincidence reactions of the type vector A( vector e, e'N)B involving the scattering of polarized electrons from polarized targets are discussed within the context of the plane-wave impulse approximation. Prescriptions are developed for polarized half-off single-nucleon cross sections; the different prescriptions are compared for typical quasi-free kinematics. Illustrative results are presented for coincidence polarized electron scattering from typical polarized nuclei. (orig.)

  20. Process-independent radiative-correction formula for single-tag and double-tag measurements of γγ reactions

    International Nuclear Information System (INIS)

    Ong, S.; Kessler, P.

    1988-01-01

    A simple and process-independent formula is given for radiative corrections in single-tag and double-tag measurements of γγ reactions. Its conditions of validity are that (i) in the γγ process itself all particles produced are detected and (ii) final-state particles, including the tagged electron(s), are measured with a good resolution in energy and momentum

  1. Shape evolution of new-phased lepidocrocite VOOH from single-shelled to double-shelled hollow nanospheres on the basis of programmed reaction-temperature strategy.

    Science.gov (United States)

    Wu, Changzheng; Zhang, Xiaodong; Ning, Bo; Yang, Jinlong; Xie, Yi

    2009-07-06

    Solid templates have been long regarded as one of the most promising ways to achieve single-shelled hollow nanostructures; however, few effective methods for the construction of multishelled hollow objects from their solid template counterparts have been developed. We report here, for the first time, a novel and convenient route to synthesizing double-shelled hollow spheres from the solid templates via programming the reaction-temperature procedures. The programmed temperature strategy developed in this work then provides an essential and general access to multishelled hollow nanostructures based on the designed extension of single-shelled hollow objects, independent of their outside contours, such as tubes, hollow spheres, and cubes. Starting from the V(OH)(2)NH(2) solid templates, we show that the relationship between the hollowing rate and the reaction temperature obey the Van't Hoff rule and Arrhenius activation-energy equation, revealing that it is the chemical reaction rather than the diffusion process that guided the whole hollowing process, despite the fact that the coupled reaction/diffusion process is involved in the hollowing process. Using the double-shelled hollow spheres as the PCM (CaCl(2).6H(2)O) matrix grants much better thermal-storage stability than that for the nanoparticles counterpart, revealing that the designed nanostructures can give rise to significant improvements for the energy-saving performance in future "smart house" systems.

  2. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  3. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  4. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  5. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  6. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  7. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  8. Influence of reactions heats on variation of radius, temperature, pressure and chemical species amounts within a single acoustic cavitation bubble.

    Science.gov (United States)

    Kerboua, Kaouther; Hamdaoui, Oualid

    2018-03-01

    The scientific interest toward the study of acoustic bubble is mainly explained by its practical benefit in providing a reactional media favorable to the rapid evolution of chemical mechanism. The evolution of this mechanism is related to the simultaneous and dependent variation of the volume, temperature and pressure within the bubble, retrieved by the resolution of a differential equations system, including among others the thermal balance. This last one is subject to different assumptions, some authors deem simply that the temperature varies adiabatically during the collapsing phase, without considering the reactions heat of the studied mechanism. This paper aims to evaluate the pertinence of neglecting reactions heats in the thermal balance, by analyzing their effect on the variation of radius, temperature, pressure and chemical species amounts. The results show that the introduction of reactions heats conducts to a decrease of the temperature, an increase of the pressure and a reduction of the bubble volume. As a consequence, this leads to a drop of the quantities of free radicals produced by the chemical mechanism evolving within the bubble. This paper also proved that the impact of the consideration of reactions heats is dependent of the frequency and the acoustic amplitude of the ultrasonic wave. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  10. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  11. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  12. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  13. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  14. Skin reaction and regeneration after single sodium lauryl sulfate exposure stratified by filaggrin genotype and atopic dermatitis phenotype

    DEFF Research Database (Denmark)

    Bandier, J; Carlsen, B C; Rasmussen, M A

    2015-01-01

    and AD phenotype on irritant response and skin regeneration. OBJECTIVES: To investigate the role of FLGnull and AD groups for skin reaction and recovery after sodium lauryl sulfate (SLS) irritation. METHODS: This is a case-control study comprising 67 subjects, including healthy controls and patients...

  15. THE MODELING OF COUNTER-ROTATING TWIN-SCREW EXTRUDERS AS REACTORS FOR SINGLE-COMPONENT REACTIONS

    NARCIS (Netherlands)

    GANZEVELD, KJ; CAPEL, JE; VANDERWAL, DJ; JANSSEN, LPBM

    Numerical models are useful to study the behaviour of the extruder as a polymerization reactor. With a correct numerical model a theoretical analysis of the influence of several reaction and extruder parameters can be made, the limitations of the use of the extruder reactor can be determined and the

  16. Probing the Energy Transfer Dynamics of Photosynthetic Reaction Center Complexes Through Hole-Burning and Single-Complex Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Kerry Joseph [Iowa State Univ., Ames, IA (United States)

    2007-01-01

    Photosynthesis is the process by which light energy is used to drive reactions that generate sugars to supply energy for cellular processes. It is one of the most important fundamental biological reactions and occurs in both prokaryotic (e.g. bacteria) and eukaryotic (e.g. plants and algae) organisms. Photosynthesis is also remarkably intricate, requiring the coordination of many different steps and reactions in order to successfully transform absorbed solar energy into a biochemical usable form of energy. However, the net reaction for all photosynthetic organisms can be reduced to the following, deceptively general, equation developed by Van Niel[1] H2 - D + Aimplieshv A - H2 + D where H2-D is the electron donor, e.g. H2O, H2S. A is the electron acceptor, e.g. CO2, and A-H2 is the synthesized sugar. Amazingly, this simple net equation is responsible for creating the oxidizing atmosphere of Earth and the recycling of CO2, both of which are necessary for the sustainment of the global ecosystem.

  17. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  18. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  19. Polymerase chain reaction as a tool for developing stress protein probes

    Energy Technology Data Exchange (ETDEWEB)

    Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

    1994-08-01

    Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

  20. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  1. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  2. Selection of single grain seeds by 14N(n,γ)15N nuclear reaction for protein improvement

    International Nuclear Information System (INIS)

    Andras, L.; Csoke, A.; Nagy, A.Z.; Balint, A.

    1979-01-01

    A new non-destructive screening technique was developed for determining the protein (total nitrogen) content of single grain seeds. Here, our first experiment is described where in the case of maize samples, 300 s was used to perform one measurement on a seed with a semiautomatic device. (author)

  3. An Immunofluorescence-assisted Microfluidic Single Cell Quantitative Reverse Transcription Polymerase Chain Reaction Analysis of Tumour Cells Separated from Blood

    Directory of Open Access Journals (Sweden)

    Kazunori Hoshino

    2015-11-01

    matched the results from a few thousand cells. Some markers (e.g., ER, HER2 that are commonly used for cancer identification showed relatively large deviations in expres‐ sion levels. However, others (e.g., GRB7 showed devia‐ tions that are small enough to supplement single cell disease profiling.

  4. Untangling reaction pathways through modern approaches to high-throughput single-molecule force-spectroscopy experiments

    NARCIS (Netherlands)

    Dulin, D.; Berghuis, B.A.; Depken, S.M.; Dekker, N.H.

    2015-01-01

    Single-molecule experiments provide a unique means for real-time observation of the activity of individual biomolecular machines. Through such techniques, insights into the mechanics of for example, polymerases, helicases, and packaging motors have been gleaned. Here we describe the recent advances

  5. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  6. Graphite Carbon-Supported Mo2C Nanocomposites by a Single-Step Solid State Reaction for Electrochemical Oxygen Reduction.

    Science.gov (United States)

    Huang, K; Bi, K; Liang, C; Lin, S; Wang, W J; Yang, T Z; Liu, J; Zhang, R; Fan, D Y; Wang, Y G; Lei, M

    2015-01-01

    Novel graphite-molybdenum carbide nanocomposites (G-Mo2C) are synthesized by a typical solid state reaction with melamine and MoO3 as precursors under inert atmosphere. The characterization results indicate that G-Mo2C composites are composed of high crystallization and purity of Mo2C and few layers of graphite carbon. Mo2C nanoparticles with sizes ranging from 5 to 50 nm are uniformly supported by surrounding graphite layers. It is believed that Mo atom resulting from the reduction of MoO3 is beneficial to the immobilization of graphite carbon. Moreover, the electrocatalytic performances of G-Mo2C for ORR in alkaline medium are investigated by cyclic voltammetry (CV), rotating disk electrode (RDE) and chronoamperometry test with 3M methanol. The results show that G-Mo2C has a considerable catalytic activity and superior methanol tolerance performance for the oxygen reduction reaction (ORR) benefiting from the chemical interaction between the carbide nanoparticles and graphite carbon.

  7. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  8. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  9. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  10. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  11. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    Science.gov (United States)

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  12. Skin reaction and regeneration after single sodium lauryl sulfate exposure stratified by filaggrin genotype and atopic dermatitis phenotype.

    Science.gov (United States)

    Bandier, J; Carlsen, B C; Rasmussen, M A; Petersen, L J; Johansen, J D

    2015-06-01

    Filaggrin is key for the integrity of the stratum corneum. Mutations in the filaggrin gene (FLGnull) play a prominent role in atopic dermatitis (AD) pathogenesis. People with AD have increased susceptibility to irritants. However, little is known about the effect of filaggrin genotype and AD phenotype on irritant response and skin regeneration. To investigate the role of FLGnull and AD groups for skin reaction and recovery after sodium lauryl sulfate (SLS) irritation. This is a case-control study comprising 67 subjects, including healthy controls and patients with and without FLGnull and AD. Reactivity to different doses of SLS at 24, 48, 72 and 145 h after SLS application was measured by transepidermal water loss (TEWL) and laser Doppler flowmetry (LDF). Reactivity was assessed univariately and by pattern analysis. All patient groups showed a higher degree of skin-barrier disruption and inflammation than did controls in response to SLS. Assessing reactivity by the delta value of the area under the curve for both TEWL and LDF showed significant differences between healthy controls and those with the AD phenotype, irrespective of filaggrin mutation. The poorest regeneration was among those with the AD phenotype. The two AD phenotype groups were separated by multivariate technique, due to earlier inflammatory reactivity among subjects with FLGnullplus AD compared with the AD phenotype alone. Both skin reaction and regeneration were significantly different between the patient population and the healthy controls. Additionally, response severity and regeneration depended more on AD phenotype than on filaggrin genotype, whereas the response was more rapid among the FLGnullplus AD individuals. © 2015 British Association of Dermatologists.

  13. Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

    Science.gov (United States)

    Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

    2013-03-15

    We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  15. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  16. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  17. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  18. Chromosome copy analysis by single-cell comparative genomic hybridization technique based on primer extension preamplification and degenerate oligonucleotide primed-PCR%引物延伸预扩增结合简并引物PCR在单细胞比较基因组杂交分析染色体异常中的应用

    Institute of Scientific and Technical Information of China (English)

    谭珂; 狄玉芬; 程德华; 徐芳; 卢光绣; 谭跃球

    2010-01-01

    Objective To establish a single-cell whole genome amplification (WGA) technique, in combination with comparative genomic hybridization (CGH), for analyzing chromosomal copy number changes, and to explore its clinical application in preimplantation genetic diagnosis (PGD). Methods Twelve single cell samples with known karyotypes, including 5 chorionic villus samples, 4 human embryonic stem cell (hESC) samples and 3 peripheral lymphocyte samples, and 4 single blastomere samples carrying chromosomal abnormalities detected by PGD, were collected for whole genome amplification by combining primer extension preamplification (PEP) with degenerate oligonucleotide primed-PCR (DOP-PCR)amplification. The amplified products labeled by red fluorescence were mixed with control DNA labeled by green fluorescence, and then the mixture was analyzed by CGH. As a comparison, 10 single cell samples were amplified by DOP-PCR only and then CGH analysis was performed. Results The amplification using PEP-DOP-PCR was more stable than traditional DOP-PCR. The products of PEP-DOP-PCR range from 100 bp to 1000 bp, with the mean size being about 400 bp. The CGH results were consistent with analyses by other methods. However, only 6 out of 10 single cell samples were successfully amplified by DOP-PCR,and CGH analysis showed a high background and 2 samples showed inconsistent results from other methods. Conclusion PEP-DOP-PCR can effectively amplify the whole genome DNA of single cell.Combined with CGH, this WGA method can successfully detect single-cell chromosomal copy number changes, while DOP-PCR was easy to fail to amplify and amplify inhomogeneousty, and CGH analysis using this PCR product usually showed high background. These results suggest that PEP-DOP-CGH is a promising method for preimplantation genetic diagnosis.%目的 建立一种可信的单细胞全基因组扩增(whole genome amplification.WGA)技术,结合比较基因组杂交(comparative genomic hybridization,CGH)分析单细

  19. Quasielastic reactions

    International Nuclear Information System (INIS)

    Henning, W.

    1979-01-01

    Quasielastic reaction studies, because of their capability to microscopically probe nuclear structure, are still of considerable interest in heavy-ion reactions. The recent progress in understanding various aspects of the reaction mechanism make this aim appear closer. The relation between microscopic and macroscopic behavior, as suggested, for example, by the single proton transfer data to individual final states or averaged excitation energy intervals, needs to be explored. It seems particularly useful to extend measurements to higher incident energies, to explore and understand nuclear structure aspects up to the limit of the energy range where they are important

  20. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  1. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  2. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  3. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  4. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  5. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  6. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  7. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  8. A single mutation in the castor Δ9-18:0-desaturase changes reaction partitioning from desaturation to oxidase chemistry

    Science.gov (United States)

    Guy, Jodie E.; Abreu, Isabel A.; Moche, Martin; Lindqvist, Ylva; Whittle, Edward; Shanklin, John

    2006-01-01

    Sequence analysis of the diiron cluster-containing soluble desaturases suggests they are unrelated to other diiron enzymes; however, structural alignment of the core four-helix bundle of desaturases to other diiron enzymes reveals a conserved iron binding motif with similar spacing in all enzymes of this structural class, implying a common evolutionary ancestry. Detailed structural comparison of the castor desaturase with that of a peroxidase, rubrerythrin, shows remarkable conservation of both identity and geometry of residues surrounding the diiron center, with the exception of residue 199. Position 199 is occupied by a threonine in the castor desaturase, but the equivalent position in rubrerythrin contains a glutamic acid. We previously hypothesized that a carboxylate in this location facilitates oxidase chemistry in rubrerythrin by the close apposition of a residue capable of facilitating proton transfer to the activated oxygen (in a hydrophobic cavity adjacent to the diiron center based on the crystal structure of the oxygen-binding mimic azide). Here we report that desaturase mutant T199D binds substrate but its desaturase activity decreases by ≈2 × 103-fold. However, it shows a >31-fold increase in peroxide-dependent oxidase activity with respect to WT desaturase, as monitored by single-turnover stopped-flow spectrometry. A 2.65-Å crystal structure of T199D reveals active-site geometry remarkably similar to that of rubrerythrin, consistent with its enhanced function as an oxidase enzyme. That a single amino acid substitution can switch reactivity from desaturation to oxidation provides experimental support for the hypothesis that the desaturase evolved from an ancestral oxidase enzyme. PMID:17088542

  9. The importance of a single methyl group in determining the reaction chemistry of pentamethylcyclopentadienyl cyclooctatetraenyl uranium metallocenes

    Energy Technology Data Exchange (ETDEWEB)

    Takase, Michael K.; Ziller, Joseph W.; Evans, William J. [Department of Chemistry, University of California, Irvine, CA (United States)

    2011-04-18

    The steric factors that allow trivalent [(C{sub 5}Me{sub 5}){sub 3}U] (1) to function as a three-electron reductant with C{sub 8}H{sub 8} to form tetravalent [{(C_5Me_5)(C_8H_8)U}{sub 2}(μ-C{sub 8}H{sub 8})] (2) have been explored by examining the synthesis and reactivity of the intermediate, ''[(C{sub 5}Me{sub 5}){sub 2}(C{sub 8}H{sub 8})U]'' (3), and the slightly less crowded analogues, [(C{sub 5}Me{sub 5})(C{sub 5}Me{sub 4}H)(C{sub 8}H{sub 8})U] and [(C{sub 5}Me{sub 4}H){sub 2}(C{sub 8}H{sub 8})U], that have, successively one less methyl group. The reaction of [{(C_5Me_5)(C_8H_8)U(μ-OTf)}{sub 2}] (4; OTf=OSO{sub 2}CF{sub 3}) with two equivalents of KC{sub 5}Me{sub 5} in THF gave ring-opening to ''[(C{sub 5}Me{sub 5})(C{sub 8}H{sub 8})U{O(CH_2)_4(C_5Me_5)}]'' consistent with in situ formation of 3. Reaction of 4 with two and four equivalents of KC{sub 5}Me{sub 4}H generates two equivalents of [(C{sub 5}Me{sub 5})(C{sub 5}Me{sub 4}H)(C{sub 8}H{sub 8})U] (5) and [(C{sub 5}Me{sub 4}H){sub 2}(C{sub 8}H{sub 8})U] (6), respectively, which in contrast to 3 were isolable. Tetravalent 5 reduces phenazine and PhEEPh (E=S, Se, and Te) to form the tetravalent uranium reduction products, [{(C_5Me_5)(C_8H_8)U}{sub 2}(μ-C{sub 12}H{sub 8}N{sub 2})] (7), [{(C_5Me_5)(C_8H_8)U}{sub 2}(μ-SPh){sub 2}] (8), [{(C_5Me_5)(C_8H_8)U}{sub 2}(μ-SePh){sub 2}] (9), and [{(C_5Me_5)(C_8H_8)U}{sub 2}(μ-TePh){sub 2}] (10), consistent with sterically induced reduction. In contrast, the less sterically crowded 6 does not react with these substrates. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  11. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  12. Study of single particle properties of nuclei in the region of the "island of inversion" by means of neutron-transfer reactions

    CERN Multimedia

    Kruecken, R; Voulot, D

    2007-01-01

    We are aiming at the investigation of single particle properties of neutron-rich nuclei in the region of the "island of inversion" where intruder states from the $\\{fp}$-shell favour deformed ground states instead of the normal spherical $\\textit{sd}$-shell states. As first experiment, we propose to study single particle states in the neutron-rich isotope $^{31}$Mg. The nucleus will be populated by a one-neutron transfer reaction with a $^{30}$Mg beam at 3 MeV/u obtained from REX-ISOLDE impinging on a CD$_{2}$ target. The $\\gamma$-rays will be detected by the MINIBALL array and the particles by a newly built set-up of segmented Si detectors with a angular coverage of nearly 4$\\pi$. Relative spectroscopic factors extracted from the cross sections will enable us to pin down the configurations of the populated states. These will be compared to recent shell model calculations involving new residual interactions. This will shed new light on the evolution of single particle structure leading to the breaking of the ...

  13. Meaurement of the target single-spin asymmetry in quasi-elastic region from the reaction {sup 3}He{up_arrow}(e,e')

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yawei [Rutgers

    2013-10-01

    A measurement of the inclusive target single-spin asymmetry has been performed using the quasi-elastic {sup 3}He{up_arrow}(e,e') reaction with a vertically polarized {sup 3}He target at Q{sup 2} values of 0.13, 0.46 and 0.97 GeV{sup 2}. This asymmetry vanishes under the one photon exchange assumption. But the interference between two-photon exchange and one-photon exchange gives rise to an imaginary amplitude, so that a non-zero A{sub y} is allowed. The experiment, conducted in Hall A of Jefferson Laboratory in 2009, used two independent spectrometers to simultaneously measure the target single-spin asymmetry. Using the effective polarization approximation, the neutron single-spin asymmetries were extracted from the measured {sup 3}He asymmetries. The measurement is to establish a non-vanishing A{sub y}. Non-zero asymmetries were observed at all Q{sup 2} points, and the overall precision is an order of magnitude improved over the existing proton data. The data provide new constraints on Generalized Parton Distribution (GPD) models and new information on the dynamics of the two-photon exchange process.

  14. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  15. High-Pressure Catalytic Reactions of C6 Hydrocarbons on PlatinumSingle-Crystals and nanoparticles: A Sum Frequency Generation VibrationalSpectroscopic and Kinetic Study

    Energy Technology Data Exchange (ETDEWEB)

    Bratlie, Kaitlin [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Catalytic reactions of cyclohexene, benzene, n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene on platinum catalysts were monitored in situ via sum frequency generation (SFG) vibrational spectroscopy and gas chromatography (GC). SFG is a surface specific vibrational spectroscopic tool capable of monitoring submonolayer coverages under reaction conditions without gas-phase interference. SFG was used to identify the surface intermediates present during catalytic processes on Pt(111) and Pt(100) single-crystals and on cubic and cuboctahedra Pt nanoparticles in the Torr pressure regime and at high temperatures (300K-450K). At low pressures (<10-6 Torr), cyclohexene hydrogenated and dehydrogenates to form cyclohexyl (C6H11) and π-allyl C6H9, respectively, on Pt(100). Increasing pressures to 1.5 Torr form cyclohexyl, π-allyl C6H9, and 1,4-cyclohexadiene, illustrating the necessity to investigate catalytic reactions at high-pressures. Simultaneously, GC was used to acquire turnover rates that were correlated to reactive intermediates observed spectroscopically. Benzene hydrogenation on Pt(111) and Pt(100) illustrated structure sensitivity via both vibrational spectroscopy and kinetics. Both cyclohexane and cyclohexene were produced on Pt(111), while only cyclohexane was formed on Pt(100). Additionally, π-allyl c-C6H9 was found only on Pt(100), indicating that cyclohexene rapidly dehydrogenates on the (100) surface. The structure insensitive production of cyclohexane was found to exhibit a compensation effect and was analyzed using the selective energy transfer (SET) model. The SET model suggests that the Pt-H system donates energy to the E2u mode of free benzene, which leads to catalysis. Linear C6 (n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene) hydrocarbons were also investigated in the presence and absence of excess hydrogen on Pt

  16. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  18. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  19. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  20. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  1. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  2. The effect of defects on the catalytic activity of single Au atom supported carbon nanotubes and reaction mechanism for CO oxidation.

    Science.gov (United States)

    Ali, Sajjad; Fu Liu, Tian; Lian, Zan; Li, Bo; Sheng Su, Dang

    2017-08-23

    The mechanism of CO oxidation by O 2 on a single Au atom supported on pristine, mono atom vacancy (m), di atom vacancy (di) and the Stone Wales defect (SW) on single walled carbon nanotube (SWCNT) surface is systematically investigated theoretically using density functional theory. We determine that single Au atoms can be trapped effectively by the defects on SWCNTs. The defects on SWCNTs can enhance both the binding strength and catalytic activity of the supported single Au atom. Fundamental aspects such as adsorption energy and charge transfer are elucidated to analyze the adsorption properties of CO and O 2 and co-adsorption of CO and O 2 molecules. It is found that CO binds stronger than O 2 on Au supported SWCNT. We clearly demonstrate that the defected SWCNT surface promotes electron transfer from the supported single Au atom to O 2 molecules. On the other hand, this effect is weaker for pristine SWCNTs. It is observed that the high density of spin-polarized states are localized in the region of the Fermi level due to the strong interactions between Au (5d orbital) and the adjacent carbon (2p orbital) atoms, which influence the catalytic performance. In addition, we elucidate both the Langmuir-Hinshelwood (LH) and Eley-Rideal (ER) mechanisms of CO oxidation by O 2 . For the LH pathway, the barriers of the rate-limiting step are calculated to be 0.02 eV and 0.05 eV for Au/m-SWCNT and Au/di-SWCNT, respectively. To regenerate the active sites, an ER-like reaction occurs to form a second CO 2 molecule. The ER pathway is observed on Au/m-SWCNT, Au/SW-SWCNT and Au/SWCNT in which the Au/m-SWCNT has a smaller barrier. The comparison with a previous study (Lu et al., J. Phys. Chem. C, 2009, 113, 20156-20160.) indicates that the curvature effect of SWCNTs is important for the catalytic property of the supported single Au. Overall, Au/m-SWCNT is identified as the most active catalyst for CO oxidation compared to pristine SWCNT, SW-SWCNT and di-SWCNT. Our findings give a

  3. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  4. Optimised padlock probe ligation and microarray detection of multiple (non-authorised GMOs in a single reaction

    Directory of Open Access Journals (Sweden)

    Schoen Cor D

    2008-12-01

    Full Text Available Abstract Background To maintain EU GMO regulations, producers of new GM crop varieties need to supply an event-specific method for the new variety. As a result methods are nowadays available for EU-authorised genetically modified organisms (GMOs, but only to a limited extent for EU-non-authorised GMOs (NAGs. In the last decade the diversity of genetically modified (GM ingredients in food and feed has increased significantly. As a result of this increase GMO laboratories currently need to apply many different methods to establish to potential presence of NAGs in raw materials and complex derived products. Results In this paper we present an innovative method for detecting (approved GMOs as well as the potential presence of NAGs in complex DNA samples containing different crop species. An optimised protocol has been developed for padlock probe ligation in combination with microarray detection (PPLMD that can easily be scaled up. Linear padlock probes targeted against GMO-events, -elements and -species have been developed that can hybridise to their genomic target DNA and are visualised using microarray hybridisation. In a tenplex PPLMD experiment, different genomic targets in Roundup-Ready soya, MON1445 cotton and Bt176 maize were detected down to at least 1%. In single experiments, the targets were detected down to 0.1%, i.e. comparable to standard qPCR. Conclusion Compared to currently available methods this is a significant step forward towards multiplex detection in complex raw materials and derived products. It is shown that the PPLMD approach is suitable for large-scale detection of GMOs in real-life samples and provides the possibility to detect and/or identify NAGs that would otherwise remain undetected.

  5. Optimised padlock probe ligation and microarray detection of multiple (non-authorised) GMOs in a single reaction.

    Science.gov (United States)

    Prins, Theo W; van Dijk, Jeroen P; Beenen, Henriek G; Van Hoef, Am Angeline; Voorhuijzen, Marleen M; Schoen, Cor D; Aarts, Henk J M; Kok, Esther J

    2008-12-04

    To maintain EU GMO regulations, producers of new GM crop varieties need to supply an event-specific method for the new variety. As a result methods are nowadays available for EU-authorised genetically modified organisms (GMOs), but only to a limited extent for EU-non-authorised GMOs (NAGs). In the last decade the diversity of genetically modified (GM) ingredients in food and feed has increased significantly. As a result of this increase GMO laboratories currently need to apply many different methods to establish to potential presence of NAGs in raw materials and complex derived products. In this paper we present an innovative method for detecting (approved) GMOs as well as the potential presence of NAGs in complex DNA samples containing different crop species. An optimised protocol has been developed for padlock probe ligation in combination with microarray detection (PPLMD) that can easily be scaled up. Linear padlock probes targeted against GMO-events, -elements and -species have been developed that can hybridise to their genomic target DNA and are visualised using microarray hybridisation.In a tenplex PPLMD experiment, different genomic targets in Roundup-Ready soya, MON1445 cotton and Bt176 maize were detected down to at least 1%. In single experiments, the targets were detected down to 0.1%, i.e. comparable to standard qPCR. Compared to currently available methods this is a significant step forward towards multiplex detection in complex raw materials and derived products. It is shown that the PPLMD approach is suitable for large-scale detection of GMOs in real-life samples and provides the possibility to detect and/or identify NAGs that would otherwise remain undetected.

  6. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  7. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  8. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  9. Nuclear reaction analysis of Ge ion-implanted ZnO bulk single crystals: The evaluation of the displacement in oxygen lattices

    Energy Technology Data Exchange (ETDEWEB)

    Kamioka, K.; Oga, T.; Izawa, Y. [College of Engineering and Research Center of Ion Beam Technology, Hosei University, Koganei, Tokyo 184-8584 (Japan); Kuriyama, K., E-mail: kuri@ionbeam.hosei.ac.jp [College of Engineering and Research Center of Ion Beam Technology, Hosei University, Koganei, Tokyo 184-8584 (Japan); Kushida, K. [Department of Arts and Science, Osaka Kyouiku University, Kashiwara, Osaka 582-8582 (Japan); Kinomura, A. [National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305-8568 (Japan)

    2014-08-01

    The displacement of oxygen lattices in Ge ion-implanted ZnO bulk single crystals is studied by nuclear reaction analysis (NAR), photoluminescence (PL), and Van der Pauw methods. The Ge ion-implantation (net concentration: 2.6 × 10{sup 20} cm{sup −3}) into ZnO is performed using a multiple-step energy. The high resistivity of ∼10{sup 3} Ω cm in un-implanted samples remarkably decreased to ∼10{sup −2} Ω cm after implanting Ge-ion and annealing subsequently. NRA measurements of as-implanted and annealed samples suggest the existence of the lattice displacement of O atoms acting as acceptor defects. As O related defects still remain after annealing, these defects are not attributed to the origin of the low resistivity in 800 and 1000 °C annealed ZnO.

  10. Nuclear reaction analysis of Ge ion-implanted ZnO bulk single crystals: The evaluation of the displacement in oxygen lattices

    Science.gov (United States)

    Kamioka, K.; Oga, T.; Izawa, Y.; Kuriyama, K.; Kushida, K.; Kinomura, A.

    2014-08-01

    The displacement of oxygen lattices in Ge ion-implanted ZnO bulk single crystals is studied by nuclear reaction analysis (NAR), photoluminescence (PL), and Van der Pauw methods. The Ge ion-implantation (net concentration: 2.6 × 1020 cm-3) into ZnO is performed using a multiple-step energy. The high resistivity of ∼103 Ω cm in un-implanted samples remarkably decreased to ∼10-2 Ω cm after implanting Ge-ion and annealing subsequently. NRA measurements of as-implanted and annealed samples suggest the existence of the lattice displacement of O atoms acting as acceptor defects. As O related defects still remain after annealing, these defects are not attributed to the origin of the low resistivity in 800 and 1000 °C annealed ZnO.

  11. Defect-induced Catalysis toward the Oxygen Reduction Reaction in Single-walled Carbon Nanotube: Nitrogen doped and Non-nitrogen doped

    International Nuclear Information System (INIS)

    Lu, Di; Wu, Dan; Jin, Jian; Chen, Liwei

    2016-01-01

    Single-walled carbon nanotubes (SWNTs) are post-treated by argon (Ar) or ammonia (NH 3 ) plasma irradiation to introduce defects that are potentially related to catalysis towards the oxygen reduction reaction (ORR). Electrochemical characterization in alkali medium suggests that the plasma irradiated SWNTs demonstrate enhanced catalytic activity toward the ORR with a positively shifted threshold potential. Moreover the enhanced desired four-electron pathway catalytic activity, which exhibited as the positive shifted threshold potential, is independent of the nitrogen dopant. The nature of the defects is probed with Raman and X-ray photoelectron spectroscopy. The results indicate that the non-nitrogen doped defects of SWNTs contribute to the actual active site for the ORR.

  12. Dynamic disorder in single-molecule Michaelis-Menten kinetics: The reaction-diffusion formalism in the Wilemski-Fixman approximation

    Science.gov (United States)

    Chaudhury, Srabanti; Cherayil, Binny J.

    2007-09-01

    Single-molecule equations for the Michaelis-Menten [Biochem. Z. 49, 333 (1913)] mechanism of enzyme action are analyzed within the Wilemski-Fixman [J. Chem. Phys. 58, 4009 (1973); 60, 866 (1974)] approximation after the effects of dynamic disorder—modeled by the anomalous diffusion of a particle in a harmonic well—are incorporated into the catalytic step of the reaction. The solution of the Michaelis-Menten equations is used to calculate the distribution of waiting times between successive catalytic turnovers in the enzyme β-galactosidase. The calculated distribution is found to agree qualitatively with experimental results on this enzyme obtained at four different substrate concentrations. The calculations are also consistent with measurements of correlations in the fluctuations of the fluorescent light emitted during the course of catalysis, and with measurements of the concentration dependence of the randomness parameter.

  13. Development of a Nuclear Reaction Database on Silicon for Simulation of Neutron-Induced Single-Event Upsets in Microelectronics and its Application

    International Nuclear Information System (INIS)

    Watanabe, Yukinobu; Kodama, Akihiro; Tukamoto, Yasuyuki; Nakashima, Hideki

    2005-01-01

    We have developed a cross-section database for neutron-induced reactions on 28Si in the energy range between 2 MeV and 3 GeV in order to analyze single-event upsets (SEUs) phenomena induced by cosmic-ray neutrons in microelectronic devices. A simplified spherical device model is proposed for simulation of the initial processes of SEUs. The model is applied to SEU cross-section calculations for semiconductor memory devices. The calculated results are compared with measured SEU cross sections and the other simulation result. The dependence of SEU cross sections on incident neutron energy and secondary ions having the most important effects on SEUs are discussed

  14. Single-molecule fluorescence measurements reveal the reaction mechanisms of the core RISC, composed of human Argonaute 2 and a guide RNA.

    Science.gov (United States)

    Jo, Myung Hyun; Song, Ji-Joon; Hohng, Sungchul

    2015-12-01

    In eukaryotes, small RNAs play important roles in both gene regulation and resistance to viral infection. Argonaute proteins have been identified as a key component of the effector complexes of various RNA-silencing pathways, but the mechanistic roles of Argonaute proteins in these pathways are not clearly understood. To address this question, we performed single-molecule fluorescence experiments using an RNA-induced silencing complex (core-RISC) composed of a small RNA and human Argonaute 2. We found that target binding of core-RISC starts at the seed region of the guide RNA. After target binding, four distinct reactions followed: target cleavage, transient binding, stable binding, and Argonaute unloading. Target cleavage required extensive sequence complementarity and accelerated core-RISC dissociation for recycling. In contrast, the stable binding of core-RISC to target RNAs required seed-match only, suggesting a potential explanation for the seed-match rule of microRNA (miRNA) target selection.

  15. Single-molecule Imaging Analysis of Elementary Reaction Steps of Trichoderma reesei Cellobiohydrolase I (Cel7A) Hydrolyzing Crystalline Cellulose Iα and IIII*

    Science.gov (United States)

    Shibafuji, Yusuke; Nakamura, Akihiko; Uchihashi, Takayuki; Sugimoto, Naohisa; Fukuda, Shingo; Watanabe, Hiroki; Samejima, Masahiro; Ando, Toshio; Noji, Hiroyuki; Koivula, Anu; Igarashi, Kiyohiko; Iino, Ryota

    2014-01-01

    Trichoderma reesei cellobiohydrolase I (TrCel7A) is a molecular motor that directly hydrolyzes crystalline celluloses into water-soluble cellobioses. It has recently drawn attention as a tool that could be used to convert cellulosic materials into biofuel. However, detailed mechanisms of action, including elementary reaction steps such as binding, processive hydrolysis, and dissociation, have not been thoroughly explored because of the inherent challenges associated with monitoring reactions occurring at the solid/liquid interface. The crystalline cellulose Iα and IIII were previously reported as substrates with different crystalline forms and different susceptibilities to hydrolysis by TrCel7A. In this study, we observed that different susceptibilities of cellulose Iα and IIII are highly dependent on enzyme concentration, and at nanomolar enzyme concentration, TrCel7A shows similar rates of hydrolysis against cellulose Iα and IIII. Using single-molecule fluorescence microscopy and high speed atomic force microscopy, we also determined kinetic constants of the elementary reaction steps for TrCel7A against cellulose Iα and IIII. These measurements were performed at picomolar enzyme concentration in which density of TrCel7A on crystalline cellulose was very low. Under this condition, TrCel7A displayed similar binding and dissociation rate constants for cellulose Iα and IIII and similar fractions of productive binding on cellulose Iα and IIII. Furthermore, once productively bound, TrCel7A processively hydrolyzes and moves along cellulose Iα and IIII with similar translational rates. With structural models of cellulose Iα and IIII, we propose that different susceptibilities at high TrCel7A concentration arise from surface properties of substrate, including ratio of hydrophobic surface and number of available lanes. PMID:24692563

  16. Zinc Enolate/Sulfinate Prepared from a Single-Run Reaction Using Zinc Dust with O-Tosylated 4-Hydroxy Coumarin and Pyrone

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ueon Sang; Joo, Seong-Ryu; Kim, Seung-Hoi [Dankook University, Cheonan (Korea, Republic of)

    2016-07-15

    We demonstrated the preparation of new zinc complexes, 2-oxo-2H-chromen-4-yloxy tosylzinc (I), and 6-methyl-2-oxo-2H-pyran-4-yloxy tosylzinc (II), by the oxidative addition of readily available zinc dust into the corresponding 4-tosylated coumarin (A) and pyrone (B), respectively. Of special interest, the thus-obtained zinc complexes showed an electrophile-dependent reactivity. The subsequent coupling reactions of I and II with a variety of acid chlorides provided the O-acylation product in moderate yields. More interestingly, it should be emphasized that the thus-prepared zinc complexes (I and II) functioned both as zinc enolate and zinc sulfinate, providing C(3)-disubstituted product (b) and sulfone (c), respectively, from a single-run reaction when I or II was treated with benzyl halides. Even though somewhat low yields were achieved under the nonoptimized conditions, the novel zinc complexes present another potential application for zinc reagents. Versatile applications of this discovery are currently underway.

  17. Investigations of Spectroscopic Factors and Sum Rules from the Single Neutron Transfer Reaction 111Cd(overrightarrow {{d}} ,p)112Cd

    Science.gov (United States)

    Jamieson, D. S.; Garrett, P. E.; Ball, G. C.; Demand, G. A.; Faestermann, T.; Finlay, P.; Green, K. L.; Hertenberger, R.; Krücken, R.; Leach, K. G.; Phillips, A. A.; Sumithrarachchi, C. S.; Triambak, S.; Wirth, H.-F.

    2014-03-01

    Cadmium isotopes have been presented for decades as excellent examples of vibrational nuclei, with low-lying levels interpreted as multi-phonon quadrupole, octupole, and mixed-symmetry states. A large amount of spectroscopic data has been obtained through various experimental studies of cadmiumisotopes. In the present work, the 111Cd(overrightarrow {{d}} ,p)112Cd reaction was used to investigate the single-particle structure of the 112Cd nucleus. A 22 MeV beam of polarized deuterons was obtained at the Maier-Leibnitz laboratory in Garching, Germany. The reaction ejectiles were momentum analyzed using a Q3D spectrograph, and 130 levels have been identified up to 4.2 MeV of excitation energy. Using DWBA analysis with optical model calculations, spin-parity assignments have been made for observed levels, and spectroscopic factors have been extracted from the experimental angular distributions of differential cross section and analyzing power. In this high energy resolution investigation, many additional levels have been observed compared with the previous (d,p) study using 8 MeV deuterons [1]. There were a total of 44 new levels observed, and the parity assignments of 34 levels were improved.

  18. Investigations of Spectroscopic Factors and Sum Rules from the Single Neutron Transfer Reaction 111Cd(d→$\\overrightarrow {\\rm{d}} $,p112Cd

    Directory of Open Access Journals (Sweden)

    Jamieson D.S.

    2014-03-01

    Full Text Available Cadmium isotopes have been presented for decades as excellent examples of vibrational nuclei, with low-lying levels interpreted as multi-phonon quadrupole, octupole, and mixed-symmetry states. A large amount of spectroscopic data has been obtained through various experimental studies of cadmiumisotopes. In the present work, the 111Cd(d→$\\overrightarrow {\\rm{d}} $,p112Cd reaction was used to investigate the single-particle structure of the 112Cd nucleus. A 22 MeV beam of polarized deuterons was obtained at the Maier-Leibnitz laboratory in Garching, Germany. The reaction ejectiles were momentum analyzed using a Q3D spectrograph, and 130 levels have been identified up to 4.2 MeV of excitation energy. Using DWBA analysis with optical model calculations, spin-parity assignments have been made for observed levels, and spectroscopic factors have been extracted from the experimental angular distributions of differential cross section and analyzing power. In this high energy resolution investigation, many additional levels have been observed compared with the previous (d,p study using 8 MeV deuterons [1]. There were a total of 44 new levels observed, and the parity assignments of 34 levels were improved.

  19. Zinc Enolate/Sulfinate Prepared from a Single-Run Reaction Using Zinc Dust with O-Tosylated 4-Hydroxy Coumarin and Pyrone

    International Nuclear Information System (INIS)

    Shin, Ueon Sang; Joo, Seong-Ryu; Kim, Seung-Hoi

    2016-01-01

    We demonstrated the preparation of new zinc complexes, 2-oxo-2H-chromen-4-yloxy tosylzinc (I), and 6-methyl-2-oxo-2H-pyran-4-yloxy tosylzinc (II), by the oxidative addition of readily available zinc dust into the corresponding 4-tosylated coumarin (A) and pyrone (B), respectively. Of special interest, the thus-obtained zinc complexes showed an electrophile-dependent reactivity. The subsequent coupling reactions of I and II with a variety of acid chlorides provided the O-acylation product in moderate yields. More interestingly, it should be emphasized that the thus-prepared zinc complexes (I and II) functioned both as zinc enolate and zinc sulfinate, providing C(3)-disubstituted product (b) and sulfone (c), respectively, from a single-run reaction when I or II was treated with benzyl halides. Even though somewhat low yields were achieved under the nonoptimized conditions, the novel zinc complexes present another potential application for zinc reagents. Versatile applications of this discovery are currently underway

  20. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  1. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

  2. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  3. Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction.

    Science.gov (United States)

    Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng

    2012-08-21

    Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.

  4. Study of single particle properties of neutron-rich Na isotopes on the "shore of the island of inversion" by means of neutron-transfer reactions

    CERN Multimedia

    Reiter, P; Blazhev, A A; Riisager, K; Bastin, B; Tengborn, E A; Kruecken, R; Voulot, D; Jeppesen, H B; Hadinia, B; Gernhaeuser, R A; Fynbo, H O U; Georgiev, G P; Habs, D; Fraile prieto, L M; Chapman, R; Nilsson, T; Diriken, J V J; Jenkins, D G; Kroell, T; Leske, J; Huyse, M L; Patronis, N

    We aim at the investigation of single particle properties of neutron-rich Na isotopes around the "shore of the island of inversion". As first experiment of this programme, we propose to study excited states in the isotope $^{29}$Na by a one-neutron transfer reaction with a $^{28}$Na beam at 3 MeV/u obtained from REX-ISOLDE impinging on a CD$_{2}$-target. The $\\gamma$-rays will be detected by the MINIBALL array and the particles by the T-REX array of segmented Si detectors. The main physics aims are to extract from the relative spectroscopic factors information on the configurations contributing to the wave functions of the populated states and, secondly, to identify and characterize negative parity states whose excitation energies reflect directly the N= 28 gap in this region. The results will be compared to recent shell model calculations involving new residual interactions. This will shed new light on the evolution of single particle structure and help to understand the underlying physics relevant for the f...

  5. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  6. Quantitative Single-letter Sequencing: a method for simultaneously monitoring numerous known allelic variants in single DNA samples

    Directory of Open Access Journals (Sweden)

    Duborjal Hervé

    2008-02-01

    Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized

  7. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    Science.gov (United States)

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  8. Concurrent validity and reliability of using ground reaction force and center of pressure parameters in the determination of leg movement initiation during single leg lift.

    Science.gov (United States)

    Aldabe, Daniela; de Castro, Marcelo Peduzzi; Milosavljevic, Stephan; Bussey, Melanie Dawn

    2016-09-01

    Postural adjustment evaluations during single leg lift requires the initiation of heel lift (T1) identification. T1 measured by means of motion analyses system is the most reliable approach. However, this method involves considerable workspace, expensive cameras, and time processing data and setting up laboratory. The use of ground reaction forces (GRF) and centre of pressure (COP) data is an alternative method as its data processing and setting up is less time consuming. Further, kinetic data is normally collected using frequency samples higher than 1000Hz whereas kinematic data are commonly captured using 50-200Hz. This study describes the concurrent-validity and reliability of GRF and COP measurements in determining T1, using a motion analysis system as reference standard. Kinematic and kinetic data during single leg lift were collected from ten participants. GRF and COP data were collected using one and two force plates. Displacement of a single heel marker was captured by means of ten Vicon(©) cameras. Kinetic and kinematic data were collected using a sample frequency of 1000Hz. Data were analysed in two stages: identification of key events in the kinetic data, and assessing concurrent validity of T1 based on the chosen key events with T1 provided by the kinematic data. The key event presenting the least systematic bias, along with a narrow 95% CI and limits of agreement against the reference standard T1, was the Baseline COPy event. Baseline COPy event was obtained using one force plate and presented excellent between-tester reliability. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Increased reaction time variability in attention-deficit hyperactivity disorder as a response-related phenomenon: evidence from single-trial event-related potentials.

    Science.gov (United States)

    Saville, Christopher W N; Feige, Bernd; Kluckert, Christian; Bender, Stephan; Biscaldi, Monica; Berger, Andrea; Fleischhaker, Christian; Henighausen, Klaus; Klein, Christoph

    2015-07-01

    Increased intra-subject variability (ISV) in reaction times (RTs) is a promising endophenotype for attention-deficit hyperactivity disorder (ADHD) and among the most robust hallmarks of the disorder. ISV has been assumed to represent an attentional deficit, either reflecting lapses in attention or increased neural noise. Here, we use an innovative single-trial event-related potential approach to assess whether the increased ISV associated with ADHD is indeed attributable to attention, or whether it is related to response-related processing. We measured electroencephalographic responses to working memory oddball tasks in patients with ADHD (N = 20, aged 11.3 ± 1.1) and healthy controls (N = 25, aged 11.7 ± 1.1), and analysed these data with a recently developed method of single-trial event-related potential analysis. Estimates of component latency variability were computed for the stimulus-locked and response-locked forms of the P3b and the lateralised readiness potential (LRP). ADHD patients showed significantly increased ISV in behavioural ISV. This increased ISV was paralleled by an increase in variability in response-locked event-related potential latencies, while variability in stimulus-locked latencies was equivalent between groups. This result held across the P3b and LRP. Latency of all components predicted RTs on a single-trial basis, confirming that all were relevant for speed of processing. These data suggest that the increased ISV found in ADHD could be associated with response-end, rather than stimulus-end processes, in contrast to prevailing conceptions about the endophenotype. This mental chronometric approach may also be useful for exploring whether the existing lack of specificity of ISV to particular psychiatric conditions can be improved upon. © 2014 Association for Child and Adolescent Mental Health.

  10. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  11. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  12. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  13. Single-particle states in neutron-rich 69,71Cu by means of the (d,3He) transfer reaction

    International Nuclear Information System (INIS)

    Morfouace, Pierre

    2014-01-01

    In two (d, 3 He) transfer reactions with MUST2 at GANIL and the split-pole at Orsay, we have determined the position of the proton-hole states in the neutron-rich 71 Cu (N=42) and 69 Cu (N=40) isotopes. We have found that in 71 Cu the hole strength of the f7/2 orbital lies at higher excitation energies than expected. From beta-decay and laser spectroscopy, the f5/2 first excited particle state in these isotopes was known to come down rapidly in energy when passing N=40 and even become the ground state in 75 Cu. This sudden energy shift has been explained in a number of theoretical works. The prediction for the f7/2 spin-orbit partner was that it would change in energy too through a related effect. Experimentally, the f7/2 proton-hole state is not known for N≥40. In 71 Cu two 7/2- states around 1 MeV are candidates to be a proton-hole. The experiment at GANIL took place in March 2011. A secondary beam of 72 Zn at 38 AMeV was produced by fragmentation and purified through the LISE spectrometer. The transfer reaction in inverse kinematics was studied with the MUST2 detectors plus four 20 micrometer silicon detector to identified the 3 He of low kinetic energy. The excitation spectrum of 71 Cu was reconstruct thanks to the missing mass method and the angular distributions were extracted and compared with a reaction model using the DWUCK4 and DWUCK5 code. From this work no states have been populated around 1 MeV concluding that the centroid of the f7/2 lies at higher excitation energy. We then remeasured the single-particle strength in 69 Cu in the corresponding (d, 3 He) reaction at Orsay in March 2013 in order to extend the existing data where 60% of the f7/2 strength is missing and make sure that there is a consistent analysis of spectroscopic factors between both isotopes in order to well understood and well quantify the evolution of the f7/2 orbital when we start filling the g9/2 orbital. In this second experiment we have performed the reaction in direct

  14. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  15. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  16. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  17. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  18. Rudimentary simple, single step fabrication of nano-flakes like AgCd alloy electro-catalyst for oxygen reduction reaction in alkaline fuel cell

    International Nuclear Information System (INIS)

    Bhandary, Nimai; Basu, Suddhasatwa; Ingole, Pravin P.

    2016-01-01

    In this work, for the first time, we report rudimentary simple, single step fabrication of an electro-catalyst based on AgCd alloy nanoparticles with flakes like geometry which shows highly efficient activity towards oxygen reduction reaction (ORR). A simple potentiostatic deposition method has been employed for co-depositing AgCd alloy nanostructures with flakes like shapes along with dendrites on the surface of carbon fibre paper. The chemico-physical properties of the catalyst are investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and energy dispersive X-ray spectroscopy (EDXS). Electro-catalytic activity of AgCd alloy based electro-catalyst towards ORR is studied in alkaline medium by cyclic voltammetry and rotating ring disk electrode (RRDE) technique. Electrochemical in-situ FTIR measurements are also performed to identify the species generated during ORR process. Based on the results from electro-catalysis experiment, it is concluded that nano-alloyed AgCd electrodeposited on carbon paper shows excellent activity for ORR, following four electron pathways with H_2O_2 yield less than 15%. The combination of low cost of Ag and Cd, fast and facile method of its fabrication and higher activity towards ORR makes the AgCd electro-catalyst an attractive catalyst of choice for alkaline fuel cell.

  19. Ganoderma-Like MoS2 /NiS2 with Single Platinum Atoms Doping as an Efficient and Stable Hydrogen Evolution Reaction Catalyst.

    Science.gov (United States)

    Guan, Yongxin; Feng, Yangyang; Wan, Jing; Yang, Xiaohui; Fang, Ling; Gu, Xiao; Liu, Ruirui; Huang, Zhengyong; Li, Jian; Luo, Jun; Li, Changming; Wang, Yu

    2018-05-27

    Herein, a unique ganoderma-like MoS 2 /NiS 2 hetero-nanostructure with isolated Pt atoms anchored is reported. This novel ganoderma-like heterostructure can not only efficiently disperse and confine the few-layer MoS 2 nanosheets to fully expose the edge sites of MoS 2 , and provide more opportunity to capture the Pt atoms, but also tune the electronic structure to modify the catalytic activity. Because of the favorable dispersibility and exposed large specific surface area, single Pt atoms can be easily anchored on MoS 2 nanosheets with ultrahigh loading of 1.8 at% (the highest is 1.3 at% to date). Owing to the ganoderma-like structure and platinum atoms doping, this catalyst shows Pt-like catalytic activity for the hydrogen evolution reaction with an ultralow overpotential of 34 mV and excellent durability of only 2% increase in overpotential for 72 h under the constant current density of 10 mA cm -2 . © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Non-destructive testing of proteins in single seeds using the 14N(d,p)15N and 14N(d,∝)12C reactions

    International Nuclear Information System (INIS)

    Moreno B, E.

    1986-01-01

    A non-destructive nuclear technique aimed for the analysis of proteins in single seeds using the 14 N(d,p) 15 N and 14 N(d,∝) 12 C reactions is implemented. This work was performed at the ININ's Tandem Van der Graaff facility, using a 6 MeV deuteron beam and a surface barrier solid state detector with its associated electronics for the pulse height analysis of the charged particles backscattered from the samples. Well defined populations of five varieties of wheat, and four of corn were used as samples in order to optimize the experimental conditions for the analysis, these results were compared with those obtained using an analytical chemical method (Kjeldahl). The linear regression coefficient (''r'') obtained from the results of these two methods was: r = 0.9 in the case of wheat, and r = 0.7 in the case of corn, which we consider adequate figures for using the non-destructive nuclear technique as an aid or support in agricultural seed protein improvement programs. In adequate geometrical conditions the analysis per seed can take a few seconds, and the exposure to the germ can be as low as ≅1 Rad. (author)

  1. Measurement of the Target-Normal Single-Spin Asymmetry in Deep-Inelastic Scattering from the Reaction 3He{uparrow}(e,e')X

    Energy Technology Data Exchange (ETDEWEB)

    Katich, Joseph; Qian, Xin; Zhao, Yuxiang; Allada, Kalyan; Aniol, Konrad; Annand, John; Averett, Todd; Benmokhtar, Fatiha; Bertozzi, William; Bradshaw, Elliott; Bosted, Peter; Camsonne, Alexandre; Canan, Mustafa; Cates, Gordon; Chen, Chunhua; Chen, Jian-Ping; Chen, Wei; Chirapatpimol, Khem; Chudakov, Eugene; Cisbani, Evaristo; Cornejo, Juan; Cusanno, Francesco; Dalton, Mark; Deconinck, Wouter; De Jager, Cornelis; De Leo, Raffaele; Deng, Xiaoyan; Deur, Alexandre; Ding, Huaibo; Dolph, Peter; Dutta, Chiranjib; Dutta, Dipangkar; El Fassi, Lamiaa; Frullani, Salvatore; Gao, Haiyan; Garibaldi, Franco; Gaskell, David; Gilad, Gilad; Gilman, Ronald; Glamazdin, Oleksandr; Golge, Serkan; Guo, Lei; Hamilton, David; Hansen, Jens-Ole; Higinbotham, Douglas; Holmstrom, Timothy; Huang, Jijun; Huang, Min; Ibrahim Abdalla, Hassan; Iodice, Mauro; Jin, Ge; Jones, Mark; Kelleher, Aidan; Kim, Wooyoung; Kolarkar, Ameya; Korsch, Wolfgang; LeRose, John; Li, Xiaomei; Li, Y; Lindgren, Richard; Liyanage, Nilanga; Long, Elena; Lu, Hai-jiang; Margaziotis, Demetrius; Markowitz, Pete; Marrone, Stefano; McNulty, Dustin; Meziani, Zein-Eddine; Michaels, Robert; Moffit, Bryan; Munoz Camacho, Carlos; Nanda, Sirish; Narayan, Amrendra; Nelyubin, Vladimir; Norum, Blaine; Oh, Yoomin; Osipenko, Mikhail; Parno, Diana; Peng, Jen-chieh; Phillips, Sarah; Posik, Matthew; Puckett, Andrew; Qiang, Yi; Rakhman, Abdurahim; Ransome, Ronald; Riordan, Seamus; Saha, Arunava; Sawatzky, Bradley; Schulte, Elaine; Shahinyan, Albert; Hashemi Shabestari, Mitra; Sirca, Simon; Stepanyan, Stepan; Subedi, Ramesh; Sulkosky, Vincent; Tang, Liguang; Tobias, William; Urciuoli, Guido; Vilardi, Ignazio; Wang, Kebin; Wang, Y; Wojtsekhowski, Bogdan; Yan, X; Yao, Huan; Ye, Yunxiu; Ye, Z; Yuan, Lulin; Zhan, Xiaohui; Zhang, Yi; Zhang, Y -W; Zhao, Bo; Zheng, Xiaochao; Zhu, Lingyan; Zhu, Xiaofeng; Zong, Xing

    2014-07-01

    We report the first measurement of the target single-spin asymmetry in deep-inelastic scattering from the inclusive reaction 3He{uparrow}(e,e')X on a 3He gas target polarized normal to the lepton plane. Assuming time-reversal invariance, this asymmetry is strictly zero in the Born approximation. The experiment, conducted at Jefferson Lab using a 5.89 GeV electron beam, covers a range of 1.72 GeV, which is non-zero at the 2.75sigma level. Theoretical calculations, which assume two-photon exchange with quasi-free quarks, predict a neutron asymmetry of O(10−4) when both photons couple to one quark, and O(10−2) for the photons coupling to different quarks. Our measured asymmetry agrees both in sign and magnitude with the prediction that uses input based on the Sivers transverse momentum distribution obtained from semi-inclusive deep-inelastic scattering.

  2. Ultrasensitive electrochemical detection of microRNA-21 combining layered nanostructure of oxidized single-walled carbon nanotubes and nanodiamonds by hybridization chain reaction.

    Science.gov (United States)

    Liu, Lingzhi; Song, Chao; Zhang, Zhang; Yang, Juan; Zhou, Lili; Zhang, Xing; Xie, Guoming

    2015-08-15

    Measurement of microRNA (miRNA) levels in body fluids is a crucial tool for the early diagnosis and prognosis of cancers. In this study, we developed an electrochemical assay to detect miRNA-21 by fabricating the electrode with layer-by-layer assembly of oxidized single-walled carbon nanotubes and nanodiamonds. Tetrahedron-structured probes with free-standing probe on the top served as receptors to hybridize with target miRNA directly. The probes were immobilized on the deposited gold nanoparticles through a well-established strong Au-S bond. The electrochemical signal was mainly derived from an ultrasensitive pattern by combining hybridization chain reaction with DNA-functionalized AuNPs, which provided DNAzyme to catalyze H2O2 reduction. Differential pulse voltammetry was applied to record the electrochemical signals, which was increased linearly with the target miRNA-21, and the linear detection range was 10 fM to 1.0 nM. The limit of detection reached 1.95 fM (S/N=3), and the proposed biosensor exhibited good reproducibility and stability, as well as high sensitivity. Hence, this biosensor has a promising potential in clinical application. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Sidewall Covalent Functionalization of Single Wall Carbon Nanotubes through C-N Bond Forming Reactions of Fluoronanotubes with Urea, Guanidine and Thiourea (Preprint)

    National Research Council Canada - National Science Library

    Pulikkathara, Merlyn X; Khabashesku, Valery N

    2007-01-01

    ...) as starting materials in the reactions with either urea, thiourea, or guanidine. Through these reactions, the derivatives with terminal amide and heteroamide groups on the nanotube sidewalls have been prepared...

  4. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  5. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  6. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  7. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  8. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  9. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  10. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  11. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  12. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  13. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  14. Ion backscattering, channeling and nuclear reaction analysis study of passive films formed on FeCrNi and FeCrNiMo (100) single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, C; Schmaus, D [Paris-7 Univ., 75 (France). Groupe de Physique des Solides de l' ENS; Elbiache, A; Marcus, P [Ecole Nationale Superieure de Chimie, 75 - Paris (France)

    1990-01-01

    The compositions of passive films formed on Fe-17Fr-13Ni (at. %) and Fe-18.5Cr-14Ni-1.5Mo (100) single crystals have been determined and the structure of the alloy under the film has been investigated. The alloys were passivated in 0.05M H{sub 2}SO{sub 4} at 250 mV/SHE for 30 min. The oxygen content was measured by nuclear microanalysis using the {sup 16}O(d,p) {sup 17}O* reaction. The oxygen content in the passive film is similar for the two alloys and equal to (12{plus minus}2) 10{sup 15} O/cm{sup 2}. The cationic compositions of the passive films have been determined by {sup 4}He channeling at two incident beam energies: 0.8 and 2.0 MeV. For the two alloys studied, a total cation content of (5{plus minus}2)10{sup 15} at/cm{sup 2} is found in the passive films. The corresponding thickness is about 12 A. There is an excess of oxygen, which can be attributed to the presence of hydroxyls and sulfate. A strong chromium enrichment is found in the passive film formed on both alloys: chromium represents about 50% of the cations. There is no evidence of molybdenum enrichment in the passive film formed on the Mo-alloyed stainless steel. The comparison of the results obtained at the two different incident beam energies (0.8MeV and 2MeV) reveals the existence of defects at the alloy/passive film interface. (author).

  15. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  17. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  18. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  19. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  20. 北方汉族人动脉粥样硬化性脑梗死与人类白细胞抗原系统-Ⅱ类基因的关联:应用顺序特异性引物聚合酶链式反应技术%Association between atherosclerotic brain infarction and human leucocyte antigen-Ⅱ gene of the Han Nationality in north China: Technique of sequent and specific primer polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    张双彦; 邬英全; 张宪忠; 曹峰林

    2005-01-01

    tendency and immunity imbalance of atherosclerotic brain infarction (ABI) have attracted the attention of many scholars at home and abroad, which suggests that immune mechanism plays a key role in ABI development. It has been found that ABI is related to polymorphism of human immune inheritance gene (HLA), particularly HLA-DR gene.OBJECTIVE: To investigate the correlation between HLA and ABI immune heredity.DESIGN: Single sample and single factor analysis.SETTING: Sino-Japanese Friendship Hospital of Jilin University; Neurological Department of the First Hospital of Harbin City.PARTICIPANTS: Totally 31 patients in experimental group and 30 healthy people in control group, whose three generations were of the Han Nationality in north China and who had no blood relation, were selected from Department of Neurology in First Hospital of Harbin between January 1998 and December 2000.METHODS: The experiment was conducted in the Blood Research Center of Department of Neurology in First Hospital of Harbin between June and December 2003.5 mL peripheral blood in both groups was taken to extract genome DNA with the previous method. Human HLA gene map had been described at gene bank in the Internet, in which mono-nucleic acid obtained from HLA of the sixth chromosome were retrieved. Each DR and DQ allele, sense primer and antisense primer were composed selectively. Amplification of DNA fragment was checked respectively and specifically. The primer was provided by Shanghai Gene Research Institute. PCR instrument (4 800) and its related reagents produced by PE Company (the US) were used. Fourfold table exact probability method was used to calculate the relative risk (RR) and P value.which was obviously higher than that of other sites (P < 0.05). However,associated with the ABI susceptible gene of the Han Nationality in north China.

  1. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  2. Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

    Science.gov (United States)

    Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

    2007-03-01

    A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

  3. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  4. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro

    2012-11-01

    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  5. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  6. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  7. Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

    Science.gov (United States)

    Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

    2016-01-01

    Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

  8. Some calculated (p,α) cross-sections using the alpha particle knock-on and triton pick-up reaction mechanisms: An optimisation of the single-step Feshbach-Kerman-Koonin (FKK) theory

    Energy Technology Data Exchange (ETDEWEB)

    Olise, Felix S.; Ajala, Afis; Olamiyl, Hezekiah B. [Dept. of Physics and Engineering Physics, Obafemi Awolowo University, Ile-Ife (Nigeria)

    2016-04-15

    The Feshbach-Kerman-Koonin (FKK) multi-step direct (MSD) theory of pre-equilibrium reactions has been used to compute the single-step cross-sections for some (p,α) reactions using the knock-on and pick-up reaction mechanisms at two incident proton energies. For the knock-on mechanism, the reaction was assumed to have taken place by the direct ejection of a preformed alpha cluster in a shell-model state of the target. But the reaction was assumed to have taken place by the pick-up of a preformed triton cluster (also bound in a shell-model state of the target core) by the incident proton for the pick-up mechanism. The Yukawa forms of potential were used for the proton-alpha (for the knock-on process) and proton-triton (for the pick-up process) interaction and several parameter sets for the proton and alpha-particle optical potentials. The calculated cross-sections for both mechanisms gave satisfactory fits to the experimental data. Furthermore, it has been shown that some combinations of the calculated distorted wave Born approximation cross-sections for the two reaction mechanisms in the FKK MSD theory are able to give better fits to the experimental data, especially in terms of range of agreement. In addition, the theory has been observed to be valid over a wider range of energy.

  9. Some Calculated (p,α Cross-Sections Using the Alpha Particle Knock-On and Triton Pick-Up Reaction Mechanisms: An Optimisation of the Single-Step Feshbach–Kerman–Koonin (FKK Theory

    Directory of Open Access Journals (Sweden)

    Felix S. Olise

    2016-04-01

    Full Text Available The Feshbach–Kerman–Koonin (FKK multi-step direct (MSD theory of pre-equilibrium reactions has been used to compute the single-step cross-sections for some (p,α reactions using the knock-on and pick-up reaction mechanisms at two incident proton energies. For the knock-on mechanism, the reaction was assumed to have taken place by the direct ejection of a preformed alpha cluster in a shell-model state of the target. But the reaction was assumed to have taken place by the pick-up of a preformed triton cluster (also bound in a shell-model state of the target core by the incident proton for the pick-up mechanism. The Yukawa forms of potential were used for the proton-alpha (for the knock-on process and proton-triton (for the pick-up process interaction and several parameter sets for the proton and alpha-particle optical potentials. The calculated cross-sections for both mechanisms gave satisfactory fits to the experimental data. Furthermore, it has been shown that some combinations of the calculated distorted wave Born approximation cross-sections for the two reaction mechanisms in the FKK MSD theory are able to give better fits to the experimental data, especially in terms of range of agreement. In addition, the theory has been observed to be valid over a wider range of energy.

  10. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  11. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  12. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  13. Property investigations of proton-proton reaction in dependence of the transverse momentum of a single particle for a beam momentum of 24 GeV/c

    International Nuclear Information System (INIS)

    Geist, W.M.

    1976-01-01

    This study is based on data produced in an experiment for the investigation of proton-proton reactions at a beam momentum of 24 GeV/c. In particular, the dependence of final state properties on the transverse momentum of a chosen secondary particle (trigger particle) is considered. The study has four parts: First, experimental procedures of selection, cleaning and correction of the data are developed and applied for exclusive and inclusive reactions. Then the description of a model with minimum correlation between two particles is given. In the third section, the mean charged multiplicities of inclusive reactions are measured and interpreted as a function of the transverse momentum of the trigger particle. A complete event structure for quasi-inclusive reactions is given in the last section. Much emphasis is placed on the investigation of events comprising the production of a particle with high transverse momentum (more than 1 GeV/c). (orig./WL) [de

  14. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  15. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  17. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  18. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    Science.gov (United States)

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  20. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  1. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  2. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  3. Changes in ground reaction force during a rebound-jump task after hip strength training for single-sided ankle dorsiflexion restriction.

    Science.gov (United States)

    Kondo, Hitoshi; Someya, Fujiko

    2016-01-01

    [Purpose] Lateral ankle sprains are common injuries suffered while playing sports, and abnormal forward- and inward-directed ground reaction force occurs during a jumping task. However, the influence of hip muscle strength training on jumping performance after ankle injuries has not been fully examined. This study thus examined changes in ground reaction force during a rebound-jump task after training to strengthen hip muscles. [Subjects and Methods] Ten of 30 female high school basketball players were assigned as subjects who showed a difference of 7 or more degrees in dorsiflexion ranges between the bilateral ankles. The subjects underwent 12 weeks of training to strengthen hip abductors and external rotators. Comparisons between before and after training were made regarding ground reaction force components, hip and knee joint angles, percentage of maximum voluntary contraction in leg muscles, and muscle strength of hip muscles during the rebound-jump task. [Results] After training, the subjects showed increased strength of external rotator muscles, increased percentage of maximum voluntary contraction in the gluteus medius muscle, decreased inward ground reaction force, and increased flexion angles of the hip and knee joints. [Conclusion] This study suggests that training to strengthen hip muscles may ameliorate the inward ground reaction force in athletes with ankle dorsiflexion restriction.

  4. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  6. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  7. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  8. Knock-out reactions

    International Nuclear Information System (INIS)

    de Forest, T. Jr.

    1977-01-01

    It is pointed out that the primary motivation for performing high energy single nucleon knock-out reactions is based on the concept of quasi-elastic scattering. The validity of and corrections to the partial wave impulse approximation and kinematical invariance of knock-out reactions and tests of the reaction mechanism are treated. The effect of distortions on the momentum distribution in the effective momentum approximation for given parameters are plotted. 12 references

  9. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

    Science.gov (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

    2016-01-01

    Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

  10. Development of a tetra-primer ARMS-PCR for detecting the E198A SNP in the isotype-1 β-tubulin gene of Haemonchus contortus populations in China.

    Science.gov (United States)

    Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu

    2018-03-15

    The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement.

    Science.gov (United States)

    Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi

    2010-08-01

    We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

  12. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  13. Reversible conversion of valence-tautomeric copper metal-organic frameworks dependent single-crystal-to-single-crystal oxidation/reduction: a redox-switchable catalyst for C-H bonds activation reaction.

    Science.gov (United States)

    Huang, Chao; Wu, Jie; Song, Chuanjun; Ding, Ran; Qiao, Yan; Hou, Hongwei; Chang, Junbiao; Fan, Yaoting

    2015-06-28

    Upon single-crystal-to-single-crystal (SCSC) oxidation/reduction, reversible structural transformations take place between the anionic porous zeolite-like Cu(I) framework and a topologically equivalent neutral Cu(I)Cu(II) mixed-valent framework. The unique conversion behavior of the Cu(I) framework endowed it as a redox-switchable catalyst for the direct arylation of heterocycle C-H bonds.

  14. Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

    Science.gov (United States)

    Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

    2014-03-04

    Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

  15. Single step synthesis of gold-amino acid composite, with the evidence of the catalytic hydrogen atom transfer (HAT) reaction, for the electrochemical recognition of Serotonin

    Science.gov (United States)

    Choudhary, Meenakshi; Siwal, Samarjeet; Nandi, Debkumar; Mallick, Kaushik

    2016-03-01

    A composite architecture of amino acid and gold nanoparticles has been synthesized using a generic route of 'in-situ polymerization and composite formation (IPCF)' [1,2]. The formation mechanism of the composite has been supported by a model hydrogen atom (H•≡H++e-) transfer (HAT) type of reaction which belongs to the proton coupled electron transfer (PCET) mechanism. The 'gold-amino acid composite' was used as a catalyst for the electrochemical recognition of Serotonin.

  16. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Directory of Open Access Journals (Sweden)

    Lina Marcela Villa

    2013-11-01

    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  17. Obtaining the neutron time-of-flight instrument response function for a single D-T neutron utilizing n-alpha coincidence from the d(t, α) n nuclear reaction

    Science.gov (United States)

    Styron, Jedediah; Ruiz, Carlos; Hahn, Kelly; Cooper, Gary; Chandler, Gordon; Jones, Brent; McWatters, Bruce; Smith, Jenny; Vaughan, Jeremy

    2017-10-01

    A measured neutron time-of-flight (nTOF) signal is a convolution of the neutron reaction history and the instrument response function (IRF). For this work, the IRF was obtained by measuring single, D-T neutron events by utilizing n-alpha coincidence. The d(t, α) n nuclear reaction was produced at Sandia National Laboratories' Ion Beam Laboratory using a 300-keV Cockroft-Walton generator to accelerate a 2- μA beam, of 175-keV D + ions, into a stationary, 2.6- μm, ErT2 target. Comparison of these results to those obtained using cosmic-rays and photons will be discussed. Sandia National Laboratories.

  18. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  19. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  20. A Primer of Middle Eastern Leadership Culture

    Directory of Open Access Journals (Sweden)

    Sheldon Greaves

    2012-01-01

    Full Text Available It is natural for someone looking in on a foreign culture from the outside to interpret what they see and frame their reactions based on their own background and assumptions. With cultures as a different as those of the Middle East and the West, the potential for blunders increases dramatically, made worse by the high political, diplomatic, military, and commercial stakes involved. Leadership culture in this region has been shaped over centuries through a variety of factors, such as reputation, family, and religion, which continue to influence decision making. The present study posits that an understanding of these factors and how they work is crucial for intelligence analysts, policy and decision makers, strategists, and scholars who must find their way through a very unfamiliar cultural landscape in the Middle East. It is hoped that this discussion will in some way assist in the creation of more effective interaction, policies, and analysis associated with the Middle East.

  1. Examining the rudimentary steps of the oxygen reduction reaction on single-atomic Pt using Ti-based non-oxide supports

    DEFF Research Database (Denmark)

    Tak, Young Joo; Yang, Sungeun; Lee, Hyunjoo

    2018-01-01

    C(100)-supported single Pt atoms. The O2 and OOH* dissociation processes on Pt/TiN(100) are determined to be non-activated (i.e. "barrier-less" dissociation) while an activation energy barrier of 0.19 and 0.51eV is found for these dissociation processes on Pt/TiC(100), respectively. Moreover, the series...

  2. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  3. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    DEFF Research Database (Denmark)

    Huang, Yili; Zeng, Yanhua; Lu, Hang

    2016-01-01

    Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

  4. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  5. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  6. In-situ Studies of the Reactions of Bifunctional and Heterocyclic Molecules over Noble Metal Single Crystal and Nanoparticle Catalysts Studied with Kinetics and Sum-Frequency Generation Vibrational Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kliewer, Christopher J. [Univ. of California, Berkeley, CA (United States)

    2009-06-30

    Sum frequency generation surface vibrational spectroscopy (SFG-VS) in combination with gas chromatography (GC) was used in-situ to monitor surface bound reaction intermediates and reaction selectivities for the hydrogenation reactions of pyrrole, furan, pyridine, acrolein, crotonaldehyde, and prenal over Pt(111), Pt(100), Rh(111), and platinum nanoparticles under Torr reactant pressures and temperatures of 300K to 450K. The focus of this work is the correlation between the SFG-VS observed surface bound reaction intermediates and adsorption modes with the reaction selectivity, and how this is affected by catalyst structure and temperature. Pyrrole hydrogenation was investigated over Pt(111) and Rh(111) single crystals at Torr pressures. It was found that pyrrole adsorbs to Pt(111) perpendicularly by cleaving the N-H bond and binding through the nitrogen. However, over Rh(111) pyrrole adsorbs in a tilted geometry binding through the {pi}-aromatic orbitals. A surface-bound pyrroline reaction intermediate was detected over both surfaces with SFG-VS. It was found that the ring-cracking product butylamine is a reaction poison over both surfaces studied. Furan hydrogenation was studied over Pt(111), Pt(100), 10 nm cubic platinum nanoparticles and 1 nm platinum nanoparticles. The product distribution was observed to be highly structure sensitive and the acquired SFG-VS spectra reflected this sensitivity. Pt(100) exhibited more ring-cracking to form butanol than Pt(111), while the nanoparticles yielded higher selectivities for the partially saturated ring dihydrofuran. Pyridine hydrogenation was investigated over Pt(111) and Pt(100). The α-pyridyl surface adsorption mode was observed with SFG-VS over both surfaces. 1,4-dihydropyridine was seen as a surface intermediate over Pt(100) but not Pt(111). Upon heating the surfaces to 350K, the adsorbed pyridine changes to a flat-lying adsorption mode. No evidence was found for the pyridinium cation. The hydrogenation of the

  7. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    Science.gov (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  8. The emergence of consensus: a primer

    Science.gov (United States)

    Baronchelli, Andrea

    2018-02-01

    The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges `spontaneously' in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems.

  9. A mathematical primer on quantum mechanics

    CERN Document Server

    Teta, Alessandro

    2018-01-01

    This book offers a rigorous yet elementary approach to quantum mechanics that will meet the needs of Master’s-level Mathematics students and is equally suitable for Physics students who are interested in gaining a deeper understanding of the mathematical structure of the theory. Throughout the coverage, which is limited to single-particle quantum mechanics, the focus is on formulating theory and developing applications in a mathematically precise manner. Following a review of selected key concepts in classical physics and the historical background, the basic elements of the theory of operators in Hilbert spaces are presented and used to formulate the rules of quantum mechanics. The discussion then turns to free particles, harmonic oscillators, delta potential, and hydrogen atoms, providing rigorous proofs of the corresponding dynamical properties. Starting from an analysis of these applications, readers are subsequently introduced to more advanced topics such as the classical limit, scattering theory, and s...

  10. Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2017-07-01

    Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

  11. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  12. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  13. The single-process biochemical reaction of Rubisco: a unified theory and model with the effects of irradiance, CO₂ and rate-limiting step on the kinetics of C₃ and C₄ photosynthesis from gas exchange.

    Science.gov (United States)

    Farazdaghi, Hadi

    2011-02-01

    Photosynthesis is the origin of oxygenic life on the planet, and its models are the core of all models of plant biology, agriculture, environmental quality and global climate change. A theory is presented here, based on single process biochemical reactions of Rubisco, recognizing that: In the light, Rubisco activase helps separate Rubisco from the stored ribulose-1,5-bisphosphate (RuBP), activates Rubisco with carbamylation and addition of Mg²(+), and then produces two products, in two steps: (Step 1) Reaction of Rubisco with RuBP produces a Rubisco-enediol complex, which is the carboxylase-oxygenase enzyme (Enco) and (Step 2) Enco captures CO₂ and/or O₂ and produces intermediate products leading to production and release of 3-phosphoglycerate (PGA) and Rubisco. PGA interactively controls (1) the carboxylation-oxygenation, (2) electron transport, and (3) triosephosphate pathway of the Calvin-Benson cycle that leads to the release of glucose and regeneration of RuBP. Initially, the total enzyme participates in the two steps of the reaction transitionally and its rate follows Michaelis-Menten kinetics. But, for a continuous steady state, Rubisco must be divided into two concurrently active segments for the two steps. This causes a deviation of the steady state from the transitional rate. Kinetic models are developed that integrate the transitional and the steady state reactions. They are tested and successfully validated with verifiable experimental data. The single-process theory is compared to the widely used two-process theory of Farquhar et al. (1980. Planta 149, 78-90), which assumes that the carboxylation rate is either Rubisco-limited at low CO₂ levels such as CO₂ compensation point, or RuBP regeneration-limited at high CO₂. Since the photosynthesis rate cannot increase beyond the two-process theory's Rubisco limit at the CO₂ compensation point, net photosynthesis cannot increase above zero in daylight, and since there is always respiration at

  14. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  15. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  16. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  17. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  18. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  19. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  20. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  1. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  2. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  3. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  4. Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Irma Suriyani

    2015-05-01

    Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

  5. Large scale collective modeling the final 'freeze out' stages of energetic heavy ion reactions and calculation of single particle measurables from these models

    International Nuclear Information System (INIS)

    Nyiri, Agnes

    2005-01-01

    -relativistic heavy ion reactions is an important hadronic observable sensitive to the early stages of system evolution. The flow analysis involves the particles, which have already been frozen out. Therefore, to perform realistic flow computations from the Multi Module Model we need a complete freeze out description and a well identified freeze out surface. However, the freeze out module is still not ready. Although we have not yet been able to evaluate collective flow using the Multi Module Model, the method and code for the calculation of flow components has been worked out in an independent module. This module is completed and can be coupled to the previous modules when those are ready for use. In order to test the code, we have calculated directed and elliptic flow from a tilted, ellipsoidally expanding source using a simple, blast wave type of model. This model was developed directly for this aim based on Buda-Lund hydro models. Although, this oversimplified blast wave model is not suitable to reproduce the experimental data -which will be an important task in the future to check our Multi Module Model-, it has provided us with important information. We have found that the directed flow, is very sensitive to the correct identification of the reaction plane included the determination of the impact parameter vector, and can be misinterpreted by some experimental methods. We have shown that misidentification of the reaction plane may even set the directed flow to zero by construction. We have presented results of the rapidity dependence of the directed flow, v1, and elliptic flow, v2, furthermore, the transverse momentum dependence of v2. We have also investigated the dependence of the flow pattern on the initial geometry of the fireball by calculating flow components from two ellipsoidal sources with the same thermodynamical properties but different shape. The code determining the freeze out hypersurface should still be improved in order to avoid inaccuracies in the further

  6. Reaction of Rb and oxygen overlayers with single-crystalline Bi2Sr2CaCu2O/sub 8+//sub δ/ superconductors

    International Nuclear Information System (INIS)

    Lindberg, P.A.P.; Shen, Z.; Wells, B.O.; Dessau, D.S.; Mitzi, D.B.; Lindau, I.; Spicer, W.E.; Kapitulnik, A.

    1989-01-01

    Single crystals of Bi 2 Sr 2 CaCu 2 O/sub 8+//sub δ/ superconductors, in situ cleaved and modified by Rb and oxygen overlayers, have been studied using ultraviolet and x-ray photoemission spectroscopy. The core-level results show that Rb strongly reacts with the Bi and O states, while the Cu and Sr states are left unchanged. This observation strongly indicates that the Bi-O plane forms the surface layer. Subsequent exposure to oxygen results in new oxygen states at the surface as monitored by the O 1s core-level data. For both Rb and oxygen overlayers the valence-band spectra are severely altered. In particular, new valence-band states, presumably of oxygen character, are formed

  7. Calcination and solid state reaction of ceramic-forming components to provide single-phase superconducting materials having fine particle size

    Science.gov (United States)

    Balachandran, Uthamalingam; Poeppel, Roger B.; Emerson, James E.; Johnson, Stanley A.

    1992-01-01

    An improved method for the preparation of single phase, fine grained ceramic materials from precursor powder mixtures where at least one of the components of the mixture is an alkali earth carbonate. The process consists of heating the precursor powders in a partial vacuum under flowing oxygen and under conditions where the partial pressure of CO.sub.2 evolved during the calcination is kept to a very low level relative to the oxygen. The process has been found particularly suitable for the preparation of high temperature copper oxide superconducting materials such as YBa.sub.2 Cu.sub.3 O.sub.x "123" and YBa.sub.2 Cu.sub.4 O.sub.8 "124".

  8. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eve J.; Chiang, Eugene, E-mail: evelee@berkeley.edu, E-mail: echiang@astro.berkeley.edu [Department of Astronomy, University of California Berkeley, Berkeley, CA 94720-3411 (United States)

    2016-08-20

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  9. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    International Nuclear Information System (INIS)

    Lee, Eve J.; Chiang, Eugene

    2016-01-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  10. A Primer on Unifying Debris Disk Morphologies

    Science.gov (United States)

    Lee, Eve J.; Chiang, Eugene

    2016-08-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  11. In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin

    Directory of Open Access Journals (Sweden)

    Reena Vora

    2012-01-01

    Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.

  12. Effect of a whitening agent application on enamel bond strength of self-etching primer systems.

    Science.gov (United States)

    Miyazaki, Masashi; Sato, Hikaru; Sato, Tomomi; Moore, B Keith; Platt, Jeffrey A

    2004-06-01

    Though reduction in bond strength after tooth whitening has been reported, little is known about it's effect on enamel bond strength of two-step bonding systems that exclude phosphoric acid etching prior to bonding agent application. The purpose of this study was to determine the effect of whitening procedure using an in-office whitening agent on enamel bond strength of self-etching primer systems. Three self-etching primer systems, Imperva Fluoro Bond, Mac Bond II, Clearfil SE Bond, and a one-bottle adhesive system Single Bond as a control material, were used. Bovine mandibular incisors were mounted in self-curing resin and the facial enamel or dentin surfaces were ground wet on 600-grit SiC paper. An in-office whitening agent, Hi-Lite was applied on the tooth surface according to the manufacturer's instruction. Bonding procedures were done soon after rinsing off the whitening agent or after 24 hours storage in distilled water. Specimens without whitening procedure were prepared as controls. Fifteen specimens per test group were stored in 37 degrees C distilled water for 24 hours, then shear tested at a crosshead speed of 1.0 mm/minute. One-way ANOVA followed by Duncan multiple range test were used for statistical analysis of the results. For the specimens made soon after rinsing off the whitening agent, a significant decrease in enamel bond strength was observed for all the bonding systems used. For the specimens made after 24 hours storage in water, a small decrease in enamel bond strength was observed and no significant differences were found compared to those of controls (without whitening). From the results of this study, enamel bond strengths of the self-etching primer systems might be affected to a lesser degree after rinsing with water followed by 24 hours storage in water.

  13. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  14. Large scale collective modeling the final 'freeze out' stages of energetic heavy ion reactions and calculation of single particle measurables from these models

    Energy Technology Data Exchange (ETDEWEB)

    Nyiri, Agnes

    2005-07-01

    -relativistic heavy ion reactions is an important hadronic observable sensitive to the early stages of system evolution. The flow analysis involves the particles, which have already been frozen out. Therefore, to perform realistic flow computations from the Multi Module Model we need a complete freeze out description and a well identified freeze out surface. However, the freeze out module is still not ready. Although we have not yet been able to evaluate collective flow using the Multi Module Model, the method and code for the calculation of flow components has been worked out in an independent module. This module is completed and can be coupled to the previous modules when those are ready for use. In order to test the code, we have calculated directed and elliptic flow from a tilted, ellipsoidally expanding source using a simple, blast wave type of model. This model was developed directly for this aim based on Buda-Lund hydro models. Although, this oversimplified blast wave model is not suitable to reproduce the experimental data--which will be an important task in the future to check our Multi Module Model--it has provided us with important information. We have found that the directed flow, is very sensitive to the correct identification of the reaction plane included the determination of the impact parameter vector, and can be misinterpreted by some experimental methods. We have shown that misidentification of the reaction plane may even set the directed flow to zero by construction. We have presented results of the rapidity dependence of the directed flow, v1, and elliptic flow, v2, furthermore, the transverse momentum dependence of v2. We have also investigated the dependence of the flow pattern on the initial geometry of the fireball by calculating flow components from two ellipsoidal sources with the same thermodynamical properties but different shape. The code determining the freeze out hypersurface should still be improved in order to avoid inaccuracies in the further

  15. Large scale collective modeling the final 'freeze out' stages of energetic heavy ion reactions and calculation of single particle measurables from these models

    Energy Technology Data Exchange (ETDEWEB)

    Nyiri, Agnes

    2005-07-01

    -relativistic heavy ion reactions is an important hadronic observable sensitive to the early stages of system evolution. The flow analysis involves the particles, which have already been frozen out. Therefore, to perform realistic flow computations from the Multi Module Model we need a complete freeze out description and a well identified freeze out surface. However, the freeze out module is still not ready. Although we have not yet been able to evaluate collective flow using the Multi Module Model, the method and code for the calculation of flow components has been worked out in an independent module. This module is completed and can be coupled to the previous modules when those are ready for use. In order to test the code, we have calculated directed and elliptic flow from a tilted, ellipsoidally expanding source using a simple, blast wave type of model. This model was developed directly for this aim based on Buda-Lund hydro models. Although, this oversimplified blast wave model is not suitable to reproduce the experimental data--which will be an important task in the future to check our Multi Module Model--it has provided us with important information. We have found that the directed flow, is very sensitive to the correct identification of the reaction plane included the determination of the impact parameter vector, and can be misinterpreted by some experimental methods. We have shown that misidentification of the reaction plane may even set the directed flow to zero by construction. We have presented results of the rapidity dependence of the directed flow, v1, and elliptic flow, v2, furthermore, the transverse momentum dependence of v2. We have also investigated the dependence of the flow pattern on the initial geometry of the fireball by calculating flow components from two ellipsoidal sources with the same thermodynamical properties but different shape. The code determining the freeze out hypersurface should still be improved in order to avoid inaccuracies in the further

  16. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  17. An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, M. D.; Higgins, R. H.

    1985-01-01

    The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

  18. Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.

    Science.gov (United States)

    Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D

    2010-10-01

    Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.

  19. Nuclear reactions

    International Nuclear Information System (INIS)

    Lane, A.M.

    1980-01-01

    In reviewing work at Harwell over the past 25 years on nuclear reactions it is stated that a balance has to be struck in both experiment and theory between work on cross-sections of direct practical relevance to reactors and on those relevant to an overall understanding of reaction processes. The compound nucleus and direct process reactions are described. Having listed the contributions from AERE, Harwell to developments in nuclear reaction research in the period, work on the optical model, neutron capture theory, reactions at doorway states with fine structure, and sum-rules for spectroscopic factors are considered in more detail. (UK)

  20. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  1. Post test investigation of the single rod tests ESSI 1-11 on temperature escalation in PWR fuel rod simulators due to the Zircaloy/steam reaction

    International Nuclear Information System (INIS)

    Hagen, S.; Kapulla, H.; Malauschek, H.; Katanishi, S.

    1987-03-01

    This KfK-report describes the posttest investigation of the single rod tests ESSI-1 to ESSI-11. The objective of these tests was to investigate the temperature escalation behaviour of Zircaloy clad PWR-fuel rods in steam. The investigation of the temperature escalation is part of the program of out-of-pile experiments (CORA) performed within the frame work of the PNS Severe Fuel Damage Program. The experimental arrangement consisted of fuel rod simulator (central tungsten heater, UO 2 ring pellets and Zircaloy cladding), Zircaloy shroud and fiber ceramic insulation. The introductory test ESSI-1 to ESSI-3 were scoping tests designed to obtain information on the temperature escalation of zircaloy in steam. ESSI-4 to ESSI-8 were run with increasing heating rates to investigate the influence of the oxide layer thickness at the start of the escalation. ESSI-9 to ESSI-11 were performed to investigate the influence of the insulation thickness on the escalation behaviour. In these tests we also learned that the gap between removed shroud and insulation has a remarkable influence due to heat removal by convection in the gap. After the test the fuel rod simulator was embedded into epoxy and cut by a diamond saw. The cross sections were photographed and investigated by metalograph microscope, SEM and EMP examinations. (orig./GL) [de

  2. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  3. Utility of a multiplex reverse transcriptasepolymerase chain reaction assay (HemaVision in the evaluation of genetic abnormalities in Korean children with acute leukemia: a single institution study

    Directory of Open Access Journals (Sweden)

    Hye-Jin kim

    2013-06-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; In children with acute leukemia, bone marrow genetic abnormalities (GA have prognostic significance, and may be the basis for minimal residual disease monitoring. Since April 2007, we have used a multiplex reverse transcriptase-polymerase chain reaction tool (HemaVision to detect of GA. &lt;b&gt;Methods:&lt;/b&gt; In this study, we reviewed the results of HemaVision screening in 270 children with acute leukemia, newly diagnosed at The Catholic University of Korea from April 2007 to December 2011, and compared the results with those of fluorescence in situ hybridization (FISH, and G-band karyotyping. &lt;b&gt;Results:&lt;/b&gt; Among the 270 children (153 males, 117 females, 187 acute lymphoblastic leukemia and 74 acute myeloid leukemia patients were identified. Overall, GA was detected in 230 patients (85.2%. HemaVision, FISH, and G-band karyotyping identified GA in 125 (46.3%, 126 (46.7%, and 215 patients (79.6%, respectively. TEL-AML1 (20.9%, 39/187 and AML1-ETO (27%, 20/74 were the most common GA in ALL and AML, respectively. Overall sensitivity of HemaVision was 98.4%, with false-negative results in 2 instances: 1 each for TEL-AML1 and MLL-AF4 . An aggregate of diseasesspecific FISH showed 100% sensitivity in detection of GA covered by HemaVision for actual probes utilized. G-band karyotype revealed GA other than those covered by HemaVison screening in 133 patients (49.3%. Except for hyperdiplody and hypodiploidy, recurrent GA as defined by the World Health Organizationthat were not screened by HemaVision, were absent in the karyotype. &lt;b&gt;Conclusion:&lt;/b&gt; HemaVision, supported by an aggregate of FISH tests for important translocations, may allow for accurate diagnosis of GA in Korean children with acute leukemia.

  4. The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

    Science.gov (United States)

    Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

    2018-01-01

    We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

  5. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  6. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  7. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  8. Table 1. Primers used in the qRT-PCR reactions. LBD gene name ...

    Indian Academy of Sciences (India)

    Vv01. CK. 1. 0.2369. Vv01. Root. 1.17. 0.1925641. Man. 38.01. 1.313. Stem. 2.72. 0.0876. NaCl. 74.17. 0.989. Leaf. 1. 0.13536654. HT. 77.15. 0.9912. LT. 0.13. 0.1134. Vv02. CK. 1. 0.2369. Vv02. Root. 2.41. 0.071614484. Man. 0.062. 0.05164. Stem. 5.47. 0.226. NaCl. 0.47. 0.08017. Leaf. 1. 0.03564736. HT. 5.22. 0.26. LT.

  9. From cutting-edge pointwise cross-section to groupwise reaction rate: A primer

    OpenAIRE

    Sublet Jean-Christophe; Fleming Michael; Gilbert Mark R.

    2017-01-01

    The nuclear research and development community has a history of using both integral and differential experiments to support accurate lattice-reactor, nuclear reactor criticality and shielding simulations, as well as verification and validation efforts of cross sections and emitted particle spectra. An important aspect to this type of analysis is the proper consideration of the contribution of the neutron spectrum in its entirety, with correct propagation of uncertainties and standard deviatio...

  10. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  11. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  12. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  13. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  14. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  15. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  16. Measurement of Single Spin Asymmetries in Semi-Inclusive Deep Inelastic Scattering Reaction n(e, e'π+) X at Jefferson Lab

    Energy Technology Data Exchange (ETDEWEB)

    Allada, Kalyan [Univ. of Kentucky, Lexington, KY (United States)

    2010-06-01

    What constitutes the spin of the nucleon? The answer to this question is still not completely understood. Although we know the longitudinal quark spin content very well, the data on the transverse quark spin content of the nucleon is still very sparse. Semi-inclusive Deep Inelastic Scattering (SIDIS) using transversely polarized targets provide crucial information on this aspect. The data that is currently available was taken with proton and deuteron targets. The E06-010 experiment was performed at Jefferson Lab in Hall-A to measure the single spin asymmetries in the SIDIS reaction n(e, e'π±/K±)X using transversely polarized 3He target. The experiment used the continuous electron beam provided by the CEBAF accelerator with a beam energy of 5.9 GeV. Hadrons were detected in a high-resolution spectrometer in coincidence with the scattered electrons detected by the BigBite spectrometer. The kinematic coverage focuses on the valence quark region, x = 0.19 to 0.34, at Q2 = 1.77 to 2.73 (GeV/c)2. This is the first measurement on a neutron target. The data from this experiment, when combined with the world data on the proton and the deuteron, will provide constraints on the transversity and Sivers distribution functions on both the u and d-quarks in the valence region. In this work we report on the single spin asymmetries in the SIDIS n(e, e'π+)X reaction.

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  19. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  20. Identification of four squid species by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  2. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  3. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  4. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  5. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  6. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  7. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  8. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  9. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  10. Comparative evaluation of self-etching primers and phosphoric acid effectiveness on composite to enamel bond: an in vitro study.

    Science.gov (United States)

    Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay

    2013-09-01

    The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.

  11. A novel single fluorophore-labeled double-stranded oligonucleotide probe for fluorescence-enhanced nucleic acid detection based on the inherent quenching ability of deoxyguanosine bases and competitive strand-displacement reaction.

    Science.gov (United States)

    Zhang, Yingwei; Tian, Jingqi; Li, Hailong; Wang, Lei; Sun, Xuping

    2012-01-01

    We develop a novel single fluorophore-labeled double-stranded oligonucleotide (OND) probe for rapid, nanostructure-free, fluorescence-enhanced nucleic acid detection for the first time. We further demonstrate such probe is able to well discriminate single-base mutation in nucleic acid. The design takes advantage of an inherent quenching ability of guanine bases. The short strand of the probe is designed with an end-labeled fluorophore that is placed adjacent to two guanines as the quencher located on the long opposite strand, resulting in great quenching of dye fluorescence. In the presence of a target complementary to the long strand of the probe, a competitive strand-displacement reaction occurs and the long strand forms a more stable duplex with the target, resulting in the two strands of the probe being separated from each other. As a consequence of this displacement, the fluorophore and the quencher are no longer in close proximity and dye fluorescence increases, signaling the presence of target.

  12. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  13. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  14. Association of single nucleotide polymorphisms in the MVP gene with platinum resistance and survival in patients with epithelial ovarian cancer.

    Science.gov (United States)

    Zhao, Ya-Nan; He, Dong-Ning; Wang, Ya-DI; Li, Jun-Jie; Ha, Min-Wen

    2016-04-01

    The human major vault protein (MVP) has been linked to the development of multidrug resistance in cancer cells, and overexpression of MVP has been observed in ovarian cancer tissues. The aim of the present study was to investigate the association between single nucleotide polymorphisms (SNPs) in the MVP gene and the tumor response to platinum-based chemotherapy and survival of patients affected by epithelial ovarian cancer (EOC), in addition to confirm whether tetra-primer amplification-refractory mutation system (ARMS)-polymerase chain reaction (PCR) is an accurate genotyping method. For this purpose, two polymorphisms in the MVP gene, namely reference SNP (rs)1057451 and rs4788186, were selected from the data obtained by the International haplotype map (HapMap) Project regarding Chinese Han population, and were evaluated by tetra-primer ARMS-PCR. Upon validation by DNA sequencing, the association of these polymorphisms with platinum resistance, progression-free survival (PFS) and overall survival (OS) in patients with EOC was assessed. The results of tetra-primer ARMS-PCR were in agreement with those derived from DNA sequencing. No significant differences were observed between platinum-sensitive and platinum-resistant cohorts in terms of allele and genotype distribution of these two polymorphisms in the MVP gene, which were not associated with PFS or OS. However, a trend toward prolonged PFS was observed in patients carrying the heterozygous AG allele at the rs4788186 locus. These results suggest that rs1057451 and rs4788186 variants in the MVP gene are not associated with favorable therapeutic response to platinum or longer survival in Chinese Han patients affected by EOC. In addition, the data of the present study confirm that tetra-primer ARMS-PCR is a trustworthy and economical genotyping method.

  15. Novel Tetra-Primer ARMS-PCR Assays for Thiopurine Intolerance Susceptibility Mutations NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C in East Asians

    Directory of Open Access Journals (Sweden)

    Chi-Chun Ho

    2017-10-01

    Full Text Available Thiopurines are clinically useful in the management of diverse immunological and malignant conditions. Nevertheless, these purine analogues can cause lethal myelosuppression, which may be prevented by prospective testing for variants in the thiopurine S-methyltransferase (TPMT and, in East Asians, Nudix hydrolase 15 (NUDT15 genes. Two single-tube, tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR assays were developed to genotype the common loss-of-function variants NUDT15 c.415C>T (rs116855232 and TPMT*3C c.719A>G (rs1142345. In a group of 60 unselected patients, one and seven were found to be homozygous and heterozygous, respectively, for NUDT15 c.415C>T; one was found to be heterozygous for TPMT*3C c.719A>G. There was no non-specific amplification, and the genotypes were 100% concordant with Sanger sequencing. Limit-of-detection for both assays was below 1 ng of heterozygous template per reaction. Time- and cost-effective ARMS-PCR assays, suitable for genotyping East-Asian patients for thiopurine intolerance, were successfully developed and validated.

  16. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  17. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  18. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  19. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  20. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Directory of Open Access Journals (Sweden)

    Roberts WE

    2015-09-01

    Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance