WorldWideScience

Sample records for single photo-electron response

  1. Photo-electronic current transport in back-gated graphene transistor

    Science.gov (United States)

    Srivastava, Ashok; Chen, Xinlu; Pradhan, Aswini K.

    2017-04-01

    In this work, we have studied photo-electronic current transport in a back-gated graphene field-effect transistor. Under the light illumination, band bending at the metal/graphene interface develops a built-in potential which generates photonic current at varying back-gate biases. A typical MOSFET type back-gated transistor structure uses a monolayer graphene as the channel layer formed over the silicon dioxide/silicon substrate. It is shown that the photo-electronic current consists of current contributions from photovoltaic, photo-thermoelectric and photo-bolometric effects. A maximum external responsivity close to 0.0009A/W is achieved at 30μW laser power source and 633nm wavelength.

  2. The PhotoElectron Boundary as observed by MAVEN instruments

    Science.gov (United States)

    Garnier, P.; Steckiewicz, M.; Mazelle, C. X.; Xu, S.; Mitchell, D. L.; Holmberg, M.; Halekas, J. S.; Andersson, L.; Brain, D.; Connerney, J. E. P.; Espley, J. R.; Lillis, R. J.; Luhmann, J. G.; Savaud, J. A.; Jakosky, B. M.

    2017-12-01

    Photoelectron peaks in the 20-30 eV energy range are commonly observed in planetary atmospheres (Earth, Mars, Titan...), produced by the intense photoionization from solar 30.4 nm photons. At Mars, these photoelectrons result from the ionization of CO2 and O atmospheric neutrals, and are known to escape the planet down its tail, making them tracers for the atmospheric escape (Frahm et al., 2006). Furthermore, their presence or absence allows us to define the so-called PhotoElectron Boundary (PEB), that separates the sunlit photoelectron-dominated ionosphere from the solar wind controlled environment, as initially observed by the Mars Global Surveyor (MGS) MAG/ER instrument (Mitchell et al. (2000, 2001). We provide here a detailed statistical analysis of the location and properties of the PEB based on the Mars Atmosphere and Volatile Evolution (MAVEN) mission electron and magnetic field data. Our dataset includes 1696 dayside PEB crossings obtained from September 2014 until May 2016 (the observations of escaping photoelectrons in the wake being not included). The PEB appears as mostly sensitive to the solar wind dynamic and crustal magnetic fields pressures, for which a quantitative dependance is derived and compared with two other important boundaries : the bow shock and magnetic pileup boundary. The PEB altitude is highly variable, leading to a variable wake cross section for escape (up to +- 50%), which is important for deriving global escape rates from in situ photoelectron escape rates. The PEB is not always sharp, and is, despite a strong variability, characterized on average by : a magnetic field topology typical for the edge of the Magnetic Pile Up Region above it, more field aligned fluxes above than below, and a clear change of the altitude dependence of both electron fluxes and total density (that appears different from the ionopause). The PEB thus appears as a transition region between two plasma and field configurations which is determined by the

  3. Measurement of actinides in environmental samples by Photo-Electron Rejecting Alpha Liquid Scintillation

    Energy Technology Data Exchange (ETDEWEB)

    Cadieux, J.R. [Westinghouse Savannah River Co., Aiken, SC (United States); Clark, S. [Savannah River Ecology Lab., Univ. of Georgia (United States); Fjeld, R.A.; Reboul, S.; Sowder, A. [Clemson Univ., SC (United States). Dept. of Environmental Systems Engineering

    1994-05-01

    This work describes the adaptation of extractive scintillation with a Photo-Electron Rejecting Alpha Liquid Scintillation (PERALS) (ORDELA, Inc.) spectrometer to the analysis of actinides in environmental samples from the Savannah River Site (SRS). Environmental quality assurance standards and actual water samples were treated by one of two methods; either a two step direct extraction, or for more complex samples, pretreatment by an extraction chromatographic separation prior to measurement of the alpha activity by PERALS.

  4. Effect of tip geometry on photo-electron-emission from nanostructures.

    Science.gov (United States)

    Teki, Ranganath; Lu, Toh-Ming; Koratkar, Nikhil

    2009-03-01

    We show in this paper the strong effect of tip geometry on the photo-electron-emission behavior of nanostructured surfaces. To study the effect of tip geometry we compared the photo-emissivity of Ru and Pt nanorods with pyramidal shaped tips to that of carbon nanorods that display flat top (planar) tips. Flat top architectures gave no significant increase in the emission current, while nanostructures with pyramidal shaped tips showed 3-4 fold increase in photo-emission compared to a thin film of the same material. Pyramidal tip geometries increase the effective surface area that is exposed to the incident photon-flux thereby enhancing the photon-collection probability of the system. Such nano-structured surfaces show promise in a variety of device applications such as photo-detectors, photon counters and photo-multiplier tubes.

  5. Single Hadron Response Measurement in ATLAS

    CERN Document Server

    Starovoitov, P; The ATLAS collaboration

    2012-01-01

    Single hadron response measurement in minimum bias proton-proton collisions at a center of mass energy of $sqrt{s}=7$~TeV are presented. Together with test-beam results, these measurement form the basis to evaluate the calorimeter energy response uncertainty of jets at high transverse momenta. A novel technique to evaluate the jet energy response from the single particle response will be presented. The single hadrons response is measured in the momentum range of 0.5 to about 20~GeV in-situ, by comparing the calorimeter response of all energy deposits in a cone around an isolated track with the more precisely measured track momenta. The agreement between data and Monte Carlo simulation is on the level of a few percent. Using kaon and $Lambda$ particles, the calorimeter response of identified pions, proton and anti-proton is studied. The MC simulation describes the energy response of pions and protons well, but differences are observed for anti-protons. It is discussed how the jet calorimeter response uncertain...

  6. Single hadron response measurements in ATLAS

    CERN Document Server

    Sousa, M J; The ATLAS collaboration

    2012-01-01

    Single hadron response measurement in minimum bias proton-proton collisions at a center of mass energy of sqrt(s)=7 TeV are presented. Together with test-beam results these measurement form the basis to evaluate the calorimeter response uncertainty of jets at high transverse momenta. The novel technique to evaluate the jet from the single particle response will be presented. The single hadrons response is measured in the momentum range of 0.5 to about 20 GeV in-situ by comparing the calorimeter response of all energy deposits in a cone around an isolated track with the precisely measured track momenta. The agreement between data and Monte Carlo simulation is on the level of a few percent. Using kaon and Lambda particles the calorimeter response of identified pions, proton and anti-proton The MC simulation describes pions and protons well, but differences are observed for anti-protons. It is discuss how the jet calorimeter response uncertainty and it correlation between tranverse momentum bins is determined fr...

  7. Measurement of single hadron response with ATLAS

    CERN Document Server

    Jennens, D; The ATLAS collaboration

    2011-01-01

    A poster to be presented at PLHC 2011 in Perugia on the response of the ATLAS calorimeter to single charged hadrons and its propagation to the uncertainty on the calorimeter jet energy scale. The response of the ATLAS calorimeter to single charged hadrons has been measured for momenta between 0.5 and 20 GeV and |eta| < 2.3. This response is measured by comparison of the sum of energy deposits in a cone of R-0.2 around the extrapolated position of a track and that track's momentum. The response measured in data matches that generated by Monte Carlo to within 2-5%. This is then used in conjunction with test beam data to estimate the bias and uncertainty of the jet energy scale uncertainty in the ATLAS detector.

  8. Photo-electron spectroscopy using synchrotron radiation of molecular radicals and fragments produced by laser photo-dissociation

    International Nuclear Information System (INIS)

    Nahon, Laurent

    1991-01-01

    This research thesis reports the combined use of a laser and of a synchrotron radiation in order to respectively photo-dissociate a molecule and to photo-ionize fragments which are analysed by photo-electron spectroscopy. This association allows, on the one hand, radical photo-ionization to be studied, and, on the other hand, polyatomic molecule photo-dissociation to be studied. The author studied the photo-excitation and/or photo-ionization in layer 4d (resp. 3d) of atomic iodine (resp. bromine) produced almost complete laser photo-dissociation of I 2 (resp. Br 2 ). He discuses the processes of relaxation of transitions from valence 4d to 5p (resp. 3d to 4p) which occur either by direct self-ionization or by resonant Auger effect, and reports the study of photo-dissociation of s-tetrazine (C 2 N 4 H 2 ) [fr

  9. Electronic structure of germanium selenide investigated using ultra-violet photo-electron spectroscopy

    International Nuclear Information System (INIS)

    Mishra, P; Lohani, H; Sekhar, B R; Kundu, A K; Menon, Krishnakumar S R; Patel, R; Solanki, G K

    2015-01-01

    The valence band electronic structure of GeSe single crystals has been investigated using angle resolved photoemission spectroscopy (ARPES) and x-ray photoelectron spectroscopy. The experimentally observed bands from ARPES, match qualitatively with our LDA-based band structure calculations along the Γ–Z, Γ–Y and Γ–T symmetry directions. The valence band maximum occurs nearly midway along the Γ–Z direction, at a binding energy of −0.5 eV, substantiating the indirect band gap of GeSe. Non-dispersive features associated with surface states and indirect transitions have been observed. The difference in hybridization of Se and Ge 4p orbitals leads to the variation of dispersion along the three symmetry directions. The predominance of the Se 4p z orbitals, evidenced from theoretical calculations, may be the cause for highly dispersive bands along the Γ–T direction. Detailed electronic structure analysis reveals the significance of the cation–anion 4p orbitals hybridization in the valence band dispersion of IV–VI semiconductors. This is the first comprehensive report of the electronic structure of a GeSe single crystal using ARPES in conjugation with theoretical band structure analysis. (paper)

  10. Optothermal response of a single silicon nanotip

    Science.gov (United States)

    Vella, A.; Shinde, D.; Houard, J.; Silaeva, E.; Arnoldi, L.; Blum, I.; Rigutti, L.; Pertreux, E.; Maioli, P.; Crut, A.; Del Fatti, N.

    2018-02-01

    The optical properties and thermal dynamics of conical single silicon nanotips are experimentally and theoretically investigated. The spectral and spatial dependencies of their optical extinction are quantitatively measured by spatial modulation spectroscopy (SMS). A nonuniform optical extinction along the tip axis and an enhanced near-infrared absorption, as compared to bulk crystalline silicon, are evidenced. This information is a key input for computing the thermal response of single silicon nanotips under ultrafast laser illumination, which is investigated by laser assisted atom probe tomography (La-APT) used as a highly sensitive temperature probe. A combination of these two experimental techniques and comparison with modeling also permits us to elucidate the impact of thermal effects on the laser assisted field evaporation process. Extension of this coupled approach opens up future perspectives for the quantitative study of the optical and thermal properties of a wide class of individual nano-objects, in particular elongated ones such as nanotubes, nanowires, and nanocones, which constitute promising nanosources for electron and/or ion emission.

  11. Design and development of a high energy photo-electron spectroscopy beamline on Indus-2 synchrotron radiation source

    International Nuclear Information System (INIS)

    Jagannath; Bhandarkar, V.B.; Pradeep, R.; Sharma, R.K.; Sule, U.S.; Goutam, U.K.; Gadkari, S.C.; Yakhmi, J.V.; Sahni, V.C.

    2007-08-01

    We report on the design and development of a high energy x-ray photo-electron spectroscopy (XPS) beamline for one of the bending magnets (BM-6) at the 2.5 GeV, 3 rd generation Indus-2 synchrotron radiation (SR) source under commissioning at the Raja Ramanna Centre for Advanced Technology, Indore. The beamline (BL) extends up to 40 m in length, and has been designed based on certain criteria such as its working energy range (0.8 - 15.0 keV), the resolution (∼ 10 -4 ), the flux throughput (10 10 -10 11 ), and the requirement of a focused beam at the sample position. Two pairs of identical crystals in the (+1, -1) double crystal monochromator (DCM) geometry, based on beryl (10i0) and Si (111) reflections with their intrinsic resolution of ∼ 10 -4 have been chosen to respectively cover the lower (0.8-2.0 keV) and higher energy (2 - 15.0 keV) ranges of the BL. The DCM has been placed at a distance of 30.0 m from the BM source. The effect of pitch (ΔΘ P ) and roll errors (ΔΘ R ) of the DCM on the vertical and horizontal shifts in the exit beam has been evaluated and minimized to acceptable values (ΔΘ P R < 2 μrad) that correspond to shifts of less than 20 % of the beam width at the sample position. Sagittal focusing has been achieved by bending the 2 nd Si crystal of the DCM in the sagittal direction. A mirror has been placed at 20.0 m from the BM source. The toroidal surface of the mirror substrate (1.2 m long Si crystal) is coated with a thin film of Pt metal (∼ 50 nm), and held at a grazing angle of 9.0 μrad so that it provides high reflectivity in a much wider energy range from 0.8 to 8.0 keV. The effect of mirror surface imperfections, such as the roughness and figure error, on the spot size at its focal position has been evaluated and optimized using a ray-trace program SHADOW. The optimum value for the roughness is found to be 3.0 A, while those for figure errors are found to be 2.0 and 20.0 μrad in the meridional and sagittal directions

  12. Reshock and release response of aluminum single crystal

    International Nuclear Information System (INIS)

    Huang, H.; Asay, J. R.

    2007-01-01

    Reshock and release experiments were performed on single crystal aluminum along three orientations and on polycrystalline 1050 aluminum with 50 μm grain size at shock stresses of 13 and 21 GPa to investigate the mechanisms for previously observed quasielastic recompression behavior. Particle velocity profiles obtained during reshocking both single crystals and polycrystalline aluminum from initial shock stresses of 13-21 GPa show similar quasielastic recompression behavior. Quasielastic release response is also observed in all single crystals, but the magnitude of the effect is crystal orientation dependent, with [111] and [110] exhibiting more ideal elastic-plastic release for unloading from the shocked state than for the [100] orientation and polycrystalline aluminum. The quasielastic response of 1050 aluminum is intermediate to that of the [100] and [111] orientations. Comparison of the wave profiles obtained for both unloading and reloading of single crystals and polycrystalline 1050 aluminum from shocked states suggests that the observed quasielastic response of polycrystalline aluminum results from the averaging response of single crystals for shock propagation along different orientations, and that the response of 1050 aluminum with large grain boundaries is not significantly different from the results obtained on single crystal aluminum. The yield strength of the single crystals and 1050 aluminum is found to increase with shock stress, which is consistent with previous results [H. Huang and I. R. Asay, J. Appl. Phys. 98, 033524 (2005)

  13. Hard X-ray PhotoElectron Spectroscopy of transition metal oxides: Bulk compounds and device-ready metal-oxide interfaces

    International Nuclear Information System (INIS)

    Borgatti, F.; Torelli, P.; Panaccione, G.

    2016-01-01

    Highlights: • Hard X-ray PhotoElectron Spectroscopy (HAXPES) applied to buried interfaces of systems involving Transition Metal Oxides. • Enhanced contribution of the s states at high kinetic energies both for valence and core level spectra. • Sensitivity to chemical changes promoted by electric field across metal-oxide interfaces in resistive switching devices. - Abstract: Photoelectron spectroscopy is one of the most powerful tool to unravel the electronic structure of strongly correlated materials also thanks to the extremely large dynamic range in energy, coupled to high energy resolution that this form of spectroscopy covers. The kinetic energy range typically used for photoelectron experiments corresponds often to a strong surface sensitivity, and this turns out to be a disadvantage for the study of transition metal oxides, systems where structural and electronic reconstruction, different oxidation state, and electronic correlation may significantly vary at the surface. We report here selected Hard X-ray PhotoElectron Spectroscopy (HAXPES) results from transition metal oxides, and from buried interfaces, where we highlight some of the important features that such bulk sensitive technique brings in the analysis of electronic properties of the solids.

  14. Stimulus-response functions of single avian olfactory bulb neurones.

    Science.gov (United States)

    McKeegan, Dorothy E F; Demmers, Theodorus G M; Wathes, Christopher M; Jones, R Bryan; Gentle, Michael J

    2002-10-25

    This study investigated olfactory processing in a functional context by examining the responses of single avian olfactory bulb neurones to two biologically important gases over relevant concentration ranges. Recordings of extracellular spike activity were made from 80 single units in the left olfactory bulb of 11 anaesthetised, freely breathing adult hens (Gallus domesticus). The units were spontaneously active, exhibiting widely variable firing rates (0.07-47.28 spikes/s) and variable temporal firing patterns. Single units were tested for their response to an ascending concentration series of either ammonia (2.5-100 ppm) or hydrogen sulphide (1-50 ppm), delivered directly to the olfactory epithelium. Stimulation with a calibrated gas delivery system resulted in modification of spontaneous activity causing either inhibition (47% of units) or excitation (53%) of firing. For ammonia, 20 of the 35 units tested exhibited a response, while for hydrogen sulphide, 25 of the 45 units tested were responsive. Approximate response thresholds for ammonia (median threshold 3.75 ppm (range 2.5-60 ppm, n=20)) and hydrogen sulphide (median threshold 1 ppm (range 1-10 ppm, n=25)) were determined with most units exhibiting thresholds near the lower end of these ranges. Stimulus response curves were constructed for 23 units; 16 (the most complete) were subjected to a linear regression analysis to determine whether they were best fitted by a linear, log or power function. No single function provided the best fit for all the curves (seven were linear, eight were log, one was power). These findings show that avian units respond to changes in stimulus concentration in a manner generally consistent with reported responses in mammalian olfactory bulb neurones. However, this study illustrates a level of fine-tuning to small step changes in concentration (<5 ppm) not previously demonstrated in vertebrate single olfactory bulb neurones.

  15. A new approach for improved time and position measurements for TOF-PET: Time-stamping of the photo-electrons using analogue SiPMs

    CERN Document Server

    Doroud, K

    2017-01-01

    Measurement of the Time-of-Flight (TOF) of the 511 keV gammas brings an important reduction of statistical noise in the PET image, with higher precision time measurements producing clearer images. The common method of coupling a photodetector to scintillating crystals is to have two matching matrices, with a one-to-one coupling between the crystal and the photodetector. We propose a new geometry based on analogue strip SiPMs reading out a scintillator cut into slabs. This technique allows the time stamping of individual photo-electrons and extracts the best time resolution using a specific algorithm. Here we present the results from the first ‘slab module’ test.

  16. A new approach for improved time and position measurements for TOF-PET: Time-stamping of the photo-electrons using analogue SiPMs

    Energy Technology Data Exchange (ETDEWEB)

    Doroud, K., E-mail: Katayoun.Doroud@cern.ch [CERN Geneva (Switzerland); Williams, M.C.S. [CERN Geneva (Switzerland); INFN, Bologna (Italy)

    2017-03-21

    Measurement of the Time-of-Flight (TOF) of the 511 keV gammas brings an important reduction of statistical noise in the PET image, with higher precision time measurements producing clearer images. The common method of coupling a photodetector to scintillating crystals is to have two matching matrices, with a one-to-one coupling between the crystal and the photodetector. We propose a new geometry based on analogue strip SiPMs reading out a scintillator cut into slabs. This technique allows the time stamping of individual photo-electrons and extracts the best time resolution using a specific algorithm. Here we present the results from the first ‘slab module’ test.

  17. The responsibility to care for single homeless people.

    Science.gov (United States)

    Crane, M; Warnes, A M

    2001-11-01

    This paper examines the reasons why in contemporary Britain many single homeless people with severe physical and mental health problems and welfare needs do not receive the treatment, care and financial support that they manifestly need, and in particular considers the interaction between their personal characteristics and the organisation and the obligations of services. Homelessness is a complex concept associated with problems of housing, health, social care and income. The greatest weaknesses of the service system are that no single agency has a statutory responsibility to ensure that vulnerable homeless people are served, and none of the generalist welfare agencies have a duty to seek out those who do not present. As a result, single homeless people fall between the housing, health and social services and amass exceptional unmet needs. The paper appraises the approaches to single homeless people's problems that have recently been introduced by the Rough Sleepers' Unit (RSU), and discusses the ways in which current reforms of the welfare services may impact on the situation of homeless people. With the possibility that the RSU's prime responsibility for commissioning single homeless people's services will transfer to local authorities in 2002, the paper concludes by specifying the implications for voluntary and statutory providers and makes recommendations about the attribution of the responsibility to care for this vulnerable group.

  18. Modeling Rabbit Responses to Single and Multiple Aerosol ...

    Science.gov (United States)

    Journal Article Survival models are developed here to predict response and time-to-response for mortality in rabbits following exposures to single or multiple aerosol doses of Bacillus anthracis spores. Hazard function models were developed for a multiple dose dataset to predict the probability of death through specifying dose-response functions and the time between exposure and the time-to-death (TTD). Among the models developed, the best-fitting survival model (baseline model) has an exponential dose-response model with a Weibull TTD distribution. Alternative models assessed employ different underlying dose-response functions and use the assumption that, in a multiple dose scenario, earlier doses affect the hazard functions of each subsequent dose. In addition, published mechanistic models are analyzed and compared with models developed in this paper. None of the alternative models that were assessed provided a statistically significant improvement in fit over the baseline model. The general approach utilizes simple empirical data analysis to develop parsimonious models with limited reliance on mechanistic assumptions. The baseline model predicts TTDs consistent with reported results from three independent high-dose rabbit datasets. More accurate survival models depend upon future development of dose-response datasets specifically designed to assess potential multiple dose effects on response and time-to-response. The process used in this paper to dev

  19. Research on techniques for laser ranging to optical corner reflectors on the moon. Research on laser techniques and single photo-electron detection and timing

    Science.gov (United States)

    Alley, C. O.

    1976-01-01

    Experimental studies using a pulsed LED, Cerenkov source, and a 100 ps laser were made of various photomultipliers and discriminator combinations. In addition, a new type of neodymium-YAG frequency doubled laser was used as the basis for the development of a stable, short pulse, high repetition rate laser system. This laser was then used in conjunction with atomic clocks to study the effect of gravitational potential on elapsed time. Avenues to promote the development of international cooperation in the area of lunar laser ranging were also explored.

  20. Thermoelectric Response in Single Quintuple Layer Bi2Te3

    KAUST Repository

    Sharma, S.

    2016-10-05

    Because Bi2Te3 belongs to the most important thermoelectric materials, the successful exfoliation of a single quintuple layer has opened access to an interesting two-dimensional material. For this reason, we study the thermoelectric properties of single quintuple layer Bi2Te3 by considering both the electron and phonon transport. On the basis of first-principles density functional theory, the electronic and phononic contributions are calculated by solving Boltzmann transport equations. The dependence of the lattice thermal conductivity on the phonon mean free path is evaluated along with the contributions of the acoustic and optical branches. We find that the thermoelectric response is significantly better for p- than for n-doping. By optimizing the carrier concentration, at 300 K, a ZT value of 0.77 is achieved, which increases to 2.42 at 700 K.

  1. Single-particle response function in finite nuclei

    International Nuclear Information System (INIS)

    Shlomo, S.; Texas A and M Univ., College Station

    1982-01-01

    I derive expressions for the single-particle response (structure) function S(E, q) and its sum rule, (Pauli blocking factor) P(q) = ∫ dE S(E, q), in terms of the Wiqner transforms (WTs) of the single-particle wave functions and the scattering probe sigma(q, r) and discuss the semi-classical phase-space interpretation of the results. For sigma(q, r) = esup(iq x r), I derive simple expressions for S(E, q) and P(q) for finite nuclei within the harmonic-oscillator model and compare the results with the well-known results of the Fermi-gas model. (orig.)

  2. Ultrafast dynamic response of single crystal β-HMX

    Science.gov (United States)

    Zaug, Joseph M.; Armstrong, Michael R.; Crowhurst, Jonathan C.; Radousky, Harry B.; Ferranti, Louis; Swan, Raymond; Gross, Rick; Teslich, Nick E.; Wall, Mark A.; Austin, Ryan A.; Fried, Laurence E.

    2017-01-01

    We report results from ultrafast compression experiments conducted on β-HMX single crystals. Results consist of nominally 12 picosecond time-resolved wave profile data, (ultrafast time domain interferometry -TDI measurements), that were analyzed to determine high-velocity wave speeds as a function of piston velocity. TDI results are used to validate calculations of anisotropic stress-strain behavior of shocked loaded energetic materials. Our previous results derived using a 350 ps duration compression drive revealed anisotropic elastic wave response in single crystal β-HMX from (110) and (010) impact planes. Here we present results using a 1.05 ns duration compression drive with a 950 ps interferometry window to extend knowledge of the anisotropic dynamic response of β-HMX within eight microns of the initial impact plane. We observe two distinct wave profiles from (010) and three wave profiles from (010) impact planes. The (110) impact plane wave speeds typically exceed (010) impact plane wave speeds at the same piston velocities. The development of multiple hydrodynamic wave profiles begins at 20 GPa for the (110) impact plane and 28 GPa for the (10) impact plane. We compare our ultrafast TDI results with previous gun and plate impact results on β-HMX and PBX9501.

  3. Single Pulse Electrical Stimulation to identify epileptogenic cortex : Clinical information obtained from early evoked responses

    NARCIS (Netherlands)

    Mouthaan, B.E.; van 't Klooster, M.A.; Keizer, D.; Hebbink, G.J.; Leijten, F.S.S.; Ferrier, C.H.; van Putten, M.J.A.M.; Zijlmans, M.; Huiskamp, G.J.M.

    Objective: Single Pulse Electrical Stimulation (SPES) probes epileptogenic cortex during electrocorticography. Two SPES responses are described: pathological delayed responses (DR, >100 ms) associated with the seizure onset zone (SOZ) and physiological early responses (ER, <100 ms) that map cortical

  4. cGMP in Mouse Rods: the spatiotemporal dynamics underlying single photon responses

    Directory of Open Access Journals (Sweden)

    Owen P. Gross

    2015-03-01

    Full Text Available Vertebrate vision begins when retinal photoreceptors transduce photons into membrane hyperpolarization, which reduces glutamate release onto second-order neurons. In rod photoreceptors, transduction of single photons is achieved by a well-understood G-protein cascade that modulates cGMP levels, and in turn, cGMP-sensitive inward current. The spatial extent and depth of the decline in cGMP during the single photon response have been major issues in phototransduction research since the discovery that single photons elicit substantial and reproducible changes in membrane current. The spatial profile of cGMP decline during the single photon response affects signal gain, and thus may contribute to reduction of trial-to-trial fluctuations in the single photon response. Here we summarize the general principles of rod phototransduction, emphasizing recent advances in resolving the spatiotemporal dynamics of cGMP during the single photon response.

  5. Neural correlates of single-vessel haemodynamic responses in vivo.

    Science.gov (United States)

    O'Herron, Philip; Chhatbar, Pratik Y; Levy, Manuel; Shen, Zhiming; Schramm, Adrien E; Lu, Zhongyang; Kara, Prakash

    2016-06-16

    Neural activation increases blood flow locally. This vascular signal is used by functional imaging techniques to infer the location and strength of neural activity. However, the precise spatial scale over which neural and vascular signals are correlated is unknown. Furthermore, the relative role of synaptic and spiking activity in driving haemodynamic signals is controversial. Previous studies recorded local field potentials as a measure of synaptic activity together with spiking activity and low-resolution haemodynamic imaging. Here we used two-photon microscopy to measure sensory-evoked responses of individual blood vessels (dilation, blood velocity) while imaging synaptic and spiking activity in the surrounding tissue using fluorescent glutamate and calcium sensors. In cat primary visual cortex, where neurons are clustered by their preference for stimulus orientation, we discovered new maps for excitatory synaptic activity, which were organized similarly to those for spiking activity but were less selective for stimulus orientation and direction. We generated tuning curves for individual vessel responses for the first time and found that parenchymal vessels in cortical layer 2/3 were orientation selective. Neighbouring penetrating arterioles had different orientation preferences. Pial surface arteries in cats, as well as surface arteries and penetrating arterioles in rat visual cortex (where orientation maps do not exist), responded to visual stimuli but had no orientation selectivity. We integrated synaptic or spiking responses around individual parenchymal vessels in cats and established that the vascular and neural responses had the same orientation preference. However, synaptic and spiking responses were more selective than vascular responses--vessels frequently responded robustly to stimuli that evoked little to no neural activity in the surrounding tissue. Thus, local neural and haemodynamic signals were partly decoupled. Together, these results indicate

  6. Eye Movement in Response to Single and Multiple Targets

    Science.gov (United States)

    1985-02-01

    50 ms. Saccades against the smooth response are more prevalent in the short delay records. In the 50-ms-delay record, the amplitude of the smooth...Experimental Bra-in Resejarchjl 1ý6, 121-139. Griffin, J.P. (1976). Theray for amblyopia . in Binloculai Anomaies Procedures for Vision phrp~ pp. 1 !75 -A3. 1

  7. Detection and Characterization of Single-Trial fMRI BOLD Responses : Paradigm Free Mapping

    NARCIS (Netherlands)

    Gaudes, Cesar Caballero; Petridou, Natalia; Dryden, Ian L.; Bai, Li; Francis, Susan T.; Gowland, Penny A.

    This work presents a novel method of mapping the brain's response to single stimuli in space and time without prior knowledge of the paradigm timing: paradigm free mapping (PFM). This method is based on deconvolution of the hemodynamic response from the voxel time series assuming a linear response

  8. A Model-Free Diagnostic for Single-Peakedness of Item Responses Using Ordered Conditional Means

    Science.gov (United States)

    Polak, Marike; De Rooij, Mark; Heiser, Willem J.

    2012-01-01

    In this article we propose a model-free diagnostic for single-peakedness (unimodality) of item responses. Presuming a unidimensional unfolding scale and a given item ordering, we approximate item response functions of all items based on ordered conditional means (OCM). The proposed OCM methodology is based on Thurstone & Chave's (1929) "criterion…

  9. Analyzing System on A Chip Single Event Upset Responses using Single Event Upset Data, Classical Reliability Models, and Space Environment Data

    Science.gov (United States)

    Berg, Melanie; LaBel, Kenneth; Campola, Michael; Xapsos, Michael

    2017-01-01

    We are investigating the application of classical reliability performance metrics combined with standard single event upset (SEU) analysis data. We expect to relate SEU behavior to system performance requirements. Our proposed methodology will provide better prediction of SEU responses in harsh radiation environments with confidence metrics. single event upset (SEU), single event effect (SEE), field programmable gate array devises (FPGAs)

  10. Noisy Response to Antibiotic Stress Predicts Subsequent Single-Cell Survival in an Acidic Environment.

    Science.gov (United States)

    Mitosch, Karin; Rieckh, Georg; Bollenbach, Tobias

    2017-04-26

    Antibiotics elicit drastic changes in microbial gene expression, including the induction of stress response genes. While certain stress responses are known to "cross-protect" bacteria from other stressors, it is unclear whether cellular responses to antibiotics have a similar protective role. By measuring the genome-wide transcriptional response dynamics of Escherichia coli to four antibiotics, we found that trimethoprim induces a rapid acid stress response that protects bacteria from subsequent exposure to acid. Combining microfluidics with time-lapse imaging to monitor survival and acid stress response in single cells revealed that the noisy expression of the acid resistance operon gadBC correlates with single-cell survival. Cells with higher gadBC expression following trimethoprim maintain higher intracellular pH and survive the acid stress longer. The seemingly random single-cell survival under acid stress can therefore be predicted from gadBC expression and rationalized in terms of GadB/C molecular function. Overall, we provide a roadmap for identifying the molecular mechanisms of single-cell cross-protection between antibiotics and other stressors. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Single passband microwave photonic filter using continuous-time impulse response.

    Science.gov (United States)

    Huang, Thomas X H; Yi, Xiaoke; Minasian, Robert A

    2011-03-28

    A single passband microwave photonic signal processor based on continuous time impulse response that has high resolution, multiple-taps and baseband-free response as well as exhibiting a square-top passband and tunability, is presented. The design and synthesis of the frequency response are based on a full systematic model for single passband microwave photonic filters to account for arbitrary spectrum slice shapes, which for the first time investigates the combined effects from both the dispersion-induced carrier suppression effect and the RF decay effect due to the spectrum slice width, to enable the optimum design to be realized by utilizing the carrier suppression effect to improve the filter performance. Experimental results demonstrate a high order microwave filter showing high resolution single passband filtering as well as exhibiting reconfiguration, square-top passband and tunability, for the first time to our best knowledge.

  12. On the excess photon noise in single-beam measurements with photo-emissive and photo-conductive cells

    NARCIS (Netherlands)

    Alkemade, C.T.J.

    In this paper the so-called excess photon noise is theoretically considered with regard to noise power measurements with a single, illumined photo-emissive or photo-conductive cell. Starting from a modification of Mandel's stochastic association of the emission of photo-electrons with wave

  13. [Prediction of the molecular response to pertubations from single cell measurements].

    Science.gov (United States)

    Remacle, Françoise; Levine, Raphael D

    2014-12-01

    The response of protein signalization networks to perturbations is analysed from single cell measurements. This experimental approach allows characterizing the fluctuations in protein expression levels from cell to cell. The analysis is based on an information theoretic approach grounded in thermodynamics leading to a quantitative version of Le Chatelier principle which allows to predict the molecular response. Two systems are investigated: human macrophages subjected to lipopolysaccharide challenge, analogous to the immune response against Gram-negative bacteria and the response of the proteins involved in the mTOR signalizing network of GBM cancer cells to changes in partial oxygen pressure. © 2014 médecine/sciences – Inserm.

  14. Binaural response characteristics of single neurons in the medial superior olivary nucleus of the albino rat.

    Science.gov (United States)

    Inbody, S B; Feng, A S

    1981-04-06

    Binaural response properties of single neurons in the medial superior olivary nucleus (MSO) were investigated in the anesthetized rat. Stimulus parameters studied included interaural time difference and interaural intensity difference. In the present study, of the two cell types observed in the rat MSO nucleus, EE and EI, variations in the binaural response properties of the MSO neurons permitted further subclassifications, which may be related to the dendritic dominance of the MSO neurons.

  15. Grafting of Single, Stimuli-Responsive Poly(ferrocenylsilane) Polymer Chains to Gold Surfaces

    NARCIS (Netherlands)

    Zou, S(han); Ma, Y.; Hempenius, Mark A.; Schönherr, Holger; Vancso, Gyula J.

    2004-01-01

    Redox-responsive poly(ferrocenylsilane) (PFS) polymer molecules were attached individually to gold surfaces for force spectroscopy experiments on the single molecule level. By grafting ethylenesulfide-functionalized PFS into the defects of preformed self-assembled monolayers (SAMs) of different

  16. Single sodium channels from human skeletal muscle in planar lipid bilayers: characterization and response to pentobarbital

    NARCIS (Netherlands)

    Wartenberg, Hans C.; Urban, Bernd W.

    2004-01-01

    PURPOSE: To investigate the response to general anesthetics of different sodium-channel subtypes, we examined the effects of pentobarbital, a close thiopental analogue, on single sodium channels from human skeletal muscle and compared them to existing data from human brain and human ventricular

  17. Intrinsic pressure response of a single mode cyclo olefin polymer fiber bragg grating

    DEFF Research Database (Denmark)

    Pedersen, Jens Kristian Mølgaard; Woyessa, Getinet; Nielsen, Kristian

    2016-01-01

    The intrinsic pressure response of a Fibre Bragg Grating (FBG) inscribed in a single-mode cyclo olefin polymer (COP) microstructured polymer optical fibre (mPOF) in the range 0-200 bar is investigated for the first time. In order to efficiently suppress the effects from changes in temperature...

  18. Immune response of gilts to single and double infection with porcine epidemic diarrhea virus.

    Science.gov (United States)

    Srijangwad, Anchalee; Stott, Christopher James; Temeeyasen, Gun; Senasuthum, Raweewan; Chongcharoen, Wanchai; Tantituvanont, Angkana; Nilubol, Dachrit

    2017-07-01

    Immune response of gilts following single and double infection with porcine epidemic diarrhea virus (PEDV) at gilt acclimatization and prepartum were investigated. One hundred PEDV-naïve gilts were divided into two groups: negative (Neg) and feedback (FB) groups. Antibody responses in serum, colostrum, and milk samples were measured by IgG/IgA ELISA and virus neutralization assay (VN). Fecal shedding was investigated using RT-PCR. In summary, a single infection at gilt acclimatization resulted in slightly increased serum antibody titers as determined by VN assay and IgG ELISA, but not by IgA ELISA. Viral RNA was detected in fecal samples up to 6 days post-exposure. A double infection at prepartum resulted in significantly increased IgA and VN titers in milk samples compared to the single-infection group. No fecal shedding was detected following the double infection.

  19. Prefrontal Single-Neuron Responses after Changes in Task Contingencies during Trace Eyeblink Conditioning in Rabbits.

    Science.gov (United States)

    Siegel, Jennifer J

    2016-01-01

    A number of studies indicate that the medial prefrontal cortex (mPFC) plays a role in mediating the expression of behavioral responses during tasks that require flexible changes in behavior. During trace eyeblink conditioning, evidence suggests that the mPFC provides the cerebellum with a persistent input to bridge the temporal gap between conditioned and unconditioned stimuli. Therefore, the mPFC is in a position to directly mediate the expression of trace conditioned responses. However, it is unknown whether persistent neural responses are associated with the flexible expression of behavior when task contingencies are changed during trace eyeblink conditioning. To investigate this, single-unit activity was recorded in the mPFC of rabbits during extinction and reacquisition of trace eyeblink conditioning, and during training to a different conditional stimulus. Persistent responses remained unchanged after full extinction, and also did not change during reacquisition training. During training to a different tone, however, the generalization of persistent responses to the new stimulus was associated with an animal's performance-when persistent responses generalized to the new tone, performance was high (>50% response rate). When persistent responses decreased to baseline rates, performance was poor (<50% response rate). The data suggest that persistent mPFC responses do not appear to mediate flexible changes in the expression of the original learning, but do appear to play a role in the generalization of that learning when the task is modified.

  20. Space and Motion Stimulus-Response Correspondence (SRC) Effects in a Single Task.

    Science.gov (United States)

    Styrkowiec, Piotr

    2016-09-01

    Previous research indicated that congruency between stimulus location and response position (spatial stimulus-response correspondence [SRC]) and stimulus motion and response movement congruency (motion SRC) are distinct SRC phenomena. This study further explored this issue and tested whether these two SRC effects are independent. This was conducted by investigating these two SRC effects in a single task. A stimulus with leftward or rightward motion was presented on the left or the right side of the screen and the participant had to move the joysticks held with the left and right hands leftward or rightward in response to the stimulus color. In this setting, the stimulus and response shared two types of correspondence: spatial and motion. The results demonstrated that two SRC effects occurred and interacted (interaction evident only in reaction times [RTs]). RT distribution analysis and accuracy delta plots for each SRC effect indicated that spatial and motion SRC are distinct phenomena based on different processes.

  1. Experimental studies of the dynamic mechanical response of a single polymer chain

    DEFF Research Database (Denmark)

    Thormann, Esben; Evans, Drew R.; Craig, Vincent S. J.

    2006-01-01

    The high-frequency and low-amplitude dynamic mechanical response from a single poly(vinyl alcohol) chain was investigated. Modification of a commercial atomic force microscope enabled high-frequency and low-amplitude periodic deformations of polymer chains during extension to be performed...... mechanical response from poly(vinyl alcohol) does not differ from its static response. This result is not unexpected as poly(vinyl alcohol) is a highly flexible polymer with intramolecular relaxation processes taking place on a short time scale. The choice of a polymer with a fast relaxation allows its...... static properties to be recovered from the dynamic measurements and enables the method suggested in this paper for decoupling the polymer response from the hydrodynamic response to be validated....

  2. Single-cell Western blotting after whole-cell imaging to assess cancer chemotherapeutic response.

    Science.gov (United States)

    Kang, Chi-Chih; Lin, Jung-Ming G; Xu, Zhuchen; Kumar, Sanjay; Herr, Amy E

    2014-10-21

    Intratumor heterogeneity remains a major obstacle to effective cancer therapy and personalized medicine. Current understanding points to differential therapeutic response among subpopulations of tumor cells as a key challenge to successful treatment. To advance our understanding of how this heterogeneity is reflected in cell-to-cell variations in chemosensitivity and expression of drug-resistance proteins, we optimize and apply a new targeted proteomics modality, single-cell western blotting (scWestern), to a human glioblastoma cell line. To acquire both phenotypic and proteomic data on the same, single glioblastoma cells, we integrate high-content imaging prior to the scWestern assays. The scWestern technique supports thousands of concurrent single-cell western blots, with each assay comprised of chemical lysis of single cells seated in microwells, protein electrophoresis from those microwells into a supporting polyacrylamide (PA) gel layer, and in-gel antibody probing. We systematically optimize chemical lysis and subsequent polyacrylamide gel electrophoresis (PAGE) of the single-cell lysate. The scWestern slides are stored for months then reprobed, thus allowing archiving and later analysis as relevant to sparingly limited, longitudinal cell specimens. Imaging and scWestern analysis of single glioblastoma cells dosed with the chemotherapeutic daunomycin showed both apoptotic (cleaved caspase 8- and annexin V-positive) and living cells. Intriguingly, living glioblastoma subpopulations show up-regulation of a multidrug resistant protein, P-glycoprotein (P-gp), suggesting an active drug efflux pump as a potential mechanism of drug resistance. Accordingly, linking of phenotype with targeted protein analysis with single-cell resolution may advance our understanding of drug response in inherently heterogeneous cell populations, such as those anticipated in tumors.

  3. Single-trial regression elucidates the role of prefrontal theta oscillations in response conflict

    Directory of Open Access Journals (Sweden)

    Michael X Cohen

    2011-02-01

    Full Text Available In most cognitive neuroscience experiments there are many behavioral and experimental dynamics, and many indices of brain activity, that vary from trial to trial. For example, in studies of response conflict, conflict is usually treated as a binary variable (i.e., response conflict exists or does not in any given trial, whereas some evidence and intuition suggests that conflict may vary in intensity from trial to trial. Here we demonstrate that single-trial multiple regression of time-frequency electrophysiological activity reveals neural mechanisms of cognitive control that are not apparent in cross-trial averages. We also introduce a novel extension to oscillation phase coherence and synchronization analyses, based on weighted phase modulation, that has advantages over standard coherence measures in terms of linking electrophysiological dynamics to trial-varying behavior and experimental variables. After replicating previous response conflict findings using trial-averaged data, we extend these findings using single trial analytic methods to provide novel evidence for the role of medial frontal-lateral prefrontal theta-band synchronization in conflict-induced response time dynamics, including a role for lateral prefrontal theta-band activity in biasing response times according to perceptual conflict. Given that these methods shed new light on the prefrontal mechanisms of response conflict, they are also likely to be useful for investigating other neurocognitive processes.

  4. Mixed response and time-to-event endpoints for multistage single-arm phase II design.

    Science.gov (United States)

    Lai, Xin; Zee, Benny Chung-Ying

    2015-06-04

    The objective of phase II cancer clinical trials is to determine if a treatment has sufficient activity to warrant further study. The efficiency of a conventional phase II trial design has been the object of considerable debate, particularly when the study regimen is characteristically cytostatic. At the time of development of a phase II cancer trial, we accumulated clinical experience regarding the time to progression (TTP) for similar classes of drugs and for standard therapy. By considering the time to event (TTE) in addition to the tumor response endpoint, a mixed-endpoint phase II design may increase the efficiency and ability of selecting promising cytotoxic and cytostatic agents for further development. We proposed a single-arm phase II trial design by extending the Zee multinomial method to fully use mixed endpoints with tumor response and the TTE. In this design, the dependence between the probability of response and the TTE outcome is modeled through a Gaussian copula. Given the type I and type II errors and the hypothesis as defined by the response rate (RR) and median TTE, such as median TTP, the decision rules for a two-stage phase II trial design can be generated. We demonstrated through simulation that the proposed design has a smaller expected sample size and higher early stopping probability under the null hypothesis than designs based on a single-response endpoint or a single TTE endpoint. The proposed design is more efficient for screening new cytotoxic or cytostatic agents and less likely to miss an effective agent than the alternative single-arm design.

  5. Effect of temperament on cortisol response to a single exercise bout in Thoroughbred racehorses - short communication.

    Science.gov (United States)

    Bohák, Zsófia; Szenci, Ottó; Harnos, Andrea; Kutasi, Orsolya; Kovács, Levente

    2017-12-01

    Temperament has not been taken into account in previous studies evaluating the stress response to exercise in horses. The aim of the present study was to investigate the cortisol response in Thoroughbred racehorses to a single exercise bout, and to analyse the results based on the basic personality of the horse examined. Twenty healthy Thoroughbred horses were selected for the study based on a 25-item rating questionnaire survey used for characterising equine temperament. Eight temperamental and twelve calm horses took part in the experiment. The horses trotted as a warm-up activity, and then galloped on a rounded sand track. Blood sampling was conducted four times for each horse. Horses with a more excitable temperament showed a higher cortisol response to the test (P = 0.036). In conclusion, cortisol levels in response to a mild intensive exercise can be affected by temperament in horses. Serum cortisol may be a relevant marker to quantify individual temperamental differences in racehorses.

  6. Response of microchannel plates in ionization mode to single particles and electromagnetic showers

    Science.gov (United States)

    Barnyakov, A. Yu.; Barnyakov, M. Yu.; Brianza, L.; Cavallari, F.; Cipriani, M.; Ciriolo, V.; del Re, D.; Gelli, S.; Ghezzi, A.; Gotti, C.; Govoni, P.; Katcin, A. A.; Malberti, M.; Martelli, A.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Pigazzini, S.; Preiato, F.; Prisekin, V. G.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Tabarelli de Fatis, T.

    2018-01-01

    Hundreds of concurrent collisions per bunch crossing are expected at future hadron colliders. Precision timing calorimetry has been advocated as a way to mitigate the pileup effects and, thanks to their excellent time resolution, microchannel plates (MCPs) are good candidate detectors for this goal. We report on the response of MCPs, used as secondary emission detectors, to single relativistic particles and to electromagnetic showers. Several prototypes, with different geometries and characteristics, were exposed to particle beams at the INFN-LNF Beam Test Facility and at CERN. Their time resolution and efficiency are measured for single particles and as a function of the multiplicity of particles. Efficiencies between 50% and 90% to single relativistic particles are reached, and up to 100% in presence of a large number of particles. Time resolutions between 20 ps and 30 ps are obtained.

  7. Highly reconfigurable microwave photonic single-bandpass filter with complex continuous-time impulse responses.

    Science.gov (United States)

    Xue, Xiaoxiao; Zheng, Xiaoping; Zhang, Hanyi; Zhou, Bingkun

    2012-11-19

    We propose a novel structure of complex-tap microwave photonic filter (MPF) employing an incoherent broadband optical source (BOS) and a programmable optical spectrum processor. By tailoring the optical spectral amplitude and phase, arbitrary complex continuous-time impulse responses of the MPF can be constructed. Frequency responses with a single flat-top, highly chirped, or arbitrary-shape passband are demonstrated, respectively. The passband center can also be tuned in a wide range only limited by the opto-electrical devices. To the best of our knowledge, it is the first demonstration of an incoherent-BOS-based MPF which is single-bandpass, widely tunable, and highly reconfigurable with complex taps.

  8. Application of laser tweezers Raman spectroscopy techniques to the monitoring of single cell response to stimuli

    Science.gov (United States)

    Chan, James W.; Liu, Rui; Matthews, Dennis L.

    2012-06-01

    Laser tweezers Raman spectroscopy (LTRS) combines optical trapping with micro-Raman spectroscopy to enable label-free biochemical analysis of individual cells and small biological particles in suspension. The integration of the two technologies greatly simplifies the sample preparation and handling of suspension cells for spectroscopic analysis in physiologically meaningful conditions. In our group, LTRS has been used to study the effects of external perturbations, both chemical and mechanical, on the biochemistry of the cell. Single cell dynamics can be studied by performing longitudinal studies to continuously monitor the response of the cell as it interacts with its environment. The ability to carry out these measurements in-vitro makes LTRS an attractive tool for many biomedical applications. Here, we discuss the use of LTRS to study the response of cancer cells to chemotherapeutics and bacteria cells to antibiotics and show that the life cycle and apoptosis of the cells can be detected. These results show the promise of LTRS for drug discovery/screening, antibiotic susceptibility testing, and chemotherapy response monitoring applications. In separate experiments, we study the response of red blood cells to the mechanical forces imposed on the cell by the optical tweezers. A laser power dependent deoxygenation of the red blood cell in the single beam trap is reported. Normal, sickle cell, and fetal red blood cells have a different behavior that enables the discrimination of the cell types based on this mechanochemical response. These results show the potential utility of LTRS for diagnosing and studying red blood cell diseases.

  9. Quantitative analysis of circadian single cell oscillations in response to temperature.

    Science.gov (United States)

    Abraham, Ute; Schlichting, Julia Katharina; Kramer, Achim; Herzel, Hanspeter

    2018-01-01

    Body temperature rhythms synchronize circadian oscillations in different tissues, depending on the degree of cellular coupling: the responsiveness to temperature is higher when single circadian oscillators are uncoupled. So far, the role of coupling in temperature responsiveness has only been studied in organotypic tissue slices of the central circadian pacemaker, because it has been assumed that peripheral target organs behave like uncoupled multicellular oscillators. Since recent studies indicate that some peripheral tissues may exhibit cellular coupling as well, we asked whether peripheral network dynamics also influence temperature responsiveness. Using a novel technique for long-term, high-resolution bioluminescence imaging of primary cultured cells, exposed to repeated temperature cycles, we were able to quantitatively measure period, phase, and amplitude of central (suprachiasmatic nuclei neuron dispersals) and peripheral (mouse ear fibroblasts) single cell oscillations in response to temperature. Employing temperature cycles of different lengths, and different cell densities, we found that some circadian characteristics appear cell-autonomous, e.g. period responses, while others seem to depend on the quality/degree of cellular communication, e.g. phase relationships, robustness of the oscillation, and amplitude. Overall, our findings indicate a strong dependence on the cell's ability for intercellular communication, which is not only true for neuronal pacemakers, but, importantly, also for cells in peripheral tissues. Hence, they stress the importance of comparative studies that evaluate the degree of coupling in a given tissue, before it may be used effectively as a target for meaningful circadian manipulation.

  10. Single-cell bioelectrical impedance platform for monitoring cellular response to drug treatment

    Science.gov (United States)

    Asphahani, Fareid; Wang, Kui; Thein, Myo; Veiseh, Omid; Yung, Sandy; Xu, Jian; Zhang, Miqin

    2011-02-01

    The response of cells to a chemical or biological agent in terms of their impedance changes in real-time is a useful mechanism that can be utilized for a wide variety of biomedical and environmental applications. The use of a single-cell-based analytical platform could be an effective approach to acquiring more sensitive cell impedance measurements, particularly in applications where only diminutive changes in impedance are expected. Here, we report the development of an on-chip cell impedance biosensor with two types of electrodes that host individual cells and cell populations, respectively, to study its efficacy in detecting cellular response. Human glioblastoma (U87MG) cells were patterned on single- and multi-cell electrodes through ligand-mediated natural cell adhesion. We comparatively investigated how these cancer cells on both types of electrodes respond to an ion channel inhibitor, chlorotoxin (CTX), in terms of their shape alternations and impedance changes to exploit the fine detectability of the single-cell-based system. The detecting electrodes hosting single cells exhibited a significant reduction in the real impedance signal, while electrodes hosting confluent monolayer of cells showed little to no impedance change. When single-cell electrodes were treated with CTX of different doses, a dose-dependent impedance change was observed. This enables us to identify the effective dose needed for this particular treatment. Our study demonstrated that this single-cell impedance system may potentially serve as a useful analytical tool for biomedical applications such as environmental toxin detection and drug evaluation.

  11. Measurement of Photomultipier Plateau Curves and Single MIP response in the AD detector at ALICE

    CERN Document Server

    Sanchez Falero, Sebastian De Jesus

    2015-01-01

    The Alice Diffractive (AD) detector is a forward detector in the ALICE experiment at CERN. It is aimed to the triggering on diffractive events and extends the pseudorapidity coverage to about 4.9 < /n/ < 6.3. In this work, a PMT's efficiency plateau and single MIP response are measured using a replica of the detector's scintillator modules, electronic and data acquisition system and cosmic rays as particle source.

  12. Effects of dynamic synapses on noise-delayed response latency of a single neuron

    Science.gov (United States)

    Uzuntarla, M.; Ozer, M.; Ileri, U.; Calim, A.; Torres, J. J.

    2015-12-01

    The noise-delayed decay (NDD) phenomenon emerges when the first-spike latency of a periodically forced stochastic neuron exhibits a maximum for a particular range of noise intensity. Here, we investigate the latency response dynamics of a single Hodgkin-Huxley neuron that is subject to both a suprathreshold periodic stimulus and a background activity arriving through dynamic synapses. We study the first-spike latency response as a function of the presynaptic firing rate f . This constitutes a more realistic scenario than previous works, since f provides a suitable biophysically realistic parameter to control the level of activity in actual neural systems. We first report on the emergence of classical NDD behavior as a function of f for the limit of static synapses. Second, we show that when short-term depression and facilitation mechanisms are included at the synapses, different NDD features can be found due to their modulatory effect on synaptic current fluctuations. For example, an intriguing double NDD (DNDD) behavior occurs for different sets of relevant synaptic parameters. Moreover, depending on the balance between synaptic depression and synaptic facilitation, single NDD or DNDD can prevail, in such a way that synaptic facilitation favors the emergence of DNDD whereas synaptic depression favors the existence of single NDD. Here we report the existence of the DNDD effect in the response latency dynamics of a neuron.

  13. Influence of the contact geometry on single-walled carbon nanotube/Si photodetector response

    Science.gov (United States)

    Scagliotti, Mattia; Salvato, Matteo; De Crescenzi, Maurizio; Boscardin, Maurizio; Castrucci, Paola

    2018-03-01

    A systematic study of the optical response of photodetectors based on carbon nanotube/Si heterojunctions is performed by measuring the responsivity, the detectivity and the time response of the devices with different contact configurations. The sensors are obtained by dry transferring single-walled carbon nanotube films on the surface of n-doped Si substrate provided with a multifinger contact geometry. The experimental data show a consistent improvement of the photodetector parameters with the increase of the number of fingers without affecting the carbon nanotube film thickness for increase its optical transmittance as in previous experiments. The role of the electrical resistance of the carbon nanotube film is discussed. The obtained results confirm the method and suggest new perspectives in the use of nanostructured materials as part of semiconducting optical devices.

  14. Multiple linear regression to estimate time-frequency electrophysiological responses in single trials.

    Science.gov (United States)

    Hu, L; Zhang, Z G; Mouraux, A; Iannetti, G D

    2015-05-01

    oscillations, obtaining single-trial estimate of response latency, frequency, and magnitude. This permits within-subject statistical comparisons, correlation with pre-stimulus features, and integration of simultaneously-recorded EEG and fMRI. Copyright © 2015. Published by Elsevier Inc.

  15. Rainfall effect on single-vehicle crash severities using polychotomous response models.

    Science.gov (United States)

    Jung, Soyoung; Qin, Xiao; Noyce, David A

    2010-01-01

    As part of the Wisconsin road weather safety initiative, the objective of this study is to assess the effects of rainfall on the severity of single-vehicle crashes on Wisconsin interstate highways utilizing polychotomous response models. Weather-related factors considered in this study include estimated rainfall intensity for 15 min prior to a crash occurrence, water film depth, temperature, wind speed/direction, stopping sight distance and deficiency of car-following distance at the crash moment. For locations with unknown weather information, data were interpolated using the inverse squared distance method. Non-weather factors such as road geometrics, traffic conditions, collision types, vehicle types, and driver and temporal attributes were also considered. Two types of polychotomous response models were compared: ordinal logistic and sequential logistic regressions. The sequential logistic regression was tested with forward and backward formats. Comparative models were also developed for single vehicle crash severity during clear weather. In conclusion, the backward sequential logistic regression model produced the best results for predicting crash severities in rainy weather where rainfall intensity, wind speed, roadway terrain, driver's gender, and safety belt were found to be statistically significant. Our study also found that the seasonal factor was significant in clear weather. The seasonal factor is a predictor suggesting that inclement weather may affect crash severity. These findings can be used to determine the probabilities of single vehicle crash severity in rainy weather and provide quantitative support on improving road weather safety via weather warning systems, highway facility improvements, and speed limit management.

  16. Quantitative studies of rhubarb using quantitative analysis of multicomponents by single marker and response surface methodology.

    Science.gov (United States)

    Sun, Jiachen; Wu, Yueting; Dong, Shengjie; Li, Xia; Gao, Wenyuan

    2017-10-01

    In this work, we developed a novel approach to evaluate the contents of bioactive components in rhubarb. The present method was based on the quantitative analysis of multicomponents by a single-marker and response surface methodology approaches. The quantitative analysis of multicomponents by a single-marker method based on high-performance liquid chromatography coupled with photodiode array detection was developed and applied to determine the contents of 12 bioactive components in rhubarb. No significant differences were found in the results from the quantitative analysis of multicomponents by a single-marker and the external standard method. In order to maximize the extraction of 12 bioactive compounds in rhubarb, the ultrasonic-assisted extraction conditions were obtained by the response surface methodology coupled with Box-Behnken design. According to the obtained results, we showed that the optimal conditions would be as follows: proportion of ethanol/water 74.39%, solvent-to-solid ratio 24.07:1 v/w, extraction time 51.13 min, and extraction temperature 63.61°C. The analytical scheme established in this research should be a reliable, convenient, and appropriate method for quantitative determination of bioactive compounds in rhubarb. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Tumorigenic responses from single or repeated inhalation exposures to relatively insoluble aerosols of Ce-144

    International Nuclear Information System (INIS)

    Boecker, B.B.; Hahn, F.F.; Mauderly, J.L.; McClellan, R.O.

    1980-01-01

    Human occupational or environmental inhalation exposures may involve repeated or chronic exposures, but most laboratory studies of inhaled radionuclides have involved single exposures. This study was designed to compare the biological effects of repeated inhalation exposures of dogs to a relatively insoluble form of 144 Ce with existing data for singly-exposed dogs that had the same cumulative dose to the lungs two years after exposure. To date, the biological effects observed in these repeatedly-exposed dogs have been substantially different from those seen in singly-exposed dogs, particularly during the first 5 years after the initial exposure. Although pulmonary hemangiosarcoma was the prominent biological effect seen in singly-exposed dogs between 2 and 4 years after exposure, no lung tumors were seen during the 5 years after the first of the repeated exposures. This response plus other clinical observations are discussed in relation to the patterns of dose rate and cumulative dose for the different exposure conditions. (H.K.)

  18. Dynamic response analysis of single-span guideway caused by high speed maglev train

    Directory of Open Access Journals (Sweden)

    Jin Shi

    Full Text Available High speed maglev is one of the most important reformations in the ground transportation systems because of its no physical contact nature. This paper intends to study the dynamic response of the single-span guideway induced by moving maglev train. The dynamic model of the maglev train-guideway system is established. In this model, a maglev train consists of three vehicles and each vehicle is regarded as a multibody system with 34 degrees-of-freedom. The guideway is modeled as a simply supported beam. Considering the motion-dependent nature of electromagnetic forces in the maglev system, an iterative approach is presented to compute the dynamic response of a maglev train-guideway system. The histories of the train traversing the guideways are simulated and the dynamic responses of the guideway and the train vehicles are calculated. A field experiment is carried out to verify the results of the analysis. The resonant conditions of single-span guideway are analyzed. The results show that all the dynamic indexes of train-guideway system are far less than permissive values of railway and maglev system, the vertical resonant of guideways caused by periodical excitations of the train will not happen.

  19. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    2016-06-01

    Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.

  20. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual

  1. The reliability of puff topography and subjective responses during ad lib smoking of a single cigarette.

    Science.gov (United States)

    Perkins, Kenneth A; Karelitz, Joshua L; Giedgowd, Grace E; Conklin, Cynthia A

    2012-04-01

    Acute smoking behavior (i.e., puff topography) and subjective responses during the ad lib smoking of a single cigarette in the laboratory may provide useful measures of smoking reinforcement and reward, respectively. However, the reliability of such measures is not clear, leaving uncertain the utility of a single assessment of smoking behavior as an individual difference measure. Dependent smokers (N = 94) smoked normally prior to each of 4 laboratory sessions during which they were instructed to smoke 1 cigarette of their preferred brand in ad libitum and unblinded fashion and then rate it for subjective effects. Puff topography (puff number, total volume, and maximum volume) was assessed via portable Clinical Research Support System device. Subjective reward and perception were assessed by visual analog scales of "liking" and "how strong," respectively. The reliability of puff topography and subjective measures was determined across days by intra-class correlations (ICCs). Differences due to sex and nicotine dependence (high and low Fagerström Test for Nicotine Dependence score) were also examined. Reliability was highly significant for each measure. ICCs were .70 for total puff volume, .60 for maximum puff volume, .73 for puff number, .64 for liking, and .78 for how strong. Reliability generally did not differ by sex or dependence, but absolute values for total volume and maximum puff volume were greater in men and in high dependent smokers. Liking was also greater in high dependent smokers. Puff topography and subjective measures during the ad lib smoking of a single cigarette are highly reliable. Smoking responses during a single ad lib smoking session may be useful in identifying stable individual differences in smoking reinforcement and reward.

  2. Single sodium channels from human skeletal muscle in planar lipid bilayers: characterization and response to pentobarbital.

    Science.gov (United States)

    Wartenberg, Hans C; Urban, Bernd W

    2004-01-01

    To investigate the response to general anesthetics of different sodium-channel subtypes, we examined the effects of pentobarbital, a close thiopental analogue, on single sodium channels from human skeletal muscle and compared them to existing data from human brain and human ventricular muscle channels. Sodium channels from a preparation of human skeletal muscle were incorporated into planar lipid bilayers, and the steady-state behavior of single sodium channels and their response to pentobarbital was examined in the presence of batrachotoxin, a sodium-channel activator. Single-channel currents were recorded before and after the addition of pentobarbital (0.34-1.34 mM). In symmetrical 500 mM NaCl, human skeletal muscle sodium channels had an averaged single-channel conductance of 21.0 +/- 0.6 pS, and the channel fractional open time was 0.96 +/- 0.04. The activation midpoint potential was -96.2 +/- 1.6 mV. Extracellular tetrodotoxin blocked the channel with a half-maximal concentration (k1/2) of 60 nM at 0 mV. Pentobarbital reduced the time-averaged conductance of single skeletal muscle sodium channels in a concentration-dependent manner (inhibitory concentration 50% [IC50] = 0.66 mM). The steady-state activation was shifted to more hyperpolarized potentials (-16.7 mV at 0.67 mM pentobarbital). In the planar lipid bilayer system, skeletal muscle sodium channels have some electrophysiological properties that are significantly different compared with those of sodium channels from cardiac or from central nervous tissue. In contrast to the control data, these different human sodium channel subtypes showed the same qualitative and quantitative response to the general anesthetic pentobarbital. The implication of these effects for overall anesthesia will depend on the role the individual channels play within their neuronal networks, but suppression of both central nervous system and peripheral sodium channels may add to general anesthetic effects.

  3. Dynamic response analysis of single-span guideway caused by high speed maglev train

    OpenAIRE

    Shi, Jin; Wang, Ying-Jie

    2011-01-01

    High speed maglev is one of the most important reformations in the ground transportation systems because of its no physical contact nature. This paper intends to study the dynamic response of the single-span guideway induced by moving maglev train. The dynamic model of the maglev train-guideway system is established. In this model, a maglev train consists of three vehicles and each vehicle is regarded as a multibody system with 34 degrees-of-freedom. The guideway is modeled as a simply suppor...

  4. Photo-response of a nanopore device with a single embedded ZnO nanoparticle.

    Science.gov (United States)

    Nguyen, Linh-Nam; Lin, Ming-Chou; Chen, Horng-Shyang; Lan, Yann-Wen; Wu, Cen-Shawn; Chang-Liao, Kuei-Shu; Chen, Chii-Dong

    2012-04-27

    The photo-response of a ZnO nanoparticle embedded in a nanopore made on a silicon nitride membrane is investigated. The ZnO nanoparticle is manipulated onto the nanopore and sandwiched between aluminum contact electrodes from both the top and bottom. The asymmetric device structure facilitates current-voltage rectification that enables photovoltaic capacity. Under illumination, the device shows open-circuit voltage as well as short-circuit current. The fill factor is found to increase at low temperatures and reaches 48.6% at 100 K. The nanopore structure and the manipulation technique provide a solid platform for exploring the electrical properties of single nanoparticles.

  5. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    Science.gov (United States)

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  6. Composite Estimation for Single-Index Models with Responses Subject to Detection Limits

    KAUST Repository

    Tang, Yanlin

    2017-11-03

    We propose a semiparametric estimator for single-index models with censored responses due to detection limits. In the presence of left censoring, the mean function cannot be identified without any parametric distributional assumptions, but the quantile function is still identifiable at upper quantile levels. To avoid parametric distributional assumption, we propose to fit censored quantile regression and combine information across quantile levels to estimate the unknown smooth link function and the index parameter. Under some regularity conditions, we show that the estimated link function achieves the non-parametric optimal convergence rate, and the estimated index parameter is asymptotically normal. The simulation study shows that the proposed estimator is competitive with the omniscient least squares estimator based on the latent uncensored responses for data with normal errors but much more efficient for heavy-tailed data under light and moderate censoring. The practical value of the proposed method is demonstrated through the analysis of a human immunodeficiency virus antibody data set.

  7. An Efficient Channel Model for OFDM and Time Domain Single Carrier Transmission Using Impulse Responses

    Directory of Open Access Journals (Sweden)

    Tariq Jamil Saifullah Khanzada

    2012-01-01

    Full Text Available The OFDM (Orthogonal Frequency Division Multiplexing is well-known, most utilized wideband communication technique of the current era. SCT (Single Carrier Transmission provides equivalent performance in time domain while decision equalizer is implemented in frequency domain. SCT annihilates the ICT (Inter Carrier Interference and the PAPR (Peak to Average Power Ratio which is inherent to OFDM and degrades its performance in time varying channels. An efficient channel model is presented in this contribution, to implement OFDM and SCT in time domain using impulse responses. Both OFDM and SCT models are derived dialectically to model the channel impulse responses. Our model enhances the performance of time domain SCT compared with OFDM and subsides the PAPR and ICI problems of OFDM. SCT is implemented at symbol level contained in blocks. Simulation results implementing Digital Radio Monadiale (DRM assert the performance gain of SCT over OFDM.

  8. Hemodynamic responses to single sessions of aerobic exercise and resistance exercise in pregnancy.

    Science.gov (United States)

    Petrov Fieril, Karolina; Glantz, Anna; Fagevik Olsen, Monika

    2016-09-01

    Previous research on maternal hemodynamic responses to a single exercise session during pregnancy is sparse, especially considering immediate responses to resistance exercise. The aim of the study was to examine blood pressure, heart rate, body temperature, and Rating of Perceived Exertion in healthy pregnant women during single sessions of continuous submaximal exercise in pregnancy week 21. A cross-over design was used. Twenty healthy pregnant women from four prenatal clinics in Gothenburg, Sweden, were included. On day 1, the women did 30 min of aerobic exercise and on day 3 they did 30 min of resistance exercise. Blood pressure, heart rate, and Rating of Perceived Exertion were measured after 15 and 30 min of exercise. After 15 and 30 min of exercise, there was a significant increase in systolic blood pressure and heart rate (p aerobic exercise (p = 0.01) than resistance exercise (p = 0.03). Resistance exercise was perceived as more intense than aerobic exercise after 15 min (p = 0.02) and 30 min (p = 0.001) of exercise. Five minutes after completing the exercise, blood pressure quickly reverted to normal although heart rate was still increased (p = 0.001). There was no correlation between heart rate and Rating of Perceived Exertion (rs  = 0.05-0.43). Maternal hemodynamic responses were essentially the same, regardless of whether the exercise was submaximal aerobic or resistance exercise, although resistance exercise was perceived as more intense. Aerobic and resistance exercise corresponding to "somewhat hard" seems to have no adverse effect with regard to maternal hemodynamic responses in healthy pregnancy. © 2016 Nordic Federation of Societies of Obstetrics and Gynecology.

  9. Acute-Phase Inflammatory Response to Single-Bout HIIT and Endurance Training: A Comparative Study.

    Science.gov (United States)

    Kaspar, Felix; Jelinek, Herbert F; Perkins, Steven; Al-Aubaidy, Hayder A; deJong, Bev; Butkowski, Eugene

    2016-01-01

    This study compared acute and late effect of single-bout endurance training (ET) and high-intensity interval training (HIIT) on the plasma levels of four inflammatory cytokines and C-reactive protein and insulin-like growth factor 1. Cohort study with repeated-measures design. Seven healthy untrained volunteers completed a single bout of ET and HIIT on a cycle ergometer. ET and HIIT sessions were held in random order and at least 7 days apart. Blood was drawn before the interventions and 30 min and 2 days after the training sessions. Plasma samples were analyzed with ELISA for the interleukins (IL), IL-1β, IL-6, and IL-10, monocyte chemoattractant protein-1 (MCP-1), insulin growth factor 1 (IGF-1), and C-reactive protein (CRP). Statistical analysis was with Wilcoxon signed-rank tests. ET led to both a significant acute and long-term inflammatory response with a significant decrease at 30 minutes after exercise in the IL-6/IL-10 ratio (-20%; p = 0.047) and a decrease of MCP-1 (-17.9%; p = 0.03). This study demonstrates that ET affects the inflammatory response more adversely at 30 minutes after exercise compared to HIIT. However, this is compensated by a significant decrease in MCP-1 at two days associated with a reduced risk of atherosclerosis.

  10. Single isolated hadron response and determination of the jet energy scale uncertainty with the ATLAS detector

    CERN Document Server

    Vivarelli, I; The ATLAS collaboration

    2010-01-01

    The response of single isolated hadrons in the ATLAS calorimeter is measured in proton-proton collisions at a centre-of-mass energy of 7 TeV at the LHC. Isolated tracks with a momentum between 0.5 to 10-20 GeV are selected in the rapidity region up to 2.3. Adjacent energy deposits collected in calorimeter clusters are summed together in a cone of size R=0.2. The measured calorimeter cluster energy sum is compared to the track momentum. Data are in compared in detail to Monte Carlo simulation based on the Geant4 tool-kit and to test-beam measurements. The response to hadrons at low momenta is described by the Monte Carlo simulation with an accuracy of a few percent. Together with test-beam data the results of the single isolated hadron analysis can be used to get a first estimate of the jet energy scale uncertainty in the ATLAS detector.

  11. Identification of single-nucleotide polymorphism markers associated with cortisol response to crowding in rainbow trout.

    Science.gov (United States)

    Liu, Sixin; Vallejo, Roger L; Gao, Guangtu; Palti, Yniv; Weber, Gregory M; Hernandez, Alvaro; Rexroad, Caird E

    2015-06-01

    Understanding stress responses is essential for improving animal welfare and increasing agriculture production efficiency. Previously, we reported microsatellite markers associated with quantitative trait loci (QTL) affecting plasma cortisol response to crowding in rainbow trout. In this study, our main objectives were to identify single-nucleotide polymorphism (SNP) markers associated with cortisol response to crowding in rainbow trout using both GWAS (genome-wide association studies) and QTL mapping methods and to employ rapidly expanding genomic resources for rainbow trout toward the identification of candidate genes affecting this trait. A three-generation F2 mapping family (2008052) was genotyped using RAD-seq (restriction-site-associated DNA sequencing) to identify 4874 informative SNPs. GWAS identified 26 SNPs associated with cortisol response to crowding whereas QTL mapping revealed two significant QTL on chromosomes Omy8 and Omy12, respectively. Positional candidate genes were identified using marker sequences to search the draft genome assembly of rainbow trout. One of the genes in the QTL interval on Omy12 is a putative serine/threonine protein kinase gene that was differentially expressed in the liver in response to handling and confinement stress in our previous study. A homologue of this gene was differentially expressed in zebrafish embryos exposed to diclofenac, a nonsteroidal anti-inflammatory drug (NSAID) and an environmental toxicant. NSAIDs have been shown to affect the cortisol response in rainbow trout; therefore, this gene is a good candidate based on its physical position and expression. However, the reference genome resources currently available for rainbow trout require continued improvement as demonstrated by the unmapped SNPs and the putative assembly errors detected in this study.

  12. Response of CEDIA amphetamines assay after a single dose of bitter orange.

    Science.gov (United States)

    Nguyen, DiemThuy T; Bui, Linda T; Ambrose, Peter J

    2006-04-01

    Bitter orange has recently been substituted as an ingredient in many "ephedra-free" dietary supplements used for weight loss. The primary active ingredient in bitter orange is synephrine. Previous reports have documented false-positive results from ephedrine with urine amphetamine assays. Because of the similarity in chemical structure of ephedrine and synephrine, it is hypothesized that ingestion of a bitter orange supplement may have the potential to cause false-positive results with urine amphetamine assays. The purpose of this study was to determine the response of the CEDIA Amphetamines Assay after ingestion of bitter orange. Six healthy adult male volunteers were administered a single oral dose of Nature's Way Bitter Orange, a 900-mg dietary supplement extract standardized to 6% synephrine. Urine specimens were collected at baseline and 3 and 6 hours post-administration. Additional urine specimens were collected from 1 subject at 9, 12, and 15 hours after administration. All specimens were analyzed by the CEDIA Amphetamines Assay. Urine specific gravity and pH also were measured. All urine specimens demonstrated a negative response to the CEDIA Amphetamines Assay. Urine specific gravity ranged from 1.007 to 1.028, and pH ranged from 5.0 to 7.0; thus, reducing the possibility that the negative results were caused by diluted specimens or reduced excretion of synephrine into alkaline urine. This information will be of value when health care providers or those who interpret drug screens are asked to provide consultation regarding the interference of bitter orange supplements with the CEDIA Amphetamines Assay. A single-dose of Nature's Way Bitter Orange was not found to cause a false-positive response to the CEDIA Amphetamines Assay in 6 healthy adult male volunteers.

  13. Single Pulse Electrical Stimulation to identify epileptogenic cortex: Clinical information obtained from early evoked responses.

    Science.gov (United States)

    Mouthaan, B E; van 't Klooster, M A; Keizer, D; Hebbink, G J; Leijten, F S S; Ferrier, C H; van Putten, M J A M; Zijlmans, M; Huiskamp, G J M

    2016-02-01

    Single Pulse Electrical Stimulation (SPES) probes epileptogenic cortex during electrocorticography. Two SPES responses are described: pathological delayed responses (DR, >100 ms) associated with the seizure onset zone (SOZ) and physiological early responses (ER, 80 Hz, in the SOZ and seizure propagation areas. We used data from 12 refractory epilepsy patients. SPES consisted of 10 pulses of 1 ms, 4-8 mA and 5s interval on adjacent electrodes pairs. Data were available at 2048 samples/s for six and 512 samples/s (22 bits) for eight patients and analyzed in the time-frequency (TF) and time-domain (TD). Electrodes with ERs were stronger associated with SOZ than non-SOZ electrodes. ERs with frequency content >80 Hz exist and are specific for SOZ channels. ERs evoked by stimulation of seizure onset electrodes were associated with electrodes involved in seizure propagation. Analysis of ERs can reveal aspects of pathology, manifested by association with seizure propagation and areas with high ER numbers that coincide with the SOZ. Not only DRs, but also ERs could have clinical value for mapping epileptogenic cortex and help to unravel aspects of the epileptic network. Copyright © 2015 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  14. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  15. Dynamical response of local magnons: single impurity limit in one dimensional magnets

    International Nuclear Information System (INIS)

    Koiller, B.; Rezende, S.M.

    1979-11-01

    The dynamic response of local magnon modes associated with a single impurity spin in one-dimensional ferro and antiferromagnetic insulators is studied theoretically with the use of a Green's function formulation solved exactly, by transfer matrix techniques, for zero temperature. The calculations are applied to the typical 1 - d ferromagnet CsNiF 3 and the antiferromagnet TMMC as functions of the impurity parameters in a way to allow the interpretation of possible future measurements of defect modes in these materials. The theory also explains qualitatively recent measurements in the three dimensional defect antiferromagnets FeF 2 : Mn 2+ , CoF 2 : Mn 2+ and FeF 2 : Co 2+ . (Author) [pt

  16. Training reduces catabolic and inflammatory response to a single practice in female volleyball players.

    Science.gov (United States)

    Eliakim, Alon; Portal, Shawn; Zadik, Zvi; Meckel, Yoav; Nemet, Dan

    2013-11-01

    We examined the effect of training on hormonal and inflammatory response to a single volleyball practice in elite adolescent players. Thirteen female, national team level, Israeli volleyball players (age 16.0 ± 1.4 years, Tanner stage 4-5) participated in the study. Blood samples were collected before and immediately after a typical 60 minutes of volleyball practice, before and after 7 weeks of training during the initial phase of the season. Training involved tactic and technical drills (20% of time), power and speed drills (25% of time), interval sessions (25% of time), endurance-type training (15% of time), and resistance training (15% of time). To achieve greater training responses, the study was performed during the early phase (first 7 weeks) of the volleyball season. Hormonal measurements included the anabolic hormones growth hormone (GH), insulin-like growth factor-I (IGF-I) and IGF-binding protein-3, the catabolic hormone cortisol, the proinflammatory marker interleukin-6 (IL-6), and the anti-inflammatory marker IL-1 receptor antagonist. Training led to a significant improvement of vertical jump, anaerobic properties (peak and mean power by the Wingate Anaerobic Test), and predicted VO2max (by the 20-m shuttle run). Volleyball practice, both before and after the training intervention, was associated with a significant increase of serum lactate, GH, and IL-6. Training resulted in a significantly reduced cortisol response ([INCREMENT]cortisol: 4.2 ± 13.7 vs. -4.4 ± 12.3 ng · ml, before and after training, respectively; p volleyball practice. The results suggest that along with the improvement of power and anaerobic and aerobic characteristics, training reduces the catabolic and inflammatory response to exercise.

  17. Metagenomics, metatranscriptomics and single cell genomics reveal functional response of active Oceanospirillales to Gulf oil spill

    Energy Technology Data Exchange (ETDEWEB)

    Mason, Olivia U.; Hazen, Terry C.; Borglin, Sharon; Chain, Patrick S. G.; Dubinsky, Eric A.; Fortney, Julian L.; Han, James; Holman, Hoi-Ying N.; Hultman, Jenni; Lamendella, Regina; Mackelprang, Rachel; Malfatti, Stephanie; Tom, Lauren M.; Tringe, Susannah G.; Woyke, Tanja; Zhou, Jizhong; Rubin, Edward M.; Jansson, Janet K.

    2012-06-12

    The Deepwater Horizon oil spill in the Gulf of Mexico resulted in a deep-sea hydrocarbon plume that caused a shift in the indigenous microbial community composition with unknown ecological consequences. Early in the spill history, a bloom of uncultured, thus uncharacterized, members of the Oceanospirillales was previously detected, but their role in oil disposition was unknown. Here our aim was to determine the functional role of the Oceanospirillales and other active members of the indigenous microbial community using deep sequencing of community DNA and RNA, as well as single-cell genomics. Shotgun metagenomic and metatranscriptomic sequencing revealed that genes for motility, chemotaxis and aliphatic hydrocarbon degradation were significantly enriched and expressed in the hydrocarbon plume samples compared with uncontaminated seawater collected from plume depth. In contrast, although genes coding for degradation of more recalcitrant compounds, such as benzene, toluene, ethylbenzene, total xylenes and polycyclic aromatic hydrocarbons, were identified in the metagenomes, they were expressed at low levels, or not at all based on analysis of the metatranscriptomes. Isolation and sequencing of two Oceanospirillales single cells revealed that both cells possessed genes coding for n-alkane and cycloalkane degradation. Specifically, the near-complete pathway for cyclohexane oxidation in the Oceanospirillales single cells was elucidated and supported by both metagenome and metatranscriptome data. The draft genome also included genes for chemotaxis, motility and nutrient acquisition strategies that were also identified in the metagenomes and metatranscriptomes. These data point towards a rapid response of members of the Oceanospirillales to aliphatic hydrocarbons in the deep sea.

  18. Mechanical confinement for tuning ferroelectric response in PMN-PT single crystal

    Science.gov (United States)

    Patel, Satyanarayan; Chauhan, Aditya; Vaish, Rahul

    2015-02-01

    Ferroelectrics form an important class of materials and are employed for a variety of applications. However, specific applications dictate the need of tailored ferroelectric response. This creates a requirement to obtain ferroelectric materials with tunable properties. Generally, chemical modifications or domain engineering are employed to this effect. This study attempts to shed light on the use of compressive pre-stresses for tuning and enhancing the ferroelectric properties. For the purpose, polarization versus electric field hysteresis data for 68Pb(Mn1/3Nb2/3)O3-32PbTiO3 (PMN-PT) single crystals were obtained as a function of uniaxial compressive stresses and operating temperatures. These data were utilized to investigate the effects of mechanical confinement for four individual case studies of electrocaloric effect, electrical energy storage, pyroelectric, and piezoelectric effect. A significant improvement was obtained for all case studies. The adiabatic temperature change was improved by ≈80% (28 MPa, 353 K); energy storage density increased by a factor of five (28 MPa, 353 K); pyroelectric figure of merits improved by an order of magnitude (21 MPa) and the piezoelectric coefficient was tailored (variable stress). The results offer promising insight into the use of directional confinement for improving application specific ferroelectric properties in PMN-PT single crystal.

  19. Pulmonary Responses of Sprague-Dawley Rats in Single Inhalation Exposure to Graphene Oxide Nanomaterials

    Directory of Open Access Journals (Sweden)

    Sung Gu Han

    2015-01-01

    Full Text Available Graphene is receiving increased attention due to its potential widespread applications in future. However, the health effects of graphene have not yet been well studied. Therefore, this study examined the pulmonary effects of graphene oxide using male Sprague-Dawley rats and a single 6-hour nose-only inhalation technique. Following the exposure, the rats were allowed to recover for 1 day, 7 days, or 14 days. A total of three groups were compared: control (fresh air, low concentration (0.46±0.06 mg/m3, and high concentration (3.76±0.24 mg/m3. The exposure to graphene oxide did not induce significant changes in the body weights, organ weights, and food consumption during the 14 days of recovery time. The microalbumin and lactate dehydrogenase levels in the bronchoalveolar lavage (BAL fluid were not significantly changed due to the exposure. Similarly, total cell count, macrophages, polymorphonuclear leukocytes, and lymphocytes were not significantly altered in the BAL fluid. Plus, the histopathological examination of the rat lungs only showed an uptake of graphene oxide in the alveolar macrophages of the high-concentration group. Therefore, these results demonstrate that the single inhalation exposure to graphene oxide induce minimal toxic responses in rat lungs at the concentrations and time points used in the present study.

  20. Middle latency response correlates of single and double deviant stimuli in a multi-feature paradigm.

    Science.gov (United States)

    Althen, H; Huotilainen, M; Grimm, S; Escera, C

    2016-01-01

    This study aimed to test single and double deviance-related modulations of the middle latency response (MLR) and the applicability of the optimum-2 multi-feature paradigm. The MLR and the MMN to frequency, intensity and double-feature deviants of an optimum-2 multi-feature paradigm and the MMN to double-feature deviants of an oddball paradigm were recorded in young adults. Double deviants elicited significant enhancements of the Nb and Pb MLR waves compared with the waves elicited by standard stimuli. These enhancements equalled approximately the sum of the numerical amplitude differences elicited by the single deviants. In contrast, the MMN to double deviants did not show such additivity. MMNs elicited by double deviants of the multi-feature and the oddball paradigm showed no significant difference in amplitude or latency. The optimum-2 multi-feature paradigm is suitable for recording double deviance-related modulations of the MLR. Interspersed intensity and frequency deviants in the standard trace of the optimum-2 condition multi-feature paradigm did not weaken the double MMN. The optimum-2 multi-feature paradigm could be especially beneficial for clinical studies on early deviance-related modulations in the MLR, due to its optimized utilization of the recording time. Copyright © 2015 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  1. Single hadron response measurement and calorimeter jet energy scale uncertainty with the ATLAS detector at the LHC

    NARCIS (Netherlands)

    Aad, G.; et al., [Unknown; Bentvelsen, S.; Berglund, E.; Bobbink, G.J.; Bos, K.; Boterenbrood, H.; Colijn, A.P.; de Jong, P.; de Nooij, L.; Deviveiros, P.O.; Doxiadis, A.D.; Ferrari, P.; Garitaonandia, H.; Geerts, D.A.A.; Gosselink, M.; Hartjes, F.; Hessey, N.P.; Igonkina, O.; Kayl, M.S.; Klous, S.; Kluit, P.; Koffeman, E.; Lee, H.; Lenz, T.; Linde, F.; Luijckx, G.; Massaro, G.; Mechnich, J.; Mussche, I.; Ottersbach, J.P.; Reichold, A.; Rijpstra, M.; Ruckstuhl, N.; Snuverink, J.; Ta, D.; Tsiakiris, M.; Turlay, E.; van der Graaf, H.; van der Kraaij, E.; van der Leeuw, R.; van der Poel, E.; van Kesteren, Z.; van Vulpen, I.; Verkerke, W.; Vermeulen, J.C.; Vranjes Milosavljevic, M.; Vreeswijk, M.

    2013-01-01

    The uncertainty on the calorimeter energy response to jets of particles is derived for the ATLAS experiment at the Large Hadron Collider (LHC). First, the calorimeter response to single isolated charged hadrons is measured and compared to the Monte Carlo simulation using proton-proton collisions at

  2. Response matrix method and its application to SCWR single channel stability analysis

    International Nuclear Information System (INIS)

    Zhao, Jiyun; Tseng, K.J.; Tso, C.P.

    2011-01-01

    To simulate the reactor system dynamic features during density wave oscillations (DWO), both the non-linear method and the linear method can be used. Although some transient information is lost through model linearization, the high computational efficiency and relatively accurate results make the linear analysis methodology attractive, especially for prediction of the onset of instability. In the linear stability analysis, the system models are simplified through linearization of the complex non-linear differential equations, and then, the linear differential equations are generally solved in the frequency domain through Laplace transformation. In this paper, a system response matrix method was introduced by directly solving the differential equations in the time domain. By using a system response matrix method, the complicated transfer function derivation, which must be done in the frequency domain method, can be avoided. Using the response matrix method, a model was developed and applied to the single channel or parallel channel type instability analyses of the typical proposed SCWR design. The sensitivity of the decay ratio (DR) to the axial mesh size was analyzed and it was found that the DR is not sensitive to mesh size once sufficient number of axial nodes is applied. To demonstrate the effects of the inlet orificing to the stability feature for the supercritical condition, the sensitivity of the stability to inlet orifice coefficient was conducted for hot channel. It is clearly shown that a higher inlet orifice coefficient will make the system more stable. The susceptibility of stability to operating parameters such as mass flow rate, power and system pressure was also performed. And the measure to improve the SCWR stability sensitivity to operating parameters was investigated. It was found that the SCWR stability sensitivity feature can be improved by carefully managing the inlet orifices and choosing proper operating parameters. (author)

  3. CAFFEINE ATTENUATES ACUTE GROWTH HORMONE RESPONSE TO A SINGLE BOUT OF RESISTANCE EXERCISE

    Directory of Open Access Journals (Sweden)

    Bo-Hun Wu

    2010-06-01

    Full Text Available The purpose of this study was to investigate the effects of caffeine consume on substrate metabolism and acute hormonal responses to a single bout of resistance exercise (RE. Ten resistance-trained men participated in this study. All subjects performed one repetition maximum (1RM test and then performed two protocols: caffeine (CAF, 6 mg·kg-1 and control (CON in counter balanced order. Subjects performed RE (8 exercises, 3 sets of 10 repetitions at 75% of 1RM after caffeine or placebo ingestion one hour prior to RE. Blood samples collected prior to treatment ingestion (pre-60, immediately prior to RE (pre-exe, and 0, 15, 30 min post to RE (P0, P15, P30 for analysis of insulin, testosterone, cortisol, growth hormone, glucose, free fatty acid and lactic acid. Each experiment was separated by seven days. In this study, statistical analysis of a two-way analysis of variance (treatment by time with repeated measures was applied. After ingesting caffeine, the concentrations of free fatty acid (pre- exe, P0, P15, P30 in CAF were significantly higher than CON (p < 0.05. Additionally, the responses of GH (P0, P15, P30 in CAF were significantly lower than CON (p < 0.05, whereas the concentrations of insulin, testosterone and cortisol were not different between CAF and CON (p < 0.05 after RE. The results of this study indicated that caffeine ingestion prior to RE might attenuate the response of GH. This effect might be caused by the elevation in blood FFA concentration at the beginning of RE

  4. Single hadron response measurement and calorimeter jet energy scale uncertainty with the ATLAS detector at the LHC

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdelalim, Ahmed Ali; Abdesselam, Abdelouahab; Abdinov, Ovsat; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Acerbi, Emilio; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Addy, Tetteh; Adelman, Jahred; Aderholz, Michael; Adomeit, Stefanie; Adragna, Paolo; Adye, Tim; Aefsky, Scott; Aguilar-Saavedra, Juan Antonio; Aharrouche, Mohamed; Ahlen, Steven; Ahles, Florian; Ahmad, Ashfaq; Ahsan, Mahsana; Aielli, Giulio; Akdogan, Taylan; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Akiyama, Kunihiro; Alam, Mohammad; Alam, Muhammad Aftab; Albert, Justin; Albrand, Solveig; Aleksa, Martin; Aleksandrov, Igor; Alessandria, Franco; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alison, John; Aliyev, Magsud; Allbrooke, Benedict; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alon, Raz; Alonso, Alejandro; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral, Pedro; Amelung, Christoph; Ammosov, Vladimir; Amorim, Antonio; Amorós, Gabriel; Amram, Nir; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Andrieux, Marie-Laure; Anduaga, Xabier; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoun, Sahar; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Arce, Ayana; Arfaoui, Samir; Arguin, Jean-Francois; Arik, Engin; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnault, Christian; Artamonov, Andrei; Artoni, Giacomo; Arutinov, David; Asai, Shoji; Asfandiyarov, Ruslan; Ask, Stefan; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astbury, Alan; Astvatsatourov, Anatoli; Aubert, Bernard; Auge, Etienne; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Avramidou, Rachel Maria; Axen, David; Ay, Cano; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baccaglioni, Giuseppe; Bacci, Cesare; Bach, Andre; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Badescu, Elisabeta; Bagnaia, Paolo; Bahinipati, Seema; Bai, Yu; Bailey, David; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Mark; Baker, Sarah; Banas, Elzbieta; Banerjee, Piyali; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barashkou, Andrei; Barbaro Galtieri, Angela; Barber, Tom; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Bardin, Dmitri; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Barrillon, Pierre; Bartoldus, Rainer; Barton, Adam Edward; Bartsch, Valeria; Bates, Richard; Batkova, Lucia; Batley, Richard; Battaglia, Andreas; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beale, Steven; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Sebastian; Beckingham, Matthew; Becks, Karl-Heinz; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Begel, Michael; Behar Harpaz, Silvia; Behera, Prafulla; Beimforde, Michael; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellina, Francesco; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Ben Ami, Sagi; Benary, Odette; Benchekroun, Driss; Benchouk, Chafik; Bendel, Markus; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Benoit, Mathieu; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernat, Pauline; Bernhard, Ralf; Bernius, Catrin; Berry, Tracey; Bertella, Claudia; Bertin, Antonio; Bertinelli, Francesco; Bertolucci, Federico; Besana, Maria Ilaria; Besson, Nathalie; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biscarat, Catherine; Bitenc, Urban; Black, Kevin; Blair, Robert; Blanchard, Jean-Baptiste; Blanchot, Georges; Blazek, Tomas; Blocker, Craig; Blocki, Jacek; Blondel, Alain; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boelaert, Nele; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Bolnet, Nayanka Myriam; Bona, Marcella; Bondarenko, Valery; Bondioli, Mario; Boonekamp, Maarten; Booth, Chris; Bordoni, Stefania; Borer, Claudia; Borisov, Anatoly; Borissov, Guennadi; Borjanovic, Iris; Borri, Marcello; Borroni, Sara; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Botterill, David; Bouchami, Jihene; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozhko, Nikolay; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Braem, André; Branchini, Paolo; Brandenburg, George; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brelier, Bertrand; Bremer, Johan; Brenner, Richard; Bressler, Shikma; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brodbeck, Timothy; Brodet, Eyal; Broggi, Francesco; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, William; Brown, Gareth; Brown, Heather; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchanan, James; Buchanan, Norman; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Budick, Burton; Büscher, Volker; Bugge, Lars; Bulekov, Oleg; Bunse, Moritz; Buran, Torleiv; Burckhart, Helfried; Burdin, Sergey; Burgard, Carsten Daniel; Burgess, Thomas; Burke, Stephen; Busato, Emmanuel; Bussey, Peter; Buszello, Claus-Peter; Butin, François; Butler, Bart; Butler, John; Buttar, Craig; Butterworth, Jonathan; Buttinger, William; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Caloi, Rita; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarri, Paolo; Cambiaghi, Mario; Cameron, David; Caminada, Lea Michaela; Campana, Simone; Campanelli, Mario; Canale, Vincenzo; Canelli, Florencia; Canepa, Anadi; Cantero, Josu; Capasso, Luciano; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capriotti, Daniele; Capua, Marcella; Caputo, Regina; Caramarcu, Costin; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Bryan; Caron, Sascha; Carrillo Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Cascella, Michele; Caso, Carlo; Castaneda Hernandez, Alfredo Martin; Castaneda-Miranda, Elizabeth; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Cataldi, Gabriella; Cataneo, Fernando; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cauz, Diego; Cavalleri, Pietro; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cetin, Serkant Ali; Cevenini, Francesco; Chafaq, Aziz; Chakraborty, Dhiman; Chan, Kevin; Chapleau, Bertrand; Chapman, John Derek; Chapman, John Wehrley; Chareyre, Eve; Charlton, Dave; Chavda, Vikash; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Shenjian; Chen, Tingyang; Chen, Xin; Cheng, Shaochen; Cheplakov, Alexander; Chepurnov, Vladimir; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Cheung, Sing-Leung; Chevalier, Laurent; Chiefari, Giovanni; Chikovani, Leila; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chizhov, Mihail; Choudalakis, Georgios; Chouridou, Sofia; Christidi, Illectra-Athanasia; Christov, Asen; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Ciapetti, Guido; Ciba, Krzysztof; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciobotaru, Matei Dan; Ciocca, Claudia; Ciocio, Alessandra; Cirilli, Manuela; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Cleland, Bill; Clemens, Jean-Claude; Clement, Benoit; Clement, Christophe; Clifft, Roger; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coe, Paul; Cogan, Joshua Godfrey; Coggeshall, James; Cogneras, Eric; Colas, Jacques; Colijn, Auke-Pieter; Collard, Caroline; Collins, Neil; Collins-Tooth, Christopher; Collot, Johann; Colon, German; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Consonni, Michele; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conventi, Francesco; Cook, James; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Costin, Tudor; Côté, David; Coura Torres, Rodrigo; Courneyea, Lorraine; Cowan, Glen; Cowden, Christopher; Cox, Brian; Cranmer, Kyle; Crescioli, Francesco; Cristinziani, Markus; Crosetti, Giovanni; Crupi, Roberto; Crépé-Renaudin, Sabine; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Curatolo, Maria; Curtis, Chris; Cuthbert, Cameron; Cwetanski, Peter; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; D'Orazio, Alessia; Da Silva, Paulo Vitor; Da Via, Cinzia; Dabrowski, Wladyslaw; Dai, Tiesheng; Dallapiccola, Carlo; Dam, Mogens; Dameri, Mauro; Damiani, Daniel; Danielsson, Hans Olof; Dannheim, Dominik; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Davey, Will; Davidek, Tomas; Davidson, Nadia; Davidson, Ruth; Davies, Eleanor; Davies, Merlin; Davison, Adam; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Dawson, John; Daya, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Castro Faria Salgado, Pedro; De Cecco, Sandro; de Graat, Julien; De Groot, Nicolo; de Jong, Paul; De La Taille, Christophe; De la Torre, Hector; De Lotto, Barbara; de Mora, Lee; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dean, Simon; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Degenhardt, James; Dehchar, Mohamed; Del Papa, Carlo; Del Peso, Jose; Del Prete, Tarcisio; Delemontex, Thomas; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delruelle, Nicolas; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demirkoz, Bilge; Deng, Jianrong; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Devetak, Erik; Deviveiros, Pier-Olivier; Dewhurst, Alastair; DeWilde, Burton; Dhaliwal, Saminder; Dhullipudi, Ramasudhakar; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Luise, Silvestro; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Diaz, Marco Aurelio; Diblen, Faruk; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dindar Yagci, Kamile; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobbs, Matt; Dobinson, Robert; Dobos, Daniel; Dobson, Ellie; Dobson, Marc; Dodd, Jeremy; Doglioni, Caterina; Doherty, Tom; Doi, Yoshikuni; Dolejsi, Jiri; Dolenc, Irena; Dolezal, Zdenek; Dolgoshein, Boris; Dohmae, Takeshi; Donadelli, Marisilvia; Donega, Mauro; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dosil, Mireia; Dotti, Andrea; Dova, Maria-Teresa; Dowell, John; Doxiadis, Alexander; Doyle, Tony; Drasal, Zbynek; Drees, Jürgen; Dressnandt, Nandor; Drevermann, Hans; Driouichi, Chafik; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Duchovni, Ehud; Duckeck, Guenter; Dudarev, Alexey; Dudziak, Fanny; Dührssen, Michael; Duerdoth, Ian; Duflot, Laurent; Dufour, Marc-Andre; Dunford, Monica; Duran Yildiz, Hatice; Duxfield, Robert; Dwuznik, Michal; Dydak, Friedrich; Düren, Michael; Ebenstein, William; Ebke, Johannes; Eckweiler, Sebastian; Edmonds, Keith; Edwards, Clive; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Ehrich, Thies; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Eisenhandler, Eric; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Katherine; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Engelmann, Roderich; Engl, Albert; Epp, Brigitte; Eppig, Andrew; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Escobar, Carlos; Espinal Curull, Xavier; Esposito, Bellisario; Etienne, Francois; Etienvre, Anne-Isabelle; Etzion, Erez; Evangelakou, Despoina; Evans, Hal; Fabbri, Laura; Fabre, Caroline; Fakhrutdinov, Rinat; Falciano, Speranza; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farley, Jason; Farooque, Trisha; Farrington, Sinead; Farthouat, Philippe; Fassnacht, Patrick; Fassouliotis, Dimitrios; Fatholahzadeh, Baharak; Favareto, Andrea; Fayard, Louis; Fazio, Salvatore; Febbraro, Renato; Federic, Pavol; Fedin, Oleg; Fedorko, Woiciech; Fehling-Kaschek, Mirjam; Feligioni, Lorenzo; Fellmann, Denis; Feng, Cunfeng; Feng, Eric; Fenyuk, Alexander; Ferencei, Jozef; Ferland, Jonathan; Fernando, Waruna; Ferrag, Samir; Ferrando, James; Ferrara, Valentina; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrer, Maria Lorenza; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filippas, Anastasios; Filthaut, Frank; Fincke-Keeler, Margret; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Gordon; Fischer, Peter; Fisher, Matthew; Flechl, Martin; Fleck, Ivor; Fleckner, Johanna; Fleischmann, Philipp; Fleischmann, Sebastian; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Fokitis, Manolis; Fonseca Martin, Teresa; Forbush, David Alan; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Foster, Joe; Fournier, Daniel; Foussat, Arnaud; Fowler, Andrew; Fowler, Ken; Fox, Harald; Francavilla, Paolo; Franchino, Silvia; Francis, David; Frank, Tal; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; Fratina, Sasa; French, Sky; Friedrich, Felix; Froeschl, Robert; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gadfort, Thomas; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Gan, KK; Gao, Yongsheng; Gapienko, Vladimir; Gaponenko, Andrei; Garberson, Ford; Garcia-Sciveres, Maurice; García, Carmen; García Navarro, José Enrique; Gardner, Robert; Garelli, Nicoletta; Garitaonandia, Hegoi; Garonne, Vincent; Garvey, John; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gayde, Jean-Christophe; Gazis, Evangelos; Ge, Peng; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerlach, Peter; Gershon, Avi; Geweniger, Christoph; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giakoumopoulou, Victoria; Giangiobbe, Vincent; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Adam; Gibson, Stephen; Gilbert, Laura; Gilewsky, Valentin; Gillberg, Dag; Gillman, Tony; Gingrich, Douglas; Ginzburg, Jonatan; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giovannini, Paola; Giraud, Pierre-Francois; Giugni, Danilo; Giunta, Michele; Giusti, Paolo; Gjelsten, Børge Kile; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glazov, Alexandre; Glitza, Karl-Walter; Glonti, George; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goebel, Martin; Göpfert, Thomas; Goeringer, Christian; Gössling, Claus; Göttfert, Tobias; Goldfarb, Steven; Golling, Tobias; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gonidec, Allain; Gonzalez, Saul; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goodson, Jeremiah Jet; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Gorokhov, Serguei; Goryachev, Vladimir; Gosdzik, Bjoern; Gosselink, Martijn; Gostkin, Mikhail Ivanovitch; Gough Eschrich, Ivo; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Grancagnolo, Francesco; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Grau, Nathan; Gray, Heather; Gray, Julia Ann; Graziani, Enrico; Grebenyuk, Oleg; Greenshaw, Timothy; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grinstein, Sebastian; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Groh, Manfred; Gross, Eilam; Grosse-Knetter, Joern; Groth-Jensen, Jacob; Grybel, Kai; Guarino, Victor; Guest, Daniel; Guicheney, Christophe; Guida, Angelo; Guindon, Stefan; Guler, Hulya; Gunther, Jaroslav; Guo, Bin; Guo, Jun; Gupta, Ambreesh; Gusakov, Yury; Gushchin, Vladimir; Gutierrez, Phillip; Guttman, Nir; Gutzwiller, Olivier; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haas, Stefan; Haber, Carl; Hackenburg, Robert; Hadavand, Haleh Khani; Hadley, David; Haefner, Petra; Hahn, Ferdinand; Haider, Stefan; Hajduk, Zbigniew; Hakobyan, Hrachya; Hall, David; Haller, Johannes; Hamacher, Klaus; Hamal, Petr; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Han, Hongguang; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Handel, Carsten; Hanke, Paul; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hansson, Per; Hara, Kazuhiko; Hare, Gabriel; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Karl; Hartert, Jochen; Hartjes, Fred; Haruyama, Tomiyoshi; Harvey, Alex; Hasegawa, Satoshi; Hasegawa, Yoji; Hassani, Samira; Hatch, Mark; Hauff, Dieter; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawes, Brian; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hawkins, Donovan; Hayakawa, Takashi; Hayashi, Takayasu; Hayden, Daniel; Hayward, Helen; Haywood, Stephen; Hazen, Eric; He, Mao; Head, Simon; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heinemann, Beate; Heisterkamp, Simon; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, Robert; Henke, Michael; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Henry-Couannier, Frédéric; Hensel, Carsten; Henß, Tobias; Medina Hernandez, Carlos; Hernández Jiménez, Yesenia; Herrberg, Ruth; Hershenhorn, Alon David; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Higón-Rodriguez, Emilio; Hill, Daniel; Hill, John; Hill, Norman; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirsch, Florian; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holder, Martin; Holmgren, Sven-Olof; Holy, Tomas; Holzbauer, Jenny; Homma, Yasuhiro; Hong, Tae Min; Hooft van Huysduynen, Loek; Horazdovsky, Tomas; Horn, Claus; Horner, Stephan; Hostachy, Jean-Yves; Hou, Suen; Houlden, Michael; Hoummada, Abdeslam; Howarth, James; Howell, David; Hristova, Ivana; Hrivnac, Julius; Hruska, Ivan; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Huang, Guang Shun; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huettmann, Antje; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Hughes-Jones, Richard; Huhtinen, Mika; Hurst, Peter; Hurwitz, Martina; Husemann, Ulrich; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibbotson, Michael; Ibragimov, Iskander; Ichimiya, Ryo; Iconomidou-Fayard, Lydia; Idarraga, John; Iengo, Paolo; Igonkina, Olga; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Yuri; Iliadis, Dimitrios; Ilic, Nikolina; Imori, Masatoshi; Ince, Tayfun; Inigo-Golfin, Joaquin; Ioannou, Pavlos; Iodice, Mauro; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishikawa, Akimasa; Ishino, Masaya; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakubek, Jan; Jana, Dilip; Jankowski, Ernest; Jansen, Eric; Jansen, Hendrik; Jantsch, Andreas; Janus, Michel; Jarlskog, Göran; Jeanty, Laura; Jelen, Kazimierz; Jen-La Plante, Imai; Jenni, Peter; Jeremie, Andrea; Jež, Pavel; Jézéquel, Stéphane; Jha, Manoj Kumar; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Ge; Jin, Shan; Jinnouchi, Osamu; Joergensen, Morten Dam; Joffe, David; Johansen, Lars; Johansen, Marianne; Johansson, Erik; Johansson, Per; Johnert, Sebastian; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tegid; Jones, Tim; Jonsson, Ove; Joram, Christian; Jorge, Pedro; Joseph, John; Jovicevic, Jelena; Jovin, Tatjana; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Juranek, Vojtech; Jussel, Patrick; Juste Rozas, Aurelio; Kabachenko, Vasily; Kabana, Sonja; Kaci, Mohammed; Kaczmarska, Anna; Kadlecik, Peter; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kaiser, Steffen; Kajomovitz, Enrique; Kalinin, Sergey; Kalinovskaya, Lidia; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kaplon, Jan; Kar, Deepak; Karagoz, Muge; Karnevskiy, Mikhail; Karr, Kristo; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kasmi, Azzedine; Kass, Richard; Kastanas, Alex; Kataoka, Mayuko; Kataoka, Yousuke; Katsoufis, Elias; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kayl, Manuel; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keil, Markus; Kekelidze, George; Kennedy, John; Kenney, Christopher John; Kenyon, Mike; Kepka, Oldrich; Kerschen, Nicolas; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khakzad, Mohsen; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharchenko, Dmitri; Khodinov, Alexander; Kholodenko, Anatoli; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Nikolai; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hyeon Jin; Kim, Min Suk; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; Kirk, Julie; Kirsch, Lawrence; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kittelmann, Thomas; Kiver, Andrey; Kladiva, Eduard; Klaiber-Lodewigs, Jonas; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klemetti, Miika; Klier, Amit; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klinkby, Esben; Klioutchnikova, Tatiana; Klok, Peter; Klous, Sander; Kluge, Eike-Erik; Kluge, Thomas; Kluit, Peter; Kluth, Stefan; Knecht, Neil; Kneringer, Emmerich; Knobloch, Juergen; Knoops, Edith; Knue, Andrea; Ko, Byeong Rok; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Köneke, Karsten; König, Adriaan; Koenig, Sebastian; Köpke, Lutz; Koetsveld, Folkert; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohn, Fabian; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kokott, Thomas; Kolachev, Guennady; Kolanoski, Hermann; Kolesnikov, Vladimir; Koletsou, Iro; Koll, James; Kollefrath, Michael; Kolya, Scott; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kono, Takanori; Kononov, Anatoly; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kootz, Andreas; Koperny, Stefan; Korcyl, Krzysztof; Kordas, Kostantinos; Koreshev, Victor; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotamäki, Miikka Juhani; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, James; Kraus, Jana; Kreisel, Arik; Krejci, Frantisek; Kretzschmar, Jan; Krieger, Nina; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruth, Andre; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Thorsten; Kuhn, Dietmar; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kummer, Christian; Kuna, Marine; Kundu, Nikhil; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurata, Masakazu; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwee, Regina; La Rosa, Alessandro; La Rotonda, Laura; Labarga, Luis; Labbe, Julien; Lablak, Said; Lacasta, Carlos; Lacava, Francesco; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laisne, Emmanuel; Lamanna, Massimo; Lampen, Caleb; Lampl, Walter; Lancon, Eric; Landgraf, Ulrich; Landon, Murrough; Lane, Jenna; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Larionov, Anatoly; Larner, Aimee; Lasseur, Christian; Lassnig, Mario; Laurelli, Paolo; Lavorini, Vincenzo; Lavrijsen, Wim; Laycock, Paul; Lazarev, Alexandre; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Maner, Christophe; Le Menedeu, Eve; Lebel, Céline; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Michel; Legendre, Marie; Leger, Annie; LeGeyt, Benjamin; Legger, Federica; Leggett, Charles; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Leltchouk, Mikhail; Lemmer, Boris; Lendermann, Victor; Leney, Katharine; Lenz, Tatiana; Lenzen, Georg; Lenzi, Bruno; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lessard, Jean-Raphael; Lesser, Jonas; Lester, Christopher; Leung Fook Cheong, Annabelle; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levitski, Mikhail; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bo; Li, Haifeng; Li, Shu; Li, Xuefei; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lichtnecker, Markus; Lie, Ki; Liebig, Wolfgang; Lifshitz, Ronen; Lilley, Joseph; Limbach, Christian; Limosani, Antonio; Limper, Maaike; Lin, Simon; Linde, Frank; Linnemann, James; Lipeles, Elliot; Lipinsky, Lukas; Lipniacka, Anna; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Chuanlei; Liu, Dong; Liu, Hao; Liu, Jianbei; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Loken, James; Lombardo, Vincenzo Paolo; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lo Sterzo, Francesco; Losty, Michael; Lou, Xinchou; Lounis, Abdenour; Loureiro, Karina; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Ludwig, Andreas; Ludwig, Dörthe; Ludwig, Inga; Ludwig, Jens; Luehring, Frederick; Luijckx, Guy; Lumb, Debra; Luminari, Lamberto; Lund, Esben; Lund-Jensen, Bengt; Lundberg, Björn; Lundberg, Johan; Lundquist, Johan; Lungwitz, Matthias; Lutz, Gerhard; Lynn, David; Lys, Jeremy; Lytken, Else; Ma, Hong; Ma, Lian Liang; Macana Goia, Jorge Andres; Maccarrone, Giovanni; Macchiolo, Anna; Maček, Boštjan; Machado Miguens, Joana; Mackeprang, Rasmus; Madaras, Ronald; Mader, Wolfgang; Maenner, Reinhard; Maeno, Tadashi; Mättig, Peter; Mättig, Stefan; Magnoni, Luca; Magradze, Erekle; Mahalalel, Yair; Mahboubi, Kambiz; Mahout, Gilles; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Malecki, Piotr; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mameghani, Raphael; Mamuzic, Judita; Manabe, Atsushi; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Mangeard, Pierre-Simon; Manhaes de Andrade Filho, Luciano; Manjavidze, Ioseb; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Manz, Andreas; Mapelli, Alessandro; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchese, Fabrizio; Marchiori, Giovanni; Marcisovsky, Michal; Marin, Alexandru; Marino, Christopher; Marroquim, Fernando; Marshall, Robin; Marshall, Zach; Martens, Kalen; Marti-Garcia, Salvador; Martin, Andrew; Martin, Brian; Martin, Brian Thomas; Martin, Franck Francois; Martin, Jean-Pierre; Martin, Philippe; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martin-Haugh, Stewart; Martinez, Mario; Martinez Outschoorn, Verena; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massaro, Graziano; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mathes, Markus; Matricon, Pierre; Matsumoto, Hiroshi; Matsunaga, Hiroyuki; Matsushita, Takashi; Mattravers, Carly; Maugain, Jean-Marie; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; May, Edward; Mayne, Anna; Mazini, Rachid; Mazur, Michael; Mazzanti, Marcello; Mazzoni, Enrico; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; McGlone, Helen; Mchedlidze, Gvantsa; McLaren, Robert Andrew; Mclaughlan, Tom; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Mechtel, Markus; Medinnis, Mike; Meera-Lebbai, Razzak; Meguro, Tatsuma; Mehdiyev, Rashid; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Mendoza Navas, Luis; Meng, Zhaoxia; Mengarelli, Alberto; Menke, Sven; Menot, Claude; Meoni, Evelin; Mercurio, Kevin Michael; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer, Joerg; Meyer, Thomas Christian; Meyer, W Thomas; Miao, Jiayuan; Michal, Sebastien; Micu, Liliana; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Miller, Robert; Mills, Bill; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Miralles Verge, Lluis; Misiejuk, Andrzej; Mitrevski, Jovan; Mitrofanov, Gennady; Mitsou, Vasiliki A; Mitsui, Shingo; Miyagawa, Paul; Miyazaki, Kazuki; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mockett, Paul; Moed, Shulamit; Moeller, Victoria; Mönig, Klaus; Möser, Nicolas; Mohapatra, Soumya; Mohr, Wolfgang; Mohrdieck-Möck, Susanne; Moisseev, Artemy; Moles-Valls, Regina; Molina-Perez, Jorge; Monk, James; Monnier, Emmanuel; Montesano, Simone; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Moorhead, Gareth; Mora Herrera, Clemencia; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Morello, Gianfranco; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Morin, Jerome; Morley, Anthony Keith; Mornacchi, Giuseppe; Morozov, Sergey; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Mudrinic, Mihajlo; Mueller, Felix; Mueller, James; Mueller, Klemens; Müller, Thomas; Mueller, Timo; Muenstermann, Daniel; Muir, Alex; Munwes, Yonathan; Murray, Bill; Mussche, Ido; Musto, Elisa; Myagkov, Alexey; Nadal, Jordi; Nagai, Koichi; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Nanava, Gizo; Napier, Austin; Narayan, Rohin; Nash, Michael; Nation, Nigel; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Neal, Homer; Nebot, Eduardo; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Silke; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neusiedl, Andrea; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen Thi Hong, Van; Nickerson, Richard; Nicolaidou, Rosy; Nicolas, Ludovic; Nicquevert, Bertrand; Niedercorn, Francois; Nielsen, Jason; Niinikoski, Tapio; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolaev, Kirill; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsen, Henrik; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nishiyama, Tomonori; Nisius, Richard; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nordberg, Markus; Nordkvist, Bjoern; Norton, Peter; Novakova, Jana; Nozaki, Mitsuaki; Nozka, Libor; Nugent, Ian Michael; Nuncio-Quiroz, Adriana-Elizabeth; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; O'Brien, Brendan Joseph; O'Neale, Steve; O'Neil, Dugan; O'Shea, Val; Oakes, Louise Beth; Oakham, Gerald; Oberlack, Horst; Ocariz, Jose; Ochi, Atsuhiko; Oda, Susumu; Odaka, Shigeru; Odier, Jerome; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohshima, Takayoshi; Ohshita, Hidetoshi; Ohsugi, Takashi; Okada, Shogo; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olcese, Marco; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira, Miguel Alfonso; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olivito, Dominick; Olszewski, Andrzej; Olszowska, Jolanta; Omachi, Chihiro; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlov, Iliya; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Osuna, Carlos; Otero y Garzon, Gustavo; Ottersbach, John; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Simon; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganis, Efstathios; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Paleari, Chiara; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panes, Boris; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Panuskova, Monika; Paolone, Vittorio; Papadelis, Aras; Papadopoulou, Theodora; Paramonov, Alexander; Park, Woochun; Parker, Andy; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pecsy, Martin; Pedraza Morales, Maria Isabel; Peleganchuk, Sergey; Peng, Haiping; Pengo, Ruggero; Penning, Bjoern; Penson, Alexander; Penwell, John; Perantoni, Marcelo; Perez, Kerstin; Perez Cavalcanti, Tiago; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Perrodo, Pascal; Persembe, Seda; Perus, Antoine; Peshekhonov, Vladimir; Peters, Krisztian; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petschull, Dennis; Petteni, Michele; Pezoa, Raquel; Phan, Anna; Phillips, Peter William; Piacquadio, Giacinto; Piccaro, Elisa; Piccinini, Maurizio; Piec, Sebastian Marcin; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Ping, Jialun; Pinto, Belmiro; Pirotte, Olivier; Pizio, Caterina; Placakyte, Ringaile; Plamondon, Mathieu; Pleier, Marc-Andre; Pleskach, Anatoly; Poblaguev, Andrei; Poddar, Sahill; Podlyski, Fabrice; Poggioli, Luc; Poghosyan, Tatevik; Pohl, Martin; Polci, Francesco; Polesello, Giacomo; Policicchio, Antonio; Polini, Alessandro; Poll, James; Polychronakos, Venetios; Pomarede, Daniel Marc; Pomeroy, Daniel; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Posch, Christoph; Pospelov, Guennady; Pospisil, Stanislav; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Prabhu, Robindra; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Pretzl, Klaus Peter; Pribyl, Lukas; Price, Darren; Price, Joe; Price, Lawrence; Price, Michael John; Prieur, Damien; Primavera, Margherita; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Prudent, Xavier; Przybycien, Mariusz; Przysiezniak, Helenka; Psoroulas, Serena; Ptacek, Elizabeth; Pueschel, Elisa; Purdham, John; Purohit, Milind; Puzo, Patrick; Pylypchenko, Yuriy; Qian, Jianming; Qian, Zuxuan; Qin, Zhonghua; Quadt, Arnulf; Quarrie, David; Quayle, William; Quinonez, Fernando; Raas, Marcel; Radescu, Voica; Radics, Balint; Radloff, Peter; Rador, Tonguc; Ragusa, Francesco; Rahal, Ghita; Rahimi, Amir; Rahm, David; Rajagopalan, Srinivasan; Rammensee, Michael; Rammes, Marcus; Randle-Conde, Aidan Sean; Randrianarivony, Koloina; Ratoff, Peter; Rauscher, Felix; Rave, Tobias Christian; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Reichold, Armin; Reinherz-Aronis, Erez; Reinsch, Andreas; Reisinger, Ingo; Rembser, Christoph; Ren, Zhongliang; Renaud, Adrien; Renkel, Peter; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richards, Alexander; Richter, Robert; Richter-Was, Elzbieta; Ridel, Melissa; Rijpstra, Manouk; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Rios, Ryan Randy; Riu, Imma; Rivoltella, Giancesare; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robinson, Mary; Robson, Aidan; Rocha de Lima, Jose Guilherme; Roda, Chiara; Roda Dos Santos, Denis; Rodriguez, Diego; Roe, Adam; Roe, Shaun; Røhne, Ole; Rojo, Victoria; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romanov, Victor; Romeo, Gaston; Romero Adam, Elena; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Anthony; Rose, Matthew; Rosenbaum, Gabriel; Rosenberg, Eli; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rosselet, Laurent; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexander; Rozen, Yoram; Ruan, Xifeng; Rubinskiy, Igor; Ruckert, Benjamin; Ruckstuhl, Nicole; Rud, Viacheslav; Rudolph, Christian; Rudolph, Gerald; Rühr, Frederik; Ruggieri, Federico; Ruiz-Martinez, Aranzazu; Rumiantsev, Viktor; Rumyantsev, Leonid; Runge, Kay; Rurikova, Zuzana; Rusakovich, Nikolai; Rust, Dave; Rutherfoord, John; Ruwiedel, Christoph; Ruzicka, Pavel; Ryabov, Yury; Ryadovikov, Vasily; Ryan, Patrick; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Rzaeva, Sevda; Saavedra, Aldo; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Samset, Björn Hallvard; Sanchez, Arturo; Sanchez Martinez, Victoria; Sandaker, Heidi; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sandvoss, Stephan; Sankey, Dave; Sansoni, Andrea; Santamarina Rios, Cibran; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Saraiva, João; Sarangi, Tapas; Sarkisyan-Grinbaum, Edward; Sarri, Francesca; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Takashi; Sasao, Noboru; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Sauvan, Jean-Baptiste; Savard, Pierre; Savinov, Vladimir; Savu, Dan Octavian; Sawyer, Lee; Saxon, David; Says, Louis-Pierre; Sbarra, Carla; Sbrizzi, Antonio; Scallon, Olivia; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schäfer, Uli; Schaepe, Steffen; Schaetzel, Sebastian; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Schamov, Andrey; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schioppa, Marco; Schlenker, Stefan; Schlereth, James; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitz, Martin; Schöning, André; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schroeder, Christian; Schroer, Nicolai; Schuh, Silvia; Schuler, Georges; Schultens, Martin Johannes; Schultes, Joachim; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Jan; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwemling, Philippe; Schwienhorst, Reinhard; Schwierz, Rainer; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Scott, Bill; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Segura, Ester; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellden, Bjoern; Sellers, Graham; Seman, Michal; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Seuster, Rolf; Severini, Horst; Sevior, Martin; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaver, Leif; Shaw, Kate; Sherman, Daniel; Sherwood, Peter; Shibata, Akira; Shichi, Hideharu; Shimizu, Shima; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Maria; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Sicho, Petr; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silbert, Ohad; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simmons, Brinick; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinnari, Louise Anastasia; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Skvorodnev, Nikolai; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Sloper, John erik; Smakhtin, Vladimir; Smart, Ben; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Ben Campbell; Smith, Douglas; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snow, Steve; Snow, Joel; Snuverink, Jochem; Snyder, Scott; Soares, Mara; Sobie, Randall; Sodomka, Jaromir; Soffer, Abner; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Soni, Nitesh; Sopko, Vit; Sopko, Bruno; Sosebee, Mark; Soualah, Rachik; Soukharev, Andrey; Spagnolo, Stefania; Spanò, Francesco; Spighi, Roberto; Spigo, Giancarlo; Spila, Federico; Spiwoks, Ralf; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staude, Arnold; Stavina, Pavel; Stavropoulos, Georgios; Steele, Genevieve; Steinbach, Peter; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stevenson, Kyle; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoerig, Kathrin; Stoicea, Gabriel; Stonjek, Stefan; Strachota, Pavel; Stradling, Alden; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strang, Michael; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Strong, John; Stroynowski, Ryszard; Strube, Jan; Stugu, Bjarne; Stumer, Iuliu; Stupak, John; Sturm, Philipp; Styles, Nicholas Adam; Soh, Dart-yin; Su, Dong; Subramania, Halasya Siva; Succurro, Antonella; Sugaya, Yorihito; Sugimoto, Takuya; Suhr, Chad; Suita, Koichi; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Sushkov, Serge; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Suzuki, Yuta; Svatos, Michal; Sviridov, Yuri; Swedish, Stephen; Sykora, Ivan; Sykora, Tomas; Szeless, Balazs; Sánchez, Javier; Ta, Duc; Tackmann, Kerstin; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tamsett, Matthew; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanaka, Yoshito; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tappern, Geoffrey; Tapprogge, Stefan; Tardif, Dominique; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tassi, Enrico; Tatarkhanov, Mous; Tayalati, Yahya; Taylor, Christopher; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teinturier, Marthe; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Terada, Susumu; Terashi, Koji; Terron, Juan; Testa, Marianna; Teuscher, Richard; Thadome, Jocelyn; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thioye, Moustapha; Thoma, Sascha; Thomas, Juergen; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tic, Tomáš; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tique Aires Viegas, Florbela De Jes; Tisserant, Sylvain; Tobias, Jürgen; Toczek, Barbara; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokunaga, Kaoru; Tokushuku, Katsuo; Tollefson, Kirsten; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Guoliang; Tonoyan, Arshak; Topfel, Cyril; Topilin, Nikolai; Torchiani, Ingo; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alesandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Trinh, Thi Nguyet; Tripiana, Martin; Trischuk, William; Trivedi, Arjun; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiakiris, Menelaos; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsung, Jieh-Wen; Tsuno, Soshi; Tsybychev, Dmitri; Tua, Alan; Tudorache, Alexandra; Tudorache, Valentina; Tuggle, Joseph; Turala, Michal; Turecek, Daniel; Turk Cakir, Ilkay; Turlay, Emmanuel; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Tzanakos, George; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ugland, Maren; Uhlenbrock, Mathias; Uhrmacher, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Underwood, David; Undrus, Alexander; Unel, Gokhan; Unno, Yoshinobu; Urbaniec, Dustin; Usai, Giulio; Uslenghi, Massimiliano; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Vahsen, Sven; Valenta, Jan; Valente, Paolo; Valentinetti, Sara; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; van der Graaf, Harry; van der Kraaij, Erik; Van Der Leeuw, Robin; van der Poel, Egge; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; van Kesteren, Zdenko; van Vulpen, Ivo; Vanadia, Marco; Vandelli, Wainer; Vandoni, Giovanna; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Varela Rodriguez, Fernando; Vari, Riccardo; Varnes, Erich; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vegni, Guido; Veillet, Jean-Jacques; Vellidis, Constantine; Veloso, Filipe; Veness, Raymond; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinek, Elisabeth; Vinogradov, Vladimir; Virchaux, Marc; Virzi, Joseph; Vitells, Ofer; Viti, Michele; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vlasov, Nikolai; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; Volpini, Giovanni; von der Schmitt, Hans; von Loeben, Joerg; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobiev, Alexander; Vorwerk, Volker; Vos, Marcel; Voss, Rudiger; Voss, Thorsten Tobias; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Wagner, Wolfgang; Wagner, Peter; Wahlen, Helmut; Wakabayashi, Jun; Walbersloh, Jorg; Walch, Shannon; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Wang, Chiho; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Joshua C; Wang, Rui; Wang, Song-Ming; Warburton, Andreas; Ward, Patricia; Warsinsky, Markus; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Anthony; Waugh, Ben; Weber, Marc; Weber, Michele; Weber, Pavel; Weidberg, Anthony; Weigell, Philipp; Weingarten, Jens; Weiser, Christian; Wellenstein, Hermann; Wells, Phillippa; Wen, Mei; Wenaus, Torre; Wendland, Dennis; Wendler, Shanti; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Werth, Michael; Wessels, Martin; Weydert, Carole; Whalen, Kathleen; Wheeler-Ellis, Sarah Jane; Whitaker, Scott; White, Andrew; White, Martin; Whitehead, Samuel Robert; Whiteson, Daniel; Whittington, Denver; Wicek, Francois; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilhelm, Ivan; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Eric; Williams, Hugh; Willis, William; Willocq, Stephane; Wilson, John; Wilson, Michael Galante; Wilson, Alan; Wingerter-Seez, Isabelle; Winkelmann, Stefan; Winklmeier, Frank; Wittgen, Matthias; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Wei-Cheng; Wooden, Gemma; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wraight, Kenneth; Wright, Catherine; Wright, Michael; Wrona, Bozydar; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wunstorf, Renate; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xie, Song; Xie, Yigang; Xu, Chao; Xu, Da; Xu, Guofa; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamaoka, Jared; Yamazaki, Takayuki; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Un-Ki; Yang, Yi; Yang, Yi; Yang, Zhaoyu; Yanush, Serguei; Yao, Yushu; Yasu, Yoshiji; Ybeles Smit, Gabriel Valentijn; Ye, Jingbo; Ye, Shuwei; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Riktura; Young, Charles; Youssef, Saul; Yu, Dantong; Yu, Jaehoon; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaets, Vassilli; Zaidan, Remi; Zaitsev, Alexander; Zajacova, Zuzana; Zanello, Lucia; Zarzhitsky, Pavel; Zaytsev, Alexander; Zeitnitz, Christian; Zeller, Michael; Zeman, Martin; Zemla, Andrzej; Zendler, Carolin; Zenin, Oleg; Ženiš, Tibor; Zenonos, Zenonas; Zenz, Seth; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhan, Zhichao; Zhang, Dongliang; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Long; Zhao, Tianchi; Zhao, Zhengguo; Zhemchugov, Alexey; Zheng, Shuchen; Zhong, Jiahang; Zhou, Bing; Zhou, Ning; Zhou, Yue; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhuravlov, Vadym; Zieminska, Daria; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Ziolkowski, Michael; Zitoun, Robert; Živković, Lidija; Zmouchko, Viatcheslav; Zobernig, Georg; Zoccoli, Antonio; Zolnierowski, Yves; Zsenei, Andras; zur Nedden, Martin; Zutshi, Vishnu; Zwalinski, Lukasz

    2013-03-02

    The uncertainty on the calorimeter energy response to jets of particles is derived for the ATLAS experiment at the Large Hadron Collider (LHC). First, the calorimeter response to single isolated charged hadrons is measured and compared to the Monte Carlo simulation using proton-proton collisions at centre-of-mass energies of $\\sqrt{s}$ = 900 GeV and 7 TeV collected during 2009 and 2010. Then, using the decay of K_s and Lambda particles, the calorimeter response to specific types of particles (positively and negatively charged pions, protons, and anti-protons) is measured and compared to the Monte Carlo predictions. Finally, the jet energy scale uncertainty is determined by propagating the response uncertainty for single charged and neutral particles to jets. The response uncertainty is 2-5% for central isolated hadrons and 1-3% for the final calorimeter jet energy scale.

  5. Hormonal responses of multiset versus single-set heavy-resistance exercise protocols.

    Science.gov (United States)

    Gotshalk, L A; Loebel, C C; Nindl, B C; Putukian, M; Sebastianelli, W J; Newton, R U; Häkkinen, K; Kraemer, W J

    1997-06-01

    The purpose of this study was to compare serum growth hormone (GH), testosterone (T), cortisol (C), and whole blood lactate (L) responses to single set (1S) versus multiple set (3S) heavy-resistance exercise protocols. Eight recreationally weight-trained men completed two identical resistance exercise workouts (1S vs. 3S). Blood was obtained preexercise (PRE), immediately postexercise (OP), and 5 min (5P), 15 min (15P), 30 min (30P) and 60 min (60P) postexercise and was analyzed for GH, T, C, and L levels. For 1S and 3S, GH, L, and T significantly increased from PRE to OP and remained significantly elevated to 60P, except for 1S. For GH, T, and L, 3S showed significantly greater increases compared to 1S. For C, 3S and 1S were increased significantly from resting at OP, 5P, and 15P; 3S increased compared to 1S at 5P, 15P and 30P. Higher volumes of total work produce significantly greater increases in circulating anabolic hormones during the recovery phase following exercise.

  6. Single-layer tungsten oxide as intelligent photo-responsive nanoagents for permanent male sterilization.

    Science.gov (United States)

    Liu, Zhen; Liu, Xianjun; Ran, Xiang; Ju, Enguo; Ren, Jinsong; Qu, Xiaogang

    2015-11-01

    Permanent male sterilization has been recognized as useful tools for the development of neuter experimental animals and fattening livestock, as well as efficient control of pet overpopulation. Traditional routes such as surgical ways, chemical injections, and anti-fertility vaccines have addressed these crucial problems with idea outcomes. However, these routes usually bring out serious pain and infection towards animals, as well as induce long-term adverse reaction and immune suppression. Thus, a convenient, but non-surgical strategy for male sterilization under a mild manner is highly desirable. Here, for the first time, we demonstrate a novel platform for male sterilization by using single-layer WO2.72 nanosheets as smart photo-responsive sterilants. Upon a 980 nm irradiation, these nanoagents can possess intrinsic NIR-induced hyperthermia and sensitize the formation of singlet oxygen due to the cooperation of photothermal and photodynamic effects. Mechanism of cellular injury can be attributed to the denaturation of protein and apoptosis-related death. Moreover, long-term toxicity and possible metabolism route after testicular injection are discussed, indicating the neglectable systemic toxicity and high bio-compatibility of our nanoagents. Overall, our strategy can extremely overcome the shortcomings in various routine routes and suggest the new biological application of nanomaterials. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Therapeutic response to single intravenous bolus administration of formate dehydrogenase in methanol-intoxicated rats.

    Science.gov (United States)

    Muthuvel, Arumugham; Rajamani, Rathinam; Sheeladevi, Rathinasamy

    2006-02-20

    Methanol remains to be a major public and environmental health hazard. Formic acid is the toxic metabolite responsible for the metabolic acidosis observed in methanol poisoning in humans, in non-human primates and in folate-depleted rodents. Cytochrome oxidase inhibition by formate leads to lactic acid accumulation, which contributes significantly to metabolic acidosis. Toxic effects in human beings are characterized by formic acidemia, metabolic acidosis, ocular toxicity, nervous system depression, blindness, coma and death. Elimination of formate is one of the principles of management in methanol poisoning. Hemodialysis facility is not readily available in all the places, in developing countries like India. Formate dehydrogenase (EC 1.2.1.2) acts directly over formate and converts formate into CO(2) in the presence of NAD. Effect of single intravenous bolus infusion of formate dehydrogenase, obtained from Candida boidinii; in methanol-intoxicated folate deficient rat model was evaluated. Folate depletion induced by methotrexate (MTX) treatment. Carbicarb (Carb) (equimolar solution of sodium carbonate and sodium bicarbonate) was used to treat metabolic acidosis. Experimental design consists of seven groups, namely Saline control, methanol control, MTX control, Enzyme control, MTX-methanol control, MTX-methanol-Carb and MTX-methanol-Carb-Enz group. Male wistar rats treated with MTX (0.3mg/kg) for a week, were injected (i.p.) with methanol (4 gm/kg), 12h latter, Carbicarb solution was infused, following this enzyme was infused (i.v.) in bolus. Blood samples were collected every 15 min for an hour from the cannulated left jugular vein and blood methanol, formate were estimated, respectively, with HPLC and fluorimetric assay. Blood pH, blood gases pO(2), pCO(2) and bicarbonate were monitored with blood gas analyzer in order to evaluate acid base status of the animal. Results obtained show that there is significant elimination of formate within 15 min. It may be

  8. Predictors of pathologic complete response after preoperative concurrent chemoradiotherapy of rectal cancer: A single center experience

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Eun Cheol [Proton Therapy Center, National Cancer Center, Goyang (Korea, Republic of); Kim, Jin Hee; Kim, Ok Bae; Kim, Mi Young; Oh, Young Ki; Baek, Sung Gyu [Dongsan Medical Center, Keimyung University School of Medicine, Daegu (Korea, Republic of)

    2016-06-15

    To identify possible predictors of pathologic complete response (pCR) of rectal cancer after preoperative concurrent chemoradiotherapy (CCRT). We conducted a retrospective review of 53 patients with rectal cancer who underwent preoperative CCRT followed by radical surgery at a single center between January 2007 and December 2012. The median radiotherapy dose to the pelvis was 54.0 Gy (range, 45.0 to 63.0 Gy). Five-fluorouracil-based chemotherapy was administered via continuous infusion with leucovorin. The pCR rate was 20.8%. The downstaging rate was 66%. In univariate analyses, poor and undifferentiated tumors (p = 0.020) and an interval of ≥7 weeks from finishing CCRT to surgery (p = 0.040) were significantly associated with pCR, while female gender (p = 0.070), initial carcinoembryonic antigen concentration of <5.0 ng/dL (p = 0.100), and clinical stage T2 (p = 0.100) were marginally significant factors. In multivariate analysis, an interval of ≥7 weeks from finishing CCRT to surgery (odds ratio, 0.139; 95% confidence interval, 0.022 to 0.877; p = 0.036) was significantly associated with pCR, while stage T2 (odds ratio, 5.363; 95% confidence interval, 0.963 to 29.877; p = 0.055) was a marginally significant risk factor. We suggest that the interval from finishing CCRT to surgery is a predictor of pCR after preoperative CCRT in patients with rectal cancer. Stage T2 cancer may also be an important predictive factor. We hope to perform a robust study by collecting data during treatment to obtain more advanced results.

  9. Glycyrrhizin Treatment Facilitates Extinction of Conditioned Fear Responses After a Single Prolonged Stress Exposure in Rats.

    Science.gov (United States)

    Lai, Shuhua; Wu, Gangwei; Jiang, Zhixian

    2018-01-01

    Impaired fear memory extinction is widely considered a key mechanism of post-traumatic stress disorder (PTSD). Recent studies have suggested that neuroinflammation after a single prolonged stress (SPS) exposure may play a critical role in the impaired fear memory extinction. Studies have shown that high mobility group box chromosomal protein 1 (HMGB-1) is critically involved in neuroinflammation. However, the role of HMGB-1 underlying the development of impairment of fear memory extinction is still not known. Thus, we examined the levels of HMGB-1 in the basolateral amygdala (BLA) following SPS using Western blot and evaluated the levels of microglia and astrocytes activation in the BLA after SPS using immunohistochemical staining. We then examined the effects of pre-SPS intra-BLA administration of glycyrrhizin, an HMGB1 inhibitor, or LPS-RS, a competitive TLR4 antagonist, on subsequent post-SPS fear extinction. We found that SPS treatment prolonged the extinction of contextual fear memory after the SPS. The impairment of SPS-induced extinction of contextual fear memory was associated with increased HMGB1 and Toll-like receptor 4 (TLR4) levels in the BLA. Additionally, the impairment of SPS-induced extinction of contextual fear memory was associated with increased activation of microglia and astrocyte in the BLA. Intra-BLA administrations of glycyrrhizin (HMGB-1 inhibitor) or LPS-RS (TLR4 antagonist) can prevent the development of SPS-induced fear extinction impairment. Taken together, these results suggested that SPS treatment may not only produce short term effects on the HMGB1/TLR4-mediated pro-inflammation, but alter the response of microglia and astrocytes to the exposure to fear associated contextual stimuli. © 2018 The Author(s). Published by S. Karger AG, Basel.

  10. Auditory and audio-vocal responses of single neurons in the monkey ventral premotor cortex.

    Science.gov (United States)

    Hage, Steffen R

    2018-03-20

    Monkey vocalization is a complex behavioral pattern, which is flexibly used in audio-vocal communication. A recently proposed dual neural network model suggests that cognitive control might be involved in this behavior, originating from a frontal cortical network in the prefrontal cortex and mediated via projections from the rostral portion of the ventral premotor cortex (PMvr) and motor cortex to the primary vocal motor network in the brainstem. For the rapid adjustment of vocal output to external acoustic events, strong interconnections between vocal motor and auditory sites are needed, which are present at cortical and subcortical levels. However, the role of the PMvr in audio-vocal integration processes remains unclear. In the present study, single neurons in the PMvr were recorded in rhesus monkeys (Macaca mulatta) while volitionally producing vocalizations in a visual detection task or passively listening to monkey vocalizations. Ten percent of randomly selected neurons in the PMvr modulated their discharge rate in response to acoustic stimulation with species-specific calls. More than four-fifths of these auditory neurons showed an additional modulation of their discharge rates either before and/or during the monkeys' motor production of the vocalization. Based on these audio-vocal interactions, the PMvr might be well positioned to mediate higher order auditory processing with cognitive control of the vocal motor output to the primary vocal motor network. Such audio-vocal integration processes in the premotor cortex might constitute a precursor for the evolution of complex learned audio-vocal integration systems, ultimately giving rise to human speech. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Glycyrrhizin Treatment Facilitates Extinction of Conditioned Fear Responses After a Single Prolonged Stress Exposure in Rats

    Directory of Open Access Journals (Sweden)

    Shuhua Lai

    2018-03-01

    Full Text Available Background/Aims: Impaired fear memory extinction is widely considered a key mechanism of post-traumatic stress disorder (PTSD. Recent studies have suggested that neuroinflammation after a single prolonged stress (SPS exposure may play a critical role in the impaired fear memory extinction. Studies have shown that high mobility group box chromosomal protein 1 (HMGB-1 is critically involved in neuroinflammation. However, the role of HMGB-1 underlying the development of impairment of fear memory extinction is still not known. Methods: Thus, we examined the levels of HMGB-1 in the basolateral amygdala (BLA following SPS using Western blot and evaluated the levels of microglia and astrocytes activation in the BLA after SPS using immunohistochemical staining. We then examined the effects of pre-SPS intra-BLA administration of glycyrrhizin, an HMGB1 inhibitor, or LPS-RS, a competitive TLR4 antagonist, on subsequent post-SPS fear extinction. Results: We found that SPS treatment prolonged the extinction of contextual fear memory after the SPS. The impairment of SPS-induced extinction of contextual fear memory was associated with increased HMGB1 and Toll-like receptor 4 (TLR4 levels in the BLA. Additionally, the impairment of SPS-induced extinction of contextual fear memory was associated with increased activation of microglia and astrocyte in the BLA. Intra-BLA administrations of glycyrrhizin (HMGB-1 inhibitor or LPS-RS (TLR4 antagonist can prevent the development of SPS-induced fear extinction impairment. Conclusion: Taken together, these results suggested that SPS treatment may not only produce short term effects on the HMGB1/TLR4-mediated pro-inflammation, but alter the response of microglia and astrocytes to the exposure to fear associated contextual stimuli.

  12. Reply to: “A response to some unwarranted criticisms of single-grain dating” by J.K. Feathers

    DEFF Research Database (Denmark)

    Thomsen, Kristina Jørkov; Murray, Andrew Sean; Buylaert, Jan-Pieter

    2017-01-01

    In the note “A response to some unwarranted criticisms of single-grain dating” Feathers raises many issues with both the approach and the conclusions of Thomsen et al. (2016). After careful consideration, we find we disagree with Feather's analysis and conclusions, and stand by the original concl...

  13. Effects of a Single Dose of Parecoxib on Inflammatory Response and Ischemic Tubular Injury Caused by Hemorrhagic Shock in Rats

    Directory of Open Access Journals (Sweden)

    Mariana Takaku

    2018-01-01

    Full Text Available Parecoxib, a selective COX-2 inhibitor, is used to improve analgesia in postoperative procedures. Here we evaluated whether pretreatment with a single dose of parecoxib affects the function, cell injury, and inflammatory response of the kidney of rats subjected to acute hemorrhage. Inflammatory response was determined according to serum and renal tissue cytokine levels (IL-1α, IL-1β, IL-6, IL-10, and TNF-α. Forty-four adult Wistar rats anesthetized with sevoflurane were randomized into four groups: placebo/no hemorrhage (Plc/NH; parecoxib/no hemorrhage (Pcx/NH; placebo/hemorrhage (Plc/H; and parecoxib/hemorrhage (Pcx/H. Pcx groups received a single dose of intravenous parecoxib while Plc groups received a single dose of placebo (isotonic saline. Animals in hemorrhage groups underwent bleeding of 30% of blood volume. Renal function and renal histology were then evaluated. Plc/H showed the highest serum levels of cytokines, suggesting that pretreatment with parecoxib reduced the inflammatory response in rats subjected to hemorrhage. No difference in tissue cytokine levels between groups was observed. Plc/H showed higher percentage of tubular dilation and degeneration, indicating that parecoxib inhibited tubular injury resulting from renal hypoperfusion. Our findings indicate that pretreatment with a single dose of parecoxib reduced the inflammatory response and tubular renal injury without altering renal function in rats undergoing acute hemorrhage.

  14. SEE Transient Response of Crane Interpoint Single Output Point of Load DC-DC Converters

    Science.gov (United States)

    Sanders, Anthony B.; Chen, Dakai; Kim, Hak S.; Phan, Anthony M.

    2011-01-01

    This study was undertaken to determine the single event effect and transient susceptibility of the Crane Interpoint Maximum Flexible Power (MFP) Single Output Point of Load DC/DC Converters for transient interruptions in the output signal and for destructive and non destructive events induced by exposing it to a heavy ion beam..

  15. Cellular and humoral responses in liver of cattle and buffaloes infected with a single dose of Fasciola gigantica.

    Science.gov (United States)

    Molina, Elizabeth C; Skerratt, Lee F

    2005-07-15

    The cellular components of the hepatic inflammatory infiltrate in cattle and buffaloes infected with a single dose of 1000 Fasciola gigantica were analysed by immunohistochemistry and histology. T and B lymphocytes, plasma cells, eosinophils and mast cells were present in the hepatic lesions. It is proposed that both cellular and humoral immune responses were induced in the liver of cattle and buffaloes during infection with F. gigantica probably by antigens released by the developing flukes and by damage caused by the flukes during their migration in the liver. The local T cell response differed between these animals, with the response decreasing after 3 weeks post-infection in cattle in contrast to a gradually increasing response in buffaloes. Difference in the T cell response between cattle and buffaloes may be related to their differences in resistance and resilience to infection with F. gigantica.

  16. Experimental studies of the dynamic mechanical response of a single polymer chain

    DEFF Research Database (Denmark)

    Thormann, Esben; Evans, Drew R.; Craig, Vincent S. J.

    2006-01-01

    mechanical response from poly(vinyl alcohol) does not differ from its static response. This result is not unexpected as poly(vinyl alcohol) is a highly flexible polymer with intramolecular relaxation processes taking place on a short time scale. The choice of a polymer with a fast relaxation allows its...... static properties to be recovered from the dynamic measurements and enables the method suggested in this paper for decoupling the polymer response from the hydrodynamic response to be validated....

  17. The technique of obtaining single-energy γ-rays in calibrating energy response of detector

    International Nuclear Information System (INIS)

    Li Rurong; Peng Taiping; Hu Mengchun; Li Zhongbao

    2004-01-01

    This paper introduces the principle of transforming γ-rays from 60 Co into a series of single-energy γ-rays and stresses the technique of shielding radiation-interfere and reducing energy-dispersion. The Single-energy γ-rays of any energy in the range of 0.36-1.02 MeV may be obtained by means of this technique. (authors)

  18. A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. | Office of Cancer Genomics

    Science.gov (United States)

    Functional genomics efforts face tradeoffs between number of perturbations examined and complexity of phenotypes measured. We bridge this gap with Perturb-seq, which combines droplet-based single-cell RNA-seq with a strategy for barcoding CRISPR-mediated perturbations, allowing many perturbations to be profiled in pooled format. We applied Perturb-seq to dissect the mammalian unfolded protein response (UPR) using single and combinatorial CRISPR perturbations. Two genome-scale CRISPR interference (CRISPRi) screens identified genes whose repression perturbs ER homeostasis.

  19. Single-trial regression elucidates the role of prefrontal theta oscillations in response conflict

    NARCIS (Netherlands)

    Cohen, M.X.; Cavanagh, J.F.

    2011-01-01

    In most cognitive neuroscience experiments there are many behavioral and experimental dynamics, and many indices of brain activity, that vary from trial to trial. For example, in studies of response conflict, conflict is usually treated as a binary variable (i.e., response conflict exists or does

  20. Experience with pegvisomant treatment in acromegaly in a single Brazilian tertiary reference center: efficacy, safety and predictors of response

    OpenAIRE

    Kasuki,Leandro; Machado,Evelyn de Oliveira; Ogino,Liana Lumi; Coelho,Maria Caroline Alves; Silva,Cintia Marques dos Santos; Wildemberg,Luiz Eduardo Armondi; Lima,Carlos Henrique Azeredo; Gadelha,Mônica R.

    2016-01-01

    ABSTRACT Objective To describe the safety and efficacy of pegvisomant therapy and the predictors of treatment response in acromegaly patients at a single tertiary reference center in Brazil. Materials and methods We retrospectively reviewed the clinical, hormonal and radiological data of acromegaly patients treated with pegvisomant in our center. We also evaluated the presence of the d3 isoform of the growth hormone receptor (d3GHR). Results Twenty-seven patients were included (17 women...

  1. Influence of PAH Genotype on Sapropterin Response in PKU: Results of a Single-Center Cohort Study.

    Science.gov (United States)

    Leuders, Sarah; Wolfgart, Eva; Ott, Torsten; du Moulin, Marcel; van Teeffelen-Heithoff, Agnes; Vogelpohl, Lydia; Och, Ulrike; Marquardt, Thorsten; Weglage, Josef; Feldmann, Reinhold; Rutsch, Frank

    2014-01-01

    Identifying phenylalanine hydroxylase (PAH) mutations associated with sapropterin response in phenylketonuria (PKU) would be an advantageous means to determine clinical benefit to sapropterin therapy. Sapropterin response, defined as a ≥30 % reduction in phenylalanine (Phe) levels after a dose of 10 mg/kg/day sapropterin for week one and 20 mg/kg/day for week two in 112 PKU patients aged 4-45 years, was assessed in an outpatient setting. PAH was sequenced in all patients. Mutations were correlated with sapropterin response. Dietary Phe intake was increased over a 6-week period in responsive patients. Forty-six of 112 patients were sapropterin responsive. Genotypes p.[L48S];[L48S] and p.[Y414C];[Y414C] were always associated with response at a low dose. The mutation Y414C (present on 16 alleles) was most frequently associated with response. Patients with presence of the mutation L48S on at least one allele (12 alleles in 7 patients) always showed response to sapropterin. Responsive patients had a mean Phe tolerance increase of 189 % (range 11-742 %). In the 66 nonresponders, mutations R408W (38 alleles) and IVS12+1G>A (18 alleles) were detected most frequently. Genotypes [IVS12+1G>A];[IVS12+1G>A], p.[L348V];[R408W], p.[P281L];[P281L], p.[R158Q];[R408W], and p.[R261Q];[R408W] were always associated with nonresponse. Data from the study contributes to growing evidence of the relationship between PAH genotype and PKU phenotype. In most cases, response to sapropterin therapy cannot be predicted based on the presence of a single mutation on one allele alone, although the complete PAH genotype may help to predict sapropterin responsiveness in PKU patients.

  2. Target representation of naturalistic echolocation sequences in single unit responses from the inferior colliculus of big brown bats

    Science.gov (United States)

    Sanderson, Mark I.; Simmons, James A.

    2005-11-01

    Echolocating big brown bats (Eptesicus fuscus) emit trains of frequency-modulated (FM) biosonar signals whose duration, repetition rate, and sweep structure change systematically during interception of prey. When stimulated with a 2.5-s sequence of 54 FM pulse-echo pairs that mimic sounds received during search, approach, and terminal stages of pursuit, single neurons (N=116) in the bat's inferior colliculus (IC) register the occurrence of a pulse or echo with an average of <1 spike/sound. Individual IC neurons typically respond to only a segment of the search or approach stage of pursuit, with fewer neurons persisting to respond in the terminal stage. Composite peristimulus-time-histogram plots of responses assembled across the whole recorded population of IC neurons depict the delay of echoes and, hence, the existence and distance of the simulated biosonar target, entirely as on-response latencies distributed across time. Correlated changes in pulse duration, repetition rate, and pulse or echo amplitude do modulate the strength of responses (probability of the single spike actually occurring for each sound), but registration of the target itself remains confined exclusively to the latencies of single spikes across cells. Modeling of echo processing in FM biosonar should emphasize spike-time algorithms to explain the content of biosonar images.

  3. Current response of ac-driven nanoelectromechanical systems in single-electron tunneling regime

    OpenAIRE

    Labadze, G.; Blanter, Ya. M.

    2010-01-01

    We investigate electric current in a single-electron tunnelling device weakly coupled to an ac-driven underdamped harmonic nanomechanical oscillator. In the linear regime, the current can respond to the external frequency in a resonant as well as in an anti-resonant fashion. The main resonance is accompanied by an additional resonance at a half of the external frequency.

  4. Non-invasive single-trial detection of variable population spike responses in human somatosensory evoked potentials.

    Science.gov (United States)

    Waterstraat, Gunnar; Scheuermann, Manuel; Curio, Gabriel

    2016-03-01

    Somatosensory evoked potentials (SEPs) around 600 Hz ('σ-bursts') are correlates of cortical population spikes. Recently, single-trial σ-bursts were detected in human scalp EEG using 29-channel low-noise recordings in an electromagnetically shielded room. To achieve clinical applicability, this study aimed to establish a protocol using only 8 EEG channels in an unshielded environment and to quantify the variability of σ-bursts. Median nerve SEPs were recorded in 10 healthy subjects using a custom-built low-noise EEG amplifier. A detection algorithm for single-trial σ-bursts was trained as combination of spatio-temporal filters and a non-linear classifier. The single-trial responses were probed for the presence of significant increases of amplitude and variability. Single-trial σ-burst detection succeeded with Detection Rates and Positive Predictive Values above 80% in subjects with high SNR. A significant inter-trial variability in the amplitudes of early low-frequency SEPs and σ-bursts could be demonstrated. Single-trial σ-bursts can be detected on scalp-EEG using only 8 EEG channels in an electromagnetically disturbed environment. The combination of dedicated hardware and detection algorithms allows quantifying and describing their variability. The variability of population spikes in the human somatosensory cortex can be traced non-invasively in a clinical setting. Copyright © 2015 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  5. Does unrestrained single-chamber plethysmography provide a valid assessment of airway responsiveness in allergic BALB/c mice?

    Directory of Open Access Journals (Sweden)

    Chen Guoqin

    2009-07-01

    Full Text Available Abstract Background Unrestrained plethysmography has been used to monitor bronchoconstriction because of its ease of use and ability to measure airway responsiveness in conscious animals. However, its reliability remains controversial. Objective To investigate if unrestrained plethysmography could provide a valid interpretation of airway responsiveness in allergic BALB/c mice. Methods Ovalbumin sensitized BALB/c mice were randomized to receive either a single-dose Ovalbumin challenge (OVA-1D group or a three-dose Ovalbumin challenge (OVA-3D group. The OVA-1D group was further divided into OVA-1D-I (measured invasively, using lung resistance as the index of responsiveness and OVA-1D-N group (measured non-invasively, using Penh as the index of responsiveness. Similarly the OVA-3D group was divided into OVA-3D-I and OVA-3D-N groups based on the above methods. The control groups were sensitized and challenged with normal saline. Bronchial alveolar lavage fluid was taken and airway histopathology was evaluated for airway inflammation. Nasal responsiveness was tested with histamine challenge. Results Compared with controls, a significant increase in airway responsiveness was shown in the OVA-1D-N group (P Conclusion Penh can not be used as a surrogate for airway resistance. The invasive measurement is specific to lower airway. Penh measurement (done as a screening procedure, must be confirmed by a direct invasive measurement specific to lower airway in evaluating lower airway responsiveness.

  6. Differential activation behavior of dermal dendritic cells underlies the strain-specific Th1 responses to single epicutaneous immunization.

    Science.gov (United States)

    Lee, Chih-Hung; Chen, Jau-Shiuh; Chiu, Hsien-Ching; Hong, Chien-Hui; Liu, Ching-Yi; Ta, Yng-Cun; Wang, Li-Fang

    2016-12-01

    Epicutaneous immunization with allergens is an important sensitization route for atopic dermatitis. We recently showed in addition to the Th2 response following single epicutaneous immunization, a remarkable Th1 response is induced in B6 mice, but not in BALB/c mice, mimicking the immune response to allergens in human non-atopics and atopics. We investigated the underlying mechanisms driving this differential Th1 response between BALB/c and B6 mice. We characterized dermal dendritic cells by flow cytometric analysis. We measured the induced Th1/Th2 responses by measuring the IFN-γ/IL-13 contents of supernatants of antigen reactivation cultures of lymph node cells. We demonstrate that more dermal dendritic cells with higher activation status migrate into draining lymph nodes of B6 mice compared to BALB/c mice. Dermal dendritic cells of B6 mice have a greater ability to capture protein antigen than those of BALB/c mice. Moreover, increasing the activation status or amount of captured antigen in dermal dendritic cells induced a Th1 response in BALB/c mice. Further, differential activation behavior, but not antigen-capturing ability of dermal dendritic cells between BALB/c and B6 mice is dendritic cell-intrinsic. These results show that the differential activation behavior of dermal dendritic cells underlies the strain-specific Th1 responses following single epicutaneous immunization. Furthermore, our findings highlight the potential differences between human atopics and non-atopics and provide useful information for the prediction and prevention of atopic diseases. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  7. Reliability of estimating the room volume from a single room impulse response

    OpenAIRE

    Kuster, M.

    2008-01-01

    The methods investigated for the room volume estimation are based on geometrical acoustics, eigenmode, and diffuse field models and no data other than the room impulse response are available. The measurements include several receiver positions in a total of 12 rooms of vastly different sizes and acoustic characteristics. The limitations in identifying the pivotal specular reflections of the geometrical acoustics model in measured room impulse responses are examined both theoretically and expe...

  8. Switchgrass, Bermudagrass, Flaccidgrass, and Lovegrass biomass yield response to nitrogen for single and double harvest

    International Nuclear Information System (INIS)

    Aravindhakshan, Sijesh C.; Epplin, Francis M.; Taliaferro, Charles M.

    2011-01-01

    Switchgrass (Panicum virgatum) has been identified as a model dedicated energy crop species. After a perennial grass is established, the major variable costs are for nitrogen (N) fertilizer and harvest. Prior to establishing switchgrass on millions of ha in a particular agro-climatic region, it would be useful to determine switchgrass yield response to N and its response to harvest frequency relative to alternative grass species. The objective of this research is to determine biomass yield response to N for four perennial grass species and to determine the species, N level, and harvest frequency that will maximize expected net returns, given the climate and soils of the U.S.A. Southern Plains. Yield data were produced in an experiment that includes four species (switchgrass, bermudagrass (Cynodon dactylon), weeping lovegrass (Eragrostis curvula), and carostan flaccidgrass (Pennisetum flaccidum)), four N levels, and two harvest levels. Linear response plateau (LRP), linear response stochastic plateau (LRSP), and quadratic response (QR) functions are estimated. For all combinations of biomass and N prices considered, the optimal species is switchgrass. For most price situations, it is economically optimal to fertilize established stands of switchgrass with 69 kg N ha -1 yr -1 and to harvest once yr -1 after senescence. (author)

  9. Coherent non-linear optical response in SU(2) symmetry broken single and bilayer graphene

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Vipin, E-mail: k.vipin@iitg.ernet.in; Enamullah,; Kumar, Upendra; Setlur, Girish S.

    2014-03-01

    Anomalous Rabi oscillations in single and bilayer graphene, in the absence of time-reversal symmetry, are described. The main findings of this work are that intra-layer sublattice space asymmetry has a remarkable effect on anomalous Rabi frequency in single and bilayer graphene, namely it is offset by the asymmetry parameter. However, the conventional Rabi frequency is nearly independent of the asymmetry parameter. Inter-layer asymmetry in bilayer graphene has an even more significant effect on anomalous Rabi frequency. When inter-layer asymmetry is taken into account, the anomalous Rabi frequency versus the external field goes through a minimum. The induced current in the frequency domain in these systems shows a finite threshold behavior even for vanishingly small applied fields. These offset oscillations are attributable to the asymmetry parameter in these systems, and are observable only for weak applied fields. For stronger applied fields these phenomena tend towards those without asymmetry.

  10. Physical investigation of square cylinder array dynamical response under single-phase cross-flow

    International Nuclear Information System (INIS)

    Longatte, E.; Baj, F.

    2014-01-01

    Fluid structure interaction and flow-induced vibration in square cylinder arrangement under single-phase incompressible laminar cross flow are investigated in the present paper. Dynamic instability governed by damping generation is studied without any consideration about mixing with turbulence effects. Conservative and non-conservative effects are pointed out and dynamical stability limit sensitivity to physical parameters is analyzed. Finally the influence of key physical parameters on fluid solid dynamics interaction is quantified. (authors)

  11. Paradigm free mapping with sparse regression automatically detects single-trial functional magnetic resonance imaging blood oxygenation level dependent responses.

    Science.gov (United States)

    Caballero Gaudes, César; Petridou, Natalia; Francis, Susan T; Dryden, Ian L; Gowland, Penny A

    2013-03-01

    The ability to detect single trial responses in functional magnetic resonance imaging (fMRI) studies is essential, particularly if investigating learning or adaptation processes or unpredictable events. We recently introduced paradigm free mapping (PFM), an analysis method that detects single trial blood oxygenation level dependent (BOLD) responses without specifying prior information on the timing of the events. PFM is based on the deconvolution of the fMRI signal using a linear hemodynamic convolution model. Our previous PFM method (Caballero-Gaudes et al., 2011: Hum Brain Mapp) used the ridge regression estimator for signal deconvolution and required a baseline signal period for statistical inference. In this work, we investigate the application of sparse regression techniques in PFM. In particular, a novel PFM approach is developed using the Dantzig selector estimator, solved via an efficient homotopy procedure, along with statistical model selection criteria. Simulation results demonstrated that, using the Bayesian information criterion to select the regularization parameter, this method obtains high detection rates of the BOLD responses, comparable with a model-based analysis, but requiring no information on the timing of the events and being robust against hemodynamic response function variability. The practical operation of this sparse PFM method was assessed with single-trial fMRI data acquired at 7T, where it automatically detected all task-related events, and was an improvement on our previous PFM method, as it does not require the definition of a baseline state and amplitude thresholding and does not compromise on specificity and sensitivity. Copyright © 2011 Wiley Periodicals, Inc.

  12. The Response of CMS Combined Calorimeters to Single Hadrons, Electrons and Muons

    CERN Document Server

    Akchurin, Nural; Gumus, Kazim; Jeong Chi Young; Kim Hee Jong; Lee Sung Won; Roh, Youn; Volobouev, Igor; Wigmans, Richard

    2007-01-01

    We report on the response of the combined CMS electromagnetic (EB) and hadronic barrel (HB) calorimeters to hadrons, electrons and muons in a wide momentum range from 1 to 350 GeV/c. To our knowledge, this is the widest range of momenta in which any calorimeter system is studied. These tests, carried out at the H2 beam-line at CERN, provide a wealth of information, especially at low energies. We analyze in detail the differences in total calorimeter response to charged pions, kaons, protons and antiprotons and discuss the underlying phenomena. These data will play a crucial role in the thorough understanding of jets in CMS.

  13. Evaluation of gamma-ray response of Tm:BaF2 single crystals

    Czech Academy of Sciences Publication Activity Database

    Abe, N.; Yokota, Y.; Yanagida, T.; Kawaguchi, N.; Pejchal, Jan; Yoshikawa, A.

    2010-01-01

    Roč. 57, č. 3 (2010), s. 1304-1307 ISSN 0018-9499 Institutional research plan: CEZ:AV0Z10100521 Keywords : 5d – 4f emission * fluoride * gamma-ray response * VUV Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.519, year: 2010

  14. Effect of a single dose of levodopa on sexual response in men and women

    NARCIS (Netherlands)

    Both, Stephanie; Everaerd, Walter; Laan, Ellen; Gooren, Louis

    2005-01-01

    From animal research, there is ample evidence for a facilitating effect of dopamine on sexual behavior. In humans, little experimental research has been conducted on the inter-relation between dopamine and sexual response, even less so in women than in men. We investigated the effect of levodopa

  15. Clinical and histological responses of congenital melanocytic nevi after single treatment with Q-switched lasers

    NARCIS (Netherlands)

    Grevelink, JM; vanLeeuwen, RL; Anderson, RR; Byers, HR

    Background: Laser irradiation of congenital melanocytic nevi is a controversial treatment. Recurrence of lesions after laser treatment appears to be the rule, and the effects of laser irradiation on cellular biological behavior and the possible mutagenic responses of nevomelanocytes that have

  16. Geometrical factor and directional response of single and multi-element particle telescopes.

    Science.gov (United States)

    Sullivan, J. D.

    1971-01-01

    After a general treatment of the gathering power of particle telescopes, exact formulae are presented for the geometrical factor and directional response of multielement cylindrically symmetric telescopes with circular or rectangular cross sections. Some useful approximations to these formulae are given. For the gathering power in arbitrary geometries, there is a discussion of applicable digital computer techniques focusing particularly on a Monte Carlo method.

  17. Modulation of pain-induced neuromuscular trunk responses by pain expectations: a single group study.

    Science.gov (United States)

    Tétreau, Charles; Dubois, Jean-Daniel; Piché, Mathieu; Descarreaux, Martin

    2012-10-01

    The purpose of this study was to investigate the alteration of pain-induced neuromuscular trunk responses by expectations in healthy volunteers. Twenty-three asymptomatic participants performed series of flexion-extension movements in 3 different experimental conditions: innocuous heat stimulation (control) and noxious heat stimulation associated with expectations of low or high pain intensity. These stimuli were administered by a contact thermode placed over the lumbar region (L4 and L5) to assess the modulation of neuromuscular responses and kinematics during the flexion-extension task. Surface electromyography (EMG) of lumbar erector spinae at L2 and L3 and L4 and L5 as well as lumbopelvic kinematic variables were compared across conditions. Noxious stimulation significantly altered EMG responses but only in full trunk flexion. Interestingly, this alteration was significant only for muscles where noxious stimulation was applied (L4 and L5) and not for the other segment (L2 and L3). Conversely, expectations significantly altered EMG activity at L2 and L3 but not at the segment where noxious stimulation was applied. These results confirm previous findings and indicate that experimental pain can alter neuromuscular responses during a trunk flexion-extension task. Furthermore, this study suggests that expectations can alter some of these alterations. Future studies should determine whether neuromuscular changes induced by expectations may contribute to the transition from acute to chronic low-back pain. Copyright © 2012 National University of Health Sciences. Published by Mosby, Inc. All rights reserved.

  18. Redefining Roles and Responsibilities: Implementing a Triage Reference Model at a Single Service Point

    Science.gov (United States)

    LaMagna, Michael; Hartman-Caverly, Sarah; Marchetti, Lori

    2016-01-01

    As academic institutions continue to renovate and remodel existing libraries to include colocated services, it is important to understand how this new environment requires the redefining of traditional library roles and responsibilities. This case study examines how Delaware County Community College redefined reference and research service by…

  19. Response of upland oak and co-occurring competitor seedlings following single and repeated prescribed fires

    Science.gov (United States)

    Heather D. Alexander; Mary Arthur; David Loftis; Stephanie Green

    2009-01-01

    Studies within and outside the United States indicate recurring oak (Quercus spp.) regeneration problems. In deciduous forests of the eastern U.S., a prevailing explanation for this trend is that fire suppression leads to high competitor abundance and low understory light. In response, prescribed fire is increasingly used as a management tool to...

  20. Reliability of estimating the room volume from a single room impulse response

    NARCIS (Netherlands)

    Kuster, M.

    2008-01-01

    The methods investigated for the room volume estimation are based on geometrical acoustics, eigenmode, and diffuse field models and no data other than the room impulse response are available. The measurements include several receiver positions in a total of 12 rooms of vastly different sizes and

  1. Circular revisit orbits design for responsive mission over a single target

    Science.gov (United States)

    Li, Taibo; Xiang, Junhua; Wang, Zhaokui; Zhang, Yulin

    2016-10-01

    The responsive orbits play a key role in addressing the mission of Operationally Responsive Space (ORS) because of their capabilities. These capabilities are usually focused on supporting specific targets as opposed to providing global coverage. One subtype of responsive orbits is repeat coverage orbit which is nearly circular in most remote sensing applications. This paper deals with a special kind of repeating ground track orbit, referred to as circular revisit orbit. Different from traditional repeat coverage orbits, a satellite on circular revisit orbit can visit a target site at both the ascending and descending stages in one revisit cycle. This typology of trajectory allows a halving of the traditional revisit time and does a favor to get useful information for responsive applications. However the previous reported numerical methods in some references often cost lots of computation or fail to obtain such orbits. To overcome this difficulty, an analytical method to determine the existence conditions of the solutions to revisit orbits is presented in this paper. To this end, the mathematical model of circular revisit orbit is established under the central gravity model and the J2 perturbation. A constraint function of the circular revisit orbit is introduced, and the monotonicity of that function has been studied. The existent conditions and the number of such orbits are naturally worked out. Taking the launch cost into consideration, optimal design model of circular revisit orbit is established to achieve a best orbit which visits a target twice a day in the morning and in the afternoon respectively for several days. The result shows that it is effective to apply circular revisit orbits in responsive application such as reconnoiter of natural disaster.

  2. Effect of residual stress on the nanoindentation response of (100) copper single crystal

    International Nuclear Information System (INIS)

    Zhu, Li-na; Xu, Bin-shi; Wang, Hai-dou; Wang, Cheng-biao

    2012-01-01

    Experimental measurements were used to investigate the effect of residual stress on the nanoindentation of (100) copper single crystal. Equi-biaxial tensile and compressive stresses were applied to the copper single crystal using a special designed apparatus. It was found that residual stresses greatly affected peak load, curvature of the loading curve, elastically recovered depth, residual depth, indentation work, pile-up amount and contact area. The Suresh and Giannakopoulos and Lee and Kwon methods were used to calculate the residual stresses from load-depth data and morphology observation of nanoindents using atomic force microscopy. Comparison of the obtained results with stress values from strain gage showed that the residual stresses analyzed from the Suresh and Giannakopoulos model agreed well with the applied stresses. -- Highlights: ► Residual stresses greatly affected various nanoindentation parameters. ► The contact area can be accurately measured from AFM observation. ► The residual stresses analyzed from the S and G model agreed well with applied stresses.

  3. Decoding of single-trial auditory mismatch responses for online perceptual monitoring and neurofeedback

    Directory of Open Access Journals (Sweden)

    Alex eBrandmeyer

    2013-12-01

    Full Text Available Multivariate pattern classification methods are increasingly applied to neuroimaging data in the context of both fundamental research and in brain-computer interfacing approaches. Such methods provide a framework for interpreting measurements made at the single-trial level with respect to a set of two or more distinct mental states. Here, we define an approach in which the output of a binary classifier trained on data from an auditory mismatch paradigm can be used for online tracking of perception and as a neurofeedback signal. The auditory mismatch paradigm is known to induce distinct perceptual states related to the presentation of high- and low-probability stimuli, which are reflected in event-related potential (ERP components such as the mismatch negativity (MMN. In the first part of the paper, we illustrate how pattern classification methods can be applied to data collected in an MMN paradigm, including discussion of the optimization of preprocessing steps, the interpretation of features and how the performance of these methods generalizes across individual participants and measurement sessions. We then go on to show that the output of these decoding methods can be used in online settings as a continuous index of single-trial brain activation underlying perceptual discrimination. We conclude by discussing several potential domains of application, including neurofeedback, cognitive monitoring and passive brain-computer interfaces.

  4. Highly efficient electrochemical responses on single crystalline ruthenium-vanadium mixed metal oxide nanowires.

    Science.gov (United States)

    Chun, Sung Hee; Choi, Hyun-A; Kang, Minkyung; Koh, Moonjee; Lee, Nam-Suk; Lee, Sang Cheol; Lee, Minyung; Lee, Youngmi; Lee, Chongmok; Kim, Myung Hwa

    2013-09-11

    Highly efficient single crystalline ruthenium-vanadium mixed metal oxide (Ru1-xVxO2, 0≤x≤1) nanowires were prepared on a SiO2 substrate and a commercial Au microelectrode for the first time through a vapor-phase transport process by adjusting the mixing ratios of RuO2 and VO2 precursors. Single crystalline Ru1-xVxO2 nanowires show homogeneous solid-solution characteristics as well as the distinct feature of having remarkably narrow dimensional distributions. The electrochemical observations of a Ru1-xVxO2 (x=0.28 and 0.66)-decorated Au microelectrode using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) demonstrate favorable charge-transfer kinetics of [Fe(CN)6]3-/4- and Ru(NH3)6(3+/2+) couples compared to that of a bare Au microelectrode. The catalytic activity of Ru1-xVxO2 for oxygen and H2O2 reduction at neutral pH increases as the fraction of vanadium increases within our experimental conditions, which might be useful in the area of biofuel cells and biosensors.

  5. Synaptic and intrinsic homeostasis cooperate to optimize single neuron response properties and tune integrator circuits

    Science.gov (United States)

    2016-01-01

    Homeostatic processes that provide negative feedback to regulate neuronal firing rate are essential for normal brain function, and observations suggest that multiple such processes may operate simultaneously in the same network. We pose two questions: why might a diversity of homeostatic pathways be necessary, and how can they operate in concert without opposing and undermining each other? To address these questions, we perform a computational and analytical study of cell-intrinsic homeostasis and synaptic homeostasis in single-neuron and recurrent circuit models. We demonstrate analytically and in simulation that when two such mechanisms are controlled on a long time scale by firing rate via simple and general feedback rules, they can robustly operate in tandem to tune the mean and variance of single neuron's firing rate to desired goals. This property allows the system to recover desired behavior after chronic changes in input statistics. We illustrate the power of this homeostatic tuning scheme by using it to regain high mutual information between neuronal input and output after major changes in input statistics. We then show that such dual homeostasis can be applied to tune the behavior of a neural integrator, a system that is notoriously sensitive to variation in parameters. These results are robust to variation in goals and model parameters. We argue that a set of homeostatic processes that appear to redundantly regulate mean firing rate may work together to control firing rate mean and variance and thus maintain performance in a parameter-sensitive task such as integration. PMID:27306675

  6. Frequency of single nucleotide polymorphisms of some immune response genes in a population sample from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Léa Campos de Oliveira

    2011-09-01

    Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.

  7. The jejunal cellular responses in chickens infected with a single dose of Ascaridia galli eggs

    DEFF Research Database (Denmark)

    Luna Olivares, Luz Adilia; Kyvsgaard, Niels Christian; Ferdushy, Tania

    2015-01-01

    This histopathological study was carried out in order to investigate the cellular response in the jejunum to Ascaridia galli during the first 7 weeks of infection. Fourty-two ISA Brown chickens (7 weeks old) were infected orally with 500 embryonated A. galli eggs each while 28 chickens were left...... to uninfected at 3, 7, 10, 14 and 28 dpi (P cells was high, but this high level of mast cells remained for a longer period in the infected group compared to the control group. Significantly higher counts were thus found in the infected group at 21 (P ..., A. galli larvae have elicited a moderate cellular response in the lamina propria, mainly consisting of eosinophils in the early phase and later of mast cells....

  8. Envelope Responses in Single-trial EEG Indicate Attended Speaker in a Cocktail Party

    Science.gov (United States)

    2014-06-25

    1Department of Cognitive Sciences, University of California, Irvine, CA 92697, USA 2Department of Biomedical Engineering, University of California, Irvine...lateralization, steady-state responses (Some figures may appear in colour only in the online journal) 1. Introduction A great deal of effort has been devoted to...S) AND ADDRESS(ES) University of California, Irvine,Department of Cognitive Sciences,Irvine,CA,92697 8. PERFORMING ORGANIZATION REPORT NUMBER 9

  9. Differential responses to radiation and hyperthermia of cloned cell lines derived from a single human melanoma xenograft

    International Nuclear Information System (INIS)

    Rofstad, E.K.; Brustad, T.

    1984-01-01

    One uncloned and five cloned cell lines were derived from a single human melanoma xenograft. Cells from passages 7-12 were exposed to either radiation or hyperthermia (42.5 0 C, pH = 7.4) under aerobic conditions and the colony forming ability of the cells was assayed in soft agar. The five cloned lines showed individual and characteristic responses to radiation as well as to hyperthermia. The variation in the response to radiation was mainly reflected in the size of the shoulders of the survival curves rather than in the D 0 -values. The variation in the response to hyperthermia was mainly reflected in the terminal slopes of the survival curves. The survival curve of cells from the uncloned line, both when exposed to radiation and hyperthermia, was positioned in the midst of those of the cloned lines. The response of the cloned lines to radiation did not correlate with the response to hyperthermia, indicating that tumor cell subpopulations which are resistant to radiation may respond well to hyperthermia

  10. An Influence of Gas Explosions on Dynamic Responses of a Single Degree of Freedom Model

    Directory of Open Access Journals (Sweden)

    Ki-Yeob Kang

    2016-01-01

    Full Text Available Explosion risk analysis (ERA is widely used to derive the dimensioning of accidental loads for design purposes. Computational fluid dynamics (CFD simulations contribute a key part of an ERA and predict possible blast consequences in a hazardous area. Explosion pressures can vary based on the model geometry, the explosion intensity, and explosion scenarios. Dynamic responses of structures under these explosion loads are dependent on a blast wave profile with respect to the magnitude of pressure, duration, and impulse in both positive and negative phases. Understanding the relationship between explosion load profiles and dynamic responses of the target area is important to mitigate the risk of explosion and perform structural design optimization. In the present study, the results of more than 3,000 CFD simulations were considered, and 1.6 million output files were analyzed using a visual basic for applications (VBA tool developed to characterize representative loading shapes. Dynamic response of a structure was investigated in both time and frequency domains using the Fast Fourier Transform (FFT algorithm. In addition, the effects of the residual wave and loading velocity were studied in this paper.

  11. Responses of horses offered a choice between stables containing single or multiple forages.

    Science.gov (United States)

    Goodwin, D; Davidson, H P B; Harris, P

    2007-04-21

    To investigate the choices of foraging location of horses, 10 to 12 horses were introduced for five minutes into each of two similar stables containing a single forage or six forages, in four replicated trials. The horses were then removed and released into the gangway between the stables, and allowed five minutes to choose between the stables. Their initial and final choices, mean duration in each stable and proportional frequency of change of location were compared. Most of the horses initially entered the closest stable on release (Pforages (Pforages in multiple locations (Pforage was available in both stables, possibly indicating a motivation to move between foraging locations regardless of the palatability of the forages offered or the horses' preference for a forage.

  12. Effects of single moor baths on physiological stress response and psychological state: a pilot study

    Science.gov (United States)

    Stier-Jarmer, M.; Frisch, D.; Oberhauser, C.; Immich, G.; Kirschneck, M.; Schuh, A.

    2017-11-01

    Moor mud applications in the form of packs and baths are widely used therapeutically as part of balneotherapy. They are commonly given as therapy for musculoskeletal disorders, with their thermo-physical effects being furthest studied. Moor baths are one of the key therapeutic elements in our recently developed and evaluated 3-week prevention program for subjects with high stress level and increased risk of developing a burnout syndrome. An embedded pilot study add-on to this core project was carried out to assess the relaxing effect of a single moor bath. During the prevention program, 78 participants received a total of seven moor applications, each consisting of a moor bath (42 °C, 20 min, given between 02:30 and 05:20 p.m.) followed by resting period (20 min). Before and after the first moor application in week 1, and the penultimate moor application in week 3, salivary cortisol was collected, blood pressure and heart rate were measured, and mood state (Multidimensional Mood State Questionnaire) was assessed. A Friedman test of differences among repeated measures was conducted. Post hoc analyses were performed using the Wilcoxon signed-rank test. A significant decrease in salivary cortisol concentration was seen between pre- and post-moor bath in week 1 ( Z = -3.355, p = 0.0008). A non-significant decrease was seen between pre- and post-moor bath in week 3. Mood state improved significantly after both moor baths. This pilot study has provided initial evidence on the stress-relieving effects of single moor baths, which can be a sensible and recommendable therapeutic element of multimodal stress-reducing prevention programs. The full potential of moor baths still needs to be validated. A randomized controlled trial should be conducted comparing this balneo-therapeutic approach against other types of stress reduction interventions.

  13. Single neurons with both form/color differential responses and saccade-related responses in the nonretinotopic pulvinar of the behaving macaque monkey.

    Science.gov (United States)

    Benevento, L A; Port, J D

    1995-01-01

    The nonretinotopic portion of the macaque pulvinar complex is interconnected with the occipitoparietal and occipitotemporal transcortical visual systems where information about the location and motion of a visual object or its form and color are modulated by eye movements and attention. We recorded from single cells in and about the border of the dorsal portion of the lateral pulvinar and the adjacent medial pulvinar of awake behaving Macaca mulatta in order to determine how the properties of these two functionally dichotomous cortical systems were represented. We found a class of pulvinar neurons that responded differentially to ten different patterns or broadband wavelengths (colors). Thirty-four percent of cells tested responded to the presentation of at least one of the pattern or color stimuli. These cells often discharged to several of the patterns or colors, but responded best to only one or two of them, and 86% were found to have statistically significant pattern and/or color preferences. Pattern/color preferential cells had an average latency of 79.1 +/- 46.0 ms (range 31-186 ms), responding well before most inferotemporal cortical cell responses. Visually guided and memory-guided saccade tasks showed that 58% of pattern/color preferential cells also had saccade-related properties, e.g. directional presaccadic and postsaccadic discharges, and inhibition of activity during the saccade. In the pulvinar, the mean presacadic response latency was earlier, and the mean postsaccadic response latency was later, than those reported for parietal cortex. We also discovered that the strength of response to patterns or colors changed depending upon the behavioral setting. In comparison to trials in which the monkey fixated dead ahead during passive presentations of pattern and color stimuli, 92% of the cells showed attenuated responses to the same passive presentation of patterns and colors during fixation when these trials were interleaved with trials which also

  14. Example of a single national regulator responsible for both transport safety and security

    International Nuclear Information System (INIS)

    Karhu, P.; Lahkola, A.; Markkanen, M.; Hellstén, S.

    2016-01-01

    Safety and security in the use of nuclear energy and in the use of radiation, including the transport of nuclear and other radioactive material, share a common objective: to protect people, society, environment, and future generations from the harmful effects of ionizing radiation. Some measures for safety contribute to those for security, and vice versa, while some requirements of one conflict with those of the other. The differences in the requirements arise from the difference in the threat against which the measures are designed: accident vs. intent. A coordinated approach endeavours to take advantage of the similarities and to avoid the problems caused by the differences. One way to implement it is to have one competent authority responsible for the regulatory control of safety and security. It is the experience in Finland that this enables an efficient regulatory system. From the operators’ point of view, a one-stop shop regulatory authority ensures that requirements for safety and security are consistent. Both safety and security require the involvement of and cooperation between several authorities—regulatory, rescue, law enforcement—and operators. The approach in Finland is built on cooperation and a clear division of competences and responsibilities. One regulatory authority provides a fixed point of contact within the professional cooperation network as well as for the public. The one regulatory authority is also easily identifiable, as appropriate, as a point of contact in international cooperation in implementing nuclear and radiation safety and security. Whatever the national regulatory framework and the assignment of responsibilities between authorities, cooperation is essential in house, nationally, and internationally. (author)

  15. Assessment of Damage in Seismically Excited RC-Structures from a Single Measured Response

    DEFF Research Database (Denmark)

    Skjærbæk, P. S.; Nielsen, Søren R. K.; Cakmak, A. S.

    1996-01-01

    for RC-frames which also admits an estimation of local damage. Based on the response time series calculated by the finite element programme, the corresponding local damages are next calculated by the present method. The method is investigated at different intensities of the earthquake and upon comparison...... with the finite element predictions it is found that the method is very efficient in localizing the damage when the damage level is sufficiently high. Furthermore, it has been experienced that the method seems to get slightly more inaccurate with increasingly structural complexity, i.e. the damage localization...

  16. Assessment of Damage in Seismically Excited RC-Structures from a Single Measured Response

    DEFF Research Database (Denmark)

    Skjærbæk, P. S.; Nielsen, Søren R.K.; Cakmak, A. S.

    for RC-frames which also admits an estimation of local damage. Based on the response time series calculated by the finite element programme, the corresponding local damages are next calculated by the present method. The method is investigated at different intensities of the earthquake and upon comparison...... with the finite element predictions it is found that the method is very efficient in localizing the damage when the damage level is sufficiently high. Furthermore, it has been experienced that the method seems to get slightly more inaccurate with increasingly structural complexity, i.e. the damage localization...

  17. The Effect of Single-Level Disc Degeneration on Dynamic Response of the Whole Lumbar Spine to Vertical Vibration.

    Science.gov (United States)

    Guo, Li-Xin; Fan, Wei

    2017-09-01

    The objective of this study was to investigate the effect of single-level disc degeneration on dynamic response of the whole lumbar spine to vertical whole body vibration that is typically present when driving vehicles. Ligamentous finite element models of the lumbar L1-S1 motion segment in different grades of degeneration (healthy, mild, and moderate) at the L4-L5 level were developed with consideration of changing disc height and material properties of the nucleus pulpous. All models were loaded with a compressive follower preload of 400 N and a sinusoidal vertical vibration load of ±40 N. After transient dynamic analyses, computational results for the 3 models in terms of disc bulge, von-Mises stress in annulus ground substance, and nucleus pressure were plotted as a function of time and compared. All the predicted results showed a cyclic response with time. At the degenerated L4-L5 disc level, as degeneration progressed, maximum value of the predicted response showed a decrease in disc bulge and von-Mises stress in annulus ground substance but a slight increase in nucleus pressure, and their vibration amplitudes were all decreased. At the adjacent levels of the degenerated disc, there was a slight decrease in maximum value and vibration amplitude of these predicted responses with the degeneration. The results indicated that single-level disc degeneration can alter vibration characteristics of the whole lumbar spine especially for the degenerated disc level, and increasing the degeneration did not deteriorate the effect of vertical vibration on the spine. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Transcriptome profiling and validation of gene based single nucleotide polymorphisms (SNPs) in sorghum genotypes with contrasting responses to cold stress.

    Science.gov (United States)

    Chopra, Ratan; Burow, Gloria; Hayes, Chad; Emendack, Yves; Xin, Zhanguo; Burke, John

    2015-12-09

    Sorghum is a versatile cereal crop, with excellent heat and drought tolerance. However, it is susceptible to early-season cold stress (12-15 °C) which limits stand-establishment and seedling growth. To gain further insights on the molecular mechanism of cold tolerance in sorghum we performed transcriptome profiling between known cold sensitive and tolerant sorghum lines using RNA sequencing technology under control and cold stress treatments. Here we report on the identification of differentially expressed genes (DEGs) between contrasting sorghum genotypes, HongkeZi (cold tolerant) and BTx623 (cold sensitive) under cool and control temperatures using RNAseq approach to elucidate the molecular basis of sorghum response to cold stress. Furthermore, we validated bi-allelic variants in the form of single nucleotide polymorphism (SNPs) between the cold susceptible and tolerant lines of sorghum. An analysis of transcriptome profile showed that in response to cold, a total of 1910 DEGs were detected under cold and control temperatures in both genotypes. We identified a subset of genes under cold stress for downstream analysis, including transcription factors that exhibit differential abundance between the sensitive and tolerant genotypes. We identified transcription factors including Dehydration-responsive element-binding factors, C-repeat binding factors, and Ethylene responsive transcription factors as significantly upregulated during cold stress in cold tolerant HKZ. Additionally, specific genes such as plant cytochromes, glutathione s-transferases, and heat shock proteins were found differentially regulated under cold stress between cold tolerant and susceptible genotype of sorghum. A total of 41,603 SNP were identified between the cold sensitive and tolerant genotypes with minimum read of four. Approximately 89 % of the 114 SNP sites selected for evaluation were validated using endpoint genotyping technology. A new strategy which involved an integrated analysis of

  19. Single and compound effects of radiation and microgravity responses in Caenorhabditis elegans

    Science.gov (United States)

    Wang, Wei; Sun, Yeqing; Xu, Dan; Yang, Jun; Luo, Yajing

    2016-07-01

    Space radiation and microgravity are main factors of spaceflight which could cause effects on organism. However, studies on the combined effects of microgravity and radiation have had conflicting results. For further elucidate the single factor effects of radiation or microgravity and the compound factor effects of them, the wild-type strain (Bristol N2) and muscle repair defective strain (dys-1) of Caenorhabditis elegansin dauer larvae were treated by ground simulated radiation in different doses (0.2Gy,2Gy) and/or 16.5-day simulated microgravity. The locomotory capacity assay and proteomic analysis were processed after the recovery of dauer larvae to adult. Locomotory capacity assay showed that the N2 nematodes were susceptible to simulated microgravity while dys-1 nematodes were susceptible to simulation radiation especially in high dose radiation (2Gy). The compound factor of microgravity and radiation has different influences to different strains. Proteomic results indicated that a wide range but different biological processes were involved in responding to radiation and/or microgravity.

  20. Responses of single germinal-center B cells in T-cell-dependent microculture.

    Science.gov (United States)

    George, A; Cebra, J J

    1991-01-01

    B cells purified from the germinal centers (GCs) of murine Peyer's patches can be stimulated in a clonal microculture containing helper T cells and dendritic cells to divide and secrete immunoglobulin. Intraclonal isotype switching occurs, and a variety of immunoglobulin isotypes, including IgA, is secreted. Memory cells, which generate clones secreting IgA exclusively, are only rarely identified in the GC B-cell subset. Such memory cells can, however, be readily identified among unfractionated Peyer's patch B cells, and in non-GC subsets of B cells. The results suggest that the GC does not contain IgA memory cells that can be restimulated in vitro to secrete only IgA. When division of GC B cells is prevented by irradiation or aphidicholin treatment, a large subset that secretes IgA as the sole immunoglobulin isotype is seen, and the output of presumably single B cells is large enough to be scored by RIA. Both helper T cells and dendritic cells are required for the phenomenon. The data indicate that commitment to IgA secretion occurs in Peyer's patch GCs and suggest that the prolific cell division known to be supported in GCs may forestall terminal differentiation of preplasmablasts to immunoglobulin secretion.

  1. Dynamics of the general factor of personality in response to a single dose of caffeine.

    Science.gov (United States)

    Caselles, Antonio; Micó, Joan C; Amigó, Salvador

    2011-11-01

    General Factor of Personality (GFP) research is an emergent field in personality research. This paper uses a theoretical mathematical model to predict the short-term effects of a dose of a stimulant drug on GFP and reports the results of an experiment showing how caffeine achieves this. This study considers the General Factor of Personality Questionnaire (GFPQ) a good psychometric approach to assess GFP. The GFP dynamic mechanism of change is based on the Unique Trait Personality Theory (UTPT). This theory proposes the existence of GFP which occupies the apex of the hierarchy of personality, and extends from an impulsiveness-and-aggressiveness pole (approach tendency) to an anxiety-and-introversion pole (avoidance tendency). An experiment with 25 volunteers was performed. All the participants completed the GFPQ and the Sensation-Seeking Scale list of adjectives from the trait version of MAACL-R (Multiple Affect Adjective Checklist Revised) on an empty stomach. The participants in the experimental group (20) received 330 mg of caffeine. All the participants filled in a state version form with the sensation-seeking adjectives every 4.5 minutes. This study considers that the Sensation-Seeking Scale list of adjectives from the MAACL-R, available in both trait and state versions, is a good psychometric approach to assess GFP. The results show that GFP is modified by a single dose of caffeine in the direction predicted by the UTPT.

  2. Is the Fundamental Electrical Response of the Single Heart Muscle Cell a Spike Potential?

    Science.gov (United States)

    Churney, Leon; Ohshima, Hisashi

    1963-01-01

    The urodele amphibians, Amphiuma and Necturus, provide heart fibers large enough to serve for microelectrode recording under visual control with the microscope. Bundles containing as few as 5 to 10 fibers yield spike potentials, rather than the plateau forms generally considered to be characteristic of heart muscle. These spikes fail to overshoot. The plateau form, and only the plateau form, is recorded exclusively from large tissue masses. An intermingling of spikes and plateau-shaped action potentials is obtained from bundles of intermediate size. These data are confirmed in experiments in which the myocardium is sliced into adhering strips of unequal sizes. The conclusion is drawn that the configuration of the recorded action potential curve is contingent upon the mass and geometry of the tissue impaled by the microelectrode. The crucial experiment of recording from an isolated single heart fiber is not possible, because of the attendant injury. Our proposal that the spike form is the elemental heart action potential is, to this extent, an extrapolation. Attempts to explain the nature of the spike along classical lines are not entirely satisfactory. Other theories are considered which, in their turn, are generally unacceptable. Evidently only further experimentation can clarify the situation. PMID:14021260

  3. A redox responsive, fluorescent supramolecular metallohydrogel consists of nanofibers with single-molecule width

    KAUST Repository

    Zhang, Ye

    2013-04-03

    The integration of a tripeptide derivative, which is a versatile self-assembly motif, with a ruthenium(II)tris(bipyridine) complex affords the first supramolecular metallo-hydrogelator that not only self assembles in water to form a hydrogel but also exhibits gel-sol transition upon oxidation of the metal center. Surprisingly, the incorporation of the metal complex in the hydrogelator results in the nanofibers, formed by the self-assembly of the hydrogelator in water, to have the width of a single molecule of the hydrogelator. These results illustrate that metal complexes, besides being able to impart rich optical, electronic, redox, or magnetic properties to supramolecular hydrogels, also offer a unique geometrical control to prearrange the self-assembly motif prior to self-assembling. The use of metal complexes to modulate the dimensionality of intermolecular interactions may also help elucidate the interactions of the molecular nanofibers with other molecules, thus facilitating the development of supramolecular hydrogel materials for a wide range of applications. © 2013 American Chemical Society.

  4. Silicon spectral response extension through single wall carbon nanotubes in hybrid solar cells

    KAUST Repository

    Del Gobbo, Silvano

    2013-01-01

    Photovoltaic devices based on single wall carbon nanotubes (SWCNTs) and n-silicon multiple heterojunctions have been fabricated by a SWCNT film transferring process. We report on the ability of the carbon nanotubes to extend the Si spectral range towards the near ultraviolet (UV) and the near infrared regions. Semiconducting and about metallic SWCNT networks have been studied as a function of the film sheet resistance, Rsh. Optical absorbance and Raman spectroscopy have been used to assign nanotube chirality and electronic character. This gave us hints of evidence of the participation of the metal nanotubes in the photocurrent generation. Moreover, we provide evidence that the external quantum efficiency spectral range can be modulated as a function of the SWCNT network sheet resistance in a hybrid SWCNT/Si solar cell. This result will be very useful to further design/optimize devices with improved performance in spectral regions generally not covered by conventional Si p-n devices. © 2013 The Royal Society of Chemistry.

  5. Effect of Saline Solution on the Electrical Response of Single Wall Carbon Nanotubes-Epoxy Nanocomposites

    Directory of Open Access Journals (Sweden)

    Hammad Younes

    2017-01-01

    Full Text Available The effects of saline solution on the electrical resistance of single wall carbon nanotubes-epoxy nanocomposites have been investigated experimentally. Ultrasonic assisted fabricated 1.0% and 0.5 W/W% SWCNTs epoxy nanocomposites are integrated into a Kelvin structure by smear cast the nanocomposites on a glass wafer. Four metal pads are deposited on the nanocomposites using the beam evaporator and wires are tethered using soldering. The effect of saline solution on the electrical resistance of the nanocomposites is studied by adding drop of saline solution to the surface of the fabricated nanocomposites and measuring electrical resistance. Moreover, the nanocomposites are soaked completely into 3 wt.% saline solution and real-time measurement of the electrical resistance is conducted. It is found that a drop of saline solution on the surface of the nanocomposites film increases the resistance by 50%. Furthermore, the real-time measurement reveals a 40% increase in the resistance of the nanocomposites film. More importantly, the nanocomposites are successfully reset by soaking in DI water for four hours. This study may open the door for using SWCNTs epoxy nanocomposites as scale sensors in oil and gas industry.

  6. Photovoltaic response and values of state dipole moments in single-layered pyrazoloquinoline/polymer composites

    Science.gov (United States)

    Gondek, E.; Kityk, I. V.; Danel, A.; Sanetra, J.

    2008-06-01

    We report the photovoltaic response of composite films formed by polymer transport matrices poly(3-octylthiophene) (P3OT) and poly(3-decylthiophene) (PDT) with incorporated 1 H-pyrazolo[3,4- b]quinoline (PAQ) chromophore (see the first figure). The photovoltage (PV) data were obtained for different substituted PAQ possessing different state dipole moments. The photovoltaic cells were formed between ITO and aluminum electrodes. We found that the PV signal of polymer/PAQ substantially depends on the state dipole moments of the pyrazoloquinoline chromophore. This fact indicates on a possibility of significant enhancement of PV efficiency by appropriate variations of the state dipole moments of chromophore. This results in photoinduced electron transfer from polymer serving as donors to PAQ being the electron acceptor. Despite an efficiency of the PV devices is below 1%, however, it may be substantially enhanced in future varying the chromophore state dipole moments appropriately.

  7. Optimized Energy Management of a Single-House Residential Micro-Grid With Automated Demand Response

    DEFF Research Database (Denmark)

    Anvari-Moghaddam, Amjad; Monsef, Hassan; Rahimi-Kian, Ashkan

    2015-01-01

    In this paper, an intelligent multi-objective energy management system (MOEMS) is proposed for applications in residential LVAC micro-grids where households are equipped with smart appliances, such as washing machine, dishwasher, tumble dryer and electric heating and they have the capability to t...... to reduce residential energy use and improve the user’s satisfaction degree by optimal management of demand/generation sides.......In this paper, an intelligent multi-objective energy management system (MOEMS) is proposed for applications in residential LVAC micro-grids where households are equipped with smart appliances, such as washing machine, dishwasher, tumble dryer and electric heating and they have the capability...... to take part in demand response (DR) programs. The superior performance and efficiency of the proposed system is studied through several scenarios and case studies and validated in comparison with the conventional models. The simulation results demonstrate that the proposed MOEMS has the capability...

  8. Single Cell Responses to Spatially Controlled Photosensitized Production of Extracellular Singlet Oxygen

    DEFF Research Database (Denmark)

    Pedersen, Brian Wett; Sinks, Louise E.; Breitenbach, Thomas

    2011-01-01

    The response of individual HeLa cells to extracellularly produced singlet oxygen was examined. The spatial domain of singlet oxygen production was controlled using the combination of a membrane-impermeable Pd porphyrin-dendrimer, which served as a photosensitizer, and a focused laser, which served...... to localize the sensitized production of singlet oxygen. Cells in close proximity to the domain of singlet oxygen production showed morphological changes commonly associated with necrotic cell death. The elapsed post-irradiation “waiting period” before necrosis became apparent depended on (a) the distance...... between the cell membrane and the domain irradiated, (b) the incident laser fluence and, as such, the initial concentration of singlet oxygen produced, and (c) the lifetime of singlet oxygen. The data imply that singlet oxygen plays a key role in this process of light-induced cell death. The approach...

  9. A single night light exposure acutely alters hormonal and metabolic responses in healthy participants

    Directory of Open Access Journals (Sweden)

    Mohammed S Albreiki

    2017-01-01

    Full Text Available Many animal studies have reported an association between melatonin suppression and the disturbance of metabolic responses; yet, few human studies have investigated bright light effects on metabolic and hormonal responses at night. This study investigated the impact of light on plasma hormones and metabolites prior to, and after, an evening meal in healthy participants. Seventeen healthy participants, 8 females (22.2 ± 2.59 years, mean ± s.d. and 9 males (22.8 ± 3.5 years were randomised to a two-way cross-over design protocol; dim light (DL (500 lux sessions, separated by at least seven days. Saliva and plasma samples were collected prior to and after a standard evening meal at specific intervals. Plasma non-esterified fatty acid (NEFA levels were significantly higher pre-meal in DL compared to BL (P < 0.01. Plasma glucose and insulin levels were significantly greater post-meal in the BL compared to DL session (P = 0.02, P = 0.001, respectively. Salivary melatonin levels were significantly higher in the DL compared to those in BL session (P = 0.005. BL at night was associated with significant increases in plasma glucose and insulin suggestive of glucose intolerance and insulin insensitivity. Raised pre-prandial NEFA levels may be due to changes in insulin sensitivity or the presence of melatonin and/or light at night. Plasma triglyceride (TAG levels were the same in both sessions. These results may explain some of the health issues reported in shift workers; however, further studies are needed to elucidate the cause of these metabolic changes.

  10. Response of cardiac autonomic modulation after a single exposure to musical auditory stimulation.

    Science.gov (United States)

    Ferreira, Lucas L; Vanderlei, Luiz Carlos M; Guida, Heraldo L; de Abreu, Luiz Carlos; Garner, David M; Vanderlei, Franciele M; Ferreira, Celso; Valenti, Vitor E

    2015-01-01

    The acute effects after exposure to different styles of music on cardiac autonomic modulation assessed through heart rate variability (HRV) analysis have not yet been well elucidated. We aimed to investigate the recovery response of cardiac autonomic modulation in women after exposure to musical auditory stimulation of different styles. The study was conducted on 30 healthy women aged between 18 years and 30 years. We did not include subjects having previous experience with musical instruments and those who had an affinity for music styles. The volunteers remained at rest for 10 min and were exposed to classical baroque (64-84 dB) and heavy metal (75-84 dB) music for 10 min, and their HRV was evaluated for 30 min after music cessation. We analyzed the following HRV indices: Standard deviation of normal-to-normal (SDNN) intervals, root mean square of successive differences (RMSSD), percentage of normal-to-normal 50 (pNN50), low frequency (LF), high frequency (HF), and LF/HF ratio. SDNN, LF in absolute units (ms 2 ) and normalized (nu), and LF/HF ratio increased while HF index (nu) decreased after exposure to classical baroque music. Regarding the heavy metal music style, it was observed that there were increases in SDNN, RMSSD, pNN50, and LF (ms 2 ) after the musical stimulation. In conclusion, the recovery response of cardiac autonomic modulation after exposure to auditory stimulation with music featured an increased global activity of both systems for the two musical styles, with a cardiac sympathetic modulation for classical baroque music and a cardiac vagal tone for the heavy metal style.

  11. Both COMT Val158Met single nucleotide polymorphism and sex-dependent differences influence response inhibition

    Directory of Open Access Journals (Sweden)

    Valentina eMione

    2015-05-01

    Full Text Available Reactive and proactive control of actions are cognitive abilities that allow to deal with a continuously changing environment by adjusting already programmed actions. They also set forthcoming acts by evaluating the outcome of the previous ones. Earlier studies highlighted sex related differences in the strategies and in the pattern of brain activation during cognitive tasks involving reactive and proactive control. To further identify sex-dependent characteristics in the cognitive control of actions, in this study we have assessed whether/how differences in reactive and proactive control were modulated by the COMT Val158Met single nucleotide polymorphism, a genetic factor known to influence the functionality of the dopaminergic system, in particular at the level of prefrontal cortex. Two groups of male and female participants were further sorted according to their genotype (Val/Met, Val/Val and Met/Met and tested in a stop signal task, a consolidated tool to measure reactive and proactive control in experimental and clinical settings. In each group of participants we estimated both a measure of the capacity to react to unexpected events and the ability of monitoring their performance. The between groups comparison of these measures indicated a poorer ability of male individuals carrying the Val/Val genotype in error-monitoring, suggesting that differences between sexes could be influenced by the efficiency of COMT and that other sex-specific factors have to be considered. The comprehension of inter-groups behavioral and physiological correlates of cognitive control will provide more accurate diagnostic tools for predicting the incidence and the development of pathologies like ADHD or deviant behaviors as drug or alcohol abuse.

  12. Collection-limited theory interprets the extraordinary response of single semiconductor organic solar cells

    Science.gov (United States)

    Ray, Biswajit; Baradwaj, Aditya G.; Khan, Mohammad Ryyan; Boudouris, Bryan W.; Alam, Muhammad Ashraful

    2015-01-01

    The bulk heterojunction (BHJ) organic photovoltaic (OPV) architecture has dominated the literature due to its ability to be implemented in devices with relatively high efficiency values. However, a simpler device architecture based on a single organic semiconductor (SS-OPV) offers several advantages: it obviates the need to control the highly system-dependent nanoscale BHJ morphology, and therefore, would allow the use of broader range of organic semiconductors. Unfortunately, the photocurrent in standard SS-OPV devices is typically very low, which generally is attributed to inefficient charge separation of the photogenerated excitons. Here we show that the short-circuit current density from SS-OPV devices can be enhanced significantly (∼100-fold) through the use of inverted device configurations, relative to a standard OPV device architecture. This result suggests that charge generation may not be the performance bottleneck in OPV device operation. Instead, poor charge collection, caused by defect-induced electric field screening, is most likely the primary performance bottleneck in regular-geometry SS-OPV cells. We justify this hypothesis by: (i) detailed numerical simulations, (ii) electrical characterization experiments of functional SS-OPV devices using multiple polymers as active layer materials, and (iii) impedance spectroscopy measurements. Furthermore, we show that the collection-limited photocurrent theory consistently interprets typical characteristics of regular SS-OPV devices. These insights should encourage the design and OPV implementation of high-purity, high-mobility polymers, and other soft materials that have shown promise in organic field-effect transistor applications, but have not performed well in BHJ OPV devices, wherein they adopt less-than-ideal nanostructures when blended with electron-accepting materials. PMID:26290582

  13. Collection-limited theory interprets the extraordinary response of single semiconductor organic solar cells.

    Science.gov (United States)

    Ray, Biswajit; Baradwaj, Aditya G; Khan, Mohammad Ryyan; Boudouris, Bryan W; Alam, Muhammad Ashraful

    2015-09-08

    The bulk heterojunction (BHJ) organic photovoltaic (OPV) architecture has dominated the literature due to its ability to be implemented in devices with relatively high efficiency values. However, a simpler device architecture based on a single organic semiconductor (SS-OPV) offers several advantages: it obviates the need to control the highly system-dependent nanoscale BHJ morphology, and therefore, would allow the use of broader range of organic semiconductors. Unfortunately, the photocurrent in standard SS-OPV devices is typically very low, which generally is attributed to inefficient charge separation of the photogenerated excitons. Here we show that the short-circuit current density from SS-OPV devices can be enhanced significantly (∼100-fold) through the use of inverted device configurations, relative to a standard OPV device architecture. This result suggests that charge generation may not be the performance bottleneck in OPV device operation. Instead, poor charge collection, caused by defect-induced electric field screening, is most likely the primary performance bottleneck in regular-geometry SS-OPV cells. We justify this hypothesis by: (i) detailed numerical simulations, (ii) electrical characterization experiments of functional SS-OPV devices using multiple polymers as active layer materials, and (iii) impedance spectroscopy measurements. Furthermore, we show that the collection-limited photocurrent theory consistently interprets typical characteristics of regular SS-OPV devices. These insights should encourage the design and OPV implementation of high-purity, high-mobility polymers, and other soft materials that have shown promise in organic field-effect transistor applications, but have not performed well in BHJ OPV devices, wherein they adopt less-than-ideal nanostructures when blended with electron-accepting materials.

  14. Response of single leukemic cells to peptidase inhibitor therapy across time and dose using a microfluidic device.

    Science.gov (United States)

    Kovarik, Michelle L; Dickinson, Alexandra J; Roy, Pourab; Poonnen, Ranjit A; Fine, Jason P; Allbritton, Nancy L

    2014-02-01

    Single-cell methodologies are revealing cellular heterogeneity in numerous biological processes and pathologies. For example, cancer cells are characterized by substantial heterogeneity in basal signaling and in response to perturbations, such as drug treatment. In this work, we examined the response of 678 individual U937 (human acute myeloid leukemia) cells to an aminopeptidase-inhibiting chemotherapeutic drug (Tosedostat) over the course of 95 days. Using a fluorescent reporter peptide and a microfluidic device, we quantified the rate of reporter degradation as a function of dose. While the single-cell measurements reflected ensemble results, they added a layer of detail by revealing unique degradation patterns and outliers within the larger population. Regression modeling of the data allowed us to quantitatively explore the relationships between reporter loading, incubation time, and drug dose on peptidase activity in individual cells. Incubation time was negatively correlated with the number of peptide fragment peaks observed, while peak area (which was proportional to reporter loading) was positively correlated with both the number of fragment peaks observed and the degradation rate. Notably, a statistically significant change in the number of peaks observed was identified as dose increased from 2 to 4 μM. Similarly, a significant difference in degradation rate as a function of reporter loading was observed for doses ≥2 μM compared to the 1 μM dose. These results suggest that additional enzymes may become inhibited at doses >1 μM and >2 μM, demonstrating the utility of single-cell data to yield novel biological hypotheses.

  15. A single sex pheromone receptor determines chemical response specificity of sexual behavior in the silkmoth Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Takeshi Sakurai

    2011-06-01

    Full Text Available In insects and other animals, intraspecific communication between individuals of the opposite sex is mediated in part by chemical signals called sex pheromones. In most moth species, male moths rely heavily on species-specific sex pheromones emitted by female moths to identify and orient towards an appropriate mating partner among a large number of sympatric insect species. The silkmoth, Bombyx mori, utilizes the simplest possible pheromone system, in which a single pheromone component, (E, Z-10,12-hexadecadienol (bombykol, is sufficient to elicit full sexual behavior. We have previously shown that the sex pheromone receptor BmOR1 mediates specific detection of bombykol in the antennae of male silkmoths. However, it is unclear whether the sex pheromone receptor is the minimally sufficient determination factor that triggers initiation of orientation behavior towards a potential mate. Using transgenic silkmoths expressing the sex pheromone receptor PxOR1 of the diamondback moth Plutella xylostella in BmOR1-expressing neurons, we show that the selectivity of the sex pheromone receptor determines the chemical response specificity of sexual behavior in the silkmoth. Bombykol receptor neurons expressing PxOR1 responded to its specific ligand, (Z-11-hexadecenal (Z11-16:Ald, in a dose-dependent manner. Male moths expressing PxOR1 exhibited typical pheromone orientation behavior and copulation attempts in response to Z11-16:Ald and to females of P. xylostella. Transformation of the bombykol receptor neurons had no effect on their projections in the antennal lobe. These results indicate that activation of bombykol receptor neurons alone is sufficient to trigger full sexual behavior. Thus, a single gene defines behavioral selectivity in sex pheromone communication in the silkmoth. Our findings show that a single molecular determinant can not only function as a modulator of behavior but also as an all-or-nothing initiator of a complex species

  16. The delayed lung responses to single and repeated intratracheal administration of pure cobalt and hard metal powder in the rat.

    Science.gov (United States)

    Lasfargues, G; Lardot, C; Delos, M; Lauwerys, R; Lison, D

    1995-05-01

    Epidemiological and clinical studies suggest that inhalation of cobalt metal dust (Co) mixed with tungsten carbide particles (WC), but not of cobalt dust alone, may cause interstitial pulmonary lesions (hard metal disease). In previous experimental studies in the rat, we have demonstrated the greater acute pulmonary toxicity of a WC-Co mixture compared to Co or WC alone. The present study was undertaken to compare in the same animal model the delayed lung response after intratracheal administration of Co or WC-Co particles (cobalt particle 6.3 wt%). The responses were also compared with those obtained after treatment with arsenic trioxide and crystalline silica used a reference materials producing an acute toxic insult and a progressive fibrogenic response, respectively. Cellular (total and differential counts) and biochemical parameters (LDH, N-acetyl-beta-D-glucosaminidase, total protein, albumin, fibronectin, and hyaluronic acid) were measured in bronchoalveolar lavage fluid following single and repeated intratracheal instillations. The results indicate that the delayed lung response observed after WC-Co is different from that after cobalt metal alone. A single intratracheal dose of WC-Co (1, 5, or 10 mg/100 g body wt) induced an acute alveolitis which persisted for at least 1 month. Four months after a single instillation of WC-Co, no clear histological lung fibrosis could however be evidenced, indicating a reversibility of the lesions. The effects of cobalt (0.06, 0.3, or 0.6 mg/100 g body wt) or tungsten carbide alone (1, 5, 10 mg/ 100 g body wt) were very modest, if any. Following repeated intratracheal instillations (four administrations at 1-month interval), increased lung hydroxyproline content and histopathological evidence of interstitial fibrosis were observed after WC-Co (4 x 1 mg/100 g body wt), but not after administration of each component separately, i.e., Co (4 x 0.06 mg/100 g body wt) or WC (4 x 1 mg/100 g body wt). The mechanism of the fibrotic

  17. Coherent nonlinear optical response of single-layer black phosphorus: third-harmonic generation

    Science.gov (United States)

    Margulis, Vladimir A.; Muryumin, Evgeny E.; Gaiduk, Evgeny A.

    2017-10-01

    We theoretically calculate the nonlinear optical (NLO) response of phosphorene (a black phosphorus monolayer) to a normally incident and linearly polarized coherent laser radiation of frequency ω, resulting in the generation of radiation at frequency 3ω. We derive explicit analytic expressions for four independent nonvanishing elements of the third-order NLO susceptibility tensor, describing the third-harmonic generation (THG) from phosphorene. The final formulas are numerically evaluated for typical values of the system's parameters to explore how the efficiency of the THG varies with both the frequency and the polarization direction of the incident radiation. The results obtained show a resonant enhancement of the THG efficiency when the pump photon energy ℏω approaches a value of one third of the bandgap energy Eg (≈1.5 eV) of phosphorene. It is also shown that the THG efficiency exhibits a specific polarization dependence, allowing the THG to be used for determining the orientation of phosphorene's crystallographic axes. Our findings highlight the material's potential for practical application in nanoscale photonic devices such as frequency convertors operating in the near-infrared spectral range.

  18. Natural variation in a single amino acid substitution underlies physiological responses to topoisomerase II poisons.

    Science.gov (United States)

    Zdraljevic, Stefan; Strand, Christine; Seidel, Hannah S; Cook, Daniel E; Doench, John G; Andersen, Erik C

    2017-07-01

    Many chemotherapeutic drugs are differentially effective from one patient to the next. Understanding the causes of this variability is a critical step towards the development of personalized treatments and improvements to existing medications. Here, we investigate sensitivity to a group of anti-neoplastic drugs that target topoisomerase II using the model organism Caenorhabditis elegans. We show that wild strains of C. elegans vary in their sensitivity to these drugs, and we use an unbiased genetic approach to demonstrate that this natural variation is explained by a methionine-to-glutamine substitution in topoisomerase II (TOP-2). The presence of a non-polar methionine at this residue increases hydrophobic interactions between TOP-2 and its poison etoposide, as compared to a polar glutamine. We hypothesize that this stabilizing interaction results in increased genomic instability in strains that contain a methionine residue. The residue affected by this substitution is conserved from yeast to humans and is one of the few differences between the two human topoisomerase II isoforms (methionine in hTOPIIα and glutamine in hTOPIIβ). We go on to show that this amino acid difference between the two human topoisomerase isoforms influences cytotoxicity of topoisomerase II poisons in human cell lines. These results explain why hTOPIIα and hTOPIIβ are differentially affected by various poisons and demonstrate the utility of C. elegans in understanding the genetics of drug responses.

  19. Multivariate Bayesian decoding of single-trial event-related fMRI responses for memory retrieval of voluntary actions.

    Directory of Open Access Journals (Sweden)

    Dongha Lee

    Full Text Available This study proposes a method for classifying event-related fMRI responses in a specialized setting of many known but few unknown stimuli presented in a rapid event-related design. Compared to block design fMRI signals, classification of the response to a single or a few stimulus trial(s is not a trivial problem due to contamination by preceding events as well as the low signal-to-noise ratio. To overcome such problems, we proposed a single trial-based classification method of rapid event-related fMRI signals utilizing sparse multivariate Bayesian decoding of spatio-temporal fMRI responses. We applied the proposed method to classification of memory retrieval processes for two different classes of episodic memories: a voluntarily conducted experience and a passive experience induced by watching a video of others' actions. A cross-validation showed higher classification performance of the proposed method compared to that of a support vector machine or of a classifier based on the general linear model. Evaluation of classification performances for one, two, and three stimuli from the same class and a correlation analysis between classification accuracy and target stimulus positions among trials suggest that presenting two target stimuli at longer inter-stimulus intervals is optimal in the design of classification experiments to identify the target stimuli. The proposed method for decoding subject-specific memory retrieval of voluntary behavior using fMRI would be useful in forensic applications in a natural environment, where many known trials can be extracted from a simulation of everyday tasks and few target stimuli from a crime scene.

  20. Experience with pegvisomant treatment in acromegaly in a single Brazilian tertiary reference center: efficacy, safety and predictors of response.

    Science.gov (United States)

    Kasuki, Leandro; Machado, Evelyn de Oliveira; Ogino, Liana Lumi; Coelho, Maria Caroline Alves; Silva, Cintia Marques Dos Santos; Wildemberg, Luiz Eduardo Armondi; Lima, Carlos Henrique Azeredo; Gadelha, Mônica R

    2016-10-01

    To describe the safety and efficacy of pegvisomant therapy and the predictors of treatment response in acromegaly patients at a single tertiary reference center in Brazil. We retrospectively reviewed the clinical, hormonal and radiological data of acromegaly patients treated with pegvisomant in our center. We also evaluated the presence of the d3 isoform of the growth hormone receptor (d3GHR). Twenty-seven patients were included (17 women). Pegvisomant was used in combination with octreotide LAR in 20 patients (74%), in combination with cabergoline in one (4%) and as monotherapy in six (22%). IGF-I normalization was achieved in 23 patients (85%). Mild and transitory elevation of liver enzymes was observed in two patients (7.4%), tumor growth in one (3.4%) and lipodystrophy in two (7.4%). One patient stopped the drug due to headaches. The GHR isoforms were evaluated in 14 patients, and the presence of at least one d3GHR allele was observed in 43% of them, but it was not a predictor of treatment response. Only pre-treatment IGF-I level was a predictor of treatment response. Pegvisomant treatment was highly effective and safe in our series of Brazilian patients. A better chance of disease control can be expected in those with lower pre-pegvisomant IGF-I levels.

  1. Attending to and remembering tactile stimuli: a review of brain imaging data and single-neuron responses.

    Science.gov (United States)

    Burton, H; Sinclair, R J

    2000-11-01

    Clinical and neuroimaging observations of the cortical network implicated in tactile attention have identified foci in parietal somatosensory, posterior parietal, and superior frontal locations. Tasks involving intentional hand-arm movements activate similar or nearby parietal and frontal foci. Visual spatial attention tasks and deliberate visuomotor behavior also activate overlapping posterior parietal and frontal foci. Studies in the visual and somatosensory systems thus support a proposal that attention to the spatial location of an object engages cortical regions responsible for the same coordinate referents used for guiding purposeful motor behavior. Tactile attention also biases processing in the somatosensory cortex through amplification of responses to relevant features of selected stimuli. Psychophysical studies demonstrate retention gradients for tactile stimuli like those reported for visual and auditory stimuli, and suggest analogous neural mechanisms for working memory across modalities. Neuroimaging studies in humans using memory tasks, and anatomic studies in monkeys support the idea that tactile information relayed from the somatosensory cortex is directed ventrally through the insula to the frontal cortex for short-term retention and to structures of the medial temporal lobe for long-term encoding. At the level of single neurons, tactile (such as visual and auditory) short-term memory appears as a persistent response during delay intervals between sampled stimuli.

  2. Time fluctuations in the response of photomultiplier tubes Dario 56 AVP, XP 1021, XP 1210

    International Nuclear Information System (INIS)

    Breuze, G.; Sawine, P.

    1969-01-01

    The authors have studied experimentally the intrinsic time resolving power of 3 photomultiplier tubes, Dario 56 AVP, XP 1021, XP 1210 at various excitation levels produced by a source of short light pulses. They show, in agreement with present theories, that there exists an optimal resolving power for a certain trigger threshold, and they check the law governing the variations of this resolving power with the average number of photo-electrons emitted by light pulse, up to the limiting case of a single photo-electron. The results obtained show the progress which has been made by the constructor between the 56 AVP and the XP 1210 models: for 100 photo-electrons per pulse, for example, the times of resolution are 260 x 10 -12 s and 75 x 10 -12 s respectively; whereas the rise time for the anode pulses decreases from 2,3 to 1,2 x 10 -9 s. The intermediate tube XP 1021 has also a particularly good performance with respect to the 56 AVP, which it resembles very much both in its price and by its outer aspect. The authors stress finally the difficulties encountered in measuring with accuracy the time characteristics of PM as fast as the XP 1210, and in particular the limitation imposed by the light source. (author) [fr

  3. Microarray analysis of the transcriptional response to single or multiple doses of ionizing radiation in human subcutaneous fibroblasts

    DEFF Research Database (Denmark)

    Rødningen, Olaug Kristin; Overgaard, Jens; Alsner, Jan

    2005-01-01

    cell lines after various ionizing radiation (IR) schemes in order to provide information on potential targets for prevention and to suggest candidate genes for SNP association studies aimed at predicting individual risk of radiation-induced morbidity. PATIENTS AND METHODS: Thirty different human......BACKGROUND AND PURPOSE: Transcriptional profiling of fibroblasts derived from breast cancer patients might improve our understanding of subcutaneous radiation-induced fibrosis. The aim of this study was to get a comprehensive overview of the changes in gene expression in subcutaneous fibroblast...... fibroblast cell lines were included in the study, and two different radiation schemes; single dose experiments with 3.5 Gy or fractionated with 3 x 3.5 Gy. Expression analyses were performed on unexposed and exposed cells after different time points. The IR response was analyzed using the statistical method...

  4. All-Printed Thin-Film Transistor Based on Purified Single-Walled Carbon Nanotubes with Linear Response

    Directory of Open Access Journals (Sweden)

    Guiru Gu

    2011-01-01

    Full Text Available We report an all-printed thin-film transistor (TFT on a polyimide substrate with linear transconductance response. The TFT is based on our purified single-walled carbon nanotube (SWCNT solution that is primarily consists of semiconducting carbon nanotubes (CNTs with low metal impurities. The all-printed TFT exhibits a high ON/OFF ratio of around 103 and bias-independent transconductance over a certain gate bias range. Such bias-independent transconductance property is different from that of conventional metal-oxide-semiconductor field-effect transistors (MOSFETs due to the special band structure and the one-dimensional (1D quantum confined density of state (DOS of CNTs. The bias-independent transconductance promises modulation linearity for analog electronics.

  5. Hormonal, Metabolic and Cardiorespiratory Responses of Young and Adult Athletes to a Single Session of High Intensity Cycle Exercise

    OpenAIRE

    Engel, Florian; Härtel, Sascha; Wagner, Matthias Oliver; Strahler, Jana; Bös, Klaus; Sperlich, Billy

    2014-01-01

    This study aimed to determine the effects of a single High Intensity Interval Training (HIIT) session on salivary cortisol (SC) levels, physiological responses and performance in trained boys and men. Twenty-three boys (11.5±0.8 years) and 25 men (29.7±4.6 years) performed HIIT (four consecutive Wingate Anaerobic Tests). SC in boys and men increased after HIIT from 5.55±3.3 nmol/l to 15.13±9.7 nmol/l (+173%) and from 7.07±4.7 nmol/l to 19.19±12.7 nmol/l (+171%), respectively (p

  6. LH-RH agonists modulate amygdala response to visual sexual stimulation: a single case fMRI study in pedophilia.

    Science.gov (United States)

    Habermeyer, Benedikt; Händel, Nadja; Lemoine, Patrick; Klarhöfer, Markus; Seifritz, Erich; Dittmann, Volker; Graf, Marc

    2012-01-01

    Pedophilia is characterized by a persistent sexual attraction to prepubescent children. Treatment with anti-androgen agents, such as luteinizing hormone-releasing hormone (LH-RH) agonists, reduces testosterone levels and thereby sexual drive and arousal. We used functional magnetic resonance imaging (fMRI) to compare visual erotic stimulation pre- and on-treatment with the LH-RH agonist leuprolide acetate in the case of homosexual pedophilia. The pre-treatment contrasts of the erotic pictures against the respective neutral pictures showed an activation of the right amygdala and adjacent parahippocampal gyrus that decreased significantly under treatment with leuprolide acetate. Our single case fMRI study supports the notion that anti-androgens may modify amygdala response to visual erotic stimulation, a hypothesis that should be further examined in larger studies.

  7. Preoperative Single-Fraction Partial Breast Radiation Therapy: A Novel Phase 1, Dose-Escalation Protocol With Radiation Response Biomarkers

    International Nuclear Information System (INIS)

    Horton, Janet K.; Blitzblau, Rachel C.; Yoo, Sua; Geradts, Joseph; Chang, Zheng; Baker, Jay A.; Georgiade, Gregory S.; Chen, Wei; Siamakpour-Reihani, Sharareh; Wang, Chunhao; Broadwater, Gloria; Groth, Jeff; Palta, Manisha; Dewhirst, Mark; Barry, William T.; Duffy, Eileen A.

    2015-01-01

    Purpose: Women with biologically favorable early-stage breast cancer are increasingly treated with accelerated partial breast radiation (PBI). However, treatment-related morbidities have been linked to the large postoperative treatment volumes required for external beam PBI. Relative to external beam delivery, alternative PBI techniques require equipment that is not universally available. To address these issues, we designed a phase 1 trial utilizing widely available technology to 1) evaluate the safety of a single radiation treatment delivered preoperatively to the small-volume, intact breast tumor and 2) identify imaging and genomic markers of radiation response. Methods and Materials: Women aged ≥55 years with clinically node-negative, estrogen receptor–positive, and/or progesterone receptor–positive HER2−, T1 invasive carcinomas, or low- to intermediate-grade in situ disease ≤2 cm were enrolled (n=32). Intensity modulated radiation therapy was used to deliver 15 Gy (n=8), 18 Gy (n=8), or 21 Gy (n=16) to the tumor with a 1.5-cm margin. Lumpectomy was performed within 10 days. Paired pre- and postradiation magnetic resonance images and patient tumor samples were analyzed. Results: No dose-limiting toxicity was observed. At a median follow-up of 23 months, there have been no recurrences. Physician-rated cosmetic outcomes were good/excellent, and chronic toxicities were grade 1 to 2 (fibrosis, hyperpigmentation) in patients receiving preoperative radiation only. Evidence of dose-dependent changes in vascular permeability, cell density, and expression of genes regulating immunity and cell death were seen in response to radiation. Conclusions: Preoperative single-dose radiation therapy to intact breast tumors is well tolerated. Radiation response is marked by early indicators of cell death in this biologically favorable patient cohort. This study represents a first step toward a novel partial breast radiation approach. Preoperative radiation should

  8. Preoperative Single-Fraction Partial Breast Radiation Therapy: A Novel Phase 1, Dose-Escalation Protocol With Radiation Response Biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Horton, Janet K., E-mail: janet.horton@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Blitzblau, Rachel C.; Yoo, Sua [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Geradts, Joseph [Department of Pathology, Duke University Medical Center, Durham, North Carolina (United States); Chang, Zheng [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Baker, Jay A. [Department of Radiology, Duke University Medical Center, Durham, North Carolina (United States); Georgiade, Gregory S. [Department of Surgery, Duke University Medical Center, Durham, North Carolina (United States); Chen, Wei [Department of Bioinformatics: Duke Cancer Institute, Duke University Medical Center, Durham, North Carolina (United States); Siamakpour-Reihani, Sharareh; Wang, Chunhao [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Broadwater, Gloria [Department of Biostatistics: Duke Cancer Institute, Duke University Medical Center, Durham, North Carolina (United States); Groth, Jeff [Department of Pathology, Duke University Medical Center, Durham, North Carolina (United States); Palta, Manisha; Dewhirst, Mark [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Barry, William T. [Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, North Carolina (United States); Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Duffy, Eileen A. [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); and others

    2015-07-15

    Purpose: Women with biologically favorable early-stage breast cancer are increasingly treated with accelerated partial breast radiation (PBI). However, treatment-related morbidities have been linked to the large postoperative treatment volumes required for external beam PBI. Relative to external beam delivery, alternative PBI techniques require equipment that is not universally available. To address these issues, we designed a phase 1 trial utilizing widely available technology to 1) evaluate the safety of a single radiation treatment delivered preoperatively to the small-volume, intact breast tumor and 2) identify imaging and genomic markers of radiation response. Methods and Materials: Women aged ≥55 years with clinically node-negative, estrogen receptor–positive, and/or progesterone receptor–positive HER2−, T1 invasive carcinomas, or low- to intermediate-grade in situ disease ≤2 cm were enrolled (n=32). Intensity modulated radiation therapy was used to deliver 15 Gy (n=8), 18 Gy (n=8), or 21 Gy (n=16) to the tumor with a 1.5-cm margin. Lumpectomy was performed within 10 days. Paired pre- and postradiation magnetic resonance images and patient tumor samples were analyzed. Results: No dose-limiting toxicity was observed. At a median follow-up of 23 months, there have been no recurrences. Physician-rated cosmetic outcomes were good/excellent, and chronic toxicities were grade 1 to 2 (fibrosis, hyperpigmentation) in patients receiving preoperative radiation only. Evidence of dose-dependent changes in vascular permeability, cell density, and expression of genes regulating immunity and cell death were seen in response to radiation. Conclusions: Preoperative single-dose radiation therapy to intact breast tumors is well tolerated. Radiation response is marked by early indicators of cell death in this biologically favorable patient cohort. This study represents a first step toward a novel partial breast radiation approach. Preoperative radiation should

  9. Preoperative Single-Fraction Partial Breast Radiation Therapy: A Novel Phase 1, Dose-Escalation Protocol With Radiation Response Biomarkers.

    Science.gov (United States)

    Horton, Janet K; Blitzblau, Rachel C; Yoo, Sua; Geradts, Joseph; Chang, Zheng; Baker, Jay A; Georgiade, Gregory S; Chen, Wei; Siamakpour-Reihani, Sharareh; Wang, Chunhao; Broadwater, Gloria; Groth, Jeff; Palta, Manisha; Dewhirst, Mark; Barry, William T; Duffy, Eileen A; Chi, Jen-Tsan A; Hwang, E Shelley

    2015-07-15

    Women with biologically favorable early-stage breast cancer are increasingly treated with accelerated partial breast radiation (PBI). However, treatment-related morbidities have been linked to the large postoperative treatment volumes required for external beam PBI. Relative to external beam delivery, alternative PBI techniques require equipment that is not universally available. To address these issues, we designed a phase 1 trial utilizing widely available technology to 1) evaluate the safety of a single radiation treatment delivered preoperatively to the small-volume, intact breast tumor and 2) identify imaging and genomic markers of radiation response. Women aged ≥55 years with clinically node-negative, estrogen receptor-positive, and/or progesterone receptor-positive HER2-, T1 invasive carcinomas, or low- to intermediate-grade in situ disease ≤2 cm were enrolled (n=32). Intensity modulated radiation therapy was used to deliver 15 Gy (n=8), 18 Gy (n=8), or 21 Gy (n=16) to the tumor with a 1.5-cm margin. Lumpectomy was performed within 10 days. Paired pre- and postradiation magnetic resonance images and patient tumor samples were analyzed. No dose-limiting toxicity was observed. At a median follow-up of 23 months, there have been no recurrences. Physician-rated cosmetic outcomes were good/excellent, and chronic toxicities were grade 1 to 2 (fibrosis, hyperpigmentation) in patients receiving preoperative radiation only. Evidence of dose-dependent changes in vascular permeability, cell density, and expression of genes regulating immunity and cell death were seen in response to radiation. Preoperative single-dose radiation therapy to intact breast tumors is well tolerated. Radiation response is marked by early indicators of cell death in this biologically favorable patient cohort. This study represents a first step toward a novel partial breast radiation approach. Preoperative radiation should be tested in future clinical trials because it has the potential to

  10. Comparison of lipid peroxidation and catalase response in invasive dreissenid mussels exposed to single and multiple stressors.

    Science.gov (United States)

    Nowicki, Carly J; Kashian, Donna R

    2018-02-14

    Dreissenid mussels Dreissena bugensis (quagga mussel) and Dreissena polymorpha (zebra mussel) are prolific invasive species to the freshwaters of the United States and Western Europe. In the Great Lakes, D. polymorpha has initially dominated the system since its invasion in the mid-1980s; however, recently D. bugensis has displaced D. polymorpha as the dominant species. Dreissena bugensis has several competitive advantages over D. polymorpha, including greater tolerances to deeper and colder waters and lower respiration rates. Nevertheless, physiological differences between the species remain largely unknown. The oxidative stress response is a mechanism used by all organisms to mitigate environmental stress by reducing oxygen radicals in the body, and comparing this mechanism between similar species can be useful for understanding how different species compete in aquatic environments. We compared oxidative stress biomarkers (lipid peroxidation [LPO] and catalase [CAT] activity) in mussels after exposure to 4 stressors (i.e., high densities, temperature, hypoxia, and polychlorinated biphenyls [PCBs]) independently and in combinations of 2 stressors. Overall, D. bugensis had lower LPO and CAT activity than D. polymorpha when exposed to single stressors; however, in multiple stressor treatments D. bugensis had increased LPO, especially with high temperatures and PCBs. The lower lipid damage in D. bugensis compared with D. polymorpha under single stressor conditions may come at the cost of the ability to respond to multiple stressors. Environ Toxicol Chem 2018;9999:1-12. © 2018 SETAC. © 2018 SETAC.

  11. Dopa-responsive dystonia: functional analysis of single nucleotide substitutions within the 5' untranslated GCH1 region.

    Directory of Open Access Journals (Sweden)

    Ioanna A Armata

    Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.

  12. Estimation of high-pT Jet Energy Scale Uncertainty from single hadron response with the ATLAS detector

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00534683; The ATLAS collaboration

    2016-01-01

    The jet energy scale (JES) uncertainty is estimated using different methods at different pT ranges. In situ techniques exploiting the pT balance between a jet and a reference object (e.g. Z or gamma) are used at lower pT, but at very high pT (> 2.5 TeV) there is not enough statistics for in-situ techniques. The JES uncertainty at high-pT is important in several searches for new phenomena, e.g. the dijet resonance and angular searches. In the highest pT range, the JES uncertainty is estimated using the calorimeter response to single hadrons. In this method, jets are treated as a superposition of energy depositions of single particles. An uncertainty is applied to each energy depositions belonging to the particles within the jet, and propagated to the final jet energy scale. This poster presents the JES uncertainty found with this method at sqrt(s) = 8 TeV and its developments.

  13. EVALUATION OF A FAST-RESPONSE URBAN WIND MODEL - COMPARISON TO SINGLE-BUILDING WIND TUNNEL DATA

    International Nuclear Information System (INIS)

    E.R. PARDYJAK; M.J. BROWN

    2001-01-01

    Prediction of the 3-dimensional flow field around buildings and other obstacles is important for a number of applications, including urban air quality studies, the tracking of plumes from accidental releases of toxic air contaminants, indoor/outdoor air pollution problems, and thermal comfort assessments. Various types of computational fluid dynamics (CFD) models have been used for determining the flow fields around buildings (e.g., Reisner et al., 1998; Eichhorn et al., 1988). Comparisons to measurements show that these models work reasonably well for the most part (e.g., Ehrhard et al., 2 ; Johnson and Hunter, 1998; Murakami, 1997). However, CFD models are computationally intensive and for some applications turn-around time is of the essence. For example, planning and assessment studies in which hundreds of cases must be analyzed or emergency response scenarios in which plume transport must be computed quickly. Several fast-response dispersion models of varying levels of fidelity have been developed to explicitly account for the effects of a single building or groups of buildings (e.g., UDM - Hall et al. (2000), NRC-Ramsdell and Fosmire (1995), CBP-3 - Yamartino and Wiegand (1986), APRAC - Daerdt et al. (1973)). Although a few of these models include the Hotchkiss and Harlow (1973) analytical solution for potential flow in a notch to describe the velocity field within an urban canyon, in general, these models do not explicitly compute the velocity field around groups of buildings. The EPA PRIME model (Schulman et al., 2000) has been empirically derived to provide streamlines around a single isolated building

  14. Effects of a single-eye γ irradiation on the electrical responses in the visual system of the adult rabbit

    International Nuclear Information System (INIS)

    Bagot, J.-D.

    1980-11-01

    The electrical responses of the retina (ERG), superior colliculus and visual cortex (VER) to photic stimulation were recorded before and during the fortnight following a single-eye γ-irradiation. The delivered doses were 10 Gy (10 animals), 15 Gy (2 animals) and 20 Gy (2 animals). The experimental methods are described (single and double-light flashes with different time intervals between flashes, scotopic and photopic adaptation) and the measured parameters exposed. The following results were obtained: in scotopic adaptation there occured a functional alteration of photoreceptors (decrease of the a-wave amplitude and slope) and an impairment at the preganglionic retinal level, particularly in the Mueller's cells (decrease of the b-wave amplitude). These changes started within 1 hour after irradiation, reached a maximum between 3 and 7 days and decreased progressively during the second week. The e 1 and e 2 oscillatory potentials were unchanged, but e 3 decreased together with b-wave. The time constant of the rapid neural mechanism of adaptation increased and the slow photochemical process of dark-adaptation was disturbed without obvious recovery after 15 days. In photopic adaptation no significant changes occured in the ERG response. With a diffuse light flash the primary components of VER were unchanged. Several mechanisms were proposed to interpret the radiation-induced alterations; the change in membrane permeability (inducing a loss of intracellular K + and an increase in intracellular Na + ) could explain most of the observed trouble. Nevertheless we could not discard injuries of the energetic cell metabolism impairing the functional activity of photoreceptors or Mueller's cells [fr

  15. Pulmonary exposure to single-walled carbon nanotubes does not affect the early immune response against Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Swedin Linda

    2012-05-01

    Full Text Available Abstract Background Single-walled carbon nanotubes (SWCNT trigger pronounced inflammation and fibrosis in the lungs of mice following administration via pharyngeal aspiration or inhalation. Human exposure to SWCNT in an occupational setting may occur in conjunction with infections and this could yield enhanced or suppressed responses to the offending agent. Here, we studied whether the sequential exposure to SWCNT via pharyngeal aspiration and infection of mice with the ubiquitous intracellular parasite Toxoplasma gondii would impact on the immune response of the host against the parasite. Methods C57BL/6 mice were pre-exposed by pharyngeal administration of SWCNT (80 + 80 μg/mouse for two consecutive days followed by intravenous injection with either 1x103 or 1x104 green fluorescence protein and luciferase-expressing T. gondii tachyzoites. The dissemination of T. gondii was monitored by in vivo bioluminescence imaging in real time for 7 days and by plaque formation. The inflammatory response was analysed in bronchoalveolar lavage (BAL fluid, and by assessment of morphological changes and immune responses in lung and spleen. Results There were no differences in parasite distribution between mice only inoculated with T. gondii or those mice pre-exposed for 2 days to SWCNT before parasite inoculum. Lung and spleen histology and inflammation markers in BAL fluid reflected the effects of SWCNT exposure and T. gondii injection, respectively. We also noted that CD11c positive dendritic cells but not F4/80 positive macrophages retained SWCNT in the lungs 9 days after pharyngeal aspiration. However, co-localization of T. gondii with CD11c or F4/80 positive cells could not be observed in lungs or spleen. Pre-exposure to SWCNT did not affect the splenocyte response to T. gondii. Conclusions Taken together, our data indicate that pre-exposure to SWCNT does not enhance or suppress the early immune response to T. gondii in mice.

  16. LACK OF REPRODUCIBILITY OF A SINGLE NEGATIVE STING CHALLENGE RESPONSE IN THE ASSESSMENT OF ANAPHYLACTIC RISK IN PATIENTS WITH SUSPECTED YELLOW JACKET HYPERSENSITIVITY

    NARCIS (Netherlands)

    FRANKEN, HH; DUBOIS, AEJ; MINKEMA, HJ; VANDERHEIDE, S; DEMONCHY, JGR

    To investigate the reproducibility of a single negative response to sting challenge with a living insect, we rechallenged a group of 61 patients who showed no clinical response to a first sting challenge. All patients had previously had symptoms suggestive of anaphylaxis after a yellow jacket field

  17. Persons with Multiple Disabilities Exercise Adaptive Response Schemes with the Help of Technology-Based Programs: Three Single-Case Studies

    Science.gov (United States)

    Lancioni, Giulio E.; Singh, Nirbhay N.; O'Reilly, Mark F.; Sigafoos, Jeff; Oliva, Doretta; Campodonico, Francesca; Lang, Russell

    2012-01-01

    The present three single-case studies assessed the effectiveness of technology-based programs to help three persons with multiple disabilities exercise adaptive response schemes independently. The response schemes included (a) left and right head movements for a man who kept his head increasingly static on his wheelchair's headrest (Study I), (b)…

  18. Single-Stroke Synthesis of Tin Sulphide/Oxide Nanocomposites Within Engineering Thermoplastic and Their Humidity Response.

    Science.gov (United States)

    Adkar, Dattatraya; Adhyapak, Parag; Mulik, Uttamrao; Jadkar, Sandesh; Vutova, Katia; Amalnerkar, Dinesh

    2018-05-01

    SnS nanostructured materials have attracted enormous interest due to their important properties and potential application in low cost solar energy conversion systems and optical devices. From the perspective of SnS based device fabrication, we offer single-stroke in-situ technique for the generation of Sn based sulphide and oxide nanostructures inside the polymer network via polymer-inorganic solid state reaction route. In this method, polyphenylene sulphide (PPS)-an engineering thermoplastic-acts as chalcogen source as well as stabilizing matrix for the resultant nano products. Typical solid state reaction was accomplished by simply heating the physical admixtures of the tin salts (viz. tin acetate/tin chloride) with PPS at the crystalline melting temperature (285 °C) of PPS in inert atmosphere. The synthesized products were characterized by using various physicochemical characterization techniques. The prima facie observations suggest the concurrent formation of nanocrystalline SnS with extraneous oxide phase. The TEM analysis revealed formation of nanosized particles of assorted morphological features with polydispersity confined to 5 to 50 nm. However, agglomerated particles of nano to submicron size were also observed. The humidity sensing characterization of these nanocomposites was also performed. The resistivity response with the level of humidity (20 to 85% RH) was compared for these nanocomposites. The linear response was obtained for both the products. Nevertheless, the nanocomposite product obtained from acetate precursor showed higher sensitivity towards the humidity than that of one prepared from chloride precursor.

  19. Nuclear Photo-Electron Avalanche Cells (NPEAC) Generator

    Data.gov (United States)

    National Aeronautics and Space Administration — Vast increase in power density to 1 kWe/kg level or higher by NPEAC would represent a revolution in energy generation for deep space exploration and other...

  20. Continuum dislocation-density based models for the dynamic shock response of single-crystal and polycrystalline materials

    Science.gov (United States)

    Luscher, Darby

    2017-06-01

    The dynamic thermomechanical responses of polycrystalline materials under shock loading are often dominated by the interaction of defects and interfaces. For example, polymer-bonded explosives (PBX) can initiate under weak shock impacts whose energy, if distributed homogeneously throughout the material, translates to temperature increases that are insufficient to drive the rapid chemistry observed. In such cases, heterogeneous thermomechanical interactions at the mesoscale (i.e. between single-crystal and macroscale) lead to the formation of localized hot spots. Within metals, a prescribed deformation associated with a shock wave may be accommodated by crystallographic slip, provided a sufficient population of mobile dislocations is available. However, if the deformation rate is large enough, there may be an insufficient number of freely mobile dislocations. In these cases, additional dislocations may be nucleated, or alternate mechanisms (e.g. twinning, damage) activated in order to accommodate the deformation. Direct numerical simulation at the mesoscale offers insight into these physical processes that can be invaluable to the development of macroscale constitutive theories, if the mesoscale models adequately represent the anisotropic nonlinear thermomechanical response of individual crystals and their interfaces. This talk will briefly outline a continuum mesoscale modeling framework founded upon local and nonlocal variations of dislocation-density based crystal plasticity theory. The nonlocal theory couples continuum dislocation transport with the local theory. In the latter, dislocation transport is modeled by enforcing dislocation conservation at a slip-system level through the solution of advection-diffusion equations. The configuration of geometrically necessary dislocation density gives rise to a back-stress that inhibits or accentuates the flow of dislocations. Development of the local theory and application to modeling the explosive molecular crystal

  1. A single dose of inactivated hepatitis A vaccine promotes HAV-specific memory cellular response similar to that induced by a natural infection.

    Science.gov (United States)

    Melgaço, Juliana Gil; Morgado, Lucas Nóbrega; Santiago, Marta Almeida; Oliveira, Jaqueline Mendes de; Lewis-Ximenez, Lia Laura; Hasselmann, Bárbara; Cruz, Oswaldo Gonçalves; Pinto, Marcelo Alves; Vitral, Claudia Lamarca

    2015-07-31

    Based on current studies on the effects of single dose vaccines on antibody production, Latin American countries have adopted a single dose vaccine program. However, no data are available on the activation of cellular response to a single dose of hepatitis A. Our study investigated the functional reactivity of the memory cell phenotype after hepatitis A virus (HAV) stimulation through administration of the first or second dose of HAV vaccine and compared the response to that of a baseline group to an initial natural infection. Proliferation assays showed that the first vaccine dose induced HAV-specific cellular response; this response was similar to that induced by a second dose or an initial natural infection. Thus, from the first dose to the second dose, increase in the frequencies of classical memory B cells, TCD8 cells, and central memory TCD4 and TCD8 cells were observed. Regarding cytokine production, increased IL-6, IL-10, TNF, and IFNγ levels were observed after vaccination. Our findings suggest that a single dose of HAV vaccine promotes HAV-specific memory cell response similar to that induced by a natural infection. The HAV-specific T cell immunity induced by primary vaccination persisted independently of the protective plasma antibody level. In addition, our results suggest that a single dose immunization system could serve as an alternative strategy for the prevention of hepatitis A in developing countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Hepatic transcriptional responses in Atlantic salmon (Salmo salar) exposed to gamma radiation and depleted uranium singly and in combination

    Energy Technology Data Exchange (ETDEWEB)

    Song, You, E-mail: yso@niva.no [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Norwegian Institute for Water Research (NIVA), Gaustadalléen 21, N-0349 Oslo (Norway); Salbu, Brit; Teien, Hans-Christian [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Evensen, Øystein [Norwegian University of Life Sciences (NMBU), Department of Basic Sciences and Aquatic Medicine, P.O. Box 8146 Dep., N-0033 Oslo (Norway); Lind, Ole Christian [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Rosseland, Bjørn Olav [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Norwegian University of Life Sciences (NMBU), Department of Ecology and Natural Resource Management (INA), P.O. Box 5003, N-1432 Ås (Norway); and others

    2016-08-15

    Radionuclides are a special group of substances posing both radiological and chemical hazards to organisms. As a preliminary approach to understand the combined effects of radionuclides, exposure studies were designed using gamma radiation (Gamma) and depleted uranium (DU) as stressors, representing a combination of radiological (radiation) and chemical (metal) exposure. Juvenile Atlantic salmon (Salmo salar) were exposed to 70 mGy external Gamma dose delivered over the first 5 h of a 48 h period (14 mGy/h), 0.25 mg/L DU were exposed continuously for 48 h and the combination of the two stressors (Combi). Water and tissue concentrations of U were determined to assess the exposure quality and DU bioaccumulation. Hepatic gene expression changes were determined using microarrays in combination with quantitative real-time reverse transcription polymerase chain reaction (qPCR). Effects at the higher physiological levels were determined as plasma glucose (general stress) and hepatic histological changes. The results show that bioaccumulation of DU was observed after both single DU and the combined exposure. Global transcriptional analysis showed that 3122, 2303 and 3460 differentially expressed genes (DEGs) were significantly regulated by exposure to gamma, DU and Combi, respectively. Among these, 349 genes were commonly regulated by all treatments, while the majority was found to be treatment-specific. Functional analysis of DEGs revealed that the stressors displayed similar mode of action (MoA) across treatments such as induction of oxidative stress, DNA damage and disturbance of oxidative phosphorylation, but also stressor-specific mechanisms such as cellular stress and injury, metabolic disorder, programmed cell death, immune response. No changes in plasma glucose level as an indicator of general stress and hepatic histological changes were observed. Although no direct linkage was successfully established between molecular responses and adverse effects at the organism

  3. Hepatic transcriptional responses in Atlantic salmon (Salmo salar) exposed to gamma radiation and depleted uranium singly and in combination

    International Nuclear Information System (INIS)

    Song, You; Salbu, Brit; Teien, Hans-Christian; Evensen, Øystein; Lind, Ole Christian; Rosseland, Bjørn Olav

    2016-01-01

    Radionuclides are a special group of substances posing both radiological and chemical hazards to organisms. As a preliminary approach to understand the combined effects of radionuclides, exposure studies were designed using gamma radiation (Gamma) and depleted uranium (DU) as stressors, representing a combination of radiological (radiation) and chemical (metal) exposure. Juvenile Atlantic salmon (Salmo salar) were exposed to 70 mGy external Gamma dose delivered over the first 5 h of a 48 h period (14 mGy/h), 0.25 mg/L DU were exposed continuously for 48 h and the combination of the two stressors (Combi). Water and tissue concentrations of U were determined to assess the exposure quality and DU bioaccumulation. Hepatic gene expression changes were determined using microarrays in combination with quantitative real-time reverse transcription polymerase chain reaction (qPCR). Effects at the higher physiological levels were determined as plasma glucose (general stress) and hepatic histological changes. The results show that bioaccumulation of DU was observed after both single DU and the combined exposure. Global transcriptional analysis showed that 3122, 2303 and 3460 differentially expressed genes (DEGs) were significantly regulated by exposure to gamma, DU and Combi, respectively. Among these, 349 genes were commonly regulated by all treatments, while the majority was found to be treatment-specific. Functional analysis of DEGs revealed that the stressors displayed similar mode of action (MoA) across treatments such as induction of oxidative stress, DNA damage and disturbance of oxidative phosphorylation, but also stressor-specific mechanisms such as cellular stress and injury, metabolic disorder, programmed cell death, immune response. No changes in plasma glucose level as an indicator of general stress and hepatic histological changes were observed. Although no direct linkage was successfully established between molecular responses and adverse effects at the organism

  4. A single bout of exercise with a flexible pole induces significant cardiac autonomic responses in healthy men

    Directory of Open Access Journals (Sweden)

    Cristiane M. Ogata

    2014-09-01

    Full Text Available OBJECTIVES: Flexible poles can provide rapid eccentric and concentric muscle contractions. Muscle vibration is associated with a "tonic vibration reflex” that is stimulated by a sequence of rapid muscle stretching, activation of the muscle spindles and stimulation of a response that is similar to the myotatic reflex. Literature studies analyzing the acute cardiovascular responses to different exercises performed with this instrument are lacking. We investigated the acute effects of exercise with flexible poles on the heart period in healthy men. METHOD: The study was performed on ten young adult males between 18 and 25 years old. We evaluated the heart rate variability in the time and frequency domains. The subjects remained at rest for 10 min. After the rest period, the volunteers performed the exercises with the flexible poles. Immediately after the exercise protocol, the volunteers remained seated at rest for 30 min and their heart rate variability was analyzed. RESULTS: The pNN50 was reduced at 5-10 and 15-20 min after exercise compared to 25-30 min after exercise (p = 0.0019, the SDNN was increased at 25-30 min after exercise compared to at rest and 0-10 min after exercise (p = 0.0073 and the RMSSD was increased at 25-30 min after exercise compared to 5-15 min after exercise (p = 0.0043. The LF in absolute units was increased at 25-30 min after exercise compared to 5-20 min after exercise (p = 0.0184. CONCLUSION: A single bout of exercise with a flexible pole reduced the heart rate variability and parasympathetic recovery was observed approximately 30 min after exercise.

  5. Tuning of the Lethal Response to Multiple Stressors with a Single-Site Mutation during Clinical Infection by Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Krishan Kumar

    2017-10-01

    Full Text Available The agr system of Staphylococcus aureus promotes invasion of host tissues, and as expected, agents that block agr quorum sensing have anti-infective properties. Paradoxically, agr-defective mutants are frequently recovered from patients, especially those persistently infected with S. aureus. We found that an agr deficiency increased survival of cultured bacteria during severe stress, such as treatment with gentamicin, ciprofloxacin, heat, or low pH. With daptomycin, deletion of agr decreased survival. Therefore, agr activity can be either detrimental or protective, depending on the type of lethal stress. Deletion of agr had no effect on the ability of the antimicrobials to block bacterial growth, indicating that agr effects are limited to lethal action. Thus, the effect of an agr deletion is on bacterial tolerance, not resistance. For gentamicin and daptomycin, activity can be altered by agr-regulated secreted factors. For ciprofloxacin, a detrimental function was downregulation of glutathione peroxidase (bsaA, an enzyme responsible for defense against oxidative stress. Deficiencies in agr and bsaA were epistatic for survival, consistent with agr having a destructive role mediated by reactive oxygen species. Enhanced susceptibility to lethal stress by wild-type agr, particularly antimicrobial stress, helps explain why inactivating mutations in S. aureus agr commonly occur in hospitalized patients during infection. Moreover, the agr quorum-sensing system of S. aureus provides a clinically relevant example in which a single-step change in the response to severe stress alters the evolutionary path of a pathogen during infection.

  6. Similar mitochondrial signaling responses to a single bout of continuous or small-sided-games-based exercise in sedentary men.

    Science.gov (United States)

    Mendham, Amy E; Duffield, Rob; Coutts, Aaron J; Marino, Frank E; Boyko, Andriy; McAinch, Andrew J; Bishop, David John

    2016-12-01

    This study assessed the mitochondrial related signaling responses to a single bout of noncontact, modified football (touch rugby), played as small-sided games (SSG), or cycling (CYC) exercise in sedentary, obese, middle-aged men. In a randomized, crossover design, nine middle-aged, sedentary, obese men completed two, 40-min exercise conditions (CYC and SSG) separated by a 21-day recovery period. Heart rate (HR) and ratings of perceived exertion (RPE) were collected during each bout. Needle biopsies from the vastus lateralis muscle were collected at rest and 30 and 240 min postexercise for analysis of protein content and phosphorylation (PGC-1α, SIRT1, p53, p53 Ser15 , AMPK, AMPK Thr172 , CAMKII, CAMKII Thr286 , p38MAPK, and p38MAPK Thr180/Tyr182 ) and mRNA expression (PGC-1α, p53, NRF1, NRF2, Tfam, and cytochrome c). A main effect of time effect for both conditions was evident for HR, RPE, and blood lactate (P 0.05). Both conditions increased PGC1-α protein and mRNA expression at 240 min (P 0.05). CYC increased p53 protein content at 240 min to a greater extent than SSG (P benefit for stimulating mitochondrial biogenesis. Differences between conditions regarding fluctuation in exercise intensity and type of muscle contraction may explain the increase of p53 and AMPK within CYC and not SSG (noncontact, modified football). Copyright © 2016 the American Physiological Society.

  7. Single-molecule spectroscopy of LHCSR1 protein dynamics identifies two distinct states responsible for multi-timescale photosynthetic photoprotection

    Science.gov (United States)

    Kondo, Toru; Pinnola, Alberta; Chen, Wei Jia; Dall'Osto, Luca; Bassi, Roberto; Schlau-Cohen, Gabriela S.

    2017-08-01

    In oxygenic photosynthesis, light harvesting is regulated to safely dissipate excess energy and prevent the formation of harmful photoproducts. Regulation is known to be necessary for fitness, but the molecular mechanisms are not understood. One challenge has been that ensemble experiments average over active and dissipative behaviours, preventing identification of distinct states. Here, we use single-molecule spectroscopy to uncover the photoprotective states and dynamics of the light-harvesting complex stress-related 1 (LHCSR1) protein, which is responsible for dissipation in green algae and moss. We discover the existence of two dissipative states. We find that one of these states is activated by pH and the other by carotenoid composition, and that distinct protein dynamics regulate these states. Together, these two states enable the organism to respond to two types of intermittency in solar intensity—step changes (clouds and shadows) and ramp changes (sunrise), respectively. Our findings reveal key control mechanisms underlying photoprotective dissipation, with implications for increasing biomass yields and developing robust solar energy devices.

  8. Fast-Response Single-Nanowire Photodetector Based on ZnO/WS2 Core/Shell Heterostructures.

    Science.gov (United States)

    Butanovs, Edgars; Vlassov, Sergei; Kuzmin, Alexei; Piskunov, Sergei; Butikova, Jelena; Polyakov, Boris

    2018-04-12

    The surface plays an exceptionally important role in nanoscale materials, exerting a strong influence on their properties. Consequently, even a very thin coating can greatly improve the optoelectronic properties of nanostructures by modifying the light absorption and spatial distribution of charge carriers. To use these advantages, 1D/1D heterostructures of ZnO/WS 2 core/shell nanowires with a-few-layers-thick WS 2 shell were fabricated. These heterostructures were thoroughly characterized by scanning and transmission electron microscopy, X-ray diffraction, and Raman spectroscopy. Then, a single-nanowire photoresistive device was assembled by mechanically positioning ZnO/WS 2 core/shell nanowires onto gold electrodes inside a scanning electron microscope. The results show that a few layers of WS 2 significantly enhance the photosensitivity in the short wavelength range and drastically (almost 2 orders of magnitude) improve the photoresponse time of pure ZnO nanowires. The fast response time of ZnO/WS 2 core/shell nanowire was explained by electrons and holes sinking from ZnO nanowire into WS 2 shell, which serves as a charge carrier channel in the ZnO/WS 2 heterostructure. First-principles calculations suggest that the interface layer i-WS 2 , bridging ZnO nanowire surface and WS 2 shell, might play a role of energy barrier, preventing the backward diffusion of charge carriers into ZnO nanowire.

  9. 6-Pyruvoyltetrahydropterin synthase orthologs of either a single or dual domain structure are responsible for tetrahydrobiopterin synthesis in bacteria.

    Science.gov (United States)

    Kong, Jin Sun; Kang, Ji-Youn; Kim, Hye Lim; Kwon, O-Seob; Lee, Kon Ho; Park, Young Shik

    2006-09-04

    6-Pyruvoyltetrahydropterin synthase (PTPS) catalyzes the second step of tetrahydrobiopterin (BH4) synthesis. We previously identified PTPS orthologs (bPTPS-Is) in bacteria which do not produce BH4. In this study we disrupted the gene encoding bPTPS-I in Synechococcus sp. PCC 7942, which produces BH4-glucoside. The mutant was normal in BH4-glucoside production, demonstrating that bPTPS-I does not participate in BH4 synthesis in vivo and bringing us a new PTPS ortholog (bPTPS-II) of a bimodular polypeptide. The recombinant Synechococcus bPTPS-II was assayed in vitro to show PTPS activity higher than human enzyme. Further computational analysis revealed the presence of mono and bimodular bPTPS-II orthologs mostly in green sulfur bacteria and cyanobacteria, respectively, which are well known for BH4-glycoside production. In summary we found new bacterial PTPS orthologs, having either a single or dual domain structure and being responsible for BH4 synthesis in vivo, thereby disclosing all the bacterial PTPS homologs.

  10. Gene expression changes of single skeletal muscle fibers in response to modulation of the mitochondrial calcium uniporter (MCU

    Directory of Open Access Journals (Sweden)

    Francesco Chemello

    2015-09-01

    Full Text Available The mitochondrial calcium uniporter (MCU gene codifies for the inner mitochondrial membrane (IMM channel responsible for mitochondrial Ca2+ uptake. Cytosolic Ca2+ transients are involved in sarcomere contraction through cycles of release and storage in the sarcoplasmic reticulum. In addition cytosolic Ca2+ regulates various signaling cascades that eventually lead to gene expression reprogramming. Mitochondria are strategically placed in close contact with the ER/SR, thus cytosolic Ca2+ transients elicit large increases in the [Ca2+] of the mitochondrial matrix ([Ca2+]mt. Mitochondrial Ca2+ uptake regulates energy production and cell survival. In addition, we recently showed that MCU-dependent mitochondrial Ca2+ uptake controls skeletal muscle trophism. In the same report, we dissected the effects of MCU-dependent mitochondrial Ca2+ uptake on gene expression through microarray gene expression analysis upon modulation of MCU expression by in vivo AAV infection. Analyses were performed on single skeletal muscle fibers at two time points (7 and 14 days post-AAV injection. Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/ (GSE60931.

  11. Response of single bacterial cells to stress gives rise to complex history dependence at the population level

    Science.gov (United States)

    Mathis, Roland; Ackermann, Martin

    2016-01-01

    Most bacteria live in ever-changing environments where periods of stress are common. One fundamental question is whether individual bacterial cells have an increased tolerance to stress if they recently have been exposed to lower levels of the same stressor. To address this question, we worked with the bacterium Caulobacter crescentus and asked whether exposure to a moderate concentration of sodium chloride would affect survival during later exposure to a higher concentration. We found that the effects measured at the population level depended in a surprising and complex way on the time interval between the two exposure events: The effect of the first exposure on survival of the second exposure was positive for some time intervals but negative for others. We hypothesized that the complex pattern of history dependence at the population level was a consequence of the responses of individual cells to sodium chloride that we observed: (i) exposure to moderate concentrations of sodium chloride caused delays in cell division and led to cell-cycle synchronization, and (ii) whether a bacterium would survive subsequent exposure to higher concentrations was dependent on the cell-cycle state. Using computational modeling, we demonstrated that indeed the combination of these two effects could explain the complex patterns of history dependence observed at the population level. Our insight into how the behavior of single cells scales up to processes at the population level provides a perspective on how organisms operate in dynamic environments with fluctuating stress exposure. PMID:26960998

  12. ERCC1 and XRCC1 but not XPA single nucleotide polymorphisms correlate with response to chemotherapy in endometrial carcinoma

    Directory of Open Access Journals (Sweden)

    Chen L

    2016-11-01

    Full Text Available Liang Chen,1 Mei-Mei Liu,1 Hui Liu,1 Dan Lu,2 Xiao-Dan Zhao,3 Xue-Jing Yang4 1Department of Gynecology and Obstetrics, 2Department of Oncology, 3Department of Clinical Laboratory, The 2nd Affiliated Hospital, Harbin Medical University, 4Nursing Department, Harbin Chest Hospital, Harbin, People’s Republic of China Abstract: Our study aimed to investigate the correlation between single nucleotide polymorphisms of ERCC1/XRCC1/XPA genes and postoperative chemotherapy efficacy and prognosis of endometrial carcinoma. Our study included 108 patients with endometrial carcinoma and 100 healthy participants. ERCC1 rs11615/XRCC1 rs25487/XPA rs1800975 gene polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism. Then the chemotherapy efficacy and toxic effects of the patients were assessed. The genotype and allele frequency of ERCC1 rs11615/XRCC1 rs25487 in the case group were significantly different from that in the control group (all P<0.05. The patients with AA + GA in ERCC1 rs11615 had an increased risk of endometrial carcinoma than those with GG, and the risk of endometrial carcinoma for patients with AA + GA was also higher in comparison with patients with GG genotype in XRCC1 rs25487 (all P<0.05. GG on both ERCC1 rs11615/XRCC1 rs25487 had a higher effective rate of chemotherapy than GA + AA (all P<0.05. ERCC1 rs11615/XRCC1 rs25487 gene polymorphisms were linked with toxic effects in liver, kidney, and nervous system. ERCC1 rs11615/XRCC1 rs25487, muscular invasion, and tumor stage were independent risk factors for the prognosis of endometrial carcinoma (all P<0.05. However, no significant associations were observed between XPA rs1800975 polymorphism and chemotherapy efficacy and prognosis of endometrial carcinoma (all P>0.05. These results indicated that ERCC1 and XRCC1 but not XPA polymorphisms correlate with response to chemotherapy in endometrial carcinoma. Keywords: ERCC1, XRCC1, XPA, single nucleotide

  13. Development of a combined model of tissue kinetics and radiation response of human bronchiolar epithelium with single cell resolution

    Science.gov (United States)

    Ostrovskaya, Natela Grigoryevna

    2005-07-01

    Lack of accurate data for epidemiological studies of low dose radiation effects necessitates development of dosimetric models allowing prediction of cancer risks for different organs. The objective of this work is to develop a model of the radiation response of human bronchiolar tissue with single cell resolution. The computer model describes epithelial tissue as an ensemble of individual cells, with the geometry of a human bronchiole and the properties of different cell types are taken into account. The model simulates the tissue kinetics and radiation exposure in four dimensions: three spatial dimensions and a temporal dimension. The bronchiole is modeled as a regular hollow cylinder with the epithelial cells of three different types (basal, secretory, and ciliated) lining its interior. For the purposes of assessment of radiation damage to the cells only the nuclei of the cells have been modeled. Subroutines describing cellular kinetics have been developed to simulate cell turnover in a normal epithelial tissue. Monte Carlo subroutines have been developed to simulate exposure to alpha particles; the GEANT4 toolkit has been used to simulate exposure to low LET radiation. Each hit cell is provided with a record of energy deposition, and this record is passed to the progeny if the cell survives. The model output provides data on the number of basal progenitor cells in different phases of a cell life-cycle and secretory to ciliated cell ratio after several generations of cell proliferation. The model calculates labeling and mitotic indices and estimates the average cell turnover time for the bronchiolar tissue. Microdosimetric calculations are performed for cells traversed by ionizing particles. The model will be used to assess the accumulation of damage in cells due to protracted low level radiation exposure. The model output may provide directions for the future experimental design.

  14. Effects of a single bout of walking on psychophysiologic responses and executive function in elderly adults: a pilot study

    Directory of Open Access Journals (Sweden)

    Hatta A

    2013-07-01

    Full Text Available Arihiro Hatta,1 Yoshiaki Nishihira,2 Takuro Higashiura3 1Department of Health Pharmacy, Yokohama College of Pharmacy, Yokohama, Kanagawa, Japan; 2Graduate School of Comprehensive Human Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan; 3Department of Law, Faculty of Law, Seiwa University, Kisarazu, Chiba, Japan Background: The purpose of this study was to examine the effects of a single bout of walking on mood, psychophysiologic responses, and executive function in elderly adults. Methods: Twenty healthy, elderly adults (10 women and 10 men; mean age 70.50 ± 3.4 years participated in this study. Mood, as assessed by the Profile of Mood States, and salivary α-amylase activity were examined before and after walking. Executive functions were also evaluated by the Wisconsin Card Sorting Test. Results: Negative feeling scores such as tension-anxiety, anger-hostility, and confusion significantly improved after walking. No significant differences were found for either salivary α-amylase activities or Wisconsin Card Sorting Test scores before and after walking. However, the changes in salivary α-amylase activity before and after walking correlated positively with the number of total errors and perseverative errors of Nelson in the Wisconsin Card Sorting Test. Conclusion: These results suggest that moderate exercise, such as self-paced one-time walking, induces beneficial psychologic effects in elderly adults. Meanwhile, the significant increase in salivary α-amylase activity after walking might temporarily cause deterioration of executive function. Keywords: salivary α-amylase, Profile of Mood States, Wisconsin Card Sorting Test, perseverative error

  15. Development and evaluation of pH-responsive single-walled carbon nanotube-doxorubicin complexes in cancer cells

    Directory of Open Access Journals (Sweden)

    Gu YJ

    2011-11-01

    Full Text Available Yan-Juan Gu1,2,*, Jinping Cheng2,*, Jiefu Jin3, Shuk Han Cheng2, Wing-Tak Wong11Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, 2Department of Biology and Chemistry, The City University of Hong Kong, 3Department of Chemistry, The University of Hong Kong, Hong Kong, China*These authors contributed equally to this workAbstract: Single-walled carbon nanotubes (SWNTs have been identified as an efficient drug carrier. Here a controlled drug-delivery system based on SWNTs coated with doxorubicin (DOX through hydrazone bonds was developed, because the hydrazone bond is more sensitive to tumor microenvironments than other covalent linkers. The SWNTs were firstly stabilized with polyethylene glycol (H2N-PEG-NH2. Hydrazinobenzoic acid (HBA was then covalently attached on SWNTs via carbodiimide-activated coupling reaction to form hydrazine-modified SWNTs. The anticancer drug DOX was conjugated to the HBA segments of SWNT using hydrazine as the linker. The resulting hydrazone bonds formed between the DOX molecules and the HBA segments of SWNTs are acid cleavable, thereby providing a strong pH-responsive drug release, which may facilitate effective DOX release near the acidic tumor microenvironment and thus reduce its overall systemic toxicity. The DOX-loaded SWNTs were efficiently taken up by HepG2 tumor cells, and DOX was released intracellularly, as revealed by MTT assay and confocal microscope observations. Compared with SWNT-DOX conjugate formed by supramolecular interaction, the SWNT-HBA-DOX featured high weight loading and prolonged release of DOX, and thus improved its cytotoxicity against cancer cells. This study suggests that while SWNTs have great potential as a drug carrier, the efficient formulation strategy requires further study.Keywords: carbon nanotubes, drug delivery, controlled release, SWNTs

  16. Analytical response function for planar Ge detectors

    Science.gov (United States)

    García-Alvarez, Juan A.; Maidana, Nora L.; Vanin, Vito R.; Fernández-Varea, José M.

    2016-04-01

    We model the response function (RF) of planar HPGe x-ray spectrometers for photon energies between around 10 keV and 100 keV. The RF is based on the proposal of Seltzer [1981. Nucl. Instrum. Methods 188, 133-151] and takes into account the full-energy absorption in the Ge active volume, the escape of Ge Kα and Kβ x-rays and the escape of photons after one Compton interaction. The relativistic impulse approximation is employed instead of the Klein-Nishina formula to describe incoherent photon scattering in the Ge crystal. We also incorporate a simple model for the continuous component of the spectrum produced by the escape of photo-electrons from the active volume. In our calculations we include external interaction contributions to the RF: (i) the incoherent scattering effects caused by the detector's Be window and (ii) the spectrum produced by photo-electrons emitted in the Ge dead layer that reach the active volume. The analytical RF model is compared with pulse-height spectra simulated using the PENELOPE Monte Carlo code.

  17. Immune and stress mediators in response to bilateral adnexectomy: comparison of single-port access and conventional laparoscopy in a porcine model.

    Science.gov (United States)

    Gracia, Meritxell; Sisó, Cristian; Martínez-Zamora, M Àngels; Sarmiento, Laura; Lozano, Francisco; Arias, Maria Teresa; Beltrán, Joan; Balasch, Juan; Carmona, Francisco

    2014-01-01

    To evaluate systemic markers of immune and stress responses after bilateral adnexectomy performed using 2 different laparoscopic techniques in pigs. Prospective comparative study (Canadian Task Force classification II-2). University teaching hospital, research hospital, and tertiary care center. Twenty female Yorkshire pigs undergoing laparoscopic surgery. Animals underwent bilateral salpingo-oophorectomy (ovary and fallopian tube extraction), performed via conventional laparoscopy (n = 10) or the single-port access approach (n = 10). Injury provokes an acute-phase response, primarily produced by cytokines. The inflammatory response has been well described for major surgery and for conventional laparoscopy; however, little information is currently available for single-port laparoscopy, and none in the gynecologic field. This is the first study to compare serum cytokine interleukin 6 (IL-6) and tumor necrosis factor alpha (TNF-α) concentrations at baseline and in the early postoperative period (2, 4, and 20 hours) after bilateral salpingo-oophorectomy performed via conventional laparoscopy (n = 10) or single-port access (n = 10) in a porcine model. The stress response was measured using glucose and cortisol concentrations and the animals' response to surgery via a 6-category observation-based behavior test. Both IL-6 and TNF-α concentrations peaked at 4 hours after surgery, and were significantly lower in the single-port access group (p = .02) than in the conventional laparoscopy group (p = .02). In addition, in the single-port access group, concentrations of stress markers were slightly lower at all intervals recorded and were statistically significant at 2 hours after the operation for glucose concentration (mean [SD], 164.50 [26.73] mg/dL for conventional laparoscopy vs 86.50 [17.93] mg/dL for single-port access; p = .02). Evidence of improved inflammatory and stress responses was recorded in the minimally invasive single-port group. More clinical

  18. Single-epitope DNA vaccination prevents exhaustion and facilitates a broad antiviral CD8+ T cell response during chronic viral infection

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Stryhn, Anette; Christensen, Jan Pravsgaard

    2004-01-01

    a single dominant epitope may suppress the response to other viral epitopes, and this may lead to increased susceptibility to reinfection with escape variants circulating in the host population. To address these issues, we induced a memory response consisting solely of monospecific, CD8+ T cells by use...... of DNA vaccines encoding immunodominant epitopes of lymphocytic choriomeningitis virus (LCMV). We analyzed the spectrum of the CD8+ T cell response and the susceptibility to infection in H-2(b) and H-2(d) mice. Priming for a monospecific, CD8+ T cell response did not render mice susceptible to viral...... variants. Thus, vaccinated mice were protected against chronic infection with LCMV, and no evidence indicating biologically relevant viral escape was obtained. In parallel, a broad and sustained CD8+ T cell response was generated upon infection, and in H-2(d) mice epitope spreading was observed. Even after...

  19. Characterization of System Level Single Event Upset (SEU) Responses using SEU Data, Classical Reliability Models, and Space Environment Data

    Science.gov (United States)

    Berg, Melanie; Label, Kenneth; Campola, Michael; Xapsos, Michael

    2017-01-01

    We propose a method for the application of single event upset (SEU) data towards the analysis of complex systems using transformed reliability models (from the time domain to the particle fluence domain) and space environment data.

  20. Analysis and demonstration of single-passband response and tuning characteristics in a chirped ladder interferometric filter for a widely tunable laser diode.

    Science.gov (United States)

    Jeong, Seok-Hwan; Matsuo, Shinji; Yoshikuni, Yuzo; Segawa, Toru; Ohiso, Yoshitaka; Suzuki, Hiroyuki

    2005-10-01

    We have designed and demonstrated a chirped ladder-type tunable filter and discussed its potential application for a tunable diode laser. A ladder interferometric filter normally has a periodic passband, which makes it impossible to stabilize laser oscillation frequency. To overcome this drawback, we have designed, fabricated, and characterized a novel chirped tunable ladder filter. We have successfully demonstrated a single-passband response in the fabricated device. Furthermore, a tuning operation of more than 30 nm was achieved by introducing a current injection structure and optimizing electrode lengths at each single-stage ladder interferometer.

  1. Subcloning the RBL-2H3 mucosal mast cell line reduces Ca2+ response heterogeneity at the single-cell level.

    Science.gov (United States)

    Kuchtey, J; Fewtrell, C

    1996-03-01

    Ca2+ imaging experiments have revealed that for a wide variety of cell types, including RBL-2H3 mucosal mast cells, there are considerable cell-to-cell differences of the Ca2+ responses of individual cells. This heterogeneity is evident in both the shape and latency of the responses. Mast cells within a single microscopic field of view, which have experienced identical culture conditions and experimental preparation, display a wide variety of responses upon antigen stimulation. We have subcloned the RBL-2H3 mucosal mast cell line to test the hypothesis that genetic heterogeneity within the population is the cause of the Ca2+ response heterogeneity. We found that cell-to-cell variability was significantly reduced in four of five clonal lines. The response heterogeneity remaining within the clones was not an experimental artifact caused by differences in the amount of fura-2 loaded by individual cells. Factors other than genetic heterogeneity must partly account for Ca2+ response heterogeneity. It is possible that the complex shapes and variability of the Ca2+ responses are reflections of the fact that there are multiple factors underlying the Ca2-response to antigen stimulation. Small differences from cell to cell in one or more of these factors could be a cause of the remaining Ca2+ response heterogeneity.

  2. Does a single session of electroconvulsive therapy alter the neural response to emotional faces in depression? A randomised sham-controlled functional magnetic resonance imaging study

    DEFF Research Database (Denmark)

    Miskowiak, Kamilla W; Kessing, Lars V; Ott, Caroline V

    2017-01-01

    expression recognition and dot-probe tasks. A single electroconvulsive therapy session had no effect on amygdala response to emotional faces. Whole-brain analysis revealed no effects of electroconvulsive therapy versus sham therapy after family-wise error correction at the cluster level, using a cluster...... neurocognitive bias in major depressive disorder. Patients with major depressive disorder were randomised to one active ( n=15) or sham electroconvulsive therapy ( n=12). The following day they underwent whole-brain functional magnetic resonance imaging at 3T while viewing emotional faces and performed facial...... to faces after a single electroconvulsive therapy session, the observed trend changes after a single electroconvulsive therapy session point to an early shift in emotional processing that may contribute to antidepressant effects of electroconvulsive therapy....

  3. Response of Listeria monocytogenes to disinfection stress at the single-cell and population levels as monitored by intracellular pH measurements and viable-cell counts

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Nielsen, Dennis S.; Arneborg, Nils

    2009-01-01

    of the bacterium. In situ analyses of Listeria monocytogenes single cells were performed during exposure to different concentrations of the disinfectant Incimaxx DES to study a possible population subdivision. Bacterial survival was quantified with plate counting and disinfection stress at the single-cell level...... by measuring intracellular pH (pHi) over time by fluorescence ratio imaging microscopy. pHi values were initially 7 to 7.5 and decreased in both attached and planktonic L. monocytogenes cells during exposure to sublethal and lethal concentrations of Incimaxx DES. The response of the bacterial population...... that a population of L. monocytogenes cells, whether planktonic or attached, is homogenous with respect to sensitivity to an acidic disinfectant studied on the single-cell level. Hence a major subpopulation more tolerant to disinfectants, and hence more persistent, does not appear to be present....

  4. Physiological responses to incremental, interval, and continuous counterweighted single-leg and double-leg cycling at the same relative intensities.

    Science.gov (United States)

    MacInnis, Martin J; Morris, Nathaniel; Sonne, Michael W; Zuniga, Amanda Farias; Keir, Peter J; Potvin, Jim R; Gibala, Martin J

    2017-07-01

    We compared physiological responses to incremental, interval, and continuous counterweighted single-leg and double-leg cycling at the same relative intensities. The primary hypothesis was that the counterweight method would elicit greater normalized power (i.e., power/active leg), greater electromyography (EMG) responses, and lower cardiorespiratory demand. Graded-exercise tests performed by 12 men (age: 21 ± 2 years; BMI: 24 ± 3 kg/m 2 ) initially established that peak oxygen uptake ([Formula: see text]; 76 ± 8.4%), expired ventilation ([Formula: see text]; 71 ± 6.8%), carbon dioxide production ([Formula: see text]; 71 ± 6.8%), heart rate (HRpeak; 91 ± 5.3%), and power output (PPO; 56 ± 3.6%) were lower during single-leg compared to double-leg cycling (main effect of mode; p cycling were performed at greater absolute power outputs but lower normalized power outputs compared to single-leg cycling (p  0.05), but semitendinosus was activated to a greater extent for single-leg cycling (p = 0.005). Single-leg interval and continuous cycling elicited lower mean [Formula: see text], [Formula: see text], [Formula: see text], HR and ratings of perceived exertion compared to double-leg cycling (p cycling elicits lower cardiorespiratory and perceptual responses than double-leg cycling at greater normalized power outputs.

  5. Correlation between single-trial visual evoked potentials and the blood oxygenation level dependent response in simultaneously recorded electroencephalography-functional magnetic resonance imaging

    DEFF Research Database (Denmark)

    Fuglø, Dan; Pedersen, Henrik; Rostrup, Egill

    2012-01-01

    . The performance of different single-trial EEG regressors was compared in terms of predicting the measured blood oxygenation level dependent response. The EEG-based regressors were the amplitude and latency of the primary positive (P1) and negative (N2) peaks of the visual evoked potential, the combined P1-N2...... amplitude, and the alpha power. Apart from peak latencies, all regressors showed significant positive or negative correlation with the blood oxygenation level dependent response in visual cortex. In addition, several EEG-based regressors were found to predict blood oxygenation level dependent variations...

  6. Homogenization optics to improve detectability of a fluorescence response to a single laser pulse: Detection of feces on apples

    Science.gov (United States)

    Fecal contamination of produce is a known food safety risk. Measuring fluorescence responses to UV excitation is an established method for detecting such contamination. One measurement system utilizes a pulsed UV laser to induce a fluorescence response from fecal material and a gated intensified cam...

  7. Single Unit Recordings of Cells Responsive to Visual, Somatic, Acoustic, and Noxious Stimuli in the Superior Colliculus of the Golden Hamster.

    Science.gov (United States)

    1978-08-01

    NUMBER 79-191T t; __ _ _ _ _ _ 4. TITLE (and Subtitle) 5. TYPE OF REPORT & PERIOD COVERED Single Unit Recordings of Cells Responsive to Visul , Somatic...8217I:I . .A The information in this thesis has been published: J. Comp. Neur. 183:269-284, "Properties of Superior Colliculus Neurons in the Golden...axons from both eyes reach both sides of the central nervous system and provide binocular information to the 6 superior colliculus and, via the

  8. Does a single session of electroconvulsive therapy alter the neural response to emotional faces in depression? A randomised sham-controlled functional magnetic resonance imaging study.

    Science.gov (United States)

    Miskowiak, Kamilla W; Kessing, Lars V; Ott, Caroline V; Macoveanu, Julian; Harmer, Catherine J; Jørgensen, Anders; Revsbech, Rasmus; Jensen, Hans M; Paulson, Olaf B; Siebner, Hartwig R; Jørgensen, Martin B

    2017-09-01

    Negative neurocognitive bias is a core feature of major depressive disorder that is reversed by pharmacological and psychological treatments. This double-blind functional magnetic resonance imaging study investigated for the first time whether electroconvulsive therapy modulates negative neurocognitive bias in major depressive disorder. Patients with major depressive disorder were randomised to one active ( n=15) or sham electroconvulsive therapy ( n=12). The following day they underwent whole-brain functional magnetic resonance imaging at 3T while viewing emotional faces and performed facial expression recognition and dot-probe tasks. A single electroconvulsive therapy session had no effect on amygdala response to emotional faces. Whole-brain analysis revealed no effects of electroconvulsive therapy versus sham therapy after family-wise error correction at the cluster level, using a cluster-forming threshold of Z>3.1 ( p2.3; pelectroconvulsive therapy-induced changes in parahippocampal and superior frontal responses to fearful versus happy faces as well as in fear-specific functional connectivity between amygdala and occipito-temporal regions. Across all patients, greater fear-specific amygdala - occipital coupling correlated with lower fear vigilance. Despite no statistically significant shift in neural response to faces after a single electroconvulsive therapy session, the observed trend changes after a single electroconvulsive therapy session point to an early shift in emotional processing that may contribute to antidepressant effects of electroconvulsive therapy.

  9. Experimental and numerical analysis of penetration/removal response of endodontic instrument made of single crystal Cu-based SMA: comparison with NiTi SMA instruments

    Science.gov (United States)

    Vincent, M.; Xolin, P.; Gevrey, A.-M.; Thiebaud, F.; Engels-Deutsch, M.; Ben Zineb, T.

    2017-04-01

    This paper presents an experimental and numerical study showing that single crystal shape memory alloy (SMA) Cu-based endodontic instruments can lead to equivalent mechanical performances compared to NiTi-based instruments besides their interesting biological properties. Following a previous finite element analysis (FEA) of single crystal CuAlBe endodontic instruments (Vincent et al 2015 J. Mater. Eng. Perform. 24 4128-39), prototypes with the determined geometrical parameters were machined and experimentally characterized in continuous rotation during a penetration/removal (P/R) protocol in artificial canals. The obtained mechanical responses were compared to responses of NiTi endodontic files in the same conditions. In addition, FEA was conducted and compared with the experimental results to validate the adopted modeling and to evaluate the local quantities inside the instrument as the stress state and the distribution of volume fraction of martensite. The obtained results highlight that single crystal CuAlBe SMA prototypes show equivalent mechanical responses to its NiTi homologous prototypes in the same P/R experimental conditions.

  10. Self-phase modulation of a single-cycle terahertz pulse by nonlinear free-carrier response in a semiconductor

    DEFF Research Database (Denmark)

    Turchinovich, Dmitry; Hvam, Jørn Märcher; Hoffmann, Matthias C.

    2012-01-01

    We investigate the self-phase modulation (SPM) of a single-cycle terahertz pulse in a semiconductor, using bulk n-GaAs as a model system. The SPM arises from the heating of free electrons in the electric field of the terahertz pulse, leading to an ultrafast reduction of the plasma frequency...

  11. Single-Channel Blind Estimation of Arterial Input Function and Tissue Impulse Response in DCE-MRI

    Czech Academy of Sciences Publication Activity Database

    Taxt, T.; Jiřík, Radovan; Rygh, C. B.; Grüner, R.; Bartoš, M.; Andersen, E.; Curry, F. R.; Reed, R. K.

    2012-01-01

    Roč. 59, č. 4 (2012), s. 1012-1021 ISSN 0018-9294 Institutional support: RVO:68081731 Keywords : arterial input function (AIF) * blind deconvolution * dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) * multichannel * perfusion * single channel Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.348, year: 2012

  12. Comparison of immune response of Pacific white shrimp, Litopenaeus vannamei, after multiple and single infections with WSSV and Vibrio anguillarum

    Science.gov (United States)

    Our previous study demonstrated that Pacific white shrimp (Litopenaeus vannamei) infected by multiple pathogens showed higher mortality and death occurred more quickly than those infected by a single pathogen [1]. For better understanding the defense mechanism against white spot syndrome virus (WSSV...

  13. Lack of Association of OPRM1 and ABCB1 Single-Nucleotide Polymorphisms to Oxycodone Response in Postoperative Pain

    DEFF Research Database (Denmark)

    Zwisler, Stine T; Enggaard, Thomas P; Mikkelsen, Soeren

    2012-01-01

    Purpose: The aim of the study was to search for an association between the single-nucleotide polymorphisms A118G in OPRM1 and C3435T and G2677T/A in ABCB1 and the analgesic effect of intravenous oxycodone in postoperative pain. Methods: There were 268 patients with postoperative pain after, prima...

  14. Increased reaction time variability in attention-deficit hyperactivity disorder as a response-related phenomenon: evidence from single-trial event-related potentials.

    Science.gov (United States)

    Saville, Christopher W N; Feige, Bernd; Kluckert, Christian; Bender, Stephan; Biscaldi, Monica; Berger, Andrea; Fleischhaker, Christian; Henighausen, Klaus; Klein, Christoph

    2015-07-01

    Increased intra-subject variability (ISV) in reaction times (RTs) is a promising endophenotype for attention-deficit hyperactivity disorder (ADHD) and among the most robust hallmarks of the disorder. ISV has been assumed to represent an attentional deficit, either reflecting lapses in attention or increased neural noise. Here, we use an innovative single-trial event-related potential approach to assess whether the increased ISV associated with ADHD is indeed attributable to attention, or whether it is related to response-related processing. We measured electroencephalographic responses to working memory oddball tasks in patients with ADHD (N = 20, aged 11.3 ± 1.1) and healthy controls (N = 25, aged 11.7 ± 1.1), and analysed these data with a recently developed method of single-trial event-related potential analysis. Estimates of component latency variability were computed for the stimulus-locked and response-locked forms of the P3b and the lateralised readiness potential (LRP). ADHD patients showed significantly increased ISV in behavioural ISV. This increased ISV was paralleled by an increase in variability in response-locked event-related potential latencies, while variability in stimulus-locked latencies was equivalent between groups. This result held across the P3b and LRP. Latency of all components predicted RTs on a single-trial basis, confirming that all were relevant for speed of processing. These data suggest that the increased ISV found in ADHD could be associated with response-end, rather than stimulus-end processes, in contrast to prevailing conceptions about the endophenotype. This mental chronometric approach may also be useful for exploring whether the existing lack of specificity of ISV to particular psychiatric conditions can be improved upon. © 2014 Association for Child and Adolescent Mental Health.

  15. Germline single nucleotide polymorphisms associated with response of urothelial carcinoma to platinum-based therapy: the role of the host.

    LENUS (Irish Health Repository)

    Gallagher, D J

    2013-09-01

    Variations in urothelial carcinoma (UC) response to platinum chemotherapy are common and frequently attributed to genetic and epigenetic variations of somatic DNA. We hypothesized that variations in germline DNA may contribute to UC chemosensitivity.

  16. Measurements of the evaporation and hygroscopic response of single fine-mode aerosol particles using a Bessel beam optical trap.

    Science.gov (United States)

    Cotterell, Michael I; Mason, Bernard J; Carruthers, Antonia E; Walker, Jim S; Orr-Ewing, Andrew J; Reid, Jonathan P

    2014-02-07

    A single horizontally-propagating zeroth order Bessel laser beam with a counter-propagating gas flow was used to confine single fine-mode aerosol particles over extended periods of time, during which process measurements were performed. Particle sizes were measured by the analysis of the angular variation of light scattered at 532 nm by a particle in the Bessel beam, using either a probe beam at 405 nm or 633 nm. The vapour pressures of glycerol and 1,2,6-hexanetriol particles were determined to be 7.5 ± 2.6 mPa and 0.20 ± 0.02 mPa respectively. The lower volatility of hexanetriol allowed better definition of the trapping environment relative humidity profile over the measurement time period, thus higher precision measurements were obtained compared to those for glycerol. The size evolution of a hexanetriol particle, as well as its refractive index at wavelengths 532 nm and 405 nm, were determined by modelling its position along the Bessel beam propagation length while collecting phase functions with the 405 nm probe beam. Measurements of the hygroscopic growth of sodium chloride and ammonium sulfate have been performed on particles as small as 350 nm in radius, with growth curves well described by widely used equilibrium state models. These are the smallest particles for which single-particle hygroscopicity has been measured and represent the first measurements of hygroscopicity on fine mode and near-accumulation mode aerosols, the size regimes bearing the most atmospheric relevance in terms of loading, light extinction and scattering. Finally, the technique is contrasted with other single particle and ensemble methods, and limitations are assessed.

  17. Variable Myocardial Response to Load Stresses in Infants with Single Left Ventricular Anatomy: Influence of Initial Physiology and Surgical Palliative Strategy.

    Science.gov (United States)

    Horriat, Narges L; Deatsman, Sara L; Stelter, Jessica; Frommelt, Peter C; Hill, Garick D

    2016-12-01

    Initial surgical strategies in neonates with single left ventricular (LV) anatomy vary based on adequacy of pulmonary and systemic blood flow. Differing myocardial responses to these strategies, as reflected in indices of systolic function, ventricular size, and mass have not been well defined. We sought to evaluate single LV myocardial response to varied physiology and initial palliation and determine whether the response is consistent and predictable. Infants with single LV physiology were divided based on neonatal palliation: no palliation/PA band (NO); BT shunt only (BT); or Norwood procedure (NP). Echo measures were obtained at presentation, early post-bidirectional Glenn (BDG), late post-BDG follow-up, and post-Fontan procedure. Measures included ejection fraction, LV mass indexed to height 2.7 and end diastolic volume indexed to body surface area, and mass/volume ratio. The cohort included 38 children (13 NO, 13 BT, 12 NP). Ejection fraction was similar but depressed in all groups at all stages. LV mass was higher in the NP group than the BT group at early post-BDG (p = 0.03) and higher than both BT and NO groups (p < 0.01) at late post-BDG, but the difference was resolved by post-Fontan follow-up. The NP group had the most remarkable remodeling in LV size from BDG to Fontan, suggesting that volume unloading is most valuable in this subgroup. Ventricular remodeling can be identified by echocardiography in children with single LV physiology, despite variable initial surgical palliative strategies. Importantly, these initial surgical strategies do not result in significant differences after Fontan palliation during early childhood.

  18. The role of demand response in single and multi-objective wind-thermal generation scheduling: A stochastic programming

    International Nuclear Information System (INIS)

    Falsafi, Hananeh; Zakariazadeh, Alireza; Jadid, Shahram

    2014-01-01

    This paper focuses on using DR (Demand Response) as a means to provide reserve in order to cover uncertainty in wind power forecasting in SG (Smart Grid) environment. The proposed stochastic model schedules energy and reserves provided by both of generating units and responsive loads in power systems with high penetration of wind power. This model is formulated as a two-stage stochastic programming, where first-stage is associated with electricity market, its rules and constraints and the second-stage is related to actual operation of the power system and its physical limitations in each scenario. The discrete retail customer responses to incentive-based DR programs are aggregated by DRPs (Demand Response Providers) and are submitted as a load change price and amount offer package to ISO (Independent System Operator). Also, price-based DR program behavior and random nature of wind power are modeled by price elasticity concept of the demand and normal probability distribution function, respectively. In the proposed model, DRPs can participate in energy market as well as reserve market and submit their offers to the wholesale electricity market. This approach is implemented on a modified IEEE 30-bus test system over a daily time horizon. The simulation results are analyzed in six different case studies. The cost, emission and multiobjective functions are optimized in both without and with DR cases. The multiobjective generation scheduling model is solved using augmented epsilon constraint method and the best solution can be chosen by Entropy and TOPSIS (Technique for Order Preference by Similarity to Ideal Solution) methods. The results indicate demand side participation in energy and reserve scheduling reduces the total operation costs and emissions. - Highlights: • Simultaneous participation of loads in both energy and reserve scheduling. • Environmental/economical scheduling of energy and reserve. • Using demand response for covering wind generation forecast

  19. Single-cell multiplexed cytokine profiling of CD19 CAR-T cells reveals a diverse landscape of polyfunctional antigen-specific response.

    Science.gov (United States)

    Xue, Qiong; Bettini, Emily; Paczkowski, Patrick; Ng, Colin; Kaiser, Alaina; McConnell, Timothy; Kodrasi, Olja; Quigley, Máire F; Heath, James; Fan, Rong; Mackay, Sean; Dudley, Mark E; Kassim, Sadik H; Zhou, Jing

    2017-11-21

    It remains challenging to characterize the functional attributes of chimeric antigen receptor (CAR)-engineered T cell product targeting CD19 related to potency and immunotoxicity ex vivo, despite promising in vivo efficacy in patients with B cell malignancies. We employed a single-cell, 16-plex cytokine microfluidics device and new analysis techniques to evaluate the functional profile of CD19 CAR-T cells upon antigen-specific stimulation. CAR-T cells were manufactured from human PBMCs transfected with the lentivirus encoding the CD19-BB-z transgene and expanded with anti-CD3/anti-CD28 coated beads. The enriched CAR-T cells were stimulated with anti-CAR or control IgG beads, stained with anti-CD4 RPE and anti-CD8 Alexa Fluor 647 antibodies, and incubated for 16 h in a single-cell barcode chip (SCBC). Each SCBC contains ~12,000 microchambers, covered with a glass slide that was pre-patterned with a complete copy of a 16-plex antibody array. Protein secretions from single CAR-T cells were captured and subsequently analyzed using proprietary software and new visualization methods. We demonstrate a new method for single-cell profiling of CD19 CAR-T pre-infusion products prepared from 4 healthy donors. CAR-T single cells exhibited a marked heterogeneity of cytokine secretions and polyfunctional (2+ cytokine) subsets specific to anti-CAR bead stimulation. The breadth of responses includes anti-tumor effector (Granzyme B, IFN-γ, MIP-1α, TNF-α), stimulatory (GM-CSF, IL-2, IL-8), regulatory (IL-4, IL-13, IL-22), and inflammatory (IL-6, IL-17A) functions. Furthermore, we developed two new bioinformatics tools for more effective polyfunctional subset visualization and comparison between donors. Single-cell, multiplexed, proteomic profiling of CD19 CAR-T product reveals a diverse landscape of immune effector response of CD19 CAR-T cells to antigen-specific challenge, providing a new platform for capturing CAR-T product data for correlative analysis. Additionally, such high

  20. Effect of single and repeated heat stress on chemical signals of heat shock response cascade in the rat's heart.

    Science.gov (United States)

    Ilievska, Gordana; Dinevska-Kjovkarovska, Suzana; Miova, Biljana

    2017-11-24

    Exposure to sublethal heat stress activates a complex cascade of signaling events, such as activators (NO), signal molecules (PKCε), and mediators (HSP70 and COX-2), leading to implementation of heat preconditioning, an adaptive mechanism which makes the organism more tolerant to additional stress. We investigated the time frame in which these chemical signals are triggered after heat stress (41 ± 0.5°С/45 min), single or repeated (24 or 72 h after the first one) in heart tissue of male Wistar rats. The animals were allowed to recover 24, 48 or 72 h at room temperature. Single heat stress caused a significant increase of the concentration of HSP70, NO, and PKC level and decrease of COX-2 level 24 h after the heat stress, which in the next course of recovery gradually normalized. The second heat stress, 24 h after the first one, caused a significant reduction of the HSP70 levels, concentration of NO and PKCɛ, and significant increase of COX-2 concentration. The second exposure, 72 h after the first heat stress, caused more expressive changes of HSP70 and NO in the 24 h-recovery groups. The level of PKCɛ was not significantly changed, but there was significantly increased COX-2 concentration during recovery. Serum activity of AST, ALT, and CK was reduced after single exposure and increased after repeated exposure to heat stress, in both time intervals. In conclusion, a longer period of recovery (72 h) between two consecutive sessions of heat stress is necessary to achieve more expressive changes in mediators (HSP70) and triggers (NO) of heat preconditioning.

  1. Effect of ethanethiolate spacer on morphology and optical responses of Ag nanoparticle array-single layer graphene hybrid systems

    Czech Academy of Sciences Publication Activity Database

    Sutrová, Veronika; Šloufová, I.; Melníková Komínková, Zuzana; Kalbáč, Martin; Pavlova, Ewa; Vlčková, B.

    2017-01-01

    Roč. 33, č. 50 (2017), s. 14414-14424 ISSN 0743-7463 R&D Projects: GA ČR(CZ) GA15-01953S; GA MŠk(CZ) LM2015073 Grant - others:GA MŠk(CZ) CZ.02.1.01/0.0/0.0/16_013/0001821 Institutional support: RVO:61389013 ; RVO:61388955 Keywords : Ag nanoparticle * single layer graphene * ethanethiol Subject RIV: JI - Composite Materials; CF - Physical ; Theoretical Chemistry (UFCH-W) OBOR OECD: Composites (including laminates, reinforced plastics, cermets, combined natural and synthetic fibre fabrics; Physical chemistry (UFCH-W) Impact factor: 3.833, year: 2016

  2. A dramatic response to a single dose of infliximab in a patient with prolonged pustular psoriasis derived from inverse psoriasis.

    Science.gov (United States)

    Li, Mengmeng; Dai, Weiwei; Yan, Wei; Liu, Yuanzhen; Wang, Lian; Li, Wei

    2017-07-01

    We report a case of a 25-year-old Chinese man with an exceptionally prolonged history of pustular psoriasis derived from inverse psoriasis who was unsatisfied with conventional treatment and was successfully treated with a single dose of infliximab without noticeable adverse effects. No recurrence or flaring was observed after 3 months of follow-up. This case illustrates that infliximab may be an effective and safe therapeutic option for patients with refractory pustular psoriasis derived from inverse psoriasis. © 2017 Wiley Periodicals, Inc.

  3. Bird community changes in response to single and repeated fires in a lowland tropical rainforest of eastern Borneo

    NARCIS (Netherlands)

    Slik, J.W.F.; Balen, van S.

    2006-01-01

    Our current understanding of bird community responses to tropical forest fires is limited and strongly geographically biased towards South America. Here we used the circular plot method to carry out complete bird inventories in undisturbed, once burned (1998) and twice burned forests (1983 and 1998)

  4. Ecological and phytohormonal aspects of plant volatile emission in response to single and dual infestations with herbivores and phytopathogens

    NARCIS (Netherlands)

    Ponzio, C.; Gols, R.; Pieterse, C.M.J.; Dicke, M.

    2013-01-01

    In their natural environment, plants are faced with a multitude of attackers, of which insect herbivores and plant pathogens are an important component. In response to these attacks, plants release volatile organic compounds (VOCs), which play an important role in the communication between plants

  5. Responsiveness of Myofascial Trigger Points to Single and Multiple Trigger Point Release Massages: A Randomized, Placebo Controlled Trial.

    Science.gov (United States)

    Moraska, Albert F; Schmiege, Sarah J; Mann, John D; Butryn, Nathan; Krutsch, Jason P

    2017-09-01

    This study aimed to assess the effects of single and multiple massage treatments on pressure-pain threshold (PPT) at myofascial trigger points (MTrPs) in people with myofascial pain syndrome expressed as tension-type headache. Individuals (n = 62) with episodic or chronic tension-type headache were randomized to receive 12 twice-weekly 45-min massage or sham ultrasound sessions or wait-list control. Massage focused on trigger point release (ischemic compression) of MTrPs in the bilateral upper trapezius and suboccipital muscles. PPT was measured at MTrPs with a pressure algometer pre and post the first and final (12th) treatments. PPT increased across the study timeframe in all four muscle sites tested for massage, but not sham ultrasound or wait-list groups (P trigger points to myofascial pain; (2) Describe an effective treatment for decreasing tenderness of a myofascial trigger point; and (3) Discuss the relative values of single vs. multiple massage sessions on increasing pressure-pain thresholds at myofascial trigger points. Advanced ACCREDITATION: The Association of Academic Physiatrists is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians.The Association of Academic Physiatrists designates this Journal-based CME activity for a maximum of 0.5 AMA PRA Category 1 Credit(s)™. Physicians should only claim credit commensurate with the extent of their participation in the activity.

  6. Cross Talk Study to the Single Photon Response of a Flat Panel PMT for the RICH Upgrade at LHCb

    CERN Multimedia

    Arnaboldi, C; Calvi, M; Fanchini, E; Gotti, C; Maino, M; Matteuzzi, C; Perego, D L; Pessina, G; Wang, J C

    2009-01-01

    The Ring Imaging CHerenkov, RICH, detector at LHCb is now readout by Hybrid Photon Detectors. In view of its upgrade a possible option is the adoption of the flat panel Photon Multipliers Tubes, PMT. An important issue for the good determination of the rings produced in the sensitive media is a negligible level of cross talk. We have experimentally studied the cross talk from the 64x64 pixels of the H9500 PMT from Hamamatsu. Results have shown that at the single photon signal level, as expected at LHCb, the statistics applied to the small number of electrons generated at the first dynode of the PMT chain leads to a cross talk mechanism that must be interpreted in term of the percentage of the number of induced signals rather than on the amplitude of the induced signals. The threshold to suppress cross talk must be increased to a significant fraction of the single photon signal for the worst case. The number of electrons generated at the first dynode is proportional to the biasing voltage. Measurements have sh...

  7. Hemodynamic mechanisms of the attenuated blood pressure response to mental stress after a single bout of maximal dynamic exercise in healthy subjects

    Directory of Open Access Journals (Sweden)

    F.J. Neves

    2012-07-01

    Full Text Available To determine the hemodynamic mechanisms responsible for the attenuated blood pressure response to mental stress after exercise, 26 healthy sedentary individuals (age 29 ± 8 years underwent the Stroop color-word test before and 60 min after a bout of maximal dynamic exercise on a treadmill. A subgroup (N = 11 underwent a time-control experiment without exercise. Blood pressure was continuously and noninvasively recorded by infrared finger photoplethysmography. Stroke volume was derived from pressure signals, and cardiac output and peripheral vascular resistance were calculated. Perceived mental stress scores were comparable between mental stress tests both in the exercise (P = 0.96 and control (P = 0.24 experiments. After exercise, the blood pressure response to mental stress was attenuated (pre: 10 ± 13 vs post: 6 ± 7 mmHg; P 0.05. In conclusion, a single bout of maximal dynamic exercise attenuates the blood pressure response to mental stress in healthy subjects, along with lower stroke volume and cardiac output, denoting an acute modulatory action of exercise on the central hemodynamic response to mental stress.

  8. Response to treatment in Brazilian patients with chronic hepatitis C is associated with a single-nucleotide polymorphism near the interleukin-28B gene

    Directory of Open Access Journals (Sweden)

    Tarciana Grandi

    2013-02-01

    Full Text Available A single-nucleotide polymorphism (SNP upstream of interleukin (IL28B was recently identified as an important predictor of the outcome of chronic hepatitis C patients treated with pegylated interferon plus ribavirin (PEG-IFN/RBV. The aim of this study was to investigate the association between the IL28B gene polymorphism (rs12979860 and virological response in chronic hepatitis C patients. Brazilian patients (n = 263 who were infected with hepatitis C virus (HCV genotype 1 and were receiving PEG-IFN/RBV were genotyped. Early virological response (EVR (12 weeks, end-of-treatment response (EOTR (48 weeks, sustained virological response (SVR (72 weeks and relapse were evaluated using conventional and quantitative polymerase chain reaction (PCR assays. The frequency of the C allele in the population was 39%. Overall, 43% of patients experienced SVR. The IL28B CC genotype was significantly associated with higher treatment response rates and a lower relapse rate compared to the other genotypes [84% vs. 58% EVR, 92% vs. 63% EOTR, 76% vs. 38% SVR and 17% vs. 40% relapse rate in CC vs. other genotypes (CT and TT, respectively]. Thus, the IL28B genotype appears to be a strong predictor of SVR following PEG-IFN/RBV therapy in treatment-naïve Brazilian patients infected with HCV genotype 1. This study, together with similar research examining other SNPs, should help to define adequate protocols for the treatment of patients infected with HCV genotype 1, especially those with a poor prognosis.

  9. Conditions required for the appearance of double responses in hippocampal field CA1 to application of single stimuli to Shäffer collaterals in freely moving rats.

    Science.gov (United States)

    Zosimovskii, V A; Korshunov, V A; Markevich, V A

    2008-03-01

    Stimulation of Shäffer collaterals with single current impulses could evoke double responses in hippocampal field CA1 in freely moving rats. The late response - the population excitatory postsynaptic potential with a preceding transient potential, often biphasic - occurred only after an early population spike and was time-locked to it. The shape characteristics of the late response, its polarity, and its latent period relative to the early population spike suggest that stimulation of Shäffer collaterals gives rise, in CA1, to a wave of excitation which passes through the entorhinal cortex and returns to CA1 directly via fibers of the perforant path. In conscious rats, medium-strength stimulation of Shäffer collaterals, sufficient to evoke a quite early population spike in CA1, did not usually lead to the appearance of a late response; the same stimulation became effective after tetanization of Shäffer collaterals in conditions of long-term potentiation of the early population spike. Furthermore, the appearance of the late response was facilitated in rats falling asleep on the background of high-amplitude, low-frequency EEG oscillations in CA1 characteristic of slow-wave sleep, as well as in sleeping rats, regardless of the EEG pattern.

  10. [Conditions required for appearance of a double response to a single-shock stimulation of Schaffer collaterals in hippocampal field CA1 in freely moving rats].

    Science.gov (United States)

    Zosimovskiĭ, V A; Korshunov, V A; Markevich, V A

    2007-01-01

    Schaffer collateral stimulation with a single current impulse can evoke a double response in hippocampal field CA1 of freely moving rats. The late response appears as a population excitatory postsynaptic potential with a preceding short-term potential (frequently biphasic) only after the early population spike and is time-locked to it. The wave shape and polarity of the late response, its latency with respect to the peak of the early population spike suggest that the excitation wave produced in the CA1 field by the stimulation of Schaffer collaterals passes across the entorhinal cortex and returns to the CA1 directly via the perforant path fibers. In waking rat, the medium-intensity stimulation of Schaffer collaterals (able to evoke in the CA1 an early population spike of sufficiently high amplitude) usually does not result in the appearance of the late response. However, similar stimulation becomes efficient after the tetanization of Schaffer collaterals, under conditions of the long-term potentiation of the early population spike. Moreover, the late response occurrence is facilitated in a rat falling asleep after the development in the CA1 of high-amplitude low-frequency EEG oscillations typical for the slow-wave sleep and in a sleeping rat independently of the EEG pattern.

  11. Optical imaging for monitoring tumor oxygenation response after initiation of single-agent bevacizumab followed by cytotoxic chemotherapy in breast cancer patients.

    Directory of Open Access Journals (Sweden)

    Shigeto Ueda

    Full Text Available PURPOSE: Optical imaging techniques for measuring tissue hemoglobin concentration have been recently accepted as a way to assess tumor vascularity and oxygenation. We investigated the correlation between early optical response to single-agent bevacizumab and treatment outcome. METHODS: Seven patients with advanced or metastatic breast cancer were treated with single-agent bevacizumab followed by addition of weekly paclitaxel. Optical imaging of patient's breasts was performed to measure tumor total hemoglobin concentration (tHb and oxygen saturation (stO2 at baseline and on days 1, 3, 6, 8, and 13 after the first infusion of bevacizumab. To assess early metabolic response, 2-deoxy-2-(18F-fluoro-D-glucose (FDG positron emission tomography/computed tomography (PET/CT, 18F-fluoromisonidazole (FMISO-PET/CT, and magnetic resonance imaging were performed at baseline and after two cycles of the regimen. RESULTS: Seven patients were grouped as responders (n = 4 and nonresponders (n = 3 on the basis of metabolic response measured by FDG-PET/CT. The responders showed remarkable tumor shrinkage and low accumulations of FMISO tracer relative to those of the nonresponders at the completion of two cycles of chemotherapy. Tumors of both groups showed remarkable attenuation of mean tHb as early as day 1 after therapy initiation. The nonresponders had lower baseline stO2 levels compared with adjacent breast tissue stO2 levels along with a pattern of steadily low stO2 levels during the observation window. On the other hand, the responders appeared to sustain high stO2 levels with temporal fluctuation. CONCLUSIONS: Low tumor stO2 level after single-agent bevacizumab treatment was characteristic of the nonresponders. Tumor stO2 level could be a predictor of an additional benefit of bevacizumab over that provided by paclitaxel.

  12. Dynamic response of a single-walled carbon nanotube under a moving harmonic load by considering modified nonlocal elasticity theory

    Science.gov (United States)

    Rahmani, O.; Shokrnia, M.; Golmohammadi, H.; Hosseini, S. A. H.

    2018-02-01

    Transverse forced vibration of a single-walled carbon nanotube (SWCNT) under excitation of a moving harmonic load has been analyzed based on modified nonlocal elasticity theory. In the parametric study, influences of nonlocal parameter, velocity of the moving load, excitation frequency, order of derivative and their interactive effects on forced deflection of the nanotube have been investigated in details. Numerical amounts of the dimensionless static deflection of the SWCNT have been calculated and compared with those of existing papers and an excellent agreement has been achieved. The results show that the variation of N affects the dynamic deflection and natural frequency of SWCNTs, significantly. Also by amplification of the excitation frequency, differences between the amounts of dynamic deflection become smaller for various values of N . Furthermore, decreasing the frequency ratio causes a reduction of the maximum deflection and increasing the frequency ratio causes an increase of the maximum deflection for values of load velocity which are greater than a specified value.

  13. Single DV-DXCCII Based Voltage Controlled First Order All-pass Filter with Inverting and Non-inverting responses

    Directory of Open Access Journals (Sweden)

    B Chaturvedi

    2015-12-01

    Full Text Available In this paper, a new voltage controlled first order all-pass filter is presented. The proposed circuit employs a single differential voltage dual-X second generation current conveyor (DV-DXCCII and a grounded capacitor only. The proposed all-pass filter provides both inverting and non inverting voltage-mode outputs from the same configuration simultaneously without any matching condition. Non-ideal analysis along with sensitivity analysis is also investigated. The proposed circuit has low active and passive sensitivities. As an application the proposed all-pass filter is connected in cascade to get higher order filter. The theoretical results are validated thorough PSPICE simulations using TSMC 0.18µm CMOS process parameters.

  14. Postprandial lipid responses of butter blend containing fish oil in a single-meal study in humans

    DEFF Research Database (Denmark)

    Overgaard, Julie; Porsgaard, Trine; Guo, Zheng

    2008-01-01

    The postprandial effects of a butter product containing fish oil were investigated in a single-meal, randomized crossover study with a commercial butter product as the control. Twelve healthy males consumed two test meals with (13)C-labelled cholesterol (45 mg) and either an interesterified butter...... blend with fish oil (352 mg n-3 long-chain PUFA (LCPUFA)) or the commercial butter blend. Blood samples were collected after the meals and in the fasting condition on the test day and the following morning, and were analysed for cholesterol absorption, plasma lipid profile and fatty acid composition....... No significant difference in the postprandial plasma fatty acid composition was observed between the groups, neither difference in cholesterol absorption, plasma cholesterol or the cholesterol contents of plasma lipoproteins. The incorporation of fish oil in the butter resulted in a significant lower...

  15. Monte Carlo study on pulse response of underwater optical channel

    Science.gov (United States)

    Li, Jing; Ma, Yong; Zhou, Qunqun; Zhou, Bo; Wang, Hongyuan

    2012-06-01

    Pulse response of the underwater wireless optical channel is significant for the analysis of channel capacity and error probability. Traditional vector radiative transfer theory (VRT) is not able to deal with the effect of receiving aperture. On the other hand, general water tank experiments cannot acquire an accurate pulse response due to the limited time resolution of the photo-electronic detector. We present a Monte Carlo simulation model to extract the time-domain pulse response undersea. In comparison with the VRT model, a more accurate pulse response for practical ocean communications could be achieved through statistical analysis of the received photons. The proposed model is more reasonable for the study of the underwater optical channel.

  16. Construct validity and responsiveness of the single-item presenteeism question in patients with lower back pain for the measurement of presenteeism.

    Science.gov (United States)

    Kigozi, Jesse; Lewis, Martyn; Jowett, Sue; Barton, Pelham; Coast, Joanna

    2014-03-01

    Validity and responsiveness study using a randomized clinical trial and prospective cohort study of patients with low back pain (LBP). To provide evidence for construct validity and responsiveness to change of a single-item presenteeism question (SIPQ) in patients with LBP. The SIPQ is a simple, easy to administer tool that has been used to measure the impact of back pain on reduced productivity at work (presenteeism) as a standalone measure. Evidence supporting the validity and responsiveness of the SIPQ among patients with back pain is however lacking. The SIPQ was administered to patients consulting for back pain in a randomized controlled trial (N = 851) and a cohort intervention study (N = 922). Construct validity was assessed using convergent, divergent, and known-group validity. The validity investigation included assessing associations between the SIPQ and pain, disability, psychological, health status, and quality of life measures. Responsiveness was assessed using external indicators of change as comparators, evaluating correlation of clinical change scores and effect size statistics. Moderate to strong correlations were found between presenteeism and pain (r: 0.44-0.77), disability (r: 0.53-0.70), and 12-Item Short Form Health Survey physical dimensions (r: -0.66 to -0.55). Presenteeism was strongly associated with disease-specific pain and disability scales. The SIPQ was responsive to changes in productivity-presenteeism change scores indicated strong correlation with change scores, and high responsiveness in distribution- and anchor-based testing. The SIPQ is a potentially valid and responsive tool for assessing the impact of back pain on presenteeism. This SIPQ could, with relative ease, facilitate further research on the estimation of presenteeism within economic evaluation studies of musculoskeletal conditions, thus providing policymakers with estimates of economic impact of musculoskeletal disease. Further evidence is, however, merited to assess

  17. EFFECTS OF PREANESTHETIC SINGLE DOSE INTRAVENOUS DEXMEDETOMIDINE VERSUS FENTANYL ON HEMODYNAMIC RESPONSE TO ENDOTRACHEAL INTUBATION-A CLINICAL COMPARATIVE STUDY

    Directory of Open Access Journals (Sweden)

    Chandita

    2015-12-01

    Full Text Available INTRODUCTION Many pharmacological agents have been evaluated in regards to their efficacy of blunting the adverse cardiovascular response to laryngoscopy and tracheal intubation. The aim of this study was to evaluate the efficacy of dexmedetomidine compared to fentanyl in blunting the haemodynamic response to laryngoscopy and intubation. METHOD Sixty patients were randomly allocated into two groups (30 patients in each group. The group D received intravenously 1 µgm/kg dexmedetomidine infusion and group F received 2µgm/kg fentanyl infusion. The study drugs were prepared in an identical looking container and were infused fifteen minutes prior to induction of anaesthesia. The study drugs were infused over a period of ten minutes and all the patients underwent a similar anaesthetics technique. Heart rate (HR and blood pressure (systolic, diastolic and mean blood pressure were noted at baseline, at the end of infusion of the study drugs, after induction of anaesthesia, immediately after laryngoscopy and intubation and at 1, 3, 5, 7 and 10 minutes after laryngoscopy and intubation. RESULTS HR significantly decreased in the group D when compared to group F immediately after study drug infusion and there was statistically significant reduction in heart rate for up to 5 min after intubation in both the groups. Although HR increased after intubation in both the groups, the magnitude was lower in the group D. In both the groups, laryngoscopy and intubation led to an increase in systolic, diastolic and mean arterial pressure; the magnitude was lower in the group D. CONCLUSION Dexmeditomidine (1µ/kg attenuates these untoward responses of laryngoscopy and intubation more effectively than fentanyl (2 µ/kg when administered as bolus dose in the pre-induction period of general anaesthesia.

  18. Low-dose DNA damage and replication stress responses quantified by optimized automated single-cell image analysis

    DEFF Research Database (Denmark)

    Mistrik, Martin; Oplustilova, Lenka; Lukas, Jiri

    2009-01-01

    Maintenance of genome integrity is essential for homeostasis and survival as impaired DNA damage response (DDR) may predispose to grave pathologies such as neurodegenerative and immunodeficiency syndromes, cancer and premature aging. Therefore, accurate assessment of DNA damage caused...... and demand for trained personnel. Here we present an option how to transform a regular fluorescence microscope and personal computer with common software into a functional alternative to high-throughput screening devices. In two detailed protocols we introduce a new semi-automatic procedure allowing for very...

  19. Hepatic responses of gene expression in juvenile brown trout (Salmo trutta lacustris) exposed to three model contaminants applied singly and in combination.

    Science.gov (United States)

    Krasnov, Aleksei; Afanasyev, Sergey; Oikari, Aimo

    2007-01-01

    Chemical pollution of the aquatic environment is almost always the result of multiple rather than single toxic compounds. The possibility of separating the effects of key risk chemicals from those of others, including theirjoint effects, is of clear theoretical interest and high technical importance. We addressed this goal using multiple gene expression profiling in the liver of juvenile brown trout (Salmo trutta lacustris) exposed to three model chemicals (cadmium, carbon tetrachloride [CCl4], and pyrene) administered singly, in binary and trinary combinations at low acutely sublethal concentrations, and in the partial dose-response manner. Differentially expressed genes were grouped by correlation of profiles, and the dependence on dose was analyzed with multiple regression. Responses to cadmium and CCl4 were largely similar, and no sign of interaction was observed (i.e., in binary combinations, the effects were equal to those produced by the more potent compound, cadmium). Joint effects became apparent in the presence of pyrene, which caused markedly different alterations in gene expression. Using the results of 118 experiments conducted earlier for comparison, we found a group of 23 genes responding to chemical toxicity (cadmium, CCl4, pyrene, and resin acids) with significantly higher probability than that of responding to other stressors (handling or viral and bacterial infections). This group included genes implicated in the immune and stress responses that were markedly enriched in extracellular proteins. In conclusion, we demonstrated that chemical-characteristic genomic endpoints often remain when the chemical is present as part of a binary or a trinary mixture. Despite dissimilar chemistry and different cellular targets, the degree of responses to the combination of cadmium and CCl4 appeared to be less than additive. Chemical interactions or nonadditive effects manifested when a compound with a markedly different mode of action (pyrene) was included into

  20. Rapid Response of Long-Standing, Treatment-Resistant Non-Catatonic Mutism in Paranoid Schizophrenia with Single ECT session.

    Science.gov (United States)

    Dar, Mansoor Ahmad; Rather, Yasir Hassan; Shah, Majid Shafi; Wani, Rayees Ahmad; Hussain, Arshad

    2014-11-01

    Mutism is a common manifestation of catatonia, but mutism due to other forms of psychopathology and neurological disorders have also been described. Although not common, long-standing mutism has also been a feature of non-catatonic schizophrenia and traditionally responds less to conventional therapies. We describe a rare case of paranoid schizophrenia presenting with continuous mutism for about 4 years. This 26-year-old male had symptoms of schizophrenia without catatonia. After failed trial of adequate pharmacotherapy and psychological intervention and considering his level of dysfunction, he was started on electroconvulsive therapy (ECT). To our surprise, he improved with a single session of ECT while he was on concurrent pharmacotherapy. We also discuss the possible explanation for this rapid effect of ECT in such clinical presentation. To our knowledge, this is the first case of non-catatonic mutism of schizophrenia of this long duration responding so promptly to ECT, although there are other reports as well in literature, but multiple ECT sessions were applied in those cases. Non-catatonic mutism is perhaps presenting as a cultural variant in this part of the world and whenever encountered, ECT should be an option. Further research should be carried out to validate this idea.

  1. Postprandial lipid responses of butter blend containing fish oil in a single-meal study in humans.

    Science.gov (United States)

    Overgaard, Julie; Porsgaard, Trine; Guo, Zheng; Lauritzen, Lotte; Mu, Huiling

    2008-10-01

    The postprandial effects of a butter product containing fish oil were investigated in a single-meal, randomized crossover study with a commercial butter product as the control. Twelve healthy males consumed two test meals with (13)C-labelled cholesterol (45 mg) and either an interesterified butter blend with fish oil (352 mg n-3 long-chain PUFA (LCPUFA)) or the commercial butter blend. Blood samples were collected after the meals and in the fasting condition on the test day and the following morning, and were analysed for cholesterol absorption, plasma lipid profile and fatty acid composition. No significant difference in the postprandial plasma fatty acid composition was observed between the groups, neither difference in cholesterol absorption, plasma cholesterol or the cholesterol contents of plasma lipoproteins. The incorporation of fish oil in the butter resulted in a significant lower concentration of triacylglycerols in the plasma 2 h after the meal in comparison with the commercial butter blend (p = 0.02); there was, however, no significant difference 24 h after the meal. In conclusion, fish oil-enriched butter blend provides a source to increase the intake of n-3 LCPUFA in the population, but has no acute effect on cholesterol absorption and plasma cholesterol concentration in human.

  2. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  3. Disparity in Cutaneous Pigmentary Response to LED vs Halogen Incandescent Visible Light: Results from a Single Center, Investigational Clinical Trial Determining a Minimal Pigmentary Visible Light Dose.

    Science.gov (United States)

    Soleymani, Teo; Cohen, David E; Folan, Lorcan M; Okereke, Uchenna R; Elbuluk, Nada; Soter, Nicholas A

    2017-11-01

    Background: While most of the attention regarding skin pigmentation has focused on the effects of ultraviolet radiation, the cutaneous effects of visible light (400 to 700nm) are rarely reported. The purpose of this study was to investigate the cutaneous pigmentary response to pure visible light irradiation, examine the difference in response to different sources of visible light irradiation, and determine a minimal pigmentary dose of visible light irradiation in melanocompetent subjects with Fitzpatrick skin type III - VI. The study was designed as a single arm, non-blinded, split-side dual intervention study in which subjects underwent visible light irradiation using LED and halogen incandescent light sources delivered at a fluence of 0.14 Watts/cm2 with incremental dose progression from 20 J/cm2 to 320 J/cm2. Pigmentation was assessed by clinical examination, cross-polarized digital photography, and analytic colorimetry. Immediate, dose-responsive pigment darkening was seen with LED light exposure in 80% of subjects, beginning at 60 Joules. No pigmentary changes were seen with halogen incandescent light exposure at any dose in any subject. This study is the first to report a distinct difference in cutaneous pigmentary response to different sources of visible light, and the first to demonstrate cutaneous pigment darkening from visible LED light exposure. Our findings raise the concern that our increasing daily artificial light surroundings may have clandestine effects on skin biology. J Drugs Dermatol. 2017;16(11):1105-1110..

  4. A vapor response mechanism study of surface-modified single-walled carbon nanotubes coated chemiresistors and quartz crystal microbalance sensor arrays.

    Science.gov (United States)

    Lu, Hung-Ling; Lu, Chia-Jung; Tian, Wei-Cheng; Sheen, Horn-Jiunn

    2015-01-01

    This paper compares the selectivity and discusses the response mechanisms of various surface-modified, single-walled carbon nanotube (SWCNT)-coated sensor arrays for the detection of volatile organic compounds (VOCs). Two types of sensor platforms, chemiresistor and quartz crystal microbalance (QCM), were used to probe the resistance changes and absorption masses during vapor sensing. Four sensing materials were used in this comparison study: pristine, acidified, esterified, and surfactant (sodium dodecyl sulfate, SDS)-coated SWCNTs. SWCNT-coated QCMs reached the response equilibrium faster than the chemiresistors did, which revealed a delay diffusion behavior at the inter-tube junction. In addition, the calibration lines for QCMs were all linear, but the chemiresistors showed curvature calibration lines which indicated less effectiveness of swelling at high concentrations. While the sorption of vapor molecules caused an increase in the resistance for most SWCNTs due to the swelling, the acidified SWCNTs showed no responses to nonpolar vapors and a negative response to hydrogen bond acceptors. This discovery provided insight into the inter-tube interlocks and conductivity modulation of acidified SWCNTs via a hydrogen bond. The results in this study provide a stepping-stone for further understanding of the mechanisms behind the vapor selectivity of surface-modified SWCNT sensor arrays. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Responses of peptide-specific T cells to stimulation with polystyrene beads carrying HLA class I molecules loaded with single peptides.

    Science.gov (United States)

    Chersi, Alberto; Galati, Rossella; Accapezzato, Daniele; Francavilla, Vittorio; Barnaba, Vincenzo; Butler, Richard H; Tanigaki, Nobuyuki

    2004-08-01

    Cell-sized microbeads carrying single peptide-loaded HLA class I molecules were prepared for HLA-A2 and HLA-B7 by a simple procedure which transfers single peptide-loaded HLA class I molecules from cultured cells to polystyrene beads using anti-peptide antibodies directed to an intracellular segment of HLA-A alpha chains. The surface density of peptide-loaded HLA class I molecules on beads was comparable to that on the peptide-loaded cells. HLA-A2 beads loaded with an HCV peptide HCV1073 were tested for stimulation activity on an HCV1073-specific CD8+ T cell clone NS3-1. A substantial level of gamma-IFN production was induced. The stimulation was peptide-specific. The efficiency was dependent on the bead concentration and the surface HLA class I density on beads and enhanced significantly by co-coupling of anti-CD28 to peptide-loaded beads. The peptide-loading efficiency on HLA class I molecules and the transfer efficiency of HLA class I molecules to polystyrene beads were reasonably high for HLA-A2 and HLA-B7. Thus, polystyrene beads carrying these single peptide-loaded HLA class I molecules are potentially useful in further analysis of the co-stimulatory or inhibitory factors involved in CD8+ T cell responses and eventually in detection of cytotoxic T cells in PBLs.

  6. Effect of relative hypoparathyroidism on the responsiveness to recombinant human erythropoietin in chronic hemodialysis patients: A single Saudi center experience

    Directory of Open Access Journals (Sweden)

    Khalid Al Saran

    2013-01-01

    Full Text Available Anemia is a common concomitant disorder in dialysis patients. The responsiveness to recombinant human erythropoietin in hemodialysis (HD patients with relative hypoparathyroidism [4 ≤ intact parathyroid hormone (iPTH ≤16.5 pmol/L] remains undetermined. We retrospectively studied 70 chronic hemodialysis patients who were divided into two groups: Group A (32 patients had 16.5 ≤ iPTH levels <33.5 pmol/L and Group B (38 patients had 4 ≥ iPTH≤16.5 pmol/L during the preceding six months without 1- (OH Vitamin D3 administration. The percentage of female gender was significantly higher in Group B compared with Group A (P = 0.018. In Groups A and B, the mean weekly recombinant human erythropoietin dose (U/kg/ week was 227.96 ± 95.24 vs. 154.1 ± 84.9 (P = 0.001 and the mean hemoglobin level was 11.15 ± 0.63 g/dL versus 11.62 ± 0.63 g/dL (P = 0.008. There was no significant statistical difference regarding the other biochemical markers (serum ferritin, iron saturation, serum Ca, serum alkaline phosphatase, C-reactive protein, serum B12, serum folate levels, residual renal function and Kt/v between the groups. If other factors related to anemia are excluded in chronic HD patients, the lower the iPTH level (relative hypoparathyroidism the better the responsiveness to recombinant human erythropoietin.

  7. A nuclear-encoded chloroplast protein harboring a single CRM domain plays an important role in the Arabidopsis growth and stress response.

    Science.gov (United States)

    Lee, Kwanuk; Lee, Hwa Jung; Kim, Dong Hyun; Jeon, Young; Pai, Hyun-Sook; Kang, Hunseung

    2014-04-16

    Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts.

  8. Equine influenza: evaluation of the humoral immune response through the hemagglutination inhibition and single radial haemolysis, in vaccinated horses with commercial and experimental vaccines

    Directory of Open Access Journals (Sweden)

    Dalva Assunção Portari Mancini

    1996-03-01

    Full Text Available Equine Influenza: evaluation of the humoral immune response through the hemagglutination inhibition and single radial haemolysis, in horses vaccinated with commercial and experimental vaccines. From 4 equine groups, the antibody protection levels against influenza were evaluted through the hemagglutination inhibition and single radial haemolysis. One group of these animals received immunization from 2 doses of influenza vaccine, of experimental preparation, at the Butantan Institute, São Paulo, Brasil (IB. Two other horse groups, regularly vaccinated received the annual booster dose from both commercial and experimental vaccines (IB. A control group remained without vaccination. Differences were observed among the antibody level medians of the serum samples harvested prior and post immunization of those vaccinated animals. No evident differences were detected among the antibody level medians from animals that received annual booster doses, due to the persistence of the protective antibody level, 12 months after the regular immunization. In the control group, the animals showed low antibody levels, for both serum samples. In fact these results suggested the good serologic response of both vaccines, the commercial and the experimental, tested preparations.

  9. Correlation of uptake patterns on single-photon emission computed tomography/computed tomography (SPECT/CT)and treatment response in patients with knee pain

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Geon; Hwang, Kyung Hoon; Lee, Hae Jin; Kim, Seog Gyun; Lee, Beom Koo [Gachon University Gil Hospital, Incheon (Korea, Republic of)

    2016-06-15

    To determine whether treatment response in patients with knee pain could be predicted using uptake patterns on single-photon emission computed tomography/computed tomography (SPECT/CT) images. Ninety-five patients with knee pain who had undergone SPECT/CT were included in this retrospective study. Subjects were divided into three groups: increased focal uptake (FTU), increased irregular tracer uptake (ITU), and no tracer uptake (NTU). A numeric rating scale (NRS-11) assessed pain intensity. We analyzed the association between uptake patterns and treatment response using Pearson's chi-square test and Fisher's exact test. Uptake was quantified from SPECT/CT with region of interest (ROI) counting, and an intraclass correlation coefficient (ICC) calculated agreement. We used Student' t-test to calculate statistically significant differences of counts between groups and the Pearson correlation to measure the relationship between counts and initial NRS-1k1. Multivariate logistic regression analysis determined which variables were significantly associated with uptake. The FTU group included 32 patients; ITU, 39; and NTU, 24. With conservative management, 64 % of patients with increased tracer uptake (TU, both focal and irregular) and 36 % with NTU showed positive response. Conservative treatment response of FTU was better than NTU, but did not differ from that of ITU. Conservative treatment response of TU was significantly different from that of NTU (OR 3.1; p 0.036). Moderate positive correlation was observed between ITU and initial NRS-11. Age and initial NRS-11 significantly predicted uptake. Patients with uptake in their knee(s) on SPECT/CT showed positive treatment response under conservative treatment.

  10. Tumor response and toxicity after single high-dose versus standard five-day divided-dose dactinomycin in childhood rhabdomyosarcoma.

    Science.gov (United States)

    Carli, M; Pastore, G; Perilongo, G; Grotto, P; De Bernardi, B; Ceci, A; Di Tullio, M; Madon, E; Pianca, C; Paolucci, G

    1988-04-01

    This report deals with a randomized prospective multicentric clinical trial in childhood rhabdomyosarcoma (RMS) conducted to evaluate the toxicity and the effectiveness of dactinomycin (ACT-D) administered as high, single doses v five-day, divided doses administered in combination with vincristine (VCR) and cyclophosphamide (CYC). Fifty-five group III evaluable patients (pts) less than 15 years of age with tumor size greater than 5 cm in diameter, without high-risk features of CNS involvement, and 15 group IV RMS pts were randomized to receive VAC as primary chemotherapy (CT): VCR, 1.5 mg/m2 intravenously (IV) days 1 and 8; CYC, 275 mg/m2 IV days 1 through 5; and ACT-D, 0.45 mg/m2 IV days 1 through 5 every 28 days for three cycles (33 pts), or VAC-M: CYC, 150 mg/m2 intramuscularly (IM) days 1 through 7; VCR, 2.0 mg/m2 IV day 8; and ACT-D, 1.7 mg/m2 IV day 8 every 21 days for four cycles (37 pts). Major responses (complete plus partial responses [PR]) were obtained in 67% of the VAC pts and in 70% of the VAC-M pts. Toxic effects were low, and no increased toxicity was observed in pts treated with high, single-dose ACT-D. These results confirm the effectiveness and feasibility of single, high doses of ACT-D with the advantage of requiring less pt hospitalization.

  11. Parasympathetic activity and blood catecholamine responses following a single partial-body cryostimulation and a whole-body cryostimulation.

    Directory of Open Access Journals (Sweden)

    Christophe Hausswirth

    Full Text Available The aim of this study was to compare the effects of a single whole-body cryostimulation (WBC and a partial-body cryostimulation (PBC (i.e., not exposing the head to cold on indices of parasympathetic activity and blood catecholamines. Two groups of 15 participants were assigned either to a 3-min WBC or PBC session, while 10 participants constituted a control group (CON not receiving any cryostimulation. Changes in thermal, physiological and subjective variables were recorded before and during the 20-min after each cryostimulation. According to a qualitative statistical analysis, an almost certain decrease in skin temperature was reported for all body regions immediately after the WBC (mean decrease±90% CL, -13.7±0.7°C and PBC (-8.3±0.3°C, which persisted up to 20-min after the session. The tympanic temperature almost certainly decreased only after the WBC session (-0.32±0.04°C. Systolic and diastolic blood pressures were very likely increased after the WBC session, whereas these changes were trivial in the other groups. In addition, heart rate almost certainly decreased after PBC (-10.9% and WBC (-15.2% sessions, in a likely greater proportion for WBC compared to PBC. Resting vagal-related heart rate variability indices (the root-mean square difference of successive normal R-R intervals, RMSSD, and high frequency band, HF were very likely increased after PBC (RMSSD: +54.4%, HF: +138% and WBC (RMSSD: +85.2%, HF: +632% sessions without any marked difference between groups. Plasma norepinephrine concentrations were likely to very likely increased after PBC (+57.4% and WBC (+76.2%, respectively. Finally, cold and comfort sensations were almost certainly altered after WBC and PBC, sensation of discomfort being likely more pronounced after WBC than PBC. Both acute cryostimulation techniques effectively stimulated the autonomic nervous system (ANS, with a predominance of parasympathetic tone activation. The results of this study also suggest

  12. Cell culture (Vero cell) derived whole-virus non-adjuvanted H5N1 influenza vaccine induces long-lasting cross-reactive memory immune response: homologous or heterologous booster response following two dose or single dose priming.

    Science.gov (United States)

    van der Velden, Maikel V W; Aichinger, Gerald; Pöllabauer, Eva Maria; Löw-Baselli, Alexandra; Fritsch, Sandor; Benamara, Karima; Kistner, Otfried; Müller, Markus; Zeitlinger, Markus; Kollaritsch, Herwig; Vesikari, Timo; Ehrlich, Hartmut J; Barrett, P Noel

    2012-09-21

    Influenza pandemic preparedness involves priming of the population with pre-pandemic vaccines. Such vaccines should be well tolerated and induce a long-lasting immunological memory that can effectively be boosted with a single dose of pandemic vaccine once available. The presented studies assessed different prime-boost regimens with a Vero cell-derived whole virus non-adjuvanted H5N1 vaccine. In one study, 281 healthy adult (18-59 years) and 280 elderly (≥ 60 years) subjects received two vaccinations, 21 days apart, with Vero cell-derived whole virus non-adjuvanted H5N1 vaccine (7.5 μg HA Antigen A/Vietnam/1203/2004) followed by a 6, 12-15, or 24 month booster (7.5 or 3.75μg A/Indonesia/05/2005 or A/Vietnam/1203/2004). In the other study, 230 healthy adults (18-59 years) received single dose priming (7.5 μg A/Vietnam/1203/2004) followed by a 12 month booster (7.5 or 3.75 μg A/Indonesia/05/2005). Antibody responses were assessed by microneutralization (MN) and single radial hemolysis (SRH) assay. Vaccine safety was assessed throughout. Two dose priming was equally immunogenic in adults and the elderly: >72% of subjects in each population achieved MN titers ≥ 1:20 after the second vaccination. Booster vaccinations at 6, 12-15, and 24 months induced substantial antibody increases to both strains: after a 7.5 μg A/Indonesia/05/2005 booster, 93-95% of adults and 72-84% of the elderly achieved MN titers ≥ 1:20 against this strain. Homologous and heterologous booster responses were higher in the 7.5μg dose group than in the 3.75 μg dose group. Booster responses following single dose priming were similar; a 7.5 μg booster dose induced homologous MN titers ≥ 1:20 in 93% of subjects. A Vero cell derived whole virus non-adjuvanted H5N1 influenza vaccine is well tolerated and induces long-lasting cross-clade immunological memory that can be effectively boosted 1-2 years after two dose or single dose priming, supporting its suitability for pre

  13. Comparison of antigen-specific T-cell responses of tuberculosis patients using complex or single antigens of Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Mustafa, A S; Amoudy, H A; Wiker, H G

    1998-01-01

    We have screened peripheral blood mononuclear cells (PBMC) from tuberculosis (TB) patients for proliferative reactivity and interferon-gamma (IFN-gamma) secretion against a panel of purified recombinant (r) and natural (n) culture filtrate (rESAT-6, nMPT59, nMPT64 and nMPB70) and somatic-derived (r......GroES, rPstS, rGroEL and rDnaK) antigens of Mycobacterium tuberculosis. The responses of PBMC to these defined antigens were compared with the corresponding results obtained with complex antigens, such as whole-cell M. tuberculosis, M. tuberculosis culture filtrate (MT-CF) and cell wall antigens, as well...... as the vaccine strain, Mycobacterium bovis bacillus Calmette-Guerin (BCG). In addition, M. tuberculosis and MT-CF-induced T-cell lines were tested in the same assays against the panel of purified and complex antigens. The compiled data from PBMC and T-cell lines tested for antigen-induced proliferation and IFN...

  14. Simultaneous estimation of population receptive field and hemodynamic parameters from single point BOLD responses using Metropolis-Hastings sampling.

    Science.gov (United States)

    Adaszewski, Stanisław; Slater, David; Melie-Garcia, Lester; Draganski, Bogdan; Bogorodzki, Piotr

    2018-01-30

    We introduce a new approach to Bayesian pRF model estimation using Markov Chain Monte Carlo (MCMC) sampling for simultaneous estimation of pRF and hemodynamic parameters. To obtain high performance on commonly accessible hardware we present a novel heuristic consisting of interpolation between precomputed responses for predetermined stimuli and a large cross-section of receptive field parameters. We investigate the validity of the proposed approach with respect to MCMC convergence, tuning and biases. We compare different combinations of pRF - Compressive Spatial Summation (CSS), Dumoulin-Wandell (DW) and hemodynamic (5-parameter and 3-parameter Balloon-Windkessel) models within our framework with and without the usage of the new heuristic. We evaluate estimation consistency and log probability across models. We perform as well a comparison of one model with and without lookup table within the RStan framework using its No-U-Turn Sampler. We present accelerated computation of whole-ROI parameters for one subject. Finally, we discuss risks and limitations associated with the usage of the new heuristic as well as the means of resolving them. We found that the new algorithm is a valid sampling approach to joint pRF/hemodynamic parameter estimation and that it exhibits very high performance. Copyright © 2018. Published by Elsevier Inc.

  15. Airway responses and inflammation in subjects with asthma after four days of repeated high-single-dose allergen challenge

    Directory of Open Access Journals (Sweden)

    Schulze Johannes

    2012-09-01

    Full Text Available Abstract Background Both standard and low-dose allergen provocations are an established tool in asthma research to improve our understanding of the pathophysiological mechanism of allergic asthma. However, clinical symptoms are less likely to be induced. Therefore, we designed a protocol for repetitive high-dose bronchial allergen challenges to generate clinical symptoms and airway inflammation. Methods A total of 27 patients aged 18 to 40 years with positive skin-prick tests and mild asthma underwent repetitive high-dose allergen challenges with household dust mites for four consecutive days. Pulmonary function and exhaled NO were measured at every visit. Induced sputum was analysed before and after the allergen challenges for cell counts, ECP, IL-5, INF-γ, IL-8, and the transcription factor Foxp3. Results We found a significant decrease in pulmonary function, an increased use of salbutamol and the development of a late asthmatic response and bronchial hyperresponsiveness, as well as a significant induction of eNO, eosinophils, and Th-2 cytokines. Repeated provocation was feasible in the majority of patients. Two subjects had severe adverse events requiring prednisolone to cope with nocturnal asthma symptoms. Conclusions Repeated high-dose bronchial allergen challenges resulted in severe asthma symptoms and marked Th-2-mediated allergic airway inflammation. The high-dose challenge model is suitable only in an attenuated form in diseased volunteers for proof-of-concept studies and in clinical settings to reduce the risk of severe asthma exacerbations. Trial registration ClinicalTrials.govNCT00677209

  16. Predictive role of multiple gene alterations in response to cetuximab in metastatic colorectal cancer: A single center study

    Directory of Open Access Journals (Sweden)

    Ulivi Paola

    2012-05-01

    Full Text Available Abstract Background KRAS mutations negatively affect outcome after treatment with cetuximab in metastatic colorectal cancer (mCRC patients. As only 20% of KRAS wild type (WT patients respond to cetuximab it is possible that other mutations, constitutively activating the EGFR pathway, are present in the non-responding KRAS WT patients. We retrospectively analyzed objective tumor response rate, (ORR progression-free (PFS and overall survival (OS with respect to the mutational status of KRAS, BRAF, PIK3CA and PTEN expression in mCRC patients treated with a cetuximab-based regimen. Methods 67 mCRC patients were enrolled onto the study. DNA was extracted from paraffin-embedded sections derived from primary or metastatic lesions. Exon 2 of KRAS and exon 15 of BRAF were analyzed by direct sequencing, PIK3CA was evaluated by pyrosequencing and PTEN expression by immunohistochemistry. Results BRAF and PIK3CA mutations were independently associated with worse PFS (p = 0.006 and p = 0.028, respectively and OS (p = 0.008 and p = 0.029, respectively. No differences in clinical outcome were found between patients who were positive or negative for PTEN expression. Conversely, patients negative for KRAS, BRAF and PIK3CA mutations were characterized by significantly better ORR, PFS and OS than patients with at least one of these mutations. Conclusions BRAF and PIK3CA mutations would seem to be independent predictors of anti-EGFR therapy effectiveness and could be taken into consideration during treatment decision making.

  17. RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

    Directory of Open Access Journals (Sweden)

    Bo Liu

    Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

  18. Intersession consistency of single-trial classification of the prefrontal response to mental arithmetic and the no-control state by NIRS.

    Science.gov (United States)

    Power, Sarah D; Kushki, Azadeh; Chau, Tom

    2012-01-01

    Near-infrared spectroscopy (NIRS) has been recently investigated for use in noninvasive brain-computer interface (BCI) technologies. Previous studies have demonstrated the ability to classify patterns of neural activation associated with different mental tasks (e.g., mental arithmetic) using NIRS signals. Though these studies represent an important step towards the realization of an NIRS-BCI, there is a paucity of literature regarding the consistency of these responses, and the ability to classify them on a single-trial basis, over multiple sessions. This is important when moving out of an experimental context toward a practical system, where performance must be maintained over longer periods. When considering response consistency across sessions, two questions arise: 1) can the hemodynamic response to the activation task be distinguished from a baseline (or other task) condition, consistently across sessions, and if so, 2) are the spatiotemporal characteristics of the response which best distinguish it from the baseline (or other task) condition consistent across sessions. The answers will have implications for the viability of an NIRS-BCI system, and the design strategies (especially in terms of classifier training protocols) adopted. In this study, we investigated the consistency of classification of a mental arithmetic task and a no-control condition over five experimental sessions. Mixed model linear regression on intrasession classification accuracies indicate that the task and baseline states remain differentiable across multiple sessions, with no significant decrease in accuracy (p = 0.67). Intersession analysis, however, revealed inconsistencies in spatiotemporal response characteristics. Based on these results, we investigated several different practical classifier training protocols, including scenarios in which the training and test data come from 1) different sessions, 2) the same session, and 3) a combination of both. Results indicate that when

  19. Functional weight-bearing mobilization after Achilles tendon rupture enhances early healing response: a single-blinded randomized controlled trial.

    Science.gov (United States)

    Valkering, Kars P; Aufwerber, Susanna; Ranuccio, Francesco; Lunini, Enricomaria; Edman, Gunnar; Ackermann, Paul W

    2017-06-01

    Functional weight-bearing mobilization may improve repair of Achilles tendon rupture (ATR), but the underlying mechanisms and outcome were unknown. We hypothesized that functional weight-bearing mobilization by means of increased metabolism could improve both early and long-term healing. In this prospective randomized controlled trial, patients with acute ATR were randomized to either direct post-operative functional weight-bearing mobilization (n = 27) in an orthosis or to non-weight-bearing (n = 29) plaster cast immobilization. During the first two post-operative weeks, 15°-30° of plantar flexion was allowed and encouraged in the functional weight-bearing mobilization group. At 2 weeks, patients in the non-weight-bearing cast immobilization group received a stiff orthosis, while the functional weight-bearing mobilization group continued with increased range of motion. At 6 weeks, all patients discontinued immobilization. At 2 weeks, healing metabolites and markers of procollagen type I (PINP) and III (PIIINP) were examined using microdialysis. At 6 and 12 months, functional outcome using heel-rise test was assessed. Healing tendons of both groups exhibited increased levels of metabolites glutamate, lactate, pyruvate, and of PIIINP (all p bearing mobilization group demonstrated significantly higher concentrations of glutamate compared to the non-weight-bearing cast immobilization group (p = 0.045).The upregulated glutamate levels were significantly correlated with the concentrations of PINP (r = 0.5, p = 0.002) as well as with improved functional outcome at 6 months (r = 0.4; p = 0.014). Heel-rise tests at 6 and 12 months did not display any differences between the two groups. Functional weight-bearing mobilization enhanced the early healing response of ATR. In addition, early ankle range of motion was improved without the risk of Achilles tendon elongation and without altering long-term functional outcome. The relationship between

  20. Peri-implant tissue response following connective tissue and bone grafting in conjunction with immediate single-tooth replacement in the esthetic zone: a case series.

    Science.gov (United States)

    Tsuda, Hirotaka; Rungcharassaeng, Kitichai; Kan, Joseph Y K; Roe, Phillip; Lozada, Jaime L; Zimmerman, Grenith

    2011-01-01

    This case series evaluated the peri-implant tissue response following extraction and immediate placement and restoration of an implant in conjunction with subepithelial connective tissue grafting (SCTG) and bone grafting in the esthetic zone. Implant success rates and the peri-implant tissue response were also reported. Ten patients (four men, six women) with a mean age of 48 years (range, 35 to 70) underwent extraction and immediate tooth replacement with SCTG and were evaluated clinically and radiographically presurgically (T0), immediately after immediate tooth replacement and SCTG (T1), and at 3 months (T2), 6 months (T3), and 12 months (T4) after surgery. Data was analyzed using Friedman and Wilcoxon signed-ranks tests at the significance level of a = .05. At 1 year, all implants remained osseointegrated, with an overall mean marginal bone change of +0.10 mm and a mean facial gingival level change of -0.05 mm. Modified Plaque Index scores showed that patients were able to maintain a good level of hygiene throughout the study. Papilla Index scores indicated that at T4, more than 50% papilla fill was observed in 80% of all sites. The results of this case series suggest that, in addition to a favorable implant success rate and peri-implant tissue response, the facial gingival level around single immediately placed implants can also be maintained following connective tissue grafting when proper three-dimensional implant positioning is achieved and bone is grafted into the implant-socket gap.

  1. Murine CR1/2 targeted antigenized single-chain antibody fragments induce transient low affinity antibodies and negatively influence an ongoing immune response.

    Science.gov (United States)

    Prechl, József; Molnár, Eszter; Szekeres, Zsuzsanna; Isaák, Andrea; Papp, Krisztián; Balogh, Péter; Erdei, Anna

    2007-01-01

    We have generated a single-chain antibody which recognizes murine CR1/2 and carries a genetically fused influenza hemagglutinin derived peptide. Theoretically such a construct is able to crosslink the B cell antigen receptor and CR1/2 on peptide specific B cells. The construct was able to reach its CR1/2 positive target cells, yet intraperitoneal delivery of the construct elicited an IgM response only slightly exceeding that induced by the free peptide. Providing T cell help by the injection of peptide specific lymphocytes did not alter the response in essence, that is anti-peptide IgG was not detectable even after booster immunizations. When used as a booster vaccine following injection of the peptide in adjuvant, the construct even inhibited the development of IgG1 and IgG3 anti-peptide antibodies. These data indicate that although targeting of antigen to CR1/2 on B cells can enhance transient proliferation or differentiation of antigen specific B cells it cannot induce strong, longlasting humoral immune responses. Furthermore, CR1/2 targeting constructs may negatively influence an ongoing immune reaction.

  2. Detection of rubella-specific serum IgG and IgA and nasopharyngeal IgA responses using a radioactive single radial immunodiffusion technique

    International Nuclear Information System (INIS)

    Al-Nakib, W.; Best, J.M.; Banatvala, J.E.

    1975-01-01

    A radioactive, single radial immunodiffusion technique (RSRID) employing 125 I-labelled antiglobulins, was developed to determine rubella-specific serum IgG and IgA and nasopharyngeal IgA antibody responses following both naturally acquired rubella and vaccination with four attenuated vaccines. Rubella-specific IgG antibodies developed in parallel with haemagglutination inhibiting (HAI) antibodies and both persisted for at least a year in all cases of naturally acquired and vaccine induced infection. However, the RSRID test detected rises in titre in all of five volunteers challenged intranasally with RA27/3, whereas only one volunteer showed a rise by HAI. Serum IgA antibodies generally persisted for at least a year following naturally acquired infection but rubella vaccines induced variable responses. Thus, following administration of RA27/3 and To-336 vaccines, rubella-specific IgA usually persisted for a year, whereas Cendehill vaccine failed to induce a detectable response. Rubella-specific nasopharyngeal IgA was detected in all five patients following naturally acquired infection and was still present in the only two patients tested a year after infection. These antibodies were detected in fourteen of twenty-three vaccinees at 3 weeks, but persisted for a year in only two vaccinees, both of whom were given RA27/3 intranasally. (author)

  3. The effects of bacterial endotoxin on lipide metabolism. I. The responses of the serum lipides of rabbits to single and repeated injections of Shear's polysaccharide.

    Science.gov (United States)

    LEQUIRE, V S; HUTCHERSON, J D; HAMILTON, R L; GRAY, M E

    1959-08-01

    Single intravenous injections of Shear's polysaccharide in varying dosages invariably produced an elevation in the levels of the total serum lipides 24 hours after injection of endotoxin. The total serum cholesterol and lipide phosphorus were also affected, although they did not change with smaller doses of endotoxin and were rarely elevated to the same degree as were the total serum lipides. The degree of elevation of the serum lipides was apparently related to the amount of endotoxin injected up to a certain point, beyond which there was no further increase. There were two types of response to endotoxin by the serum lipides, a moderate increase and an uncontrolled increase. Higher dosages of endotoxin and fasting apparently increased the incidence of the latter response. No direct correlation could be made between serum lipide responses and histologic evidence typical of the generalized Shwartzman reaction following this regimen of endotoxin injection. The Shwartzman reaction did occur with greater frequency and with lower dosages of endotoxin in fasted animals. Animals given repeated injections of endotoxin showed an initial increase in serum lipides followed by a progressive decrease to normal levels as tolerance to the febrile action of endotoxin appeared. The febrile tolerance as well as the unresponsiveness of the serum lipides to endotoxin was abolished by thorium dioxide (thorotrast) in these animals. In similar experiments a "breakthrough" of lipide unresponsiveness to endotoxin was obtained by increasing the amount of endotoxin injected. Some of the implications of these results for the metabolic alterations produced by bacterial endotoxins are discussed.

  4. Response

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    ALICE is the LHC experiment dedicated to the study of Heavy Ion collisions. In particular, the detector features low momentum tracking and vertexing, and comprehensive particle identification capabilities. In a single central heavy ion collision at the LHC, thousands of particles per unit rapidity are produced, making the data volume, track reconstruction and search of rare signals particularly challenging. Data science and machine learning techniques could help to tackle some of the challenges outlined above. In this talk, we will discuss some early attempts to use these techniques for the processing of detector signals and for the physics analysis. We will also highlight the most promising areas for the application of these methods.

  5. The progeny of a single virgin B cell predominates the human recall B cell response to the capsular polysaccharide of Haemophilus influenzae type b

    DEFF Research Database (Denmark)

    Barington, T; Hougs, L; Juul, L

    1996-01-01

    of Haemophilus influenzae type b coupled to tetanus toxoid. We combined affinity purification of circulating vaccine-induced Ab-secreting cells with PCR amplification of cDNA followed by cloning and sequencing. Forty-eight and 42 kappa VJ gene transcripts were analyzed from two adults, respectively. Both......Restricted V region diversity is a key feature of Abs to many haptens and simple polysaccharides. Two possible mechanisms exist: 1) selection of many clonally unrelated B cells using very similar or identical VDJ and VJ rearrangements; and 2) selection of a heavily expanded progeny of few virgin B...... cells. How many virgin B cells eventually give rise to the total Ab response to a simple Ag is a fundamental immunologic question. In this report, we address this question in human adults by analyzing the rearranged VkappaJkappa genes of B cells responding to a single dose of the capsular polysaccharide...

  6. Symptomatic response to blocked and unblocked pentagastrin stimulation in functional dyspepsia - Comparison of responders and non-responders to omeprazole identified in a single-subject trial model

    DEFF Research Database (Denmark)

    Madsen, L.G.; Bytzer, P.

    2008-01-01

    Background: The role of acid in functional dyspepsia is controversial and drug treatment trials indicate that only a subset of patients has acid-related symptoms. A novel single-subject trial design, the Random Starting Day trial (RSD trial), was developed to identify acid-related symptoms. We...... was expected not to be influenced by gastric acid stimulation or type of treatment. Methods: Nineteen patients were evaluated. Symptomatic response to pentagastrin (6 mu g/kg) was assessed twice in each patient following placebo and omeprazole (40 mg bid) treatment in a randomized, double-blind, cross......-over design. Epigastric pain was assessed every 15 for 90 min after stimulation using a 5-graded Likert scale and a VAS scale. A positive acid provocation test was defined as an increase of the Likert score of epigastric pain by at least one grade after pentagastrin stimulation during placebo treatment...

  7. Data describing the flow-mediated vasodilation responses and blood pressure in young adult humans after a single dose of oral edible emu oil

    Directory of Open Access Journals (Sweden)

    Tadayoshi Miyashita

    2018-04-01

    Full Text Available The data provided herein include flow-mediated vasodilation responses, represented by changes in arterial diameter, and blood pressure in young adults after a single oral dose of edible emu oil or placebo (cross-over design. Ten healthy men and 10 healthy women participated. Increased blood flow in the antebrachial region was induced by inflating a pressure cuff and subsequently releasing the pressure by deflating the cuff. After the release, the arterial diameter was continuously monitored for 110 sec using ultrasonic diagnostic equipment. The changes in the arterial diameter from 20 to 110 sec post-cuff deflation are described in line graphs and tables. In addition, systolic and diastolic blood pressure data are provided in a table.

  8. Measurements and simulations on position dependencies in the response of single PWO crystals and a prototype for the $\\overline{P}ANDA$ EMC

    CERN Document Server

    Bremer, Daniel Andreas

    The PANDA experiment, which will be located at the future Facility for Antiproton and Ion Research, aims at the study of strong interaction within the charm sector via antiproton- proton collisions. An essential component of the PANDA detector to achieve the ambitious physics goals is the Electromagnetic Calorimeter (EMC). Reason for this is particularly its high detection efficiency for photons and electrons over a large dynamic range, since most of the expected physics channels are accompanied by secondary photons. The EMC is based on second generation lead tungstate scintillator crystals and thus features a very compact design and improved performance. To guarantee a homogeneous and precise energy and momentum response, an exact knowledge on the incident particle position is mandatory. In the scope of this work, non-uniformities in the light yield of single lead tungstate crystals with tapered geometry are investigated. This effect was studied with the SLitrani simulation package in comparison to a series ...

  9. Single-cell-type quantitative proteomic and ionomic analysis of epidermal bladder cells from the halophyte model plant Mesembryanthemum crystallinum to identify salt-responsive proteins.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Raymond, Carolyn

    2016-05-10

    Epidermal bladder cells (EBC) are large single-celled, specialized, and modified trichomes found on the aerial parts of the halophyte Mesembryanthemum crystallinum. Recent development of a simple but high throughput technique to extract the contents from these cells has provided an opportunity to conduct detailed single-cell-type analyses of their molecular characteristics at high resolution to gain insight into the role of these cells in the salt tolerance of the plant. In this study, we carry out large-scale complementary quantitative proteomic studies using both a label (DIGE) and label-free (GeLC-MS) approach to identify salt-responsive proteins in the EBC extract. Additionally we perform an ionomics analysis (ICP-MS) to follow changes in the amounts of 27 different elements. Using these methods, we were able to identify 54 proteins and nine elements that showed statistically significant changes in the EBC from salt-treated plants. GO enrichment analysis identified a large number of transport proteins but also proteins involved in photosynthesis, primary metabolism and Crassulacean acid metabolism (CAM). Validation of results by western blot, confocal microscopy and enzyme analysis helped to strengthen findings and further our understanding into the role of these specialized cells. As expected EBC accumulated large quantities of sodium, however, the most abundant element was chloride suggesting the sequestration of this ion into the EBC vacuole is just as important for salt tolerance. This single-cell type omics approach shows that epidermal bladder cells of M. crystallinum are metabolically active modified trichomes, with primary metabolism supporting cell growth, ion accumulation, compatible solute synthesis and CAM. Data are available via ProteomeXchange with identifier PXD004045.

  10. Improved metabolic control in tetrahydrobiopterin (BH4), responsive phenylketonuria with sapropterin administered in two divided doses vs. a single daily dose.

    Science.gov (United States)

    Kör, Deniz; Yılmaz, Berna Şeker; Bulut, Fatma Derya; Ceylaner, Serdar; Mungan, Neslihan Önenli

    2017-07-26

    Phenylketonuria (PKU) often requires a lifelong phenylalanine (Phe)-restricted diet. Introduction of 6R-tetrahydrobiopterin (BH4) has made a huge difference in the diets of patients with PKU. BH4 is the co-factor of the enzyme phenylalanine hydroxylase (PAH) and improves PAH activity and, thus, Phe tolerance in the diet. A limited number of published studies suggest a pharmacodynamic profile of BH4 more suitable to be administered in divided daily doses. After a 72-h BH4 loading test, sapropterin was initiated in 50 responsive patients. This case-control study was conducted by administering the same daily dose of sapropterin in group 1 (n=24) as a customary single dose or in two divided doses in group 2 (n=26) over 1 year. Mean daily consumption of Phe increased significantly after the first year of BH4 treatment in group 2 compared to group 1 (p<0.05). At the end of the first year of treatment with BH4, another dramatic difference observed between the two groups was the ability to transition to a Phe-free diet. Eight patients from group 2 and two from group 1 could quit dietary restriction. When given in two divided daily doses, BH4 was more efficacious than a single daily dose in increasing daily Phe consumption, Phe tolerance and the ability to transition to a Phe-unrestricted diet at the end of the first year of treatment.

  11. Development of a scientific torsional system experiment containing controlled single or dual-clearance non-linearities: Examination of step-responses

    Science.gov (United States)

    Krak, Michael D.; Singh, Rajendra

    2017-02-01

    The chief goal of this paper is to propose a new laboratory experiment that exhibits the step-response of a torsional system containing one or two controlled clearances. This work is motivated by the disadvantages of prior large-scale experiments which utilize production vehicle drivelines and their components with significant real-life complexities. The conceptual and physical design features, which include sizing, modal properties, excitation, and instrumentation, are discussed with the goal of creating a controlled experiment. Like prior literature, a step-down torque excitation is selected and all analyses are performed on the acceleration signals to observe vibro-impact in the time domain. Typical measurements (for both the single and dual-clearance configurations) exhibit rich non-linear behavior, including the double-sided impact regime and a time-varying oscillatory period. Additionally, new measurements are compared to predictions from simple reduced order non-linear models to verify the feasibility of the proposed experiment. Finally, the utility of this experiment is demonstrated by comparing its measurements to a prior large-scale experiment that accommodates a production vehicle clutch damper with multiple stages. The hardening and softening effects in both experiments are discussed in the context of double and single-sided impacts as well as the oscillatory periods that vary with time.

  12. Transcriptomic responses of the aphid Myzus persicae nicotianae Blackman (Hemiptera: Aphididae to insecticides: Analyses in the single Chilean clone of the tobacco aphid

    Directory of Open Access Journals (Sweden)

    Marco Cabrera-Brandt

    2014-04-01

    Full Text Available The tobacco aphid Myzus persicae nicotianae Blackman is a subspecies of the highly polyphagous and agricultural pest Myzus persicae (Sulzer. For its control, insecticide applications are widely used, but resistance to numerous molecules has been reported, displaying at least three insecticide resistance mechanisms, including: (i elevated carboxylesterases (E-Carb, (ii modification of the acetylcholinesterase (MACE, and (iii kdr and super-kdr insensitivity mutations. In Chile, populations of the tobacco aphid are characterized by the presence of a single predominant clone, which is also present in high proportions in other countries of the Americas. This aphid clone exhibits low levels of carboxylesterase activity and is kdr susceptible, but the MACE mechanism of insecticide resistance has not been studied. In order to characterize the tobacco aphid in terms of the MACE mechanism and to identify a preliminary group of aphid genes putatively involved in insecticide resistance, a cDNA microarray was used to study the transcriptomic responses when aphids are sprayed with a carbamate insecticide. The single Chilean clone of the tobacco aphid was characterized as MACE susceptible, but we found 38 transcripts significantly regulated by insecticide exposure (13 up- and 25 down-regulated genes. The expression of six of them was validated by qRT-PCR experiments at several time points (6, 12, 18, 24, 30, 36, and 42 h after insecticide application. This mutational and transcriptomic characterization of the tobacco aphid responding to insecticide spray opens new hypotheses in the understanding of the molecular mechanisms underlying insecticide resistance.

  13. A single bout of high-intensity aerobic exercise facilitates response to paired associative stimulation and promotes sequence-specific implicit motor learning.

    Science.gov (United States)

    Mang, Cameron S; Snow, Nicholas J; Campbell, Kristin L; Ross, Colin J D; Boyd, Lara A

    2014-12-01

    The objectives of the present study were to evaluate the impact of a single bout of high-intensity aerobic exercise on 1) long-term potentiation (LTP)-like neuroplasticity via response to paired associative stimulation (PAS) and 2) the temporal and spatial components of sequence-specific implicit motor learning. Additionally, relationships between exercise-induced increases in systemic brain-derived neurotrophic factor (BDNF) and response to PAS and motor learning were evaluated. Sixteen young healthy participants completed six experimental sessions, including the following: 1) rest followed by PAS; 2) aerobic exercise followed by PAS; 3) rest followed by practice of a continuous tracking (CT) task and 4) a no-exercise 24-h retention test; and 5) aerobic exercise followed by CT task practice and 6) a no-exercise 24-h retention test. The CT task included an embedded repeated sequence allowing for evaluation of sequence-specific implicit learning. Slope of motor-evoked potential recruitment curves generated with transcranial magnetic stimulation showed larger increases when PAS was preceded by aerobic exercise (59.8% increase) compared with rest (14.2% increase, P = 0.02). Time lag of CT task performance on the repeated sequence improved under the aerobic exercise condition from early (-100.8 ms) to late practice (-75.2 ms, P 0.16). Systemic BDNF increased on average by 3.4-fold following aerobic exercise (P = 0.003), but the changes did not relate to neurophysiological or behavioral measures (P > 0.42). These results indicate that a single bout of high-intensity aerobic exercise can prime LTP-like neuroplasticity and promote sequence-specific implicit motor learning. Copyright © 2014 the American Physiological Society.

  14. Early clinical and immune response to NNRTI-based antiretroviral therapy among women with prior exposure to single-dose nevirapine.

    Science.gov (United States)

    Chi, Benjamin H; Sinkala, Moses; Stringer, Elizabeth M; Cantrell, Ronald A; Mtonga, Velepi; Bulterys, Marc; Zulu, Isaac; Kankasa, Chipepo; Wilfert, Catherine; Weidle, Paul J; Vermund, Sten H; Stringer, Jeffrey S A

    2007-05-11

    To determine whether prior exposure to single-dose nevirapine (NVP) for prevention of mother-to-child HIV transmission (PMTCT) is associated with attenuated CD4 cell response, death, or clinical treatment failure in women starting antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTI). Open cohort evaluation of outcomes for women in program sites across Zambia. HIV treatment was provided according to Zambian/World Health Organization guidelines. Peripartum NVP exposure status was known for 6740 women initiating NNRTI-containing ART, of whom 751 (11%) reported prior use of NVP for PMTCT. There was no significant difference in mean CD4 cell change between those exposed or unexposed to NVP at 6 (+202 versus +182 cells/microl; P = 0.20) or 12 (+201 versus +211 cells/microl; P = 0.60) months. Multivariable analyses showed no significant differences in mortality [adjusted hazard ratio (HR), 1.2; 95% confidence interval (CI), 0.8-1.8] or clinical treatment failure (adjusted HR, 1.1; 95% CI, 0.8-1.5). Comparison of recent NVP exposure with remote exposure suggested a less favorable CD4 cell response at 6 (+150 versus +219 cells/microl; P = 0.06) and 12 (+149 versus +215 cells/microl; P = 0.39) months. Women with recent NVP exposure also had a trend towards elevated risk for clinical treatment failure (adjusted HR, 1.6; 95% CI, 0.9-2.7). Exposure to maternal single-dose NVP was not associated with substantially different short-term treatment outcomes. However, evidence was suggestive that exposure within 6 months of ART initiation may be a risk factor for poor treatment outcomes, highlighting the importance of ART screening and initiation early in pregnancy.

  15. T-cell responsiveness to LCMV segregates as a single locus in crosses between BALB/cA and C.B-17 mice. Evidence for regulation by a gene outside the Igh region

    DEFF Research Database (Denmark)

    Christensen, Jan Pravsgaard; Marker, Ole; Thomsen, Allan Randrup

    1993-01-01

    with a difference in virus-specific T-cell responsiveness measured in terms of virus-specific cytotoxicity in vitro and delayed-type hypersensitivity in vivo. Analysis of F1, BC1 and F2 progeny showed that differential T-cell responsiveness was influenced by a single gene or gene complex; however, no linkage...

  16. Estimating of aquifer parameters from the single-well water-level measurements in response to advancing longwall mine by using particle swarm optimization

    Science.gov (United States)

    Buyuk, Ersin; Karaman, Abdullah

    2017-04-01

    We estimated transmissivity and storage coefficient values from the single well water-level measurements positioned ahead of the mining face by using particle swarm optimization (PSO) technique. The water-level response to the advancing mining face contains an semi-analytical function that is not suitable for conventional inversion shemes because the partial derivative is difficult to calculate . Morever, the logaritmic behaviour of the model create difficulty for obtaining an initial model that may lead to a stable convergence. The PSO appears to obtain a reliable solution that produce a reasonable fit between water-level data and model function response. Optimization methods have been used to find optimum conditions consisting either minimum or maximum of a given objective function with regard to some criteria. Unlike PSO, traditional non-linear optimization methods have been used for many hydrogeologic and geophysical engineering problems. These methods indicate some difficulties such as dependencies to initial model, evolution of the partial derivatives that is required while linearizing the model and trapping at local optimum. Recently, Particle swarm optimization (PSO) became the focus of modern global optimization method that is inspired from the social behaviour of birds of swarms, and appears to be a reliable and powerful algorithms for complex engineering applications. PSO that is not dependent on an initial model, and non-derivative stochastic process appears to be capable of searching all possible solutions in the model space either around local or global optimum points.

  17. Time-Dependent Mechanical Response of APbX3 (A = Cs, CH3NH3; X = I, Br) Single Crystals

    KAUST Repository

    Reyes-Martinez, Marcos A.

    2017-05-02

    The ease of processing hybrid organic-inorganic perovskite (HOIPs) films, belonging to a material class with composition ABX3 , from solution and at mild temperatures promises their use in deformable technologies, including flexible photovoltaic devices, sensors, and displays. To successfully apply these materials in deformable devices, knowledge of their mechanical response to dynamic strain is necessary. The authors elucidate the time- and rate-dependent mechanical properties of HOIPs and an inorganic perovskite (IP) single crystal by measuring nanoindentation creep and stress relaxation. The observation of pop-in events and slip bands on the surface of the indented crystals demonstrate dislocation-mediated plastic deformation. The magnitudes of creep and relaxation of both HOIPs and IPs are similar, negating prior hypothesis that the presence of organic A-site cations alters the mechanical response of these materials. Moreover, these samples exhibit a pronounced increase in creep, and stress relaxation as a function of indentation rate whose magnitudes reflect differences in the rates of nucleation and propagation of dislocations within the crystal structures of HOIPs and IP. This contribution provides understanding that is critical for designing perovskite devices capable of withstanding mechanical deformations.

  18. Psoriasis responds to intralesional injections of alefacept and may predict systemic response to intramuscular alefacept: interim results of a single-arm, open-label study.

    Science.gov (United States)

    Gattu, Shilpa; Busse, Kristine; Bhutani, Tina; Chiang, Charles; Nguyen, Thao; Becker, Emily; Koo, John Y M

    2012-04-01

    Alefacept is a remittive treatment for generalized psoriasis but is rarely used due to its erratic efficacy. To determine if psoriasis plaques will respond to intralesional alefacept and if this predicts a systemic response to intramuscular (IM) alefacept. We describe a 25-week, single-center, open-label study. Patients received weekly intralesional alefacept of increasing concentrations into target plaques for 3 weeks followed by IM injections for 12 weeks and concluded with an observation period of 9 weeks. The psoriasis area and severity index (PASI) was used to assess the efficacy of IM alefacept. Interim results are reported for the first seven patients enrolled. Two patients responded intralesionally to the most dilute 1:100 concentration of alefacept to sterile water and achieved a 59% and 100% improvement in PASI. Five patients did not respond intralesionally to the most dilute form of alefacept and none achieved PASI 75. Two of these five patients did not respond to any concentration and achieved a 26% and 38% improvement in PASI. Limitations to this study include a small sample size and being non-placebo-controlled. Alefacept is effective intralesionally and may predict a systemic response - challenging the concept that biologics must work systemically.

  19. In vitro response of the human breast cancer cell line MDAMB-231 and human peripheral blood mononuclear cells exposed to 60Co at single fraction

    International Nuclear Information System (INIS)

    Andrade, Lidia Maria; Campos, Tarcisio Passos Ribeiro de; Leite, M.F.; Goes, A.M.

    2005-01-01

    Radiotherapy using gamma rays is a common modality of breast cancer treatment. The aim of this research is to investigate the biological response of the human breast cancer cell line MDAMB-231 and human peripheral blood mononuclear cells (PBMC) exposed in vitro to 60 Co irradiation at a single fraction of 10 Gy, 25 Gy and 50 Gy doses at 136,4 cGy.min -1 rate. Cells were irradiated at room temperature by the Theratron 80 radiotherapy system. Biological response was evaluated through cellular viability using MTT assay and nucleus damages visualized by Propidium Iodide assay and electrophoresis agarose gel after gamma irradiation. Nucleus damages induced by 60 Co irradiation were compared to damage caused by cell exposure to 10% methanol. The 50 Gy dose of irradiation did not stimulate nucleus damages at the same level as that affected by 10% methanol induction in the MDAMB-231. Further studies are necessary to understand these mechanisms in the MDAMB-231 human breast carcinoma cell line.(author)

  20. In vitro response of the human breast cancer cell line MDAMB-231 and human peripheral blood mononuclear cells exposed to {sup 60}Co at single fraction

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Lidia Maria; Campos, Tarcisio Passos Ribeiro de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear]. E-mail: lidia.andrade@unifenas.br; Leite, M.F. [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Dept. de Fisiologia e Biofisica; Goes, A.M. [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Imunologia

    2005-10-15

    Radiotherapy using gamma rays is a common modality of breast cancer treatment. The aim of this research is to investigate the biological response of the human breast cancer cell line MDAMB-231 and human peripheral blood mononuclear cells (PBMC) exposed in vitro to {sup 60} Co irradiation at a single fraction of 10 Gy, 25 Gy and 50 Gy doses at 136,4 cGy.min{sup -1} rate. Cells were irradiated at room temperature by the Theratron 80 radiotherapy system. Biological response was evaluated through cellular viability using MTT assay and nucleus damages visualized by Propidium Iodide assay and electrophoresis agarose gel after gamma irradiation. Nucleus damages induced by {sup 60} Co irradiation were compared to damage caused by cell exposure to 10% methanol. The 50 Gy dose of irradiation did not stimulate nucleus damages at the same level as that affected by 10% methanol induction in the MDAMB-231. Further studies are necessary to understand these mechanisms in the MDAMB-231 human breast carcinoma cell line.(author)

  1. A single nucleotide polymorphism in cBIM is associated with a slower achievement of major molecular response in chronic myeloid leukaemia treated with imatinib.

    Directory of Open Access Journals (Sweden)

    Vanessa Augis

    Full Text Available BIM is essential for the response to tyrosine-kinase inhibitors (TKI in chronic myeloid leukaemia (CML patients. Recently, a deletion polymorphism in intron 2 of the BIM gene was demonstrated to confer an intrinsic TKI resistance in Asian patients. The present study aimed at identifying mutations in the BIM sequence that could lead to imatinib resistance independently of BCR-ABL mutations.BIM coding sequence analysis was performed in 72 imatinib-treated CML patients from a French population of our centre and in 29 healthy controls (reference population as a case-control study. Real-time quantitative PCR (RT qPCR was performed to assess Bim expression in our reference population.No mutation with amino-acid change was found in the BIM coding sequence. However, we observed a silent single nucleotide polymorphism (SNP c465C>T (rs724710. A strong statistical link was found between the presence of the T allele and the high Sokal risk group (p = 0.0065. T allele frequency was higher in non responsive patients than in the reference population (p = 0.0049. Similarly, this T allele was associated with the mutation frequency on the tyrosine kinase domain of BCR-ABL (pT SNP of BIM could be useful for predicting the outcome of imatinib-treated CML patients.

  2. Novel application of quantitative single-photon emission computed-tomography/computed tomography to predict early response to methimazole in Graves' disease

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyun Joo; Bang, Ji In; Kim, Ji Young; Moon, Jae Hoon [Seoul National University Bundang Hospital, Seoul National University College of Medicine, Seongnam (Korea, Republic of); So, Young [Dept. of Nuclear Medicine, Konkuk University Medical Center, Seoul (Korea, Republic of); Lee, Won Woo [Institute of Radiation Medicine, Medical Research Center, Seoul National University, Seoul (Korea, Republic of)

    2017-06-15

    Since Graves' disease (GD) is resistant to antithyroid drugs (ATDs), an accurate quantitative thyroid function measurement is required for the prediction of early responses to ATD. Quantitative parameters derived from the novel technology, single-photon emission computed tomography/computed tomography (SPECT/CT), were investigated for the prediction of achievement of euthyroidism after methimazole (MMI) treatment in GD. A total of 36 GD patients (10 males, 26 females; mean age, 45.3 ± 13.8 years) were enrolled for this study, from April 2015 to January 2016. They underwent quantitative thyroid SPECT/CT 20 minutes post-injection of {sup 99m}Tc-pertechnetate (5 mCi). Association between the time to biochemical euthyroidism after MMI treatment and uptake, standardized uptake value (SUV), functional thyroid mass (SUVmean × thyroid volume) from the SPECT/CT, and clinical/biochemical variables, were investigated. GD patients had a significantly greater %uptake (6.9 ± 6.4%) than historical control euthyroid patients (n = 20, 0.8 ± 0.5%, p < 0.001) from the same quantitative SPECT/CT protocol. Euthyroidism was achieved in 14 patients at 156 ± 62 days post-MMI treatment, but 22 patients had still not achieved euthyroidism by the last follow-up time-point (208 ± 80 days). In the univariate Cox regression analysis, the initial MMI dose (p = 0.014), %uptake (p = 0.015), and functional thyroid mass (p = 0.016) were significant predictors of euthyroidism in response to MMI treatment. However, only uptake remained significant in a multivariate Cox regression analysis (p = 0.034). A uptake cutoff of 5.0% dichotomized the faster responding versus the slower responding GD patients (p = 0.006). A novel parameter of thyroid uptake from quantitative SPECT/CT is a predictive indicator of an early response to MMI in GD patients.

  3. Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

    Science.gov (United States)

    Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

    2013-09-01

    Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. A living cell quartz crystal microbalance biosensor for continuous monitoring of cytotoxic responses of macrophages to single-walled carbon nanotubes

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2011-01-01

    Full Text Available Abstract Background Numerous engineered nanomaterials (ENMs exist and new ENMs are being developed. A challenge to nanotoxicology and environmental health and safety is evaluating toxicity of ENMs before they become widely utilized. Cellular assays remain the predominant test platform yet these methods are limited by using discrete time endpoints and reliance on organic dyes, vulnerable to interference from ENMs. Label-free, continuous, rapid response systems with biologically meaningful endpoints are needed. We have developed a device to detect and monitor in real time responses of living cells to ENMs. The device, a living cell quartz crystal microbalance biosensor (QCMB, uses macrophages adherent to a quartz crystal. The communal response of macrophages to treatments is monitored continuously as changes in crystal oscillation frequency (Δf. We report the ability of this QCMB to distinguish benign from toxic exposures and reveal unique kinetic information about cellular responses to varying doses of single-walled carbon nanotubes (SWCNTs. Results We analyzed macrophage responses to additions of Zymosan A, polystyrene beads (PBs (benign substances or SWCNT (3-150 μg/ml in the QCMB over 18 hrs. In parallel, toxicity was monitored over 24/48 hrs using conventional viability assays and histological stains to detect apoptosis. In the QCMB, a stable unchanging oscillation frequency occurred when cells alone, Zymosan A alone, PBs alone or SWCNTs without cells at the highest dose alone were used. With living cells in the QCMB, when Zymosan A, PBs or SWCNTs were added, a significant decrease in frequency occurred from 1-6 hrs. For SWCNTs, this Δf was dose-dependent. From 6-18 hrs, benign substances or low dose SWCNT (3-30 μg/ml treatments showed a reversal of the decrease of oscillation frequency, returning to or exceeding pre-treatment levels. Cell recovery was confirmed in conventional assays. The lag time to see the Δf reversal in QCMB plots

  5. Rheumatic disorders associated with immune checkpoint inhibitors in patients with cancer-clinical aspects and relationship with tumour response: a single-centre prospective cohort study.

    Science.gov (United States)

    Kostine, Marie; Rouxel, Léa; Barnetche, Thomas; Veillon, Rémi; Martin, Florent; Dutriaux, Caroline; Dousset, Léa; Pham-Ledard, Anne; Prey, Sorilla; Beylot-Barry, Marie; Daste, Amaury; Gross-Goupil, Marine; Lallier, Julie; Ravaud, Alain; Forcade, Edouard; Bannwarth, Bernard; Truchetet, Marie-Elise; Richez, Christophe; Mehsen, Nadia; Schaeverbeke, Thierry

    2018-03-01

    To evaluate the prevalence and type of rheumatic immune-related adverse events (irAEs) in patients receiving immune checkpoint inhibitors (ICIs), as well as the correlation with tumour response. This was a single-centre prospective observational study including all cancer patients receiving ICIs. The occurrence of irAEs and tumour response was assessed on a regular basis. Patients who experienced musculoskeletal symptoms were referred to the department of rheumatology for clinical evaluation and management. From September 2015 to May 2017, 524 patients received ICIs and 35 were referred to the department of rheumatology (6.6%). All but one of the rheumatic irAEs occurred with anti-programmed cell death protein 1(PD-1)/PD-1 ligand 1(PD-L1) antibodies, with a median exposure time of 70 days. There were two distinct clinical presentations: (1) inflammatory arthritis (3.8%) mimicking either rheumatoid arthritis (n=7), polymyalgia rheumatica (n=11) or psoriatic arthritis (n=2) and (2) non-inflammatory musculoskeletal conditions (2.8%; n=15). One patient with rheumatoid arthritis was anti-cyclic citrullinated peptide (anti-CCP) positive. Nineteen patients required glucocorticoids, and methotrexate was started in two patients. Non-inflammatory disorders were managed with non-steroidal anti-inflammatory drugs, analgesics and/or physiotherapy. ICI treatment was pursued in all but one patient. Patients with rheumatic irAEs had a higher tumour response rate compared with patients without irAEs (85.7% vs 35.3%; P<0.0001). Since ICIs are used with increasing frequency, knowledge of rheumatic irAEs and their management is of major interest. All patients were responsive either to low-to-moderate doses of prednisone or symptomatic therapies and did not require ICI discontinuation. Furthermore, tumour response was significantly higher in patients who experienced rheumatic irAEs. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All

  6. A living cell quartz crystal microbalance biosensor for continuous monitoring of cytotoxic responses of macrophages to single-walled carbon nanotubes

    Science.gov (United States)

    2011-01-01

    Background Numerous engineered nanomaterials (ENMs) exist and new ENMs are being developed. A challenge to nanotoxicology and environmental health and safety is evaluating toxicity of ENMs before they become widely utilized. Cellular assays remain the predominant test platform yet these methods are limited by using discrete time endpoints and reliance on organic dyes, vulnerable to interference from ENMs. Label-free, continuous, rapid response systems with biologically meaningful endpoints are needed. We have developed a device to detect and monitor in real time responses of living cells to ENMs. The device, a living cell quartz crystal microbalance biosensor (QCMB), uses macrophages adherent to a quartz crystal. The communal response of macrophages to treatments is monitored continuously as changes in crystal oscillation frequency (Δf). We report the ability of this QCMB to distinguish benign from toxic exposures and reveal unique kinetic information about cellular responses to varying doses of single-walled carbon nanotubes (SWCNTs). Results We analyzed macrophage responses to additions of Zymosan A, polystyrene beads (PBs) (benign substances) or SWCNT (3-150 μg/ml) in the QCMB over 18 hrs. In parallel, toxicity was monitored over 24/48 hrs using conventional viability assays and histological stains to detect apoptosis. In the QCMB, a stable unchanging oscillation frequency occurred when cells alone, Zymosan A alone, PBs alone or SWCNTs without cells at the highest dose alone were used. With living cells in the QCMB, when Zymosan A, PBs or SWCNTs were added, a significant decrease in frequency occurred from 1-6 hrs. For SWCNTs, this Δf was dose-dependent. From 6-18 hrs, benign substances or low dose SWCNT (3-30 μg/ml) treatments showed a reversal of the decrease of oscillation frequency, returning to or exceeding pre-treatment levels. Cell recovery was confirmed in conventional assays. The lag time to see the Δf reversal in QCMB plots was linearly SWCNT

  7. Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported responses to alcohol in American Indians.

    Science.gov (United States)

    Ehlers, Cindy L; Lind, Penelope A; Wilhelmsen, Kirk C

    2008-04-23

    Variation in response to the hedonic and adverse effects of a substance is in part an inherited factor that may influence its use, abuse and dependence. The mu opioid receptor is the primary site of action for opiates and individuals with polymorphisms in this receptor appear to have variation in the CNS effects of opiates. Several studies have suggested that this receptor may also mediate some of the effects of non-opioid drugs, such as alcohol. The purpose of this study was to investigate associations between 13 single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) with self-reported responses to alcohol, an endophenotype associated with the development of alcohol dependence, in American Indians living on eight contiguous reservations. Each participant gave a blood sample and completed a structured diagnostic interview. Additionally, response to alcohol was indexed using the expectation version of the subjective high assessment scale (SHAS-E). SNPs were genotyped in 251 participants and data analyses were conducted using SOLAR. The estimated heritability (h2) for the SHAS-E phenotypes ranged from 0.01 to 0.28. Endorsing the expectation of a more intense response on one or more of the following items from the SHAS-E: buzzed, clumsy, dizzy, drunk, effects, high, nausea, sleepy, talkative, terrible, and/or uncomfortable after imbibing 2-3 drinks was significantly associated with having at least one minor allele for at least one of 7 SNPs (p < 0.01) in the OPRM1 receptor gene. These studies provide data to suggest that the minor allele, for most of the polymorphisms in the OPRM1 receptor gene investigated, was found to be associated with a more intense, and/or more adverse, response to alcohol, traits that are significantly correlated with lowered quantity of alcohol consumption and less susceptibility to dependence in this Indian population. These data further suggest that making conclusions on the role of the mu opiod receptor gene in the

  8. Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1 and self-reported responses to alcohol in American Indians

    Directory of Open Access Journals (Sweden)

    Wilhelmsen Kirk C

    2008-04-01

    Full Text Available Abstract Background Variation in response to the hedonic and adverse effects of a substance is in part an inherited factor that may influence its use, abuse and dependence. The mu opioid receptor is the primary site of action for opiates and individuals with polymorphisms in this receptor appear to have variation in the CNS effects of opiates. Several studies have suggested that this receptor may also mediate some of the effects of non-opioid drugs, such as alcohol. The purpose of this study was to investigate associations between 13 single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1 with self-reported responses to alcohol, an endophenotype associated with the development of alcohol dependence, in American Indians living on eight contiguous reservations. Methods Each participant gave a blood sample and completed a structured diagnostic interview. Additionally, response to alcohol was indexed using the expectation version of the subjective high assessment scale (SHAS-E. SNPs were genotyped in 251 participants and data analyses were conducted using SOLAR. Results The estimated heritability (h2 for the SHAS-E phenotypes ranged from 0.01 to 0.28. Endorsing the expectation of a more intense response on one or more of the following items from the SHAS-E: buzzed, clumsy, dizzy, drunk, effects, high, nausea, sleepy, talkative, terrible, and/or uncomfortable after imbibing 2–3 drinks was significantly associated with having at least one minor allele for at least one of 7 SNPs (p OPRM1 receptor gene. Conclusion These studies provide data to suggest that the minor allele, for most of the polymorphisms in the OPRM1 receptor gene investigated, was found to be associated with a more intense, and/or more adverse, response to alcohol, traits that are significantly correlated with lowered quantity of alcohol consumption and less susceptibility to dependence in this Indian population. These data further suggest that making conclusions on the

  9. A single base substitution in BADH/AMADH is responsible for fragrance in cucumber (Cucumis sativus L.), and development of SNAP markers for the fragrance.

    Science.gov (United States)

    Yundaeng, Chutintorn; Somta, Prakit; Tangphatsornruang, Sithichoke; Chankaew, Sompong; Srinives, Peerasak

    2015-09-01

    Sequence analysis revealed that an SNP (A1855G) in CsBADH of cucumber accession PK2011T202 causes amino acid change in a highly conserved motif, Y163C. Gene mapping showed association between the SNP and the fragrance. Pandan-like fragrance is a value-added trait in several food crops such as rice, vegetable soybean and sorghum. The fragrance is caused by the volatile chemical 2-acetyl-1-pyrroline (2AP). Mutation(s) in betaine aldehyde dehydrogenase 2 (BADH2; also known as aminoaldehyde dehydrogenase 2) gene causes defective BADH2 and results in biosynthesis of 2AP. Recently, cucumber cultivars possessing pandan-like fragrance were discovered in Thailand. In this study, we report an association between CsBADH and the fragrance in cucumber accession "PK2011T202". Gene expression analysis of CsBADH in leaves of PK2011T202 and "301176" (non-fragrant) at various growth stages revealed that CsBADH was expressed in both accessions. Sequence comparison of CsBADH showed that PK2011T202 possesses a single base substitution (A1855G) in exon 5 which causes an amino acid change in a highly conserved motif of BADH, Y163C. Single nucleotide-amplified polymorphism markers were developed to detect the SNP polymorphism between the wild-type and fragrance alleles. Since CsBADH is located on chromosome 1, quantitative trait locus (QTL) mapping was conducted for this chromosome using an F2 and a backcross populations developed from the cross between PK2011T202 and 301176. QTL analysis in both populations showed that the major QTL for fragrance, qFgr, was co-localized with the CsBADH. We concluded that the defect function of CsBADH is responsible for fragrance in cucumber PK2011T202.

  10. Single molecule manipulation at low temperature and laser scanning tunnelling photo-induced processes analysis through time-resolved studies

    International Nuclear Information System (INIS)

    Riedel, Damien

    2010-01-01

    This paper describes, firstly, the statistical analysis used to determine the processes that occur during the manipulation of a single molecule through electronically induced excitations with a low temperature (5 K) scanning tunnelling microscope (STM). Various molecular operation examples are described and the ability to probe the ensuing molecular manipulation dynamics is discussed within the excitation context. It is, in particular, shown that such studies can reveal reversible manipulation for tuning dynamics through variation of the excitation energy. Secondly, the photo-induced process arising from the irradiation of the STM junction is also studied through feedback loop dynamics analysis, allowing us to distinguish between photo-thermally and photo-electronically induced signals.

  11. Single molecule manipulation at low temperature and laser scanning tunnelling photo-induced processes analysis through time-resolved studies.

    Science.gov (United States)

    Riedel, Damien

    2010-07-07

    This paper describes, firstly, the statistical analysis used to determine the processes that occur during the manipulation of a single molecule through electronically induced excitations with a low temperature (5 K) scanning tunnelling microscope (STM). Various molecular operation examples are described and the ability to probe the ensuing molecular manipulation dynamics is discussed within the excitation context. It is, in particular, shown that such studies can reveal reversible manipulation for tuning dynamics through variation of the excitation energy. Secondly, the photo-induced process arising from the irradiation of the STM junction is also studied through feedback loop dynamics analysis, allowing us to distinguish between photo-thermally and photo-electronically induced signals. © 2010 IOP Publishing Ltd

  12. Differential uptake and oxidative stress response in zebrafish fed a single dose of the principal copper and zinc enriched sub-cellular fractions of Gammarus pulex

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Farhan R., E-mail: f.khan@nhm.ac.uk [Nutritional Sciences Division, King' s College London, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NH (United Kingdom); Bury, Nicolas R.; Hogstrand, Christer [Nutritional Sciences Division, King' s College London, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NH (United Kingdom)

    2010-09-15

    The sub-cellular compartmentalisation of trace metals and its effect on trophic transfer and toxicity in the aquatic food chain has been a subject of growing interest. In the present study, the crustacean Gammarus pulex was exposed to either 11 {mu}g Cu l{sup -1}, added solely as the enriched stable isotope {sup 65}Cu, or 660 {mu}g Zn l{sup -1}, radiolabeled with 2MBq {sup 65}Zn, for 16 days. Post-exposure the heat stable cytosol containing metallothionein-like proteins (MTLP) and a combined granular and exoskeletal (MRG + exo) fractions were isolated by differential centrifugation, incorporated into gelatin and fed to zebrafish as a single meal. Assimilation efficiency (AE) and intestinal lipid peroxidation, as malondialdehyde (MDA) were measured. There was a significant difference (p < 0.05) between the retention of the MTLP-Zn (39.0 {+-} 6.4%) and MRG + exo-Zn (17.2 {+-} 3.7%) and of this zinc retained by the zebrafish a significantly greater proportion of the MTLP-Zn feed had been transported away from the site of uptake. For {sup 65}Cu, although the results pointed towards greater bioavailability of the MTLP fraction compared to MRG + exo during the slow elimination phase (24-72 h) these results were not significant (p = 0.155). Neither zinc feed provoked a lipid peroxidation response in the intestinal tissue of zebrafish compared to control fish (gelatin fed), but both {sup 65}Cu labeled feeds did. The greater effect was exerted by the MRG + exo (2.96 {+-} 0.29 nmol MDA mg protein{sup -1}) feed which three-fold greater than control (p < 0.01) and almost twice the MDA concentration of the MTLP feed (1.76 {+-} 0.21 nmol MDA mg protein{sup -1}, p < 0.05). The oxidative stress response produced by Zn and Cu is in keeping with their respective redox potentials; Zn being oxidatively inert and Cu being redox active. These results are similar, in terms of bioavailability and stress response of each feed, to those in our previous study in which {sup 109}Cd labeled G

  13. Single N277A substitution in C2 of simian immunodeficiency virus envelope influences vaccine-elicited CD4i neutralizing and anti-V2 antibody responses.

    Science.gov (United States)

    Tang, Xian; Guo, Jia; Cheng, Lin; Sun, Caijun; Liu, Li; Zuo, Teng; Wang, Hui; Chen, Ling; Zhang, Linqi; Chen, Zhiwei

    2017-05-02

    An effective HIV vaccine remains elusive, and immunogens capable of eliciting protective host humoral immunity have not yet been identified. Although HIV/SIV infections result in the abundant production of CD4-induced (CD4i) antibodies (Abs), these Abs are not protective due to steric restrictions following gp120 binding to CD4 on target cells. Here we report that both DNA- and vaccinia-based vaccines encoding SIV mac239 gp160 readily elicited high levels of CD4i Abs in experimental animals. We identified a highly conserved N-linked glycosylation site N277 in the C2 region which strongly affected the immunogenicity of the CD4i Ab domain. Moreover, a single N277A substitution significantly enhanced the immunogenicity of the V2 domain yielding higher titers and frequency of anti-V2 Ab responses as determined by ELISA and yeast antigen display mapping, respectively. Importantly, immune sera elicited by the N277A-mutated gp160 exhibited elevated antibody-dependent cellular cytotoxicity (ADCC) activity. ADCC activity correlated positively with the anti-V2 Ab titer yet, inversely with CD4i Ab titer. Thus, we identified a determinant of the CD4i domain that might affect vaccine-elicited anti-V2 Ab and ADCC responses to SIV mac239 . Our findings may have implications for design of immunogens to direct B cell recognition in the development of an Ab-based HIV vaccine. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. DNA Sequence Variation and Selection of Tag Single-Nucleotide Polymorphisms at Candidate Genes for Drought-Stress Response in Pinus taeda L.

    Science.gov (United States)

    González-Martínez, Santiago C.; Ersoz, Elhan; Brown, Garth R.; Wheeler, Nicholas C.; Neale, David B.

    2006-01-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (πsil = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from ∼0.50 to ∼0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of ∼30–40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine. PMID:16387885

  15. Neural Response After a Single ECT Session During Retrieval of Emotional Self-Referent Words in Depression: A Randomized, Sham-Controlled fMRI Study

    Science.gov (United States)

    Miskowiak, Kamilla W; Macoveanu, Julian; Jørgensen, Martin B; Støttrup, Mette M; Ott, Caroline V; Jensen, Hans M; Jørgensen, Anders; Harmer, J; Paulson, Olaf B; Kessing, Lars V; Siebner, Hartwig R

    2018-01-01

    Abstract Background Negative neurocognitive bias is a core feature of depression that is reversed by antidepressant drug treatment. However, it is unclear whether modulation of neurocognitive bias is a common mechanism of distinct biological treatments. This randomized controlled functional magnetic resonance imaging study explored the effects of a single electroconvulsive therapy session on self-referent emotional processing. Methods Twenty-nine patients with treatment-resistant major depressive disorder were randomized to one active or sham electroconvulsive therapy session at the beginning of their electroconvulsive therapy course in a double-blind, between-groups design. The following day, patients were given a self-referential emotional word categorization test and a free recall test. This was followed by an incidental word recognition task during whole-brain functional magnetic resonance imaging at 3T. Mood was assessed at baseline, on the functional magnetic resonance imaging day, and after 6 electroconvulsive therapy sessions. Data were complete and analyzed for 25 patients (electroconvulsive therapy: n = 14, sham: n = 11). The functional magnetic resonance imaging data were analyzed using the FMRIB Software Library randomize algorithm, and the Threshold-Free Cluster Enhancement method was used to identify significant clusters (corrected at P words. However, electroconvulsive therapy reduced the retrieval-specific neural response for positive words in the left frontopolar cortex. This effect occurred in the absence of differences between groups in behavioral performance or mood symptoms. Conclusions The observed effect of electroconvulsive therapy on prefrontal response may reflect early facilitation of memory for positive self-referent information, which could contribute to improvements in depressive symptoms including feelings of self-worth with repeated treatments. PMID:29718333

  16. Effects of lidocaine and magnesium sulfate in attenuating hemodynamic response to tracheal intubation: single-center, prospective, double-blind, randomized study.

    Science.gov (United States)

    Mendonça, Fabricio Tavares; de Queiroz, Lucas Macedo da Graça Medeiros; Guimarães, Cristina Carvalho Rolim; Xavier, Alexandre Cordeiro Duarte

    Hemodynamic response to airway stimuli is a common phenomenon and its management is important to reduce the systemic repercussions. The objective of this study is to compare the efficacy of intravenous magnesium sulfate versus lidocaine on this reflex hemodynamics after laryngoscopy and tracheal intubation. This single-center, prospective, double-blind, randomized study evaluated 56 patients ASA 1 or 2, aged 18-65 years, scheduled for elective surgeries under general anesthesia with intubation. The patients were allocated into two groups: Group F received 30mg·kg -1 of magnesium sulphate and Group L, 2mg·kg -1 of lidocaine, continuous infusion, immediately before the anesthetic induction. Blood pressure (BP), heart rate (HR), and bispectral index (BIS) were measured in both groups at six different times related to administration of the study drugs. In both groups there was an increase in HR and BP after laryngoscopy and intubation, compared to baseline. Group M showed statistically significant increase in the values of systolic and diastolic blood pressure after intubation, which was clinically unimportant. There was no difference in the BIS values between groups. Among patients receiving magnesium sulfate, three (12%) had high blood pressure versus only one among those receiving lidocaine (4%), with no statistical difference. Magnesium sulfate and lidocaine have good efficacy and safety for hemodynamic management in laryngoscopy and intubation. Copyright © 2016 Sociedade Brasileira de Anestesiologia. Published by Elsevier Editora Ltda. All rights reserved.

  17. Antigen delivery by filamentous bacteriophage fd displaying an anti-DEC-205 single-chain variable fragment confers adjuvanticity by triggering a TLR9-mediated immune response.

    Science.gov (United States)

    Sartorius, Rossella; D'Apice, Luciana; Trovato, Maria; Cuccaro, Fausta; Costa, Valerio; De Leo, Maria Giovanna; Marzullo, Vincenzo Manuel; Biondo, Carmelo; D'Auria, Sabato; De Matteis, Maria Antonietta; Ciccodicola, Alfredo; De Berardinis, Piergiuseppe

    2015-07-01

    Filamentous bacteriophage fd particles delivering antigenic determinants via DEC-205 (fdsc-αDEC) represent a powerful delivery system that induces CD8(+) T-cell responses even when administered in the absence of adjuvants or maturation stimuli for dendritic cells. In order to investigate the mechanisms of this activity, RNA-Sequencing of fd-pulsed dendritic cells was performed. A significant differential expression of genes involved in innate immunity, co-stimulation and cytokine production was observed. In agreement with these findings, we demonstrate that induction of proinflammatory cytokines and type I interferon by fdsc-αDEC was MYD88 mediated and TLR9 dependent. We also found that fdsc-αDEC is delivered into LAMP-1-positive compartments and co-localizes with TLR9. Thus, phage particles containing a single-strand DNA genome rich in CpG motifs delivered via DEC-205 are able to intercept and trigger the active TLR9 innate immune receptor into late endosome/lysosomes and to enhance the immunogenicity of the displayed antigenic determinants. These findings make fd bacteriophage a valuable tool for immunization without administering exogenous adjuvants. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.

  18. Estimation of Joule heating and its role in nonlinear electrical response of Tb0.5Sr0.5MnO3 single crystal

    Science.gov (United States)

    Nhalil, Hariharan; Elizabeth, Suja

    2016-12-01

    Highly non-linear I-V characteristics and apparent colossal electro-resistance were observed in non-charge ordered manganite Tb0.5Sr0.5MnO3 single crystal in low temperature transport measurements. Significant changes were noticed in top surface temperature of the sample as compared to its base while passing current at low temperature. By analyzing these variations, we realize that the change in surface temperature (ΔTsur) is too small to have caused by the strong negative differential resistance. A more accurate estimation of change in the sample temperature was made by back-calculating the sample temperature from the temperature variation of resistance (R-T) data (ΔTcal), which was found to be higher than ΔTsur. This result indicates that there are large thermal gradients across the sample. The experimentally derived ΔTcal is validated with the help of a simple theoretical model and estimation of Joule heating. Pulse measurements realize substantial reduction in Joule heating. With decrease in sample thickness, Joule heating effect is found to be reduced. Our studies reveal that Joule heating plays a major role in the nonlinear electrical response of Tb0.5Sr0.5MnO3. By careful management of the duty cycle and pulse current I-V measurements, Joule heating can be mitigated to a large extent.

  19. Single Cell Chemical Cytometry of Akt Activity in Rheumatoid Arthritis and Normal Fibroblast-like Synoviocytes in Response to Tumor Necrosis Factor α.

    Science.gov (United States)

    Mainz, Emilie R; Serafin, D Stephen; Nguyen, Tuong T; Tarrant, Teresa K; Sims, Christopher E; Allbritton, Nancy L

    2016-08-02

    The etiology of rheumatoid arthritis (RA) is poorly understood, and 30% of patients are unresponsive to established treatments targeting tumor necrosis factor α (TNFα). Akt kinase is implicated in TNFα signaling and may act as a barometer of patient responses to biologic therapies. Fluorescent peptide sensors and chemical cytometry were employed to directly measure Akt activity as well as proteolytic activity in individual fibroblast-like synoviocytes (FLS) from RA and normal subjects. The specificity of the peptide reporter was evaluated and shown to be a valid measure of Akt activity in single cells. The effect of TNFα treatment on Akt activity was highly heterogeneous between normal and RA subjects, which was not observable in bulk analyses. In 2 RA subjects, a bimodal distribution of Akt activity was observed, primarily due to a subpopulation (21.7%: RA Subject 5; 23.8%: RA Subject 6) of cells in which >60% of the reporter was phosphorylated. These subjects also possessed statistically elevated proteolytic cleavage of the reporter relative to normal subjects, suggesting heterogeneity in Akt and protease activity that may play a role in the RA-affected joint. We expect that chemical cytometry studies pairing peptide reporters with capillary electrophoresis will provide valuable data regarding aberrant kinase activity from small samples of clinical interest.

  20. Genetic injury in hybrid male mice exposed to low doses of /sup 60/CO. gamma. -rays or fission neutrons. 1. Response to single doses

    Energy Technology Data Exchange (ETDEWEB)

    Grahn, D.; Carnes, B.A.; Farrington, B.H.; Lee, C.H. (Argonne National Lab., IL (USA))

    1984-11-01

    Young adult male B6CF/sub 1/ mice were exposed to single whole body doses of fission neutrons or /sup 60/Co ..gamma.. rays. Postspermatogonial dominant lethal injury, incidence of reciprocal chromosome translocations induced in spermatogonia, incidence of abnormal epididymal sperm 4-6 weeks after exposure, and testis weight loss 3-6 weeks after exposure were all measured. Significant effects were seen at 1 and 2.5 rad of neutrons consistent with extrapolation from higher doses, with the exception of dominant lethal mutations, which occurred in significant excess of expectation. Dose-response functions were linear or linear-quadratic, depending upon end point, radiation quality, and dose range. For translocation frequencies, the D/sup 2/ term was negative for neutron and positive for ..gamma..-ray irradiations. RBE values varied with dose and end point. For testis weight loss and abnormal sperm over the full dose range, the RBEs were between 5 and 6. They were between 7 and 9 at lower doses (< 10 rad) for translocations. RBEs for postimplantation and total dominant lethal rates were 5-6 above 10 rad and 10-14 below 10 rad. The RBEs for preimplant losses were between 15 and 25 above 10 rad and possibly higher below 10 rad, although the data are statistically 'noisy'.

  1. Luminescence properties and gamma-ray response of the Ce and Ca co-doped (Gd,Y)F{sub 3} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Kamada, Kei, E-mail: k-kamada@furukawakk.co.jp [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai (Japan); Furukawa Co. Ltd. (Japan); Yanagida, Takayuki; Fujimoto, Yutaka; Fukabori, Akihiro [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai (Japan); Yoshikawa, Akira [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai (Japan); New Industry Creation Hatchery Center, Tohoku University, Sendai (Japan); Nikl, Martin [Institute of Physics AS CR (Czech Republic)

    2011-12-11

    The Ca0.5% and Ce1%, 3%, 7%, 10% co-doped Gd{sub 0.5}Y{sub 0.5}F{sub 3} single crystals were grown by the {mu}-PD method. In the Ca0.5% and Ce3% co-doped sample, Ce{sup 3+}-perturbed luminescence at 380 nm was observed with 32.4 ns photoluminescence decay time. The energy transfer in the sequence of the regular Ce{sup 3+}{yields} (Gd{sup 3+}){sub n}{yields} the perturbed Ce{sup 3+} sites was evidenced through observation of decay time shortening of the regular Ce{sup 3+} and Gd{sup 3+} centers and the change between the Gd{sup 3+} and Ce{sup 3+}-perturbed emission intensity. The gamma-ray excited scintillation response of the Ca0.5%, Ce7% co-doped Gd{sub 0.5}Y{sub 0.5}F{sub 3} sample was investigated with the help of the pulse height spectra and the light yield, energy resolution and non-proportionality was evaluated in the interval of energies of 59.4-1274 keV.

  2. Luminescence properties and gamma-ray response of the Ce and Ca co-doped (Gd,Y)F3 single crystals

    International Nuclear Information System (INIS)

    Kamada, Kei; Yanagida, Takayuki; Fujimoto, Yutaka; Fukabori, Akihiro; Yoshikawa, Akira; Nikl, Martin

    2011-01-01

    The Ca0.5% and Ce1%, 3%, 7%, 10% co-doped Gd 0.5 Y 0.5 F 3 single crystals were grown by the μ-PD method. In the Ca0.5% and Ce3% co-doped sample, Ce 3+ -perturbed luminescence at 380 nm was observed with 32.4 ns photoluminescence decay time. The energy transfer in the sequence of the regular Ce 3+ → (Gd 3+ ) n → the perturbed Ce 3+ sites was evidenced through observation of decay time shortening of the regular Ce 3+ and Gd 3+ centers and the change between the Gd 3+ and Ce 3+ -perturbed emission intensity. The gamma-ray excited scintillation response of the Ca0.5%, Ce7% co-doped Gd 0.5 Y 0.5 F 3 sample was investigated with the help of the pulse height spectra and the light yield, energy resolution and non-proportionality was evaluated in the interval of energies of 59.4-1274 keV.

  3. Regulatory T Cell Responses in Participants with Type 1 Diabetes after a Single Dose of Interleukin-2: A Non-Randomised, Open Label, Adaptive Dose-Finding Trial.

    Directory of Open Access Journals (Sweden)

    John A Todd

    2016-10-01

    Full Text Available Interleukin-2 (IL-2 has an essential role in the expansion and function of CD4+ regulatory T cells (Tregs. Tregs reduce tissue damage by limiting the immune response following infection and regulate autoreactive CD4+ effector T cells (Teffs to prevent autoimmune diseases, such as type 1 diabetes (T1D. Genetic susceptibility to T1D causes alterations in the IL-2 pathway, a finding that supports Tregs as a cellular therapeutic target. Aldesleukin (Proleukin; recombinant human IL-2, which is administered at high doses to activate the immune system in cancer immunotherapy, is now being repositioned to treat inflammatory and autoimmune disorders at lower doses by targeting Tregs.To define the aldesleukin dose response for Tregs and to find doses that increase Tregs physiologically for treatment of T1D, a statistical and systematic approach was taken by analysing the pharmacokinetics and pharmacodynamics of single doses of subcutaneous aldesleukin in the Adaptive Study of IL-2 Dose on Regulatory T Cells in Type 1 Diabetes (DILT1D, a single centre, non-randomised, open label, adaptive dose-finding trial with 40 adult participants with recently diagnosed T1D. The primary endpoint was the maximum percentage increase in Tregs (defined as CD3+CD4+CD25highCD127low from the baseline frequency in each participant measured over the 7 d following treatment. There was an initial learning phase with five pairs of participants, each pair receiving one of five pre-assigned single doses from 0.04 × 106 to 1.5 × 106 IU/m2, in order to model the dose-response curve. Results from each participant were then incorporated into interim statistical modelling to target the two doses most likely to induce 10% and 20% increases in Treg frequencies. Primary analysis of the evaluable population (n = 39 found that the optimal doses of aldesleukin to induce 10% and 20% increases in Tregs were 0.101 × 106 IU/m2 (standard error [SE] = 0.078, 95% CI = -0.052, 0.254 and 0.497

  4. In vitro response of the human breast cancer cell line MDAMB-231 and human peripheral blood mononuclear cells exposed to 60Co at single fraction

    Directory of Open Access Journals (Sweden)

    Lídia Maria Andrade

    2005-10-01

    Full Text Available Radiotherapy using gamma rays is a common modality of breast cancer treatment. The aim of this research is to investigate the biological response of the human breast cancer cell line MDAMB-231 and human peripheral blood mononuclear cells (PBMC exposed in vitro to 60 Co irradiation at a single fraction of 10 Gy, 25 Gy and 50 Gy doses at 136,4 cGy.min-1 rate. Cells were irradiated at room temperature by the Theratron 80 radiotherapy system. Biological response was evaluated through cellular viability using MTT assay and nucleus damages visualized by Propidium Iodide assay and electrophoresis agarose gel after gamma irradiation. Nucleus damages induced by 60Co irradiation were compared to damage caused by cell exposure to 10% methanol. The 50 Gy dose of irradiation did not stimulate nuclus damages at the same level as that affected by 10% methanol induction in the MDAMB-231. Further studies are necessary to understand these mechanisms in the MDAMB-231 human breast carcinoma cell line.Radioterapia utilizando radiação gama é uma modalidade comum no tratamento do câncer de mama. A proposta deste estudo é investigar a resposta biológica in vitro da linhagem celular MDAMB-231 de câncer de mama humano e células do sangue periférico humano (PBMC expostas à irradiação pelo Co60 em frações simples de 10Gy, 25Gy e 50Gy e 136,4cGy min-1 rate. As células foram irradiadas a temperatura ambiente usando o equipamento de radioterapia Theratron 80 radiotherapy system. A resposta biológica, após irradiação gama, foi avaliada através do ensaio do MTT para viabilidade celular e o do ensaio com Iodeto de Propídio para visualização do dano nuclear, além da eletroforese em gel de agarose. Os danos nucleares induzidos pelo Co60 foram comparados aos danos causados pela exposição das células à solução de metanol a 10%. Nós observamos que a dose de 50Gy não estimulou a mesma quantidade de danos nucleares que a solução de metanol a 10% nas c

  5. Monitoring of single-cell responses in the optic tectum of adult zebrafish with dextran-coupled calcium dyes delivered via local electroporation.

    Directory of Open Access Journals (Sweden)

    Vanessa Kassing

    Full Text Available The zebrafish (Danio rerio has become one of the major animal models for in vivo examination of sensory and neuronal computation. Similar to Xenopus tadpoles neural activity in the optic tectum, the major region controlling visually guided behavior, can be examined in zebrafish larvae by optical imaging. Prerequisites of these approaches are usually the transparency of larvae up to a certain age and the use of two-photon microscopy. This principle of fluorescence excitation was necessary to suppress crosstalk between signals from individual neurons, which is a critical issue when using membrane-permeant dyes. This makes the equipment to study neuronal processing costly and limits the approach to the study of larvae. Thus there is lack of knowledge about the properties of neurons in the optic tectum of adult animals. We established a procedure to circumvent these problems, enabling in vivo calcium imaging in the optic tectum of adult zebrafish. Following local application of dextran-coupled dyes single-neuron activity of adult zebrafish can be monitored with conventional widefield microscopy, because dye labeling remains restricted to tens of neurons or less. Among the neurons characterized with our technique we found neurons that were selective for a certain pattern orientation as well as neurons that responded in a direction-selective way to visual motion. These findings are consistent with previous studies and indicate that the functional integrity of neuronal circuits in the optic tectum of adult zebrafish is preserved with our staining technique. Overall, our protocol for in vivo calcium imaging provides a useful approach to monitor visual responses of individual neurons in the optic tectum of adult zebrafish even when only widefield microscopy is available. This approach will help to obtain valuable insight into the principles of visual computation in adult vertebrates and thus complement previous work on developing visual circuits.

  6. Kinetic Study on Peptide-Bound Pyrraline Formation and Elimination in the Maillard Reaction Using Single- and Multiple-Response Models.

    Science.gov (United States)

    Liang, Zhili; Li, Lin; Qi, Haiping; Zhang, Zhenbo Xu Xia; Li, Bing

    2016-10-01

    Pyrraline, an advanced glycation end product (AGE), is related to some chronic diseases and can be employed as an indicator for heat damage in food processing. In this study, the impact of changing the reactant concentration and ratio on the kinetic parameters describing peptide-bound pyrraline (pep-pyr) formation and elimination was evaluated in the Lys-Gly/glucose model systems, with microwave heating treatment ranging from 120 to 200 °C. The maximum pep-pyr concentration increased as follows: 200 °C ˂ 180 °C ˂ 160 °C ˂ 120 °C ˂ 140 °C. First, the pep-pyr formation and elimination was modeled by using a single-response modelling. The formation rate constant (k F ) of pep-pyr was independent of the initial concentration of the reactants and ratios. However, the elimination rate constant of pep-pyr (k E ) increased with increasing reactant concentrations. Second, a multiresponse modelling was performed to illustrate the pathways of pep-pyr formation and elimination. Two adapted models can fit to the experimental data with the goodness-of-fit ranging from 0.663 to 0.920. Glucose-to-fructose isomerization rather than glucose-to-mannose epimerization was detected in an equimolar model system and the model system with an excess of any of the reactants. The caramelization reaction was negligible in the equimolar systems and the model systems with an excess of peptide. The reaction rate constant of glucose-to-fructose isomerization was independent of the initial reactant ratios. It was more difficult for pep-pyr elimination in the model system with an excess of peptide than that in the other 2 model systems (the equimolar system and the system with an excess of glucose), whereas a reverse result in pep-pyr formation was obtained. © 2016 Institute of Food Technologists®.

  7. Impact of neoadjuvant single or dual HER2 inhibition and chemotherapy backbone upon pathological complete response in operable and locally advanced breast cancer: Sensitivity analysis of randomized trials.

    Science.gov (United States)

    Bria, Emilio; Carbognin, Luisa; Furlanetto, Jenny; Pilotto, Sara; Bonomi, Maria; Guarneri, Valentina; Vicentini, Cecilia; Brunelli, Matteo; Nortilli, Rolando; Pellini, Francesca; Sperduti, Isabella; Giannarelli, Diana; Pollini, Giovanni Paolo; Conte, Pierfranco; Tortora, Giampaolo

    2014-08-01

    The role of the dual HER2 inhibition, and the best chemotherapy backbone for neoadjuvant chemotherapy still represent an issue for clinical practice. A literature-based meta-analysis exploring single versus dual HER2 inhibition in terms of pathological complete response (pCR, breast plus axilla) rate and testing the interaction according to the chemotherapy (anthracyclines-taxanes or taxanes) was conducted. In addition, an event-based pooled analysis by extracting activity and safety events and deriving 95% confidence intervals (CI) was accomplished. Fourteen trials (4149 patients) were identified, with 6 trials (1820 patients) included in the meta-analysis and 31 arms (14 trials, 3580 patients) in the event-based pooled analysis. The dual HER2 inhibition significantly improves pCR rate, in the range of 16-19%, regardless of the chemotherapy backbone (relative risk 1.37, 95% CI 1.23-1.53, p<0.0001); pCR was significantly higher in the hormonal receptor negative population, regardless of the HER2 inhibition and type of chemotherapy. pCR and the rate of breast conserving surgery was higher when anthracyclines were added to taxanes, regardless of the HER2 inhibition. Severe neutropenia was higher with the addition of anthracyclines to taxanes, with an absolute difference of 19.7%, despite no differences in febrile neutropenia. While no significant differences according to the HER2 inhibition were found in terms of cardiotoxicity, a slightly difference for grade 3-4 (1.2%) against the addition of anthracyclines was calculated. The dual HER2 inhibition for the neoadjuvant treatment of HER2-positive breast cancer significantly increases pCR; the combination of anthracyclines, taxanes and anti-Her2 agents should be currently considered the standard of care. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. The Gly16 allele of the G16R single nucleotide polymorphism in the β2-adrenergic receptor gene augments the glycemic response to adrenaline in humans

    DEFF Research Database (Denmark)

    Rokamp, Kim Z.; Staalsø, Jonatan M.; Zaar, Morten

    2017-01-01

    Cerebral non-oxidative carbohydrate consumption may be driven by a ß2-adrenergic mechanism. This study tested whether the 46G > A (G16R) single nucleotide polymorphism of the ß2-adrenergic receptor gene (ADRB2) influences the metabolic and cerebrovascular responses to administration of adrenaline...

  9. Characterization of System on a Chip (SoC) Single Event Upset (SEU) Responses Using SEU Data, Classical Reliability Models, and Space Environment Data

    Science.gov (United States)

    Berg, Melanie; Label, Kenneth; Campola, Michael; Xapsos, Michael

    2017-01-01

    We propose a method for the application of single event upset (SEU) data towards the analysis of complex systems using transformed reliability models (from the time domain to the particle fluence domain) and space environment data.

  10. Analyzing Test-As-You-Fly Single Event Upset (SEU) Responses using SEU Data, Classical Reliability Models, and Space Environment Data

    Science.gov (United States)

    Berg, Melanie; Label, Kenneth; Campola, Michael; Xapsos, Michael

    2017-01-01

    We propose a method for the application of single event upset (SEU) data towards the analysis of complex systems using transformed reliability models (from the time domain to the particle fluence domain) and space environment data.

  11. The Megapixel EBCCD a high-resolution imaging tube sensitive to single photons

    CERN Document Server

    Buontempo, S; Dalinenko, I N; Ereditato, A; Ekimov, A V; Fabre, Jean-Paul; Fedorov, V Yu; Frenkel, A; Galeazzi, F; Garufi, F; Golovkin, S V; Govorun, V N; Kalashnikova, N N; Kosov, V G; Kozarenko, E N; Kreslo, I E; Lasovsky, L Y; Liberti, B; Malyarov, A V; Martellotti, G; Medvedkov, A M; Penso, G; Vishnevski, G I; Wolff, T; Zhuk, A

    1998-01-01

    A hybrid image-intensifier tube, suitable for extremely low-light imaging, has been tested. This device is based on an Electron-Bombarded CCD chip (EBCCD) with $1024 \\times 1024$ sensitive pixe ls. The tube, which has a photocathode diameter of 40 mm, is gateable and zoomable, with an image magnification varying from 0.62 to 1.3. The high gain (about 4000 collected electrons per photo electron at the operational voltage of 15 kV) and the relatively low noise (180 electrons per pixel at 10 MHz pixel-readout frequency), allows single-photoelectron signals to be separated from n oise with a signal-to-noise ratio greater than 10. By applying an appropriate threshold on the signal amplitude, the background can almost be eliminated, with a loss of few percent in single-ph otoelectron counting. High inner gain, low noise, single-photoelectron sensitivity, and high spatial resolution make the EBCCD imaging tube a unique device, attractive for many applications in h igh-energy physics, astrophysics, biomedical diagnos...

  12. A single vaccination with an inactivated bovine respiratory syncytial virus vaccine primes the cellular immune response in calves with maternal antibody

    Directory of Open Access Journals (Sweden)

    Makoschey Birgit

    2010-01-01

    Full Text Available Abstract Background The efficacy of a single dose of an inactivated bovine respiratory syncytial virus (BRSV - Parainfluenaza type 3 (PI3 - Mannheimia haemolytica (Mh combination vaccine, in calves positive for maternal antibodies, was established in a BRSV infection study. Results As expected the single vaccination did not have any effect on the decline of BRSV-specific neutralising or ELISA antibody. The cellular immune system was however primed by the vaccination. In the vaccinated group virus excretion with nasal discharge was reduced, less virus could be re-isolated from lung tissues and the lungs were less affected. Conclusions These results indicate that a single vaccination with an inactivated BRSV vaccine was able to break through the maternal immunity and induce partial protection in very young calves. It can be speculated that the level and duration of protection will improve after the second dose of vaccine is administered. A two-dose basic vaccination schedule is recommended under field conditions.

  13. Differential patterns of human immunoglobulin G subclass responses to distinct regions of a single protein, the merozoite surface protein 1 of Plasmodium falciparum

    DEFF Research Database (Denmark)

    Cavanagh, D R; Dobaño, C; Elhassan, I M

    2001-01-01

    Comparisons of immunoglobulin G (IgG) subclass responses to the major polymorphic region and to a conserved region of MSP-1 in three cohorts of African villagers exposed to Plasmodium falciparum revealed that responses to Block 2 are predominantly IgG3 whereas antibodies to MSP-1(19) are mainly Ig...

  14. Luminescence properties and gamma-ray response of the Ce and Ca co-doped (Gd,Y)F.sub.3./sub. single crystals

    Czech Academy of Sciences Publication Activity Database

    Kamada, K.; Yanagida, T.; Fujimoto, Y.; Fukabori, A.; Yoshikawa, A.; Nikl, Martin

    2011-01-01

    Roč. 659, č. 1 (2011), s. 355-360 ISSN 0168-9002 R&D Projects: GA AV ČR KAN300100802 Institutional research plan: CEZ:AV0Z10100521 Keywords : Micro Pulling Down method * fluoride single crystal * luminescence * scintillator * Ce 3+ Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.207, year: 2011

  15. Peptide motifs of the single dominantly expressed class I molecule explain the striking MHC-determined response to Rous sarcoma virus in chickens

    DEFF Research Database (Denmark)

    Wallny, Hans-Joachim; Avila, David; Hunt, Lawrence G.

    2006-01-01

    Compared with the MHC of typical mammals, the chicken MHC is smaller and simpler, with only two class I genes found in the B12 haplotype. We make five points to show that there is a single-dominantly expressed class I molecule that can have a strong effect on MHC function. First, we find only one...

  16. A Single 17D Yellow Fever Vaccination Provides Lifelong Immunity; Characterization of Yellow-Fever-Specific Neutralizing Antibody and T-Cell Responses after Vaccination

    NARCIS (Netherlands)

    Wieten, Rosanne W.; Jonker, Emile F. F.; van Leeuwen, Ester M. M.; Remmerswaal, Ester B. M.; ten Berge, Ineke J. M.; de Visser, Adriëtte W.; van Genderen, Perry J. J.; Goorhuis, Abraham; Visser, Leo G.; Grobusch, Martin P.; de Bree, Godelieve J.

    2016-01-01

    Prompted by recent amendments of Yellow Fever (YF) vaccination guidelines from boost to single vaccination strategy and the paucity of clinical data to support this adjustment, we used the profile of the YF-specific CD8+ T-cell subset profiles after primary vaccination and neutralizing antibodies as

  17. Intracellular β2-adrenergic receptor signaling specificity in mouse skeletal muscle in response to single-dose β2-agonist clenbuterol treatment and acute exercise.

    Science.gov (United States)

    Sato, Shogo; Shirato, Ken; Mitsuhashi, Ryosuke; Inoue, Daisuke; Kizaki, Takako; Ohno, Hideki; Tachiyashiki, Kaoru; Imaizumi, Kazuhiko

    2013-05-01

    The aim of this study was to clarify the intracellular β2-adrenergic receptor signaling specificity in mouse slow-twitch soleus and fast-twitch tibialis anterior (TA) muscles, resulting from single-dose β2-agonist clenbuterol treatment and acute exercise. At 1, 4, and 24 h after single-dose treatment with clenbuterol or after acute running exercise, the soleus and TA muscles were isolated and subjected to analysis. The phosphorylation of p38 mitogen-activated protein kinase (MAPK) increased after single-dose clenbuterol treatment and acute exercise in the soleus muscle but not in the TA muscle. Although there was no change in the phosphorylation of Akt after acute exercise in either muscle, phosphorylation of Akt in the soleus muscle increased after single-dose clenbuterol treatment, whereas that in the TA muscle remained unchanged. These results suggest that p38 MAPK and Akt pathways play a functional role in the adaptation to clenbuterol treatment and exercise, particularly in slow-twitch muscles.

  18. Bird communities following high-severity fire: Response to single and repeat fires in a mixed-evergreen forest, Oregon, USA

    Science.gov (United States)

    Joseph B. Fontaine; Daniel C. Donato; W. Douglas Robinson; Beverly E. Law; J. Boone Kauffman

    2009-01-01

    Fire is a widespread natural disturbance agent in most conifer-dominated forests. In light of climate change and the effects of fire exclusion, single and repeated high-severity (stand-replacement) fires have become prominent land management issues. We studied bird communities using point counting in the Klamath-Siskiyou ecoregion of Oregon, USA at various points in...

  19. Frequency-dependent linear and non-linear response properties of single carrier quantum dots: Role of effective mass and anharmonicity in the confinement potential

    Energy Technology Data Exchange (ETDEWEB)

    Mandal, Parikshit [Department of Chemistry, Physical Chemistry Section, Visva Bharati University, Santiniketan, Birbhum 731 235, West Bengal (India); Ghosh, Manas [Department of Chemistry, Physical Chemistry Section, Visva Bharati University, Santiniketan, Birbhum 731 235, West Bengal (India)], E-mail: pcmg77@rediffmail.com

    2008-09-01

    We explore the pattern of frequency-dependent linear and non-linear optical (NLO) response of one electron quantum dots harmonically confined in two dimensions. For some fixed values of transverse magnetic field strength ({omega}{sub c}), and harmonic confinement potential ({omega}{sub 0}), the influence of effective mass (m*) of the system and the symmetry breaking anharmonic interaction on the frequency-dependent linear ({alpha}), and the first ({beta}), and second ({gamma}) NLO responses of the dot is computed through linear variational route. The investigation reveals interesting roles played by the anharmonic interaction and effective mass in modulating the response properties.

  20. Single-epitope DNA vaccination prevents exhaustion and facilitates a broad antiviral CD8+ T cell response during chronic viral infection

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Stryhn, Anette; Christensen, Jan Pravsgaard

    2004-01-01

    of DNA vaccines encoding immunodominant epitopes of lymphocytic choriomeningitis virus (LCMV). We analyzed the spectrum of the CD8+ T cell response and the susceptibility to infection in H-2(b) and H-2(d) mice. Priming for a monospecific, CD8+ T cell response did not render mice susceptible to viral...... acute LCMV infection, DNA vaccination did not significantly impair naturally induced immunity. Thus, the response to the other immunogenic epitopes was not dramatically suppressed in DNA-immunized mice undergoing normal immunizing infection, and the majority of mice were protected against rechallenge...... variants. Thus, vaccinated mice were protected against chronic infection with LCMV, and no evidence indicating biologically relevant viral escape was obtained. In parallel, a broad and sustained CD8+ T cell response was generated upon infection, and in H-2(d) mice epitope spreading was observed. Even after...

  1. Can the responses of photosynthesis and stomatal conductance to water and nitrogen stress combinations be modeled using a single set of parameters?

    NARCIS (Netherlands)

    Zhang, Ningyi; Li, Gang; Yu, Shanxiang; An, Dongsheng; Sun, Qian; Luo, Weihong; Yin, Xinyou

    2017-01-01

    Accurately predicting photosynthesis in response to water and nitrogen stress is the first step toward predicting crop growth, yield and many quality traits under fluctuating environmental conditions. While mechanistic models are capable of predicting photosynthesis under fluctuating environmental

  2. Acute Immune-Inflammatory Responses to a Single Bout of Aerobic Exercise in Smokers; The Effect of Smoking History and Status

    Science.gov (United States)

    Kastelein, Tegan Emma; Duffield, Rob; Marino, Frank E.

    2015-01-01

    This study examined the acute immune and inflammatory responses to exercise in smokers compared to non-smokers, and further, the effect of smoking history on these immune-inflammatory responses. Fifty-four recreationally active males who were either smokers (SM; n = 27) or non-smokers (NS; n = 27) were allocated into either young (YSM, YNS) or middle-aged groups (MSM, MNS) based on smoking status. Participants were matched for fitness and smoking habits and following familiarization and baseline testing, undertook an exercise protocol that involved 40 min of cycle ergometry at 50% of VO2peak. Venous blood was obtained pre- and post- (0 min, 1, and 4 h) exercise to measure circulating leukocytes and inflammatory markers interleukin (IL)-6, IL-1β, IL-1ra, and monocyte chemoattractant protein-1 (MCP-1). Compared to MNS, MSM showed elevated basal concentrations of MCP-1, which were increased with a longer smoking history (P exercise, YSM demonstrated an amplified IL-6 response from immediately- to 1 h-post compared to YNS. Furthermore, IL-1ra in YSM was elevated above that of YNS across all time points (P exercise leukocyte response was greater in MSM compared to YSM and non-smokers (P exercise-induced inflammatory responses noted in YSM may be indicative tobacco smoke exposure priming circulating leukocytes to amplify inflammatory responses. PMID:26779179

  3. Prediction of the antidepressant response to total sleep deprivation of depressed patients: longitudinal versus single day assessment of diurnal mood variation.

    Science.gov (United States)

    Reinink, E; Bouhuys, A L; Gordijn, M C; Van Den Hoofdakker, R H

    1993-10-01

    The relationship between diurnal variation of mood and the clinical response to total sleep deprivation (TSD) was investigated in 43 depressed patients. The question asked was whether the propensity to produce diurnal variations of mood or the actual mood course on the day before TSD determines the clinical response to TSD. Patients rated their mood three times daily during an experimental period of 56 days. The frequency as well as the amplitude of daily mood changes were assessed during this period. For each patient six TSDs were scheduled: two after days with a positive mood course, two after a negative mood course, and two after days without a diurnal change of mood. This strategy allowed comparisons of TSD responses within patients. Moreover, longitudinally and retrospectively assessed diurnal variation were compared with each other. It was found that patients vary largely in the occurrence of diurnal variations of mood. The propensity to produce diurnal variations either in terms of frequency or amplitude was positively correlated with the response to TSD. Within patients no differences were found in responses to TSDs applied after days with diurnal variations (positive or negative) or without diurnal variations. A second aim was to get more insight into the mechanism relating diurnal variations of mood and the TSD response. Therefore, the interrelatedness of various measures of diurnal variations, such as amplitudes and frequencies of positive or negative diurnal mood changes, was studied, as well as the relationships of these variables with TSD responses. On the basis of the strong interrelatedness it is suggested that they all reflect the same underlying mechanism, to be symbolized by an oscillator, producing positive daily fluctuations of mood.

  4. Temperature-dependent sex determination in fish revisited: prevalence, a single sex ratio response pattern, and possible effects of climate change.

    Directory of Open Access Journals (Sweden)

    Natalia Ospina-Alvarez

    Full Text Available BACKGROUND: In gonochoristic vertebrates, sex determination mechanisms can be classified as genotypic (GSD or temperature-dependent (TSD. Some cases of TSD in fish have been questioned, but the prevalent view is that TSD is very common in this group of animals, with three different response patterns to temperature. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed field and laboratory data for the 59 fish species where TSD has been explicitly or implicitly claimed so far. For each species, we compiled data on the presence or absence of sex chromosomes and determined if the sex ratio response was obtained within temperatures that the species experiences in the wild. If so, we studied whether this response was statistically significant. We found evidence that many cases of observed sex ratio shifts in response to temperature reveal thermal alterations of an otherwise predominately GSD mechanism rather than the presence of TSD. We also show that in those fish species that actually have TSD, sex ratio response to increasing temperatures invariably results in highly male-biased sex ratios, and that even small changes of just 1-2 degrees C can significantly alter the sex ratio from 1:1 (males:females up to 3:1 in both freshwater and marine species. CONCLUSIONS/SIGNIFICANCE: We demonstrate that TSD in fish is far less widespread than currently believed, suggesting that TSD is clearly the exception in fish sex determination. Further, species with TSD exhibit only one general sex ratio response pattern to temperature. However, the viability of some fish populations with TSD can be compromised through alterations in their sex ratios as a response to temperature fluctuations of the magnitude predicted by climate change.

  5. Analysis of a high brightness photo electron beam with self field and wake field effects

    International Nuclear Information System (INIS)

    Parsa, Z.

    1991-01-01

    High brightness sources are the basic ingredients in the new accelerator developments such as Free-Electron Laser experiments. The effects of the interactions between the highly charged particles and the fields in the accelerating structure, e.g. R.F., Space charge and Wake fields can be detrimental to the beam and the experiments. We present and discuss the formulation used, some simulation and results for the Brookhaven National Laboratory high brightness beam that illustrates effects of the accelerating field, space charge forces (e.g. due to self field of the bunch), and the wake field (e.g. arising from the interaction of the cavity surface and the self field of the bunch)

  6. Microscopic measurements of variations in local (photo)electronic properties in nanostructured solar cells

    Czech Academy of Sciences Publication Activity Database

    Fejfar, Antonín; Hývl, Matěj; Ledinský, Martin; Vetushka, Aliaksi; Stuchlík, Jiří; Kočka, Jan; Misra, S.; O'Donnell, B.; Foldyna, M.; Yu, L.; Roca i Cabarrocas, P.

    2013-01-01

    Roč. 119, Dec (2013), s. 228-234 ISSN 0927-0248 R&D Projects: GA MPO FR-TI2/736; GA ČR GA13-25747S; GA ČR GA13-12386S; GA MŠk(CZ) LM2011026 Grant - others:AVČR(CZ) M100101216; AVČR(CZ) M100101217 Institutional support: RVO:68378271 Keywords : silicon * thin films * nanowires * random diode arrays * atomic force microscopy * photoresponse Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.030, year: 2013

  7. Photo-Electron Injection into TiO2: Quantum Dot vs. Graphene

    Science.gov (United States)

    Long, Run

    2013-03-01

    We presented a detailed comparison on the similalaries and differences of the ultrafast photoinduced electron transfer (ET) from two kinds of donor species, namely PbSe quantum dot (QD) and graphene, into the acceptor TiO2 surface via ab initio time domain density functional theory simulations. The main diffrences stem from the size and dimensionality of the donor species and donor-acceptor bonding characteristics. For exmaple, the QD is localized species and composed by heavy atoms that connected to TiO2 surface via chemical bonds. In contrast, the graphene layer is delocalized two-dimensional object that attached to TiO2 substrate by van der Waals interaction and partial chemical bonds. The ET mechanism depends on the dimensionality of the donor and donor-acceptor chemical bonding. The injection from the localized donor states of the QD is dominatly adiabatic. In contrast, the injection from the two-dimensional graphene into TiO2 exhibits prominently nonadiabatic (NA) component. The NA mechanism is efficient for the graphene/TiO2 composites because it is delocalized over two dimensions and is able to couple with a dense manifold of delocalized TiO2 conduction band states and weak coupling as well. The high density of acceptor states in this case favors the NA mechanism. This work is supported by Science Foundation Ireland SIRG program (Grant Number 11/SIRG/E2172).

  8. [Studies on photo-electron-chemical catalytic degradation of the malachite green].

    Science.gov (United States)

    Li, Ming-yu; Diao, Zeng-hui; Song, Lin; Wang, Xin-le; Zhang, Yuan-ming

    2010-07-01

    A novel two-compartment photo-electro-chemical catalytic reactor was designed. The TiO2/Ti thin film electrode thermally formed was used as photo-anode, and graphite as cathode and a saturated calomel electrode (SCE) as the reference electrode in the reactor. The anode compartment and cathode compartment were connected with the ionic exchange membrane in this reactor. Effects of initial pH, initial concentration of malachite green and connective modes between the anode compartment and cathode compartment on the decolorization efficiency of malachite green were investigated. The degradation dynamics of malachite green was studied. Based on the change of UV-visible light spectrum, the degradation process of malachite green was discussed. The experimental results showed that, during the time of 120 min, the decolouring ratio of the malachite green was 97.7% when initial concentration of malachite green is 30 mg x L(-1) and initial pH is 3.0. The catalytic degradation of malachite green was a pseudo-first order reaction. In the degradation process of malachite green the azo bond cleavage and the conjugated system of malachite green were attacked by hydroxyl radical. Simultaneity, the aromatic ring was oxidized. Finally, malachite green was degraded into other small molecular compounds.

  9. 75 FR 63810 - Grant of Authority for Subzone Status; SICK, Inc. (Photo-Electronic Industrial Sensors...

    Science.gov (United States)

    2010-10-18

    ... Sensors); Bloomington, MN Pursuant to its authority under the Foreign-Trade Zones Act of June 18, 1934, as... industrial sensor manufacturing and distribution facility of SICK, Inc., located in Bloomington, Minnesota... sensors at the SICK, Inc., facility located in Bloomington, Minnesota (Subzone 119G), as described in the...

  10. Association of a single nucleotide polymorphic variation in the human chromosome 19q13.3 with drug responses in the NCI60 cell lines

    DEFF Research Database (Denmark)

    Nissen, K.K.; Vogel, Ulla Birgitte; Nexo, B.A.

    2009-01-01

    We studied the importance of certain polymorphisms on human chromosome 19q13.3 for drug sensitivity in human tumor cell cultures. NCI60 is a panel of 60 established tumor-derived cell lines, which have been tested for their sensitivity to tens of thousands of different drugs. Here we investigate...... the correlations between the responses of the NCI60 cells to different anticancer drugs and their respective alleles of five DNA polymorphisms located in a cancer-related chromosomal area. One polymorphism, located in the 5' noncoding region of the gene ASE-1, alias CD3EAP, proved to be associated with drug...... sensitivity (P=0.025). The same polymorphism has previously been associated with treatment response of multiple myeloma after bone marrow ablation. The polymorphism ASE-1-e1 was of importance for the drug response in the human cancer cell lines investigated and could eventually become important...

  11. Single and combined effects of microplastics and mercury on juveniles of the European seabass (Dicentrarchus labrax): Changes in behavioural responses and reduction of swimming velocity and resistance time.

    Science.gov (United States)

    Barboza, Luís Gabriel Antão; Vieira, Luís Russo; Guilhermino, Lúcia

    2018-05-01

    Microplastics and mercury are environmental pollutants of great concern. The main goal of the present study was to investigate the effects of these pollutants, both individually and in binary mixtures, on the swimming performance of juvenile European seabass, Dicentrarchus labrax. Microplastics alone, mercury alone and all the mixtures caused significant reduction of the swimming velocity and resistance time of fish. Moreover, changes in behavioural responses including lethargic and erratic swimming behaviour were observed. These results highlight that fish behavioural responses can be used as sensitive endpoint to establish the effects of contamination by microplastics and also emphasizes the need to assess the combined effects of microplastics and other environmental contaminants, with special attention to the effects on behavioural responses in fish and other aquatic species. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Single and combined effects of cadmium and arsenate in Gammarus pulex (Crustacea, Amphipoda): Understanding the links between physiological and behavioural responses

    Energy Technology Data Exchange (ETDEWEB)

    Vellinger, Céline, E-mail: celine.vellinger@gmail.com [Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), CNRS UMR 7360, Université de Lorraine – Metz (France); Gismondi, Eric, E-mail: gismondi.eric@gmail.com [Laboratoire d’Ecologie animale et d’Ecotoxicologie, Institut de Chimie, Université de Liège, Allée du 6 Août 15, B-4000 Sart-Tilman, Liège (Belgium); Felten, Vincent, E-mail: vincent.felten@univ-lorraine.fr [Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), CNRS UMR 7360, Université de Lorraine – Metz (France); Rousselle, Philippe, E-mail: rousselle@univ-lorraine.fr [Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), CNRS UMR 7360, Université de Lorraine – Metz (France); Mehennaoui, Kahina, E-mail: meh_kahina@yahoo.fr [Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), CNRS UMR 7360, Université de Lorraine – Metz (France); Parant, Marc, E-mail: parant@univ-lorraine.fr [Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), CNRS UMR 7360, Université de Lorraine – Metz (France); Usseglio-Polatera, Philippe, E-mail: usseglio-polatera@univ-lorraine.fr [Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), CNRS UMR 7360, Université de Lorraine – Metz (France)

    2013-09-15

    Highlights: •Linking physiological to behavioural responses of G. pulex exposed to AsV and/or Cd. •AsV and/or Cd exposure exhibited similar biomarkers responses. •Contamination increases the mobilization of detoxification systems in gammarids. •Both changes in energy reserve use and allocation are involved in gammarid response. •Increased lipid peroxidation could be the cause of increasing gammarid mortality. -- Abstract: This study aimed at investigating the individual and interactive effects of cadmium (Cd) and arsenate (AsV) in Gammarus pulex (Crustacea, Amphipoda) through the use of several biomarkers. Individuals were exposed for 240 h to two concentrations of AsV or Cd alone, and all the possible binary mixtures of these concentrations of AsV and Cd in a complete factorial design. The pattern of the biomarkers’ responses to Cd and AsV alone or in mixture was similar in Gammarus pulex, even if the response intensity varied depending on the tested conditions. G. pulex responded to contamination with increased mobilization of the detoxification systems [i.e. γ-glutamyl-cystein ligase activity (GCL), reduced glutathione content (GSH) and metallothionein concentrations (MT)]. This response seems to imply changes in energy reserve utilization (total lipids and proteins are used prior to glycogen reserves), but also a possible energy reallocation from locomotion to detoxification processes. The observed increase in lipid peroxidation could be relied to the increasing gammarid mortality, despite the higher mobilization of detoxification systems. Even if the outcome of the complex interactions between AsV and Cd remains difficult to unravel, such studies are critically important for better assessing the effects of stressors on organisms, populations and communities in a multi-contamination context of ecosystems.

  13. The diagnostic accuracy of dual-view digital mammography, single-view breast tomo-synthesis and a dual-view combination of breast tomo-synthesis and digital mammography in a free-response observer performance study

    International Nuclear Information System (INIS)

    Svahn, T.; Andersson, I.; Chakraborty, D.; Svensson, S.; Ikeda, D.; Foernvik, D.; Mattsson, S.; Tingberg, A.; Zackrisson, S.

    2010-01-01

    The purpose of the present study was to compare the diagnostic accuracy of dual-view digital mammography (DM), single view breast tomo-synthesis (BT) and BT combined with the opposite DM view. Patients with subtle lesions were selected to undergo BT examinations. Two radiologists who are non-participants in the study and have experience in using DM and BT determined the locations and extents of lesions in the images. Five expert mammographers interpreted the cases using the free-response paradigm. The task was to mark and rate clinically reportable findings suspicious for malignancy and clinically relevant benign findings. The marks were scored with reference to the outlined regions into lesion localization or non-lesion localization, and analysed by the jackknife alternative free-response receiver operating characteristic method. The analysis yielded statistically significant differences between the combined modality and dual-view DM (p < 0.05). No differences were found between single-view BT and dual-view DM or between single-view BT and the combined modality. (authors)

  14. The Effect of Isomaltulose Together with Green Tea on Glycemic Response and Antioxidant Capacity: A Single-Blind, Crossover Study in Healthy Subjects

    OpenAIRE

    Suraphad, Passakorn; Suklaew, Phim On; Ngamukote, Sathaporn; Adisakwattana, Sirichai; M?kynen, Kittana

    2017-01-01

    Isomaltulose, a naturally-occurring isomer of sucrose, is commonly used as an alternative sweetener in foods and beverages. The goal of this study was to determine the effect of isomaltulose together with green tea on postprandial plasma glucose and insulin concentration, as well as antioxidant capacity in healthy subjects. In a randomized, single-blind, crossover study, 15 healthy subjects (eight women and seven men; ages 23.5 ? 0.7 years; with body mass index of 22.6 ? 0.4 kg/m2) consumed f...

  15. Azithromycin To Prevent Bronchopulmonary Dysplasia in Ureaplasma-Infected Preterm Infants: Pharmacokinetics, Safety, Microbial Response, and Clinical Outcomes with a 20-Milligram-per-Kilogram Single Intravenous Dose

    Science.gov (United States)

    Othman, Ahmed A.; Hassan, Hazem E.; Eddington, Natalie D.; Abebe, Elias; Terrin, Michael L.; Kaufman, David A.; Waites, Ken B.

    2013-01-01

    Ureaplasma respiratory tract colonization is associated with bronchopulmonary dysplasia (BPD) in preterm infants. Previously, we demonstrated that a single intravenous (i.v.) dose of azithromycin (10 mg/kg of body weight) is safe but inadequate to eradicate Ureaplasma spp. in preterm infants. We performed a nonrandomized, single-arm open-label study of the pharmacokinetics (PK) and safety of intravenous 20-mg/kg single-dose azithromycin in 13 mechanically ventilated neonates with a gestational age between 24 weeks 0 days and 28 weeks 6 days. Pharmacokinetic data from 25 neonates (12 dosed with 10 mg/kg i.v. and 13 dosed with 20 mg/kg i.v.) were analyzed using a population modeling approach. Using a two-compartment model with allometric scaling of parameters on body weight (WT), the population PK parameter estimates were as follows: clearance, 0.21 liter/h × WT(kg)0.75 [WT(kg)0.75 indicates that clearance was allometrically scaled on body weight (in kilograms) with a fixed exponent of 0.75]; intercompartmental clearance, 2.1 liters/h × WT(kg)0.75; central volume of distribution (V), 1.97 liters × WT (kg); and peripheral V, 17.9 liters × WT (kg). There was no evidence of departure from dose proportionality in azithromycin exposure over the tested dose range. The calculated area under the concentration-time curve over 24 h in the steady state divided by the MIC90 (AUC24/MIC90) for the single dose of azithromycin (20 mg/kg) was 7.5 h. Simulations suggest that 20 mg/kg for 3 days will maintain azithromycin concentrations of >MIC50 of 1 μg/ml for this group of Ureaplasma isolates for ≥96 h after the first dose. Azithromycin was well tolerated with no drug-related adverse events. One of seven (14%) Ureaplasma-positive subjects and three of six (50%) Ureaplasma-negative subjects developed physiologic BPD. Ureaplasma was eradicated in all treated Ureaplasma-positive subjects. Simulations suggest that a multiple-dose regimen may be efficacious for microbial clearance

  16. The intestinal T cell response to alpha-gliadin in adult celiac disease is focused on a single deamidated glutamine targeted by tissue transglutaminase

    DEFF Research Database (Denmark)

    Arentz-Hansen, H; Körner, R; Molberg, O

    2000-01-01

    The great majority of patients that are intolerant of wheat gluten protein due to celiac disease (CD) are human histocompatibility leukocyte antigen (HLA)-DQ2(+), and the remaining few normally express HLA-DQ8. These two class II molecules are chiefly responsible for the presentation of gluten...

  17. Lathosterol to cholesterol ratio in serum predicts cholesterol lowering response to plant sterol consumption in a dual center, randomized, single-blind placebo controlled trial

    Science.gov (United States)

    Benefits of plant sterols (PS) for cholesterol lowering are compromised by large variability in efficacy across individuals. High fractional cholesterol synthesis measured by deuterium incorporation has been associated with non-response to PS consumption; however, prospective studies showing this as...

  18. No Associations Between Single Nucleotide Polymorphisms in Corticoid Receptor Genes and Heart Rate and Cortisol Responses to a Standardized Social Stress Test in Adolescents : The TRAILS Study

    NARCIS (Netherlands)

    Bouma, Esther M. C.; Riese, Harriette; Nolte, Ilja M.; Oosterom, Elvira; Verhulst, Frank C.; Ormel, Johan; Oldehinkel, Albertine J.

    Previously, sequence variation in the glucocorticoid (GR) and mineralocorticoid (MR) receptor genes (NR3C1 and NR3C2, respectively) have been found to be associated with physiological stress responses to social stress tests in small samples of adult men and oral contraceptives (OC) using women.

  19. Research of predictive factors for cardiac resynchronization therapy: a prospective study comparing data from phase-analysis of gated myocardial perfusion single-photon computed tomography and echocardiography : Trying to anticipate response to CRT.

    Science.gov (United States)

    Gendre, Rémy; Lairez, O; Mondoly, P; Duparc, A; Carrié, D; Galinier, M; Berry, I; Cognet, T

    2017-04-01

    Cardiac resynchronization therapy (CRT) reduces morbidity and mortality in chronic systolic heart failure. About 20% of implanted patients are considered as "non-responders". This study aimed to evaluate gated myocardial perfusion single-photon emission computed tomography (GMPS) phase parameters as compared to echocardiography in the assessment of predictors for response to CRT before and after CRT activation. Forty-two patients were prospectively included during 15 months. A single injection of 99m Tc-tetrofosmin was used to acquire GMPS phase pre- and post-CRT activation. Indicators of positive CRT response were improvement of functional status and 15% reduction in left ventricular end-systolic volume at 3 months. Phase parameters at baseline were similar in the two groups with no influence of perfusion data. Phase parameters after CRT activation were significantly improved in the responders' group (Δ Bandwidth -19° ± 24° vs. 13° ± 31°, p = 0.001; Δ SD -20° ± 30° vs. 26° ± 46°, p = 0.001; Δ Entropy -11 ± 12 vs. 2 ± 6%, p = 0.001). Feasibility and reproducibility were higher for GMPS. Acute phase modifications after CRT activation may predict response to CRT immediately after implantation, but not at baseline, even when adjusted to perfusion data.

  20. The German ISS experiment Cellular Responses to Radiation in Space (CERASP): The effects of single and combined space flight conditions on mammalian cells

    Science.gov (United States)

    Baumstark-Khan, C.; Hellweg, C.; Arenz, A.

    2005-08-01

    The German experiment "Cellular Responses to Radiation in Space (CERASP)", to be performed on the International Space Station (ISS) will supply basic information on the cellular response to radiation applied in microgravity. One of the biological endpoints under investigation will be gene activation by space flight conditions in mammalian cells, based on fluorescent promoter reporter systems using green fluorescent protein. The promoter element to be investigated reflects the activity of the nuclear factor kappa B (NF-κB) pathway. Results obtained with X-rays and accelerated argon ions (95 MeV/u, LET 230 keV/μm) produced at the French heavy ion accelerator GANIL imply that densely ionizing radiation has a stronger potential to activate NF-κB dependent gene expression than sparsely ionizing radiation.

  1. Carbon black nanoparticles induce biphasic gene expression changes associated with inflammatory responses in the lungs of C57BL/6 mice following a single intratracheal instillation

    DEFF Research Database (Denmark)

    Husain, Mainul; Kyjovska, Zdenka O.; Bourdon-Lacombe, Julie

    2015-01-01

    instilled with 162μg CBNPs alongside vehicle controls. Lung tissues were examined 3h, and 1, 2, 3, 4, 5, 14, and 42days (d) post-exposure. Global gene expression and pulmonary inflammation were assessed. DNA damage was evaluated in bronchoalveolar lavage (BAL) cells and lung tissue using the comet assay....... Increased neutrophil influx was observed at all time-points. DNA strand breaks were increased in BAL cells 3h post-exposure, and in lung tissues 2-5d post-exposure. Approximately 2600 genes were differentially expressed (±1.5 fold; p≤0.05) across all time-points in the lungs of exposed mice. Altered...... transcript levels were associated with immune-inflammatory response and acute phase response pathways, consistent with the BAL profiles and expression changes found in common respiratory infectious diseases. Genes involved in DNA repair, apoptosis, cell cycle regulation, and muscle contraction were also...

  2. Impact of human D398N single nucleotide polymorphism on intracellular calcium response mediated by α3β4α5 nicotinic acetylcholine receptors

    Science.gov (United States)

    Tammimäki, Anne; Herder, Penelope; Li, Ping; Esch, Caroline; Laughlin, James R.; Akk, Gustav; Stitzel, Jerry A.

    2013-01-01

    The human CHRNA5 D398N polymorphism (rs16969968) causes an aspartic acid to asparagine change in the nicotinic acetylcholine receptor (nAChR) α5 subunit gene. The N398 variant of CHRNA5 is linked to increased risk for nicotine dependence. In this study, we explored the effect of the CHRNA5 D398N polymorphism on the properties of human α3β4* nicotinic acetylcholine receptors in human embryonic kidney (HEK) cells. Addition of either D398 or N398 variant of α5 subunit in the α3β4* receptor did not affect total [125I]-epibatidine binding or surface expression of the receptor. However, addition of α5D398 into α3β4* receptor decreased the maximal response to agonist without significantly affecting EC50 in aequorin intracellular calcium assay. α3β4α5N398 nAChRs showed further decreased maximal response. The differences in agonist efficacy between the receptor subtypes were found to be dependent upon the concentration of external calcium but independent of external sodium. Moreover, activation of α3β4α5 nAChRs led to significantly greater intracellular calcium release from IP3 stores relative to α3β4 nAChRs although no effect of the α5 polymorphism was observed. Finally, inclusion of the α5 variant caused a small shift to the left in IC50 for some of the antagonists tested, depending upon α5 variant but did not affect sensitivity of α3β4* receptors to desensitization in response to incubation with nicotine. In conclusion, addition of either variant of a5 into an α3β4α5 receptor similarly effects receptor pharmacology and function. However, the N398 variant exhibits a reduced response to agonists when extracellular calcium is high and it may lead to distinct downstream cellular signaling. PMID:22820273

  3. The Cytotoxic T-Cell Response to Herpes Simplex Virus Type 1 Infection of C57BL/6 Mice Is Almost Entirely Directed against a Single Immunodominant Determinant

    Science.gov (United States)

    Wallace, Morgan E.; Keating, Rachael; Heath, William R.; Carbone, Francis R.

    1999-01-01

    Many virus infections give rise to surprisingly limited T-cell responses directed to very few immunodominant determinants. We have been examining the cytotoxic T-lymphocyte (CTL) response to herpes simplex virus type 1 (HSV-1) infection. Previous studies have identified the glycoprotein B-derived peptide from residues 498 to 505 (gB498–505) as one of at least three determinants recognized by HSV-1-specific CTLs isolated from C57BL/6 mice. We had previously found that in vitro-derived CTLs directed to gB498–505 show a characteristic pattern of T-cell receptor (TCR) usage, with 60% of gB498–505-specific CD8+ T cells expressing BV10+ TCR β chains and a further 20% expressing BV8S1. In this report, we confirm that this TCR V-region bias is also reflected in the ex vivo response to HSV-1 infection. A high proportion of activated CD8+ draining lymph node cells were found to express these dominant V regions, suggesting that a substantial number of in vivo responding T cells were directed to this one viral determinant. The use of an HSV-1 deletion mutant lacking the gB498–505 determinant in combination with accurate intracellular gamma interferon staining allowed us to quantify the extent of gB-specific T-cell dominance. Together, these results suggested that between 70 and 90% of all CD8+ HSV-1-specific T cells target gB498–505. While deletion of this determinant resulted in an attenuated CD8+ T-cell response, it also permitted the emergence of one or more previously unidentified cryptic specificities. Overall, HSV-1 infection of C57BL/6 mice results in an extremely focused pattern of CD8+ T-cell selection in terms of target specificity and TCR expression. PMID:10438852

  4. Robust and Balanced Immune Responses to All 4 Dengue Virus Serotypes Following Administration of a Single Dose of a Live Attenuated Tetravalent Dengue Vaccine to Healthy, Flavivirus-Naive Adults.

    Science.gov (United States)

    Kirkpatrick, Beth D; Durbin, Anna P; Pierce, Kristen K; Carmolli, Marya P; Tibery, Cecilia M; Grier, Palmtama L; Hynes, Noreen; Diehl, Sean A; Elwood, Dan; Jarvis, Adrienne P; Sabundayo, Beulah P; Lyon, Caroline E; Larsson, Catherine J; Jo, Matthew; Lovchik, Janece M; Luke, Catherine J; Walsh, Mary C; Fraser, Ellen A; Subbarao, Kanta; Whitehead, Steven S

    2015-09-01

    The 4 serotypes of dengue virus, DENV-1-4, are the leading cause of arboviral disease globally. The ideal dengue vaccine would provide protection against all serotypes after a single dose. Two randomized, placebo-controlled trials were performed with 168 flavivirus-naive adults to demonstrate the safety and immunogenicity of a live attenuated tetravalent dengue vaccine (TV003), compared with those of a second tetravalent vaccine with an enhanced DENV-2 component (TV005), and to evaluate the benefit of a booster dose at 6 months. Safety data, viremia, and neutralizing antibody titers were evaluated. A single dose of TV005 elicited a tetravalent response in 90% of vaccinees by 3 months after vaccination and a trivalent response in 98%. Compared with TV003, the higher-dose DENV-2 component increased the observed frequency of immunogenicity to DENV-2 in the TV005 trial. Both the first and second doses were well tolerated. Neither vaccine viremia, rash, nor a significant antibody boost were observed following a second dose. A single subcutaneous dose of TV005 dengue vaccine is safe and induces a tetravalent antibody response at an unprecedented frequency among vaccinees. A second dose has limited benefit and appears to be unnecessary. Studies to confirm these findings and assess vaccine efficacy will now move to populations in regions where DENV transmission is endemic. NCT01072786 and NCT01436422. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Measurement of the elastic tensor of a single crystal of La0.83Sr0.17MnO3 and its response to magnetic fields

    International Nuclear Information System (INIS)

    Darling, T.W.; Migliori, A.; Moshopoulou, E.G.; Trugman, S.A.; Neumeier, J.J.; Sarrao, J.L.; Bishop, A.R.; Thompson, J.D.

    1998-01-01

    We have measured the (cubic-lattice-approximation) elastic moduli of optical melt-zone-grown single-crystal La 0.83 Sr 0.17 MnO 3 using resonant ultrasound spectroscopy. We observe the structural transition at 285 K to be hysteretic in the ambient (almost zero) magnetic field. A second elastic feature at the ferromagnetic T c 265 K, a third at 252 K, and a fourth in magnetic field at 220 K are also observed in this sample, which sits in a particularly complex region in composition space. The application of a magnetic field changes some of the elastic moduli significantly between 220 K and 285 K. By determining the complete elastic tensor, we identify which cubic crystallographic distortions are strongest at each elastic anomaly and which are sensitive to magnetic field. We also determine which bonds play a role in each of the observed features. copyright 1998 The American Physical Society

  6. Near-Band-Edge Optical Responses of CH3NH3PbCl3 Single Crystals: Photon Recycling of Excitonic Luminescence

    Science.gov (United States)

    Yamada, Takumi; Aharen, Tomoko; Kanemitsu, Yoshihiko

    2018-02-01

    The determination of the band gap and exciton energies of lead halide perovskites is very important from the viewpoint of fundamental physics and photonic device applications. By using photoluminescence excitation (PLE) spectra, we reveal the optical properties of CH3NH3PbCl3 single crystals in the near-band-edge energy regime. The one-photon PLE spectrum exhibits the 1 s exciton peak at 3.11 eV. On the contrary, the two-photon PLE spectrum exhibits no peak structure. This indicates photon recycling of excitonic luminescence. By analyzing the spatial distribution of the excitons and photon recycling, we obtain 3.15 eV for the band gap energy and 41 meV for the exciton binding energy.

  7. An examination of resveratrol's mechanisms of action in human tissue: impact of a single dose in vivo and dose responses in skeletal muscle ex vivo.

    Directory of Open Access Journals (Sweden)

    Cameron B Williams

    Full Text Available The current study tested the hypothesis that a single, moderate dose of RSV would activate the AMPK/SIRT1 axis in human skeletal muscle and adipose tissue. Additionally, the effects of RSV on mitochondrial respiration in PmFBs were examined. Eight sedentary men (23.8±2.4 yrs; BMI: 32.7±7.1 reported to the lab on two occasions where they were provided a meal supplemented with 300 mg of RSV or a placebo. Blood samples, and a muscle biopsy were obtained in the fasted state and again, with the addition of an adipose tissue biopsy, two hours post-prandial. The effect of RSV on mitochondrial respiration was examined in PmFBs taken from muscle biopsies from an additional eight men (23.4±5.4 yrs; BMI: 24.4±2.8. No effect of RSV was observed on nuclear SIRT1 activity, acetylation of p53, or phosphorylation of AMPK, ACC or PKA in either skeletal muscle or adipose tissue. A decrease in post absorptive insulin levels was accompanied by elevated skeletal muscle phosphorylation of p38 MAPK, but no change in either skeletal muscle or adipose tissue insulin signalling. Mitochondrial respiration in PmFBs was rapidly inhibited by RSV at 100-300 uM depending on the substrate examined. These results question the efficacy of a single dose of RSV at altering skeletal muscle and adipose tissue AMPK/SIRT1 activity in humans and suggest that RSV mechanisms of action in humans may be associated with altered cellular energetics resulting from impaired mitochondrial ATP production.

  8. Metal accumulation and antioxidant defenses in the freshwater fish Carassius auratus in response to single and combined exposure to cadmium and hydroxylated multi-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Qu, Ruijuan; Wang, Xinghao; Wang, Zunyao, E-mail: wangzun315cn@163.com; Wei, Zhongbo; Wang, Liansheng

    2014-06-30

    Highlights: • Cd and OH-MWCNTs have a synergistic effect on Carassius auratus. • OH-MWCNTs significantly increased Cd accumulation in liver after 12 d exposure. • Co-exposure to Cd and OH-MWCNTs evoked severe hepatic oxidative stress. - Abstract: The effects of cadmium, hydroxylated multi-walled carbon nanotubes, and their mixture on metal accumulation and antioxidant defenses were studied using the goldfish Carassius auratus as the test organism. The fish were exposed to 0.1 mg/L Cd, 0.5 mg/L OH-MWCNTs, or 0.1 mg/L Cd + 0.5 mg/L OH-MWCNTs for 3 and 12 days. Then, the Cd concentration was determined in the gill, liver and muscle. Moreover, hepatic antioxidant enzyme activity (superoxide dismutase, catalase and glutathione peroxidase), glutathione level and malondialdehyde content were also measured. A continuous accumulation of Cd was observed throughout the experimental period. Cd accumulation in tissues occurred in the following order: gill > liver > muscle at 3 days and liver > gill > muscle at 12 days. The concentrations of Cd in the livers of fish exposed to the combination of Cd + OH-MWCNTs were significantly higher than those in fish exposed to either single chemical after 12 d of exposure. Meanwhile, the mixture evoked severe oxidative stress in the exposed fish, as indicated by significant inhibition of SOD, CAT and GPx activity, a remarkable decrease in GSH level, and simultaneous elevation of MDA content. These results suggested that the effect of the combined factors on metal accumulation and oxidative stress biomarkers was more obvious than that of single factors at longer exposure durations.

  9. Physiological functions at single-cell level of Lactobacillus spp. isolated from traditionally fermented cabbage in response to different pH conditions.

    Science.gov (United States)

    Olszewska, Magdalena A; Kocot, Aleksandra M; Łaniewska-Trokenheim, Łucja

    2015-04-20

    Changes in pH are significant environmental stresses that may be encountered by lactobacilli during fermentation processes or passage through the gastrointestinal tract. Here, we report the cell response of Lactobacillus spp. isolated from traditionally fermented cabbage subjected to acid/alkaline treatments at pH 2.5, 7.4 and 8.1, which represented pH conditions of the gastrointestinal tract. Among six isolates, four species of Lactobacillus plantarum and two of Lactobacillus brevis were identified by fluorescence in situ hybridization (FISH). The fluorescence-based strategy of combining carboxyfluorescein diacetate (CFDA) and propidium iodine (PI) into a dual-staining assay was used together with epifluorescence microscopy (EFM) and flow cytometry (FCM) for viability assessment. The results showed that the cells maintained esterase activity and membrane integrity at pH 8.1 and 7.4. There was also no loss of culturability as shown by plate counts. In contrast, the majority of 2.5 pH-treated cells had a low extent of esterase activity, and experienced membrane perturbation. For these samples, an extensive loss of culturability was demonstrated. Comparison of the results of an in situ assessment with that of the conventional culturing method has revealed that although part of the stressed population was unable to grow on the growth media, it was deemed viable using a CFDA/PI assay. However, there was no significant change in the cell morphology among pH-treated lactobacilli populations. These analyses are expected to be useful in understanding the cell response of Lactobacillus strains to pH stress and may facilitate future investigation into functional and industrial aspects of this response. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. The intestinal T cell response to alpha-gliadin in adult celiac disease is focused on a single deamidated glutamine targeted by tissue transglutaminase

    DEFF Research Database (Denmark)

    Arentz-Hansen, H; Körner, R; Molberg, O

    2000-01-01

    The great majority of patients that are intolerant of wheat gluten protein due to celiac disease (CD) are human histocompatibility leukocyte antigen (HLA)-DQ2(+), and the remaining few normally express HLA-DQ8. These two class II molecules are chiefly responsible for the presentation of gluten...... for T cell recognition. Gluten-specific T cell lines from 16 different adult patients all responded to one or both of these deamidated peptides, indicating that these epitopes are highly relevant to disease pathology. Binding studies showed that the deamidated peptides displayed an increased affinity...

  11. Discovery of the Potential Role of Sensors in a Personal Emergency Response System: What Can We Learn from a Single Workshop?

    Directory of Open Access Journals (Sweden)

    Femke De Backere

    2015-12-01

    Full Text Available Capturing knowledge from domain experts is important to effectively integrate novel technological support in existing care processes. In this paper, we present our experiences in using a specific type of workshop, which we identified as a decision-tree workshop, to determine the process and information exchange during the usage of a Personal Emergency Response System (PERS. We conducted the workshop with current and possible future users of a PERS system to investigate the potential of context- and social awareness for such a system. We discuss the workshop format as well as the results and reflection on this workshop.

  12. A 12-Month-Interval Dosing Study in Adults Indicates That a Single Dose of the National Institute of Allergy and Infectious Diseases Tetravalent Dengue Vaccine Induces a Robust Neutralizing Antibody Response.

    Science.gov (United States)

    Durbin, Anna P; Kirkpatrick, Beth D; Pierce, Kristen K; Carmolli, Marya P; Tibery, Cecilia M; Grier, Palmtama L; Hynes, Noreen; Opert, Kari; Jarvis, Adrienne P; Sabundayo, Beulah P; McElvany, Benjamin D; Sendra, Eli A; Larsson, Catherine J; Jo, Matthew; Lovchik, Janece M; Luke, Catherine J; Walsh, Mary C; Fraser, Ellen A; Subbarao, Kanta; Whitehead, Stephen S

    2016-09-15

    The ideal dengue vaccine will provide protection against all serotypes of dengue virus and will be economical and uncomplicated in its administration. To determine the ability of a single dose of the live attenuated tetravalent dengue vaccine TV003 to induce a suitable neutralizing antibody response, a placebo-controlled clinical trial was performed in 48 healthy adults who received 2 doses of vaccine or placebo administered 12 months apart. Evaluation of safety, vaccine viremia, and neutralizing antibody response after each dose indicated that the first dose of vaccine was capable of preventing infection with the second dose, thus indicating that multiple doses are unnecessary. NCT01782300. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  13. Minimal dose of milk protein concentrate to enhance the anabolic signalling response to a single bout of resistance exercise; a randomised controlled trial.

    Science.gov (United States)

    Mitchell, Cameron J; Zeng, Nina; D'Souza, Randall F; Mitchell, Sarah M; Aasen, Kirsten; Fanning, Aaron C; Poppitt, Sally D; Cameron-Smith, David

    2017-01-01

    Resistance training is a potent stimulus to induce muscle hypertrophy. Supplemental protein intake is known to enhance gains in muscle mass through activation of the mammalian target of rapamycin complex 1 (mTORC1) pathway, which initiates protein translation. While the optimal dose of high quality protein to promote post exercise anabolism in young or older men has been investigated, little is known about the minimum doses of protein required to potentiate the resistance exercise activation of anabolic signalling in middle aged men. Twenty healthy men (46.3 ± 5.7 years, BMI: 23.9 ± 6.6 kg/m 2 ) completed a single bout of unilateral resistance exercise consisting of 4 sets of leg extension and press at 80% of 1 repetition maximum. Participants were randomised to consume either formulated milk product containing 9 g milk protein (FMP) or an isoenergetic carbohydrate placebo (CHO) immediately post exercise, in a double blind fashion. A single muscle biopsy was collected at pre-exercise baseline and then bilateral biopsies were collected 90 and 240 min after beverage consumption. P70S6K Thr389 phosphorylation was increased with exercise irrespective of group, P70S6K Thr421/Ser424 was increased with exercise only in the FMP group at 240 min. Likewise, rpS6 Ser235/236 phosphorylation was increased with exercise irrespective of group, rpS6 Ser240/244 increased to a greater extent following exercise in the FMP group. mRNA expression of the amino acid transporter, LAT1/ SLC7A5 increased with both exercise and beverage consumption irrespective of group. PAT1/ SLC36A1 , CAT1/ SLC7A1 and SNAT2/ SLC38A2 mRNA increased only after exercise regardless of group. Nine grams of milk protein is sufficient to augment some measures of downstream mTORC1 signalling after resistance exercise but does not potentiate exercise induced increases in amino acid transporter expression. Formulated products containing nine grams of milk protein would be expected stimulate muscle

  14. Monte Carlo Study of the Effect of Collimator Thickness on T-99m Source Response in Single Photon Emission Computed Tomography

    International Nuclear Information System (INIS)

    Islamian, Jalil Pirayesh; Toossi, Mohammad Taghi Bahreyni; Momennezhad, Mahdi; Zakavi, Seyyed Rasoul; Sadeghi, Ramin; Ljungberg, Michael

    2012-01-01

    In single photon emission computed tomography (SPECT), the collimator is a crucial element of the imaging chain and controls the noise resolution tradeoff of the collected data. The current study is an evaluation of the effects of different thicknesses of a low-energy high-resolution (LEHR) collimator on tomographic spatial resolution in SPECT. In the present study, the SIMIND Monte Carlo program was used to simulate a SPECT equipped with an LEHR collimator. A point source of 99m Tc and an acrylic cylindrical Jaszczak phantom, with cold spheres and rods, and a human anthropomorphic torso phantom (4D-NCAT phantom) were used. Simulated planar images and reconstructed tomographic images were evaluated both qualitatively and quantitatively. According to the tabulated calculated detector parameters, contribution of Compton scattering, photoelectric reactions, and also peak to Compton (P/C) area in the obtained energy spectrums (from scanning of the sources with 11 collimator thicknesses, ranging from 2.400 to 2.410 cm), we concluded the thickness of 2.405 cm as the proper LEHR parallel hole collimator thickness. The image quality analyses by structural similarity index (SSIM) algorithm and also by visual inspection showed suitable quality images obtained with a collimator thickness of 2.405 cm. There was a suitable quality and also performance parameters’ analysis results for the projections and reconstructed images prepared with a 2.405 cm LEHR collimator thickness compared with the other collimator thicknesses

  15. The dataset from administration of single or combined immunomodulation agents to modulate anti-FVIII antibody responses in FVIII plasmid or protein primed hemophilia A mice

    Directory of Open Access Journals (Sweden)

    Chao Lien Liu

    2016-06-01

    Full Text Available Hemophilia A mice with pre-existing inhibitory antibodies against factor VIII (FVIII were treated with single agents, AMD3100 and GCS-F, respectively. Inhibitor titers in treated mice and control HemA inhibitors mice were followed over time. Total B cells and plasma cells (PCs were characterized by flow cytometry. HemA inhibitor mice were then treated with a combination regimen of IL-2/IL-2mAb complexes plus rapamycin and AMD3100. Finally, HemA inhibitor mice were treated with a new combination therapy using include IL-2/IL-2mAb complexes + Anti-CD20+AMD3100+G-CSF. The timeline of combination therapy was illustrated. Inhibitor titers following treatment in FVIII plasmid or protein induced inhibitor mice were evaluated overtime. A representative figure and gating strategies to characterize the subsets of Treg cells and B cells are presented. Please see http://dx.doi.org/10.1016/j.cellimm.2016.01.005 [1] for interpretation and discussion of these data and results.

  16. STAT3 single nucleotide polymorphism rs4796793 SNP does not correlate with response to adjuvant IFNα therapy in stage III melanoma patients

    Directory of Open Access Journals (Sweden)

    David eSchrama

    2014-11-01

    Full Text Available Interferon alpha (IFNα is approved for adjuvant treatment of stage III melanoma in Europe and the US. Its clinical efficacy, however, is restricted to a subpopulation of patients while side effects occur in most of treated patients. Thus, the identification of predictive biomarkers would be highly beneficial to improve the benefit to risk ratio. In this regard, STAT3 is important for signaling of the IFNα receptor. Moreover, the STAT3 single nucleotide polymorphism (SNP rs4796793 has recently been reported to be associated with IFNα sensitivity in metastatic renal cell carcinoma. To translate this notion to melanoma, we scrutinized the impact of rs4796793 functionally and clinically in this cancer. Interestingly, melanoma cells carrying the minor allele of rs4796793 were the most sensitive to IFNα in vitro. However, we did not detect a correlation between SNP genotype and STAT3 mRNA expression for either melanoma cells or for peripheral blood lymphocytes. Next, we analyzed the impact of rs4796793 on the clinical outcome of 259 stage III melanoma patients of which one third had received adjuvant IFNα treatment. These analyses did not reveal a significant association between the STAT3 rs4796793 SNP and patients’ progression free or overall survival when IFN treated and untreated patients were compared. In conclusion, STAT3 rs4796793 SNP is no predictive marker for the efficacy of adjuvant IFNα treatment in melanoma patients.

  17. Qualitative Sybr Green real-time detection of single nucleotide polymorphisms responsible for target-site resistance in insect pests: the example of Myzus persicae and Musca domestica.

    Science.gov (United States)

    Puggioni, V; Chiesa, O; Panini, M; Mazzoni, E

    2017-02-01

    Chemical insecticides have been widely used to control insect pests, leading to the selection of resistant populations. To date, several single nucleotide polymorphisms (SNPs) have already been associated with insecticide resistance, causing reduced sensitivity to many classes of products. Monitoring and detection of target-site resistance is currently one of the most important factors for insect pest management strategies. Several methods are available for this purpose: automated and high-throughput techniques (i.e. TaqMan or pyrosequencing) are very costly; cheaper alternatives (i.e. RFLP or PASA-PCRs) are time-consuming and limited by the necessity of a final visualization step. This work presents a new approach (QSGG, Qualitative Sybr Green Genotyping) which combines the specificity of PASA-PCR with the rapidity of real-time PCR analysis. The specific real-time detection of Cq values of wild-type or mutant alleles (amplified used allele-specific primers) allows the calculation of ΔCqW-M values and the consequent identification of the genotypes of unknown samples, on the basis of ranges previously defined with reference clones. The methodology is applied here to characterize mutations described in Myzus persicae and Musca domestica and we demonstrate it represents a valid, rapid and cost-effective technique that can be adopted for monitoring target-site resistance in field populations of these and other insect species.

  18. Adapting to the global shortage of cholera vaccines: targeted single dose cholera vaccine in response to an outbreak in South Sudan.

    Science.gov (United States)

    Parker, Lucy A; Rumunu, John; Jamet, Christine; Kenyi, Yona; Lino, Richard Laku; Wamala, Joseph F; Mpairwe, Allan M; Ciglenecki, Iza; Luquero, Francisco J; Azman, Andrew S; Cabrol, Jean-Clement

    2017-04-01

    Shortages of vaccines for epidemic diseases, such as cholera, meningitis, and yellow fever, have become common over the past decade, hampering efforts to control outbreaks through mass reactive vaccination campaigns. Additionally, various epidemiological, political, and logistical challenges, which are poorly documented in the literature, often lead to delays in reactive campaigns, ultimately reducing the effect of vaccination. In June 2015, a cholera outbreak occurred in Juba, South Sudan, and because of the global shortage of oral cholera vaccine, authorities were unable to secure sufficient doses to vaccinate the entire at-risk population-approximately 1 million people. In this Personal View, we document the first public health use of a reduced, single-dose regimen of oral cholera vaccine, and show the details of the decision-making process and timeline. We also make recommendations to help improve reactive vaccination campaigns against cholera, and discuss the importance of new and flexible context-specific dose regimens and vaccination strategies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. High genetic homogeneity points to a single introduction event responsible for invasion of Cotton leaf curl Multan virus and its associated betasatellite into China.

    Science.gov (United States)

    Du, Zhenguo; Tang, Yafei; He, Zifu; She, Xiaoman

    2015-10-07

    Cotton leaf curl Multan virus (CLCuMuV) is a Whitefly Transmitted Geminivirus (WTG) endemic to the India subcontinent and is notorious as a causal agent of cotton leaf curl disease (CLCuD), a major constraint to cotton production in south Asia. We found CLCuMuV infecting Hibiscus rosa-sinensis in Guangzhou, China in 2006. The spread and evolution of the invading CLCuMuV were monitored in the following nine years. CLCuMuV spread rapidly in the last nine years and became established in Southern China. It infects at least five malvaceous plant species, H. rosa-sinensis, H. esculentus, Malvaiscus arboreus, Gossypium hirsutum and H. cannabinus. Complete nucleotide sequences of 34 geographically and/or temporally distinct CLCuMuV isolates were determined and analyzed together with six other publicly available genomes of CLCuMuV occurring in China. The 40 CLCuMuV isolates were found to share > 99 % nucleotide sequence identity with each other. In all cases tested, the CLCuMuVs were associated with a CLCuMuB. The 36 CLCuMuBs (30 sequenced by us) shared > 98 % nucleotide sequence identity. The high genetic homogeneity of CLCuMuV and CLCuMuB in China suggests the establishment of them from a single founder event.

  20. Single-Photon Optomechanics

    Science.gov (United States)

    Nunnenkamp, A.; Børkje, K.; Girvin, S. M.

    2011-08-01

    Optomechanics experiments are rapidly approaching the regime where the radiation pressure of a single photon displaces the mechanical oscillator by more than its zero-point uncertainty. We show that in this limit the power spectrum has multiple sidebands and that the cavity response has several resonances in the resolved-sideband limit. Using master-equation simulations, we also study the crossover from the weak-coupling many-photon to the single-photon strong-coupling regime. Finally, we find non-Gaussian steady states of the mechanical oscillator when multiphoton transitions are resonant. Our study provides the tools to detect and take advantage of this novel regime of optomechanics.

  1. Immune response after a single vaccination against 2009 influenza A H1N1 in USA: a preliminary report of two randomised controlled phase 2 trials.

    Science.gov (United States)

    Plennevaux, Eric; Sheldon, Eric; Blatter, Mark; Reeves-Hoché, Mary-Kate; Denis, Martine

    2010-01-02

    Data are needed from large clinical trials of paediatric, adult, and elderly people to find the appropriate antigen dose and vaccination schedule for the 2009 pandemic influenza A H1N1. We therefore report preliminary safety and immunogenicity results after one injection of a licensed monovalent pandemic H1N1 vaccine in the USA. We randomly assigned healthy children (aged 6-35 months and 3-9 years) and adults (18-64 years and >or=65 years) to vaccine containing per dose 7.5 microg (children and adults), 15 microg (children and adults), or 30 microg (adults only) haemagglutinin in two placebo-controlled, observer-masked, multicentre phase 2 studies done in the USA. Participants were allocated with an interactive voice-response system or computer-generated randomisation lists with opaque scratchable patches. Primary outcome was haemagglutination inhibition antibody response 21 days after the first of two planned vaccinations (interim analysis of studies in progress). Analyses were by full-analysis set. The trials are registered with ClinicalTrials.gov as NCT00953524 and NCT00952419. 410 of 423 children and 724 of 750 adults given an active vaccine, and 50 of 51 children and 95 of 99 adults given placebo were assessed for immunogenicity on day 21. After active vaccination, 45 of 101 (45%; 95% CI 35-55) to 47 of 94 (50%; 40-61) infants aged 6-35 months, 75 of 109 (69%; 59-77) to 80 of 106 (75%; 66-83) 3-9-year-old children, 134 of 141 (95%; 90-98) to 144 of 144 (100%; 98-100) of 18-64-year-old adults, and 93 of 100 (93%; 86-96) to 93 of 98 (95%; 89-98) elderly adults were seroprotected (proportion with titres >or=1:40). No vaccine-related serious adverse events occurred. Injection-site and systemic reactions were reported by up to about 50% of every age and vaccine group, with no noticeable differences between vaccine and placebo groups. One dose of vaccine was highly immunogenic in adults, suggesting that it afforded sufficient protection against this pandemic

  2. Correlation of abnormal response of left ventricular ejection fraction after exercise and left ventricular cavity-to-myocardium count ratio of technetium-99m-tetrofosmin single photon emission computed tomography in patients with coronary artery disease

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Hueisch-J [Kaohsiung Medical Univ., Taiwan (China). School of Technology for Medical Science; Lin, Ching-C; Wang, Jhi-J [Chi-Mei Medical Center, Tainan, Taiwan (China); Ho, Shung-T [National Defense Medical Center, Taipei, Taiwan (China). School of Medicine; Kao, Albert [China Medical Coll., Taichung, Taiwan (China). Hospital

    2002-09-01

    The aim of this study was to assess the value of the left ventricular cavity-to-myocardium count ratio (C/M ratio) of technetium-99m (Tc-99m) tetrofosmin single photon emission computed tomography (SPECT) to identify abnormal left ventricular ejection fraction (LVEF) responses after exercise in patients with coronary artery diseases (CAD). We studied 50 patients with recent CAD undergoing rest and exercise first-pass ventriculography to calculate LVEF and rest and exercise Tc-99m tetrofosmin myocardial perfusion SPECT to calculate left ventricular C/M ratios. Group A, consisting of 25 CAD patients with normal responses (increased LVEF{>=}5% after exercise), had significantly higher rest and exercise C/M ratios than those of the group B, consisting of 25 CAD patients with abnormal responses (increased LVEF <5% after exercise) after exercise. However, the C/M ratios between exercise and rest did not differ significantly between groups A and B. In addition, there was significant correlation between LVEF and C/M ratios in all of the patients. C/M ratios of Tc-99m tetrofosmin myocardial perfusion SPECT are useful parameters for identifying patients with abnormal LVEF responses among patients with CAD. (author)

  3. Bioaccumulation of the synthetic dye Basic Violet 3 and heavy metals in single and binary systems by Candida tropicalis grown in a sugarcane bagasse extract medium: Modelling optimal conditions using response surface methodology (RSM) and inhibition kinetics

    International Nuclear Information System (INIS)

    Das, Devlina; Charumathi, D.; Das, Nilanjana

    2011-01-01

    Single and binary effects of dye Basic Violet 3 and heavy metals, 'namely', Pb(II) and Cd(II), were investigated for their role in dye and heavy metal bioaccumulation by Candida tropicalis that was grown in a sugarcane bagasse extract medium containing 8 g/L, 16 g/L or 24 g/L of sugar. The optimum pH was found to be 4.0 in the single system and 5.0 in the binary system. A central composite design was successfully used to analyse the experimental results. Four numerical correlations that were fitted to a second order quadratic equation were used to estimate optimum combinations predicted by response surface methodology. In the dye-Pb(II) binary system, C. tropicalis was capable of bioaccumulating 49.5% of the dye and 49.6% of the Pb(II), in comparison to 15.9% of the dye and 55.5% of the Cd(II) in the dye-Cd(II) binary system. In these two systems, the pollutants were dispersed at minimum working concentration levels. Competitive inhibition was observed in both the single and binary systems, which was suggested by an increase in the saturation constant, K s , and a simultaneous decrease in the specific growth rate that was calculated from Lineweaver-Burk plots. Atomic force microscopy images demonstrated changes in yeast cell morphology by exposure to these contaminants in the dye-Pb(II) binary system grown in a bioaccumulation medium.

  4. Rectal single dose immunization of mice with Escherichia coli O157:H7 bacterial ghosts induces efficient humoral and cellular immune responses and protects against the lethal heterologous challenge.

    Science.gov (United States)

    Mayr, Ulrike Beate; Kudela, Pavol; Atrasheuskaya, Alena; Bukin, Eugenij; Ignatyev, Georgy; Lubitz, Werner

    2012-03-01

    Bacterial ghosts (BGs) have been applied through oral, aerogenic, intraocular or intranasal routes for mucosal immunization using a wide range of experimental animals. All these applications required a booster after primary immunization to achieve protective immunity against the lethal challenge. Here we report for the first time that a single rectal dose of BGs produced from enterohaemorrhagic Escherichia coli (EHEC) O157:H7 fully protects mice against a 50% lethal challenge with a heterologous EHEC strain given at day 55. BGs from EHEC O157:H7 were prepared by a combination of protein E-mediated cell lysis and expression of staphylococcal nuclease A guaranteeing the complete degradation of pathogen residual DNA. The lack of genetic material in the EHEC BGs vaccine abolished any potential hazard for horizontal gene transfer of plasmid encoded antibiotic resistance genes or pathogenic islands to the recipient's gut flora. Single rectal immunization using EHEC O157:H7 BGs without any addition of adjuvant significantly stimulated efficient humoral and cellular immune responses, and was equally protective as two immunizations, which indicates the possibility to develop a novel efficacious single dose mucosal EHEC O157:H7 BGs vaccine using a simplified immunization regimen. © 2011 The Authors. Microbial Biotechnology © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. The intestinal T cell response to alpha-gliadin in adult celiac disease is focused on a single deamidated glutamine targeted by tissue transglutaminase

    DEFF Research Database (Denmark)

    Arentz-Hansen, H; Körner, R; Molberg, O

    2000-01-01

    The great majority of patients that are intolerant of wheat gluten protein due to celiac disease (CD) are human histocompatibility leukocyte antigen (HLA)-DQ2(+), and the remaining few normally express HLA-DQ8. These two class II molecules are chiefly responsible for the presentation of gluten...... peptides to the gluten-specific T cells that are found only in the gut of CD patients but not of controls. Interestingly, tissue transglutaminase (tTG)-mediated deamidation of gliadin plays an important role in recognition of this food antigen by intestinal T cells. Here we have used recombinant antigens...... for T cell recognition. Gluten-specific T cell lines from 16 different adult patients all responded to one or both of these deamidated peptides, indicating that these epitopes are highly relevant to disease pathology. Binding studies showed that the deamidated peptides displayed an increased affinity...

  6. Symptomatic response to blocked and unblocked pentagastrin stimulation in functional dyspepsia - Comparison of responders and non-responders to omeprazole identified in a single-subject trial model

    DEFF Research Database (Denmark)

    Madsen, L.G.; Bytzer, P.

    2008-01-01

    hypothesized that RSD trial responders and non-responders would react differently to gastric acid stimulation. Development of epigastric pain was expected in RSD trial responders after pentagastrin stimulation during placebo treatment, but not during omeprazole treatment. In non-responders, epigastric pain...... was expected not to be influenced by gastric acid stimulation or type of treatment. Methods: Nineteen patients were evaluated. Symptomatic response to pentagastrin (6 mu g/kg) was assessed twice in each patient following placebo and omeprazole (40 mg bid) treatment in a randomized, double-blind, cross...... but not during omeprazole treatment. Results: The acid provocation test was positive in 43% (3/7) of responders compared to only 17% (2/12) non-responders. VAS-score changes showed trends towards a more pronounced symptom reduction during omeprazole treatment in responders compared to non-responders. Conclusion...

  7. Cessation of tyrosine kinase inhibitors in patients with chronic-phase chronic myelogenous leukemia following durable complete molecular response: a single center facing the dilemma.

    Science.gov (United States)

    Iliakis, Theodoros; Papadopoulou, Vasiliki; Diamantopoulos, Panagiotis T; Panayiotidis, Panayiotis; Zervakis, Konstantinos; Giannakopoulou, Nefeli; Tilimidos, Gerassimos; Angelopoulou, Maria; Siakantaris, Marina P; Pangalis, Gerassimos; Mantzourani, Marina; Variami, Eleni; Viniou, Nora Athina

    2013-08-01

    Tyrosine kinase inhibitors (TKIs), namely imatinib mesylate (IM) and recently approved second-generation TKIs dasatinib and nilotinib, are currently considered the treatment of choice for newly-diagnosed chronic phase chronic myelogenous leukemia (CP-CML). Although treatment with TKIs has not yet been proven curative, it certainly accomplishes a sustained control of the disease in the vast majority of patients. More than a decade after the successful launching of IM in first-line treatment of CP-CML and the subsequent introduction of second-generation TKIs in this setting, the question of the possibility of TKI cessation in a specific subset of patients has emerged. Side-effects of TKIs, along with some patients' wish to abandon the drugs and the rising financial burden upon healthcare systems, have led to the dilemma whether IM can be safely withdrawn after achieving deep molecular remissions and which patients are suitable for this discontinuation. We examined the data of our patients with CML in search of potential canditates for cessation of TKI therapy and identified their characteristics. We also performed a thorough review of the relevant literature. Eight out of fifty patients were discriminated on grounds of sustained complete molecular response (CMR) exceeding 12 months, most of them with a low or intermediate Sokal score at diagnosis. The median interval from IM initiation to CMR was almost 2 years and the median duration of detected CMR reached 6.5 years. Based on the promising results of prospective clinical trials reporting successful cessation of treatment with TKIs on selected subgroups of patients, we decided to proceed to interruption of therapy in the specific subset of our patients and closely monitor their response.

  8. Precarity in the Brussels-Capital Region: The Issues at Stake for Public Policy in Response to the Precarization of Single-parent Families in Brussels

    Directory of Open Access Journals (Sweden)

    Martin Wagener

    2015-12-01

    Full Text Available The process of precarization is analysed in different manners in most literature concerning contemporary stakes of western welfare states. In comparison to other countries, Belgium has known a rather specific and delimited effect of the economic crisis from 2008, but certain groups face rather an ongoing effect of precarization on multiple and intertwined aspects. The aim of the article is to analyse the situation of precarity of single-parent families in the Brussels-Capital Region. The attention to that group is related to its higher risk of precarity and poverty. Furthermore it allows analysing the limits of public policies in the fight against poverty and precarity, that are clearly inadequate. Various options in terms of public policies and legal measures in the fight against poverty are discussed from three different angles of perspective: socioeconomic positions, social integration and the subjective experience (Dubet 1994. The tension between recognition and redistribution measures is central (Fraser 2011 in the argumentation for a balanced vision of policy measures to address single-parent poverty. La literatura científica sobre las apuestas contemporáneas de los estados de bienestar occidentales analiza de forma diferente el proceso de precarización. En comparación con otros países, Bélgica ha vivido desde 2008 un efecto de la crisis económica bastante específico y delimitado. Sin embargo, algunos grupos se enfrentan a un proceso de precarización continuo en numerosos aspectos, interrelacionados entre sí. El objetivo de este artículo es analizar la situación de precariedad de las familias monoparentales de la región de Bruselas capital. La atención a ese grupo está relacionada con su mayor riesgo de precariedad y pobreza. Además, permite analizar los límites de las políticas públicas en la lucha contra la pobreza y la precariedad, que son claramente insuficientes. Se analizan desde tres puntos de vista diversas

  9. Contribution of Hippocampal 5-HT3 Receptors in Hippocampal Autophagy and Extinction of Conditioned Fear Responses after a Single Prolonged Stress Exposure in Rats.

    Science.gov (United States)

    Wu, Zhong-Min; Yang, Li-Hua; Cui, Rong; Ni, Gui-Lian; Wu, Feng-Tian; Liang, Yong

    2017-05-01

    One of the hypotheses about the pathogenesis of posttraumatic stress disorder (PTSD) is the dysfunction of serotonin (5-HT) neurotransmission. While certain 5-HT receptor subtypes are likely critical for the symptoms of PTSD, few studies have examined the role of 5-HT 3 receptor in the development of PTSD, even though 5-HT 3 receptor is critical for contextual fear extinction and anxiety-like behavior. Therefore, we hypothesized that stimulation of 5-HT 3 receptor in the dorsal hippocampus (DH) could prevent hippocampal autophagy and the development of PTSD-like behavior in animals. To this end, we infused SR57227, selective 5-HT 3 agonist, into the DH after a single prolonged stress (SPS) treatment in rats. Three weeks later, we evaluated the effects of this pharmacological treatment on anxiety-related behaviors and extinction of contextual fear memory. We also accessed hippocampal autophagy and the expression of 5-HT 3A subunit, Beclin-1, LC3-I, and LC3-II in the DH. We found that SPS treatment did not alter anxiety-related behaviors but prolonged the extinction of contextual fear memory, and such a behavioral phenomenon was correlated with increased hippocampal autophagy, decreased 5-HT 3A expression, and increased expression of Beclin-1 and LC3-II/LC3-I ratio in the DH. Furthermore, intraDH infusions of SR57227 dose-dependently promoted the extinction of contextual fear memory, prevented hippocampal autophagy, and decreased expression of Beclin-1 and LC3-II/LC3-I ratio in the DH. These results indicated that 5-HT 3 receptor in the hippocampus may play a critical role in the pathogenesis of hippocampal autophagy, and is likely involved in the pathophysiology of PTSD.

  10. PET Imaging of VCAM-1 Expression and Monitoring Therapy Response in Tumor with a68Ga-Labeled Single Chain Variable Fragment.

    Science.gov (United States)

    Zhang, Xiao; Liu, Chunbao; Hu, Fan; Zhang, Yingying; Wang, Jing; Gao, Yongheng; Jiang, Yaqun; Zhang, Yongxue; Lan, Xiaoli

    2018-02-05

    Vascular cell adhesion molecule-1 (VCAM-1) is a transmembrane glycoprotein closely related to tumorigenicity as well as tumor metastasis. It is also a well-known candidate for detecting tumors. LY2409881, an IKKβ inhibitor, could induce apoptosis of VCAM-1 positive cells. Our purpose is to prepare a novel tracer to evaluate its feasibility of detecting VCAM-1 expression and monitoring LY2409881 tumor curative effect. The tracer was prepared by conjugating the single chain variable fragment (scFv) of VCAM-1 and NOTA-NHS-ester and then labeled with 68 Ga. 68 Ga-NOTA-VCAM-1 scFv was successfully prepared with high radiochemical yield. VCAM-1 overexpression and underexpression melanoma cell lines, B16F10 and A375m, were used in this study. The results of microPET/CT imaging in small animals indicated that the uptake of 68 Ga-NOTA-VCAM-1 scFv in B16F10 tumor was much higher than that of A375m, which was also confirmed by the biodistribution and autoradiography results. LY2409881 inhibits the growth of B16F10 melanoma in vivo by inducing dose- and time-dependent growth inhibition and apoptosis of the cells. The LY2409881 treated group and DMSO control group were established and imaged by microPET/CT. In the LY2409881 group, uptake of the tracer in tumor was decreased at the first week, and then gradually recovered to the initial level. In DMSO control, the uptake of the tracer remained at the same level during the whole time. The results suggested that LY2409881 inhibits the expression of VCAM-1 and suppresses tumor growth. 68 Ga-NOTA-VCAM-1 scFv , an easily synthesized probe, has a potential clinical application in the visual monitoring of IKKβ inhibitor intervention on VCAM-1 positive tumors.

  11. The Effect of Isomaltulose Together with Green Tea on Glycemic Response and Antioxidant Capacity: A Single-Blind, Crossover Study in Healthy Subjects.

    Science.gov (United States)

    Suraphad, Passakorn; Suklaew, Phim On; Ngamukote, Sathaporn; Adisakwattana, Sirichai; Mäkynen, Kittana

    2017-05-06

    Isomaltulose, a naturally-occurring isomer of sucrose, is commonly used as an alternative sweetener in foods and beverages. The goal of this study was to determine the effect of isomaltulose together with green tea on postprandial plasma glucose and insulin concentration, as well as antioxidant capacity in healthy subjects. In a randomized, single-blind, crossover study, 15 healthy subjects (eight women and seven men; ages 23.5 ± 0.7 years; with body mass index of 22.6 ± 0.4 kg/m²) consumed five beverages: (1) 50 g sucrose in 400 mL water; (2) 50 g isomaltulose in 400 mL of water; (3) 400 mL of green tea; (4) 50 g sucrose in 400 mL of green tea; and (5) 50 g isomaltulose in 400 mL of green tea. Incremental area under postprandial plasma glucose, insulin, ferric reducing ability of plasma (FRAP) and malondialdehyde (MDA) concentration were determined during 120 min of administration. Following the consumption of isomaltulose, the incremental 2-h area under the curve (AUC 0-2 h ) indicated a higher reduction of postprandial glucose (43.4%) and insulin concentration (42.0%) than the consumption of sucrose. The addition of green tea to isomaltulose produced a greater suppression of postprandial plasma glucose (20.9%) and insulin concentration (37.7%). In accordance with antioxidant capacity, consumption of sucrose (40.0%) and isomaltulose (28.7%) caused the reduction of green tea-induced postprandial increases in FRAP. A reduction in postprandial MDA after drinking green tea was attenuated when consumed with sucrose (34.7%) and isomaltulose (17.2%). In conclusion, green tea could enhance the reduction of postprandial glucose and insulin concentration when consumed with isomaltulose. In comparison with sucrose, isomaltulose demonstrated less alteration of plasma antioxidant capacity after being consumed with green tea.

  12. Interaction of single-walled carbon nanotubes and saxitoxin: Ab initio simulations and biological responses in hippocampal cell line HT-22.

    Science.gov (United States)

    Ramos, Patrícia; Schmitz, Marcos; Filgueira, Daza; Votto, Ana Paula; Durruthy, Michael; Gelesky, Marcos; Ruas, Caroline; Yunes, João; Tonel, Mariana; Fagan, Solange; Monserrat, José

    2017-07-01

    Saxitoxins (STXs) are potent neurotoxins that also induce cytotoxicity through the generation of reactive oxygen species. Carbon nanotubes (CNTs) are nanomaterials that can promote a Trojan horse effect, facilitating the entry of toxic molecules to cells when adsorbed to nanomaterials. The interaction of pristine single-walled (SW)CNTs and carboxylated (SWCNT-COOH) nanotubes with STX was evaluated by ab initio simulation and bioassays using the cell line HT-22. Cells (5 × 10 4  cells/mL) were exposed to SWCNT and SWCNT-COOH (5 μg mL -1 ), STX (200 μg L -1 ), SWCNT+STX, and SWCNT-COOH+STX for 30 min or 24 h. Results of ab initio simulation showed that the interaction between SWCNT and SWCNT-COOH with STX occurs in a physisorption. The interaction of SWCNT+STX induced a decrease in cell viability. Cell proliferation was not affected in any treatment after 30 min or 24 h of exposure (p > 0.05). Treatment with SWCNT-COOH induced high reactive oxygen species levels, an effect attenuated in SWCNT-COOH+STX treatment. In terms of cellular oxygen consumption, both CNTs when coexposed with STX antagonize the toxin effect. Based on these results, it can be concluded that the results obtained in vitro corroborate the semiempirical evidence found using density functional theory ab initio simulation. Environ Toxicol Chem 2017;36:1728-1737. © 2016 SETAC. © 2016 SETAC.

  13. Single amino acid substitution in human platelet glycoprotein Ibbeta is responsible for the formation of the platelet-specific alloantigen Iy(a).

    Science.gov (United States)

    Sachs, U J; Kiefel, V; Böhringer, M; Afshar-Kharghan, V; Kroll, H; Santoso, S

    2000-03-01

    We recently described a new low-frequency platelet alloantigen on the human platelet glycoprotein (GP) Ib-IX complex, termed Iy(a), which was implicated in a severe case of neonatal alloimmune thrombocytopenia. Immunoprecipitation studies with trypsin-treated platelets indicated that the Iy(a) alloantigenic determinants are formed by the membrane-associated remnant moiety of GP Ibalpha (GP Ibalpha(r)) together with GP Ibbeta and GP IX. To elucidate the molecular basis underlying the Iy(a) alloantigen, we amplified GPIbalpha(r), GPIbbeta, and GPIX genes by polymerase chain reaction (PCR). Nucleotide-sequence analysis of these 3 genes showed a G to A transition at position 141 on GPIbbeta gene in a subject positive for Iy(a). This transition resulted in a Gly(15)Glu dimorphism on the N-terminal domain of GPIbbeta. This finding was confirmed by genotyping analysis of 6 Iy(a)-positive subjects by restriction fragment length polymorphism (RFLP) studies using NarI endonuclease. In 300 randomly selected healthy blood donors, one Iy(a)-positive individual was found. Phenotypes determined by monoclonal antibody-specific immobilization of platelet antigens assay and genotypes determined by RFLP were identical in this population. Analysis of Iy(a)-positive platelets showed that the point mutation affected neither the degree of surface expression nor the function of the GP Ibalpha-GP Ibbeta-IX complex on the platelet surface. Transient expression of the GP Ib-IX complex in CHO cells using wild-type GP Ibbeta (Gly(15)) or mutant GP Ibbeta (Glu(15)) allowed us to demonstrate that this single amino acid substitution is sufficient to induce Iy(a) epitope(s). (Blood. 2000;95:1849-1855)

  14. Comparison of serological responses to single-dose azithromycin (2 g) versus benzathine penicillin G in the treatment of early syphilis in HIV-infected patients in an area of low prevalence of macrolide-resistant Treponema pallidum infection.

    Science.gov (United States)

    Yang, Chia-Jui; Tang, Hung-Jen; Chang, Sui-Yuan; Hsieh, Szu-Min; Lee, Kuan-Yeh; Lee, Yuan-Ti; Sheng, Wang-Huei; Yang, Shang-Ping; Hung, Chien-Ching; Chang, Shan-Chwen

    2016-03-01

    Effectiveness of single-dose azithromycin (2 g) in the treatment of early syphilis among HIV-infected patients has rarely been evaluated in the era of combination ART. Consecutive HIV-infected patients with early syphilis, who received 2 g single-dose azithromycin or 2.4 MU benzathine penicillin G, between 2007 and 2014, were prospectively observed. Genotypic resistance to macrolides was determined in Treponema pallidum isolates identified from clinical specimens using PCR assays. Rapid plasma reagin (RPR) titres were determined at baseline and every 3 months after treatment. Primary outcome was a decline of RPR titre by ≥4-fold at 12 months after treatment. During the study period, 162 HIV-infected patients with early syphilis received benzathine penicillin G and 237 patients received azithromycin. At 12 months follow-up, the serological response rate for penicillin and azithromycin groups was 61.1% and 56.5% (P = 0.41), respectively; respective response rate was 61.1% and 65.9% (P = 0.49) if we only included patients infected with T. pallidum not harbouring macrolide resistance in the azithromycin group. In multivariate analysis, RPR titres ≥1:32 (OR 2.56; 95% CI 1.55-4.21) and prior syphilis (OR 0.54; 95% CI 0.35-0.81) were predictors of serological response. Most common adverse effects of azithromycin included diarrhoea (52.7%), nausea (22.4%), abdominal pain (18.6%), bloating (17.7%) and lassitude/somnolence (27.4%). In the setting of a low prevalence of macrolide-resistant T. pallidum, 2 g single-dose azithromycin achieved a similar serological response to benzathine penicillin G in HIV-infected patients with early syphilis. Major adverse effects of azithromycin were gastrointestinal symptoms and lassitude/somnolence. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. The German ISS-experiment Cellular Responses to Radiation in Space (CERASP): The effects of single and combined space flight conditions on mammalian cells

    Science.gov (United States)

    Hellweg, C. E.; Thelen, M.; Arenz, A.; Baumstark-Khan, C.

    The combined action of ionizing radiation and microgravity will continue to influence future manned space missions, with special risks for astronauts on the Moon surface or for long duration missions to Mars. There is increasing evidence that basic cellular functions are sensitive not only to radiation but also to microgravity. Previous space flight experiments gave contradictory results: from inhibition of DNA repair by microgravity to enhancement, whereas others did not detect any influence of microgravity on repair. At the Radiation Biology Department of the German Aerospace Center (DLR), recombinant bacterial and mammalian cell systems were developed as reporters for cellular signal transduction modulation by genotoxic environmental conditions. The space experiment “Cellular Responses to Radiation in Space” (CERASP) to be performed at the International Space Station (ISS) will make use of such reporter cell lines thereby supplying basic information on the cellular response to radiation applied in microgravity. One of the biological endpoints will be survival reflected by radiation-dependent reduction of constitutive expression of the enhanced variant of green fluorescent protein (EGFP). A second end-point will be gene activation by space flight conditions in mammalian cells, based on fluorescent promoter reporter systems using the destabilized d2EGFP variant. The promoter element to be investigated reflects the activity of the nuclear factor kappa B (NF-κB) pathway. The NF-κB family of proteins plays a major role in the inflammatory and immune response, cell proliferation and differentiation, apoptosis and tumor genesis. Results obtained with X-rays and accelerated heavy ions produced at the French heavy ion accelerator GANIL imply that densely ionizing radiation has a stronger potential to activate NF-κB dependent gene expression than sparsely ionizing radiation. The correlation of NF-κB activation to negative regulation of apoptosis could favor

  16. Can the Responses of Photosynthesis and Stomatal Conductance to Water and Nitrogen Stress Combinations Be Modeled Using a Single Set of Parameters?

    Science.gov (United States)

    Zhang, Ningyi; Li, Gang; Yu, Shanxiang; An, Dongsheng; Sun, Qian; Luo, Weihong; Yin, Xinyou

    2017-01-01

    Accurately predicting photosynthesis in response to water and nitrogen stress is the first step toward predicting crop growth, yield and many quality traits under fluctuating environmental conditions. While mechanistic models are capable of predicting photosynthesis under fluctuating environmental conditions, simplifying the parameterization procedure is important toward a wide range of model applications. In this study, the biochemical photosynthesis model of Farquhar, von Caemmerer and Berry (the FvCB model) and the stomatal conductance model of Ball, Woodrow and Berry which was revised by Leuning and Yin (the BWB-Leuning-Yin model) were parameterized for Lilium (L. auratum × speciosum “Sorbonne”) grown under different water and nitrogen conditions. Linear relationships were found between biochemical parameters of the FvCB model and leaf nitrogen content per unit leaf area (Na), and between mesophyll conductance and Na under different water and nitrogen conditions. By incorporating these Na-dependent linear relationships, the FvCB model was able to predict the net photosynthetic rate (An) in response to all water and nitrogen conditions. In contrast, stomatal conductance (gs) can be accurately predicted if parameters in the BWB-Leuning-Yin model were adjusted specifically to water conditions; otherwise gs was underestimated by 9% under well-watered conditions and was overestimated by 13% under water-deficit conditions. However, the 13% overestimation of gs under water-deficit conditions led to only 9% overestimation of An by the coupled FvCB and BWB-Leuning-Yin model whereas the 9% underestimation of gs under well-watered conditions affected little the prediction of An. Our results indicate that to accurately predict An and gs under different water and nitrogen conditions, only a few parameters in the BWB-Leuning-Yin model need to be adjusted according to water conditions whereas all other parameters are either conservative or can be adjusted according to

  17. Low-dose responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin in single living human cells measured by synhrotron infrared spectromicroscopy

    International Nuclear Information System (INIS)

    Holman, Hoi-Ying N.; Goth-Goldstein, R.; Martin, M.C.; Russel, M.L.; McKinney, W.R.

    1999-01-01

    We report synchrotron radiation-based (SR) Fourier-transform infrared (FTIR) spectromicroscopy measurements of HepG2 cells exposed to an environmental contaminant that is a known ligand for the aryl hydrocarbon receptor (AhR). Measurements were made on cells treated with an AhR-binding model compound 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Compared to untreated control cells, treated cells display unique spectral changes with TCDD concentrations of 0.01 to 10.0 nanomolar (nM). Key spectral changes involve P=O, C-O and C-H stretching bands. The first changes are related to the environment of the phosphate backbone of nucleic acids. The C-H stretching bands data show a relative increase in the number of methyl to methylene groups. We find an excellent correlation between spectral changes and an increase in CYP1A1 expression measured by the reverse transcriptase polymerase chain reaction (RT-PCR) technique demonstrating that the SR-FTIR method is observing cellular biochemical changes related to this gene expression pathway. Finally, we discuss the potential use of SR-FTIR spectromicroscopy as a diagnostic tool for monitoring cellular exposure and early molecular responses to environmental pollutants

  18. A novel marker for terminal Schwann cells, homocysteine-responsive ER-resident protein, as isolated by a single cell PCR-differential display.

    Science.gov (United States)

    Oda, Ryo; Yaoi, Takeshi; Okajima, Seiichiro; Kobashi, Hiroaki; Kubo, Toshikazu; Fushiki, Shinji

    2003-09-05

    Terminal Schwann cells (TSCs) that cover motor neuron terminals are known to play important roles in maintaining neuromuscular junctions, as well as in the repair process after nerve injury. However, molecular characteristics of TSCs remain unknown, because of the difficulties in analyzing them due to their paucity. We have established a method of selectively and efficiently collecting TSCs so that cDNA analysis can be done properly. The expression of 1-2% of whole mRNAs was compared between myelinating Schwann cells (MSCs) and TSCs, and it turned out that approximately one-third of the bands could be categorized as cell-type-specific bands. TSCs thus constitute a distinct entity from the viewpoint of gene expression. As one of the cDNA clones belonging to TSC-specific bands was identified homocysteine-responsive ER-resident protein (Herp), and in situ hybridization confirmed that Herp mRNA is expressed in TSCs on motor nerve terminals but not in MSCs, both in developing and adult rats. In conclusion, we have been able to identify Herp as a novel molecular marker for TSCs.

  19. A single exposure to cocaine during development elicits regionally-selective changes in basal basic Fibroblast Growth Factor (FGF-2) gene expression and alters the trophic response to a second injection.

    Science.gov (United States)

    Giannotti, Giuseppe; Caffino, Lucia; Malpighi, Chiara; Melfi, Simona; Racagni, Giorgio; Fumagalli, Fabio

    2015-02-01

    During adolescence, the brain is maturing and more sensitive to drugs of abuse that can influence its developmental trajectory. Recently, attention has been focused on basic fibroblast growth factor (FGF-2) given that its administration early in life enhances the acquisition of cocaine self-administration and sensitization at adulthood (Turner et al. (Pharmacol Biochem Behav 92:100-4, 2009), Clinton et al. (Pharmacol Biochem Behav103:6-17, 2012)). Additionally, we found that abstinence from adolescent cocaine exposure long lastingly dysregulates FGF-2 transcription (Giannotti et al. (Psychopharmacology (Berl) 225:553-60, 2013 ). The objectives of the study are to evaluate if (1) a single injection of cocaine (20 mg/kg) at postnatal day 35 alters FGF-2 messenger RNA (mRNA) levels and (2) the first injection influences the trophic response to a second injection (10 mg/kg) provided 24 h or 7 days later. We found regional differences in the FGF-2 expression pattern as either the first or the second injection of cocaine by themselves upregulated FGF-2 mRNA in the medial prefrontal cortex and nucleus accumbens while downregulating it in the hippocampus. The first injection influences the trophic response of the second. Of note, 24 h after the first injection, accumbal and hippocampal FGF-2 changes produced by cocaine in saline-pretreated rats were prevented in cocaine-pretreated rats. Conversely, in the medial prefrontal cortex and hippocampus 7 days after the first injection, the cocaine-induced FGF-2 changes were modified by the subsequent exposure to the psychostimulant. These findings show that a single cocaine injection is sufficient to produce enduring changes in the adolescent brain and indicate that early cocaine priming alters the mechanisms regulating the trophic response in a brain region-specific fashion.

  20. Immunological Response to Single Pathogen Challenge with Agents of the Bovine Respiratory Disease Complex: An RNA-Sequence Analysis of the Bronchial Lymph Node Transcriptome.

    Directory of Open Access Journals (Sweden)

    Polyana C Tizioto

    Full Text Available Susceptibility to bovine respiratory disease (BRD is multi-factorial and is influenced by stress in conjunction with infection by both bacterial and viral pathogens. While vaccination is broadly used in an effort to prevent BRD, it is far from being fully protective and cases diagnosed from a combination of observed clinical signs without any attempt at identifying the causal pathogens are usually treated with antibiotics. Dairy and beef cattle losses from BRD are profound worldwide and genetic studies have now been initiated to elucidate host loci which underlie susceptibility with the objective of enabling molecular breeding to reduce disease prevalence. In this study, we employed RNA sequencing to examine the bronchial lymph node transcriptomes of controls and beef cattle which had individually been experimentally challenged with bovine respiratory syncytial virus, infectious bovine rhinotracheitis, bovine viral diarrhea virus, Pasteurella multocida, Mannheimia haemolytica or Mycoplasma bovis to identify the genes that are involved in the bovine immune response to infection. We found that 142 differentially expressed genes were located in previously described quantitative trait locus regions associated with risk of BRD. Mutations affecting the expression or amino acid composition of these genes may affect disease susceptibility and could be incorporated into molecular breeding programs. Genes involved in innate immunity were generally found to be differentially expressed between the control and pathogen-challenged animals suggesting that variation in these genes may lead to a heritability of susceptibility that is pathogen independent. However, we also found pathogen-specific expression profiles which suggest that host genetic variation for BRD susceptibility is pathogen dependent.

  1. Immunological Response to Single Pathogen Challenge with Agents of the Bovine Respiratory Disease Complex: An RNA-Sequence Analysis of the Bronchial Lymph Node Transcriptome.

    Science.gov (United States)

    Tizioto, Polyana C; Kim, JaeWoo; Seabury, Christopher M; Schnabel, Robert D; Gershwin, Laurel J; Van Eenennaam, Alison L; Toaff-Rosenstein, Rachel; Neibergs, Holly L; Taylor, Jeremy F

    2015-01-01

    Susceptibility to bovine respiratory disease (BRD) is multi-factorial and is influenced by stress in conjunction with infection by both bacterial and viral pathogens. While vaccination is broadly used in an effort to prevent BRD, it is far from being fully protective and cases diagnosed from a combination of observed clinical signs without any attempt at identifying the causal pathogens are usually treated with antibiotics. Dairy and beef cattle losses from BRD are profound worldwide and genetic studies have now been initiated to elucidate host loci which underlie susceptibility with the objective of enabling molecular breeding to reduce disease prevalence. In this study, we employed RNA sequencing to examine the bronchial lymph node transcriptomes of controls and beef cattle which had individually been experimentally challenged with bovine respiratory syncytial virus, infectious bovine rhinotracheitis, bovine viral diarrhea virus, Pasteurella multocida, Mannheimia haemolytica or Mycoplasma bovis to identify the genes that are involved in the bovine immune response to infection. We found that 142 differentially expressed genes were located in previously described quantitative trait locus regions associated with risk of BRD. Mutations affecting the expression or amino acid composition of these genes may affect disease susceptibility and could be incorporated into molecular breeding programs. Genes involved in innate immunity were generally found to be differentially expressed between the control and pathogen-challenged animals suggesting that variation in these genes may lead to a heritability of susceptibility that is pathogen independent. However, we also found pathogen-specific expression profiles which suggest that host genetic variation for BRD susceptibility is pathogen dependent.

  2. Accumulation and detoxication responses of the gastropod Lymnaea stagnalis to single and combined exposures to natural (cyanobacteria) and anthropogenic (the herbicide RoundUp(®) Flash) stressors.

    Science.gov (United States)

    Lance, Emilie; Desprat, Julia; Holbech, Bente Frost; Gérard, Claudia; Bormans, Myriam; Lawton, Linda A; Edwards, Christine; Wiegand, Claudia

    2016-08-01

    Freshwater gastropods are increasingly exposed to multiple stressors in the field such as the herbicide glyphosate in Roundup formulations and cyanobacterial blooms either producing or not producing microcystins (MCs), potentially leading to interacting effects. Here, the responses of Lymnaea stagnalis to a 21-day exposure to non-MC or MC-producing (33μgL(-1)) Planktothrix agardhii alone or in combination with the commercial formulation RoundUp(®) Flash at a concentration of 1μgL(-1) glyphosate, followed by 14days of depuration, were studied via i) accumulation of free and bound MCs in tissues, and ii) activities of anti-oxidant (catalase CAT) and biotransformation (glutathione-S-transferase GST) enzymes. During the intoxication, the cyanobacterial exposure induced an early increase of CAT activity, independently of the MC content, probably related to the production of secondary cyanobacterial metabolites. The GST activity was induced by RoundUp(®) Flash alone or in combination with non MC-producing cyanobacteria, but was inhibited by MC-producing cyanobacteria with or without RoundUp(®) Flash. Moreover, MC accumulation in L. stagnalis was 3.2 times increased when snails were concomitantly exposed to MC-producing cyanobacteria with RoundUp(®), suggesting interacting effects of MCs on biotransformation processes. The potent inhibition of detoxication systems by MCs and RoundUp(®) Flash was reversible during the depuration, during which CAT and GST activities were significantly higher in snails previously exposed to MC-producing cyanobacteria with or without RoundUp(®) Flash than in other conditions, probably related to the oxidative stress caused by accumulated MCs remaining in tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Single Purpose Satellite Systems

    OpenAIRE

    Watkins, Warren

    1989-01-01

    This paper examines the need for tactically responsive space systems capable of supporting battlefield and fleet commanders. Terminology used to describe this category of satellite system varies according to organization or agency. The Defense Advanced Research Projects Agency's Lightsat, the Naval Space Command's SPINSAT, and the Air Force Space Command s TACSAT, are reviewed. The United State Space Command's space support mission IS addressed and the role single-purpose satellites can play ...

  4. Markers of biological stress in response to a single session of high-intensity interval training and high-volume training in young athletes.

    Science.gov (United States)

    Kilian, Yvonne; Engel, Florian; Wahl, Patrick; Achtzehn, Silvia; Sperlich, Billy; Mester, Joachim

    2016-12-01

    The aim of the present study was to compare the effects of high-intensity interval training (HIIT) vs high-volume training (HVT) on salivary stress markers [cortisol (sC), testosterone (sT), alpha-amylase (sAA)], metabolic and cardiorespiratory response in young athletes. Twelve young male cyclists (14 ± 1 years; 57.9 ± 9.4 mL min -1  kg -1 peak oxygen uptake) performed one session of HIIT (4 × 4 min intervals at 90-95 % peak power output separated by 3 min of active rest) and one session of HVT (90 min constant load at 60 % peak power output). The levels of sC, sT, their ratio (sT/sC) and sAA were determined before and 0, 30, 60, 180 min after each intervention. Metabolic and cardiorespiratory stress was characterized by blood lactate, blood pH, respiratory exchange ratio (RER) and heart rate (HR), oxygen uptake ([Formula: see text]), ventilation (V E ) and ventilatory equivalent (V E /[Formula: see text]). sC increased 30 and 60 min after HIIT. However, 180 min post exercise, sC decreased below baseline levels in both conditions. sT increased 0 and 30 min after HIIT and 0 min after HVT. sAA and sT/sC ratio did not change significantly over time in HIIT nor HVT. Metabolic and cardiorespiratory stress, evidenced by blood lactate, HR, [Formula: see text], V E , and V E /[Formula: see text] was higher during HIIT compared to HVT. The metabolic and cardiorespiratory stress during HIIT was higher compared to HVT, but based on salivary analyses (cortisol, testosterone, alpha-amylase), we conclude no strong acute catabolic effects neither by HIIT nor by HVT.

  5. A randomised, double-blind study in adults with major depressive disorder with an inadequate response to a single course of selective serotonin reuptake inhibitor or serotonin-noradrenaline reuptake inhibitor treatment switched to vortioxetine or agomelatine.

    Science.gov (United States)

    Montgomery, Stuart A; Nielsen, Rebecca Z; Poulsen, Lis H; Häggström, Lars

    2014-09-01

    This randomised, double-blind, 12-week study compared efficacy and tolerability of flexible-dose treatment with vortioxetine(10-20 mg/day) versus agomelatine (25-50 mg/day) in major depressive disorder patients with inadequate response to selective serotonin reuptake inhibitor (SSRI)/serotonin-noradrenaline reuptake inhibitor (SNRI) monotherapy. Patients were switched directly from SSRI/SNRI to vortioxetine or agomelatine. Primary endpoint was change from baseline to week 8 in the Montgomery-Åsberg Depression Rating Scale (MADRS) total score analysed by mixed model for repeated measurements, using a noninferiority test followed by a superiority test. Secondary endpoints included response and remission rates, anxiety symptoms(Hamilton Anxiety Rating Scale), Clinical Global Impression, overall functioning (Sheehan Disability Scale), health-related quality of life(EuroQol 5 Dimensions), productivity (work limitation questionnaire) and family functioning (Depression and Family Functioning Scale). Primary endpoint noninferiority was established and vortioxetine (n = 252) was superior to agomelatine (n = 241) by 2.2 MADRS points (pDepression and Family Functioning Scale at weeks 8 and 12. Fewer patients withdrew because of adverse events with vortioxetine (5.9% vs 9.5%). Adverse events (incidence ≥5%) were nausea, headache, dizziness and somnolence. Vortioxetine was noninferior and significantly superior to agomelatine in major depressive disorder patients with previous inadequate response to a single course of SSRI/SNRI monotherapy. Vortioxetine was safe and well tolerated.

  6. Obtaining the neutron time-of-flight instrument response function for a single D-T neutron utilizing n-alpha coincidence from the d(t, α) n nuclear reaction

    Science.gov (United States)

    Styron, Jedediah; Ruiz, Carlos; Hahn, Kelly; Cooper, Gary; Chandler, Gordon; Jones, Brent; McWatters, Bruce; Smith, Jenny; Vaughan, Jeremy

    2017-10-01

    A measured neutron time-of-flight (nTOF) signal is a convolution of the neutron reaction history and the instrument response function (IRF). For this work, the IRF was obtained by measuring single, D-T neutron events by utilizing n-alpha coincidence. The d(t, α) n nuclear reaction was produced at Sandia National Laboratories' Ion Beam Laboratory using a 300-keV Cockroft-Walton generator to accelerate a 2- μA beam, of 175-keV D + ions, into a stationary, 2.6- μm, ErT2 target. Comparison of these results to those obtained using cosmic-rays and photons will be discussed. Sandia National Laboratories.

  7. Psychometric properties of three single-item pain scales in patients with rheumatoid arthritis seen during routine clinical care: a comparative perspective on construct validity, reproducibility and internal responsiveness.

    Science.gov (United States)

    Sendlbeck, Melanie; Araujo, Elizabeth G; Schett, Georg; Englbrecht, Matthias

    2015-01-01

    To investigate the construct validity, reproducibility (ie, retest reliability) and internal responsiveness to treatment change of common single-item scales measuring overall pain in patients with rheumatoid arthritis (RA) and to investigate the corresponding effect of common pain-related comorbidities and medical consultation on these outcomes. 236 patients with RA completed a set of questionnaires including a visual analogue scale (VAS), a numerical rating scale (NRS) and a verbal rating scale (VRS) measuring overall pain before and immediately after routine medical consultation as well as 1 week after the patient's visit. Construct validity and retest reliability were evaluated using the Bravais-Pearson correlation while standardised response means (SRM) were calculated for evaluating internal responsiveness. Differences in the perception of pain were calculated using dependent samples t-tests. In the total sample, construct validity was good across all three time points (convergent validity of pain scales: rT1-T3=0.82-0.92, pscales with age: rage=0.01-0.16, p>0.05). In patients maintaining antirheumatic treatment, retest reliability of pain scales was confirmed for all scales and across time points (rVAS=0.82-0.95, rNRS=0.89-0.98, rVRS=0.80-0.90, pscales to a change in treatment was low across all scales (SRM=0.08-0.21). The VAS especially suggested a change in pain perception after medical consultation in patients maintaining therapy. The VAS, NRS and VRS are valid and retest reliable in an outpatient clinical practice setting. The low pain scales' internal responsiveness to treatment change is likely to be due to the short follow-up period. Patients with RA maintaining antirheumatic therapy seem to experience less pain after medical consultation.

  8. A Single Dose of LSD Does Not Alter Gene Expression of the Serotonin 2A Receptor Gene (HTR2A) or Early Growth Response Genes (EGR1-3) in Healthy Subjects

    Science.gov (United States)

    Dolder, Patrick C.; Grünblatt, Edna; Müller, Felix; Borgwardt, Stefan J.; Liechti, Matthias E.

    2017-01-01

    Rationale: Renewed interest has been seen in the use of lysergic acid diethylamide (LSD) in psychiatric research and practice. The repeated use of LSD leads to tolerance that is believed to result from serotonin (5-HT) 5-HT2A receptor downregulation. In rats, daily LSD administration for 4 days decreased frontal cortex 5-HT2A receptor binding. Additionally, a single dose of LSD acutely increased expression of the early growth response genes EGR1 and EGR2 in rat and mouse brains through 5-HT2A receptor stimulation. No human data on the effects of LSD on gene expression has been reported. Therefore, we investigated the effects of single-dose LSD administration on the expression of the 5-HT2A receptor gene (HTR2A) and EGR1-3 genes. Methods: mRNA expression levels were analyzed in whole blood as a peripheral biomarker in 15 healthy subjects before and 1.5 and 24 h after the administration of LSD (100 μg) and placebo in a randomized, double-blind, placebo-controlled, cross-over study. Results: LSD did not alter the expression of the HTR2A or EGR1-3 genes 1.5 and 24 h after administration compared with placebo. Conclusion: No changes were observed in the gene expression of LSD’s primary target receptor gene or genes that are implicated in its downstream effects. Remaining unclear is whether chronic LSD administration alters gene expression in humans. PMID:28701958

  9. The peptide motif of the single dominantly expressed class I molecule of the chicken MHC can explain the response to a molecular defined vaccine of infectious bursal disease virus (IBDV).

    Science.gov (United States)

    Butter, Colin; Staines, Karen; van Hateren, Andrew; Davison, T Fred; Kaufman, Jim

    2013-08-01

    In contrast to typical mammals, the chicken MHC (the BF-BL region of the B locus) has strong genetic associations with resistance and susceptibility to infectious pathogens as well as responses to vaccines. We have shown that the chicken MHC encodes a single dominantly expressed class I molecule whose peptide-binding motifs can determine resistance to viral pathogens, such as Rous sarcoma virus and Marek's disease virus. In this report, we examine the response to a molecular defined vaccine, fp-IBD1, which consists of a fowlpox virus vector carrying the VP2 gene of infectious bursal disease virus (IBDV) fused with β-galactosidase. We vaccinated parental lines and two backcross families with fp-IBD1, challenged with the virulent IBDV strain F52/70, and measured damage to the bursa. We found that the MHC haplotype B15 from line 15I confers no protection, whereas B2 from line 61 and B12 from line C determine protection, although another locus from line 61 was also important. Using our peptide motifs, we found that many more peptides from VP2 were predicted to bind to the dominantly expressed class I molecule BF2*1201 than BF2*1501. Moreover, most of the peptides predicted to bind BF2*1201 did in fact bind, while none bound BF2*1501. Using peptide vaccination, we identified one B12 peptide that conferred protection to challenge, as assessed by bursal damage and viremia. Thus, we show the strong genetic association of the chicken MHC to a T cell vaccine can be explained by peptide presentation by the single dominantly expressed class I molecule.

  10. Isotropic Single Negative Metamaterials

    Directory of Open Access Journals (Sweden)

    P. Protiva

    2008-09-01

    Full Text Available This paper presents the application of simple, and therefore cheap, planar resonators for building 3D isotropic metamaterials. These resonators are: a broadside-coupled split ring resonator with a magnetic response providing negative permeability; an electric dipole terminated by a loop inductor together with a double H-shaped resonator with an electric response providing negative permittivity. Two kinds of 3D isotropic single negative metamaterials are reported. The first material consists of unit cells in the form of a cube bearing on its faces six equal planar resonators with tetrahedral symmetry. In the second material, the planar resonators boxed into spherical plastic shells and randomly distributed in a hosting material compose a real 3D volumetric metamaterial with an isotropic response. In both cases the metamaterial shows negative permittivity or permeability, according to the type of resonators that are used. The experiments prove the isotropic behavior of the cells and of the metamaterial specimens.

  11. Respons Antibodi terhadap Penyakit Tetelo pada Ayam yang Divaksin Tetelo dan Tetelo-Flu Burung (NEWCASTLE DISEASE/ND ANTIBODY RESPONSE OF CHICKENS VACCINATED WITH ND SINGLE AND COMBINED ND AND AVIAN INFLUENZA VACCINES

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2015-08-01

    Full Text Available The aim of this study was to investigate antibody response of specific pathogen-free (SPF chickens vaccinatedwith single inactivated Newcastle disease (ND vaccine and combined inactive ND and avian influenza(AI vaccines and to known the efficacy of both vaccines. The vaccines used were killed ND vaccine andkilled ND-AI vaccine produced by PT. Sanbio Laboratories Bogor, West Java. SPF chickens were vaccinatedwith 3 different doses. Antibody titer of SPF chickens against ND virus were determined byhaemagglutination inhibition (HI test. As many as 130 two week old SPF chickens were used and theywere divided into 2 groups (A and B consisting of 60 chickens and 10 chickens were used as control withoutvaccine. Group A chickens were vaccinated with ND-K vaccine and group B were vaccinated with combinedkilled ND-AI vaccines. Each group was further divided into 3 subsgroups (1, 2 and 3 consisting 20 chickens.Subgroups 1, 2 and 3 were vaccinated intramuscularly respectively with intramuskular 1, 1/10 and 1/100doses of each vaccines. Antibody response of chickens against ND virus was examined before vaccinationand every three week after vaccination and was expresses as geometric mean titre (GMT HI units. Theresult showed that the titre antibody against ND increased at the second week following the vaccination.The antibody titer against ND virus of chickens vaccinated single killed ND at the second week in eachdose were 6.05 GMT HI unit, 4.05 GMT HI unit, and 0.9 GMT HI unit. The antibody titre at the third week were 7.90 GMT HI unit ,5.40 GMT HI unit and 2.20 GMT HI unit. The antibody titre against ND virus ofchickens vaccinated with combined ND-AI vaccine at the second week were 6.30 GMT HI unit , 4.15 GMTHI unit , and 2.05 GMT HI unit. At the third week, the antibody titre against ND virus of chickensvaccinated with combined ND-AI vaccine in each subgroup were 7.45 GMT HI unit, 5.60 GMT HI unit , and2.40 GMT HI unit . It showed that the antibody titers

  12. Single-nucleotide polymorphisms in base excision repair, nucleotide excision repair, and double strand break genes as markers for response to radiotherapy in patients with Stage I to II head-and-neck cancer

    International Nuclear Information System (INIS)

    Carles, Joan; Monzo, Mariano; Amat, Marta; Jansa, Sonia; Artells, Rosa; Navarro, Alfons; Foro, Palmira; Alameda, Francesc; Gayete, Angel; Gel, Bernat; Miguel, Maribel; Albanell, Joan; Fabregat, Xavier

    2006-01-01

    Purpose: Polymorphisms in DNA repair genes can influence response to radiotherapy. We analyzed single-nucleotide polymorphisms (SNP) in nine DNA repair genes in 108 patients with head-and-neck cancer (HNSCC) who had received radiotherapy only. Methods and Materials: From May 1993 to December 2004, patients with Stage I and II histopathologically confirmed HNSCC underwent radiotherapy. DNA was obtained from paraffin-embedded tissue, and SNP analysis was performed using a real-time polymerase chain reaction allelic discrimination TaqMan assay with minor modifications. Results: Patients were 101 men (93.5%) and 7 (6.5%) women, with a median age of 64 years (range, 40 to 89 years). Of the patients, 76 (70.4%) patients were Stage I and 32 (29.6%) were Stage II. The XPF/ERCC1 SNP at codon 259 and XPG/ERCC5 at codon 46 emerged as significant predictors of progression (p 0.00005 and 0.049, respectively) and survival (p = 0.0089 and 0.0066, respectively). Similarly, when variant alleles of XPF/ERCC1, XPG/ERCC5 and XPA were examined in combination, a greater number of variant alleles was associated with shorter time to progression (p = 0.0003) and survival (p 0.0002). Conclusions: Genetic polymorphisms in XPF/ERCC1, XPG/ERCC5, and XPA may significantly influence response to radiotherapy; large studies are warranted to confirm their role in HNSCC

  13. Single point mutations in the helicase domain of the NS3 protein enhance dengue virus replicative capacity in human monocyte-derived dendritic cells and circumvent the type I interferon response.

    Science.gov (United States)

    Silveira, G F; Strottmann, D M; de Borba, L; Mansur, D S; Zanchin, N I T; Bordignon, J; dos Santos, C N Duarte

    2016-01-01

    Dengue is the most prevalent arboviral disease worldwide. The outcome of the infection is determined by the interplay of viral and host factors. In the present study, we evaluated the cellular response of human monocyte-derived DCs (mdDCs) infected with recombinant dengue virus type 1 (DV1) strains carrying a single point mutation in the NS3hel protein (L435S or L480S). Both mutated viruses infect and replicate more efficiently and produce more viral progeny in infected mdDCs compared with the parental, non-mutated virus (vBACDV1). Additionally, global gene expression analysis using cDNA microarrays revealed that the mutated DVs induce the up-regulation of the interferon (IFN) signalling and pattern recognition receptor (PRR) canonical pathways in mdDCs. Pronounced production of type I IFN were detected specifically in mdDCs infected with DV1-NS3hel-mutated virus compared with mdDCs infected with the parental virus. In addition, we showed that the type I IFN produced by mdDCs is able to reduce DV1 infection rates, suggesting that cytokine function is effective but not sufficient to mediate viral clearance of DV1-NS3hel-mutated strains. Our results demonstrate that single point mutations in subdomain 2 have important implications for adenosine triphosphatase (ATPase) activity of DV1-NS3hel. Although a direct functional connection between the increased ATPase activity and viral replication still requires further studies, these mutations speed up viral RNA replication and are sufficient to enhance viral replicative capacity in human primary cell infection and circumvent type I IFN activity. This information may have particular relevance for attenuated vaccine protocols designed for DV. © 2015 British Society for Immunology.

  14. Analysis of single biological cells

    International Nuclear Information System (INIS)

    Watt, Frank

    2002-01-01

    The extraction of elemental information from single cultured cells using nuclear microscopy is an area of great potential because it can provide both quantitative information on the uptake of elements by the cell, and also its elemental response to a wide variety of external stimuli. A recent technique based on nuclear physics technology enables the analysis of single cells down to the parts per million level to be achieved

  15. First-line response-adapted treatment with the combination of bendamustine and rituximab in patients with mucosa-associated lymphoid tissue lymphoma (MALT2008-01): a multicentre, single-arm, phase 2 trial.

    Science.gov (United States)

    Salar, Antonio; Domingo-Domenech, Eva; Panizo, Carlos; Nicolás, Concepción; Bargay, Joan; Muntañola, Ana; Canales, Miguel; Bello, José Luis; Sancho, Juan Manuel; Tomás, José Francisco; Rodríguez, María José; Peñalver, Francisco Javier; Grande, Carlos; Sánchez-Blanco, José Javier; Palomera, Luis; Arranz, Reyes; Conde, Eulogio; García, Mar; García, Juan Fernando; Caballero, Dolores; Montalbán, Carlos

    2014-12-01

    No standard first-line systemic treatment for mucosa-associated lymphoid tissue (MALT) lymphoma is available. In a phase 2 study we aimed to assess the safety and activity of a response-adapted combination of bendamustine plus rituximab as upfront treatment for this type of lymphoma. In a multicentre, single-arm, non-randomised, phase 2 trial, we enrolled patients with MALT lymphoma at any site and stage and treated them with bendamustine (90 mg/m(2) on days 1 and 2) plus rituximab (375 mg/m(2) on day 1), every 4 weeks. Inclusion criteria were measurable or evaluable disease, age 18-85 years, and unequivocal active lymphoma; we also enrolled patients with MALT lymphoma arising in the stomach after failure of Helicobacter pylori eradication and primary cutaneous cases after failure of local therapies. Exclusion criteria included evidence of histological transformation, CNS involvement, and active hepatitis B or C virus or HIV infection. After three cycles, patients achieving complete response received one additional cycle (total four cycles) and those achieving partial response received three additional cycles (total six cycles). The primary endpoint was 2-year event-free survival. Analysis was by modified intention to treat. This trial is registered with ClinicalTrials.gov, number NCT01015248. 60 patients from 19 centres in Spain were enrolled between May 27, 2009, and May 23, 2011, and received treatment; 57 patients were evaluable for the primary endpoint. Only 14 (25%) patients needed more than four cycles of treatment. After a median follow-up of 43 months (IQR 37-51), median event-free survival was not reached. Event-free survival at 2 years was 93% (95% CI 84-97) and at 4 years was 88% (95% CI 74-95). The most frequently observed grade 3-4 adverse events were haematological: lymphopenia in 20 (33%) patients, neutropenia in 12 (20%) patients, and leucopenia in three (5%) patients. Grade 3-4 febrile neutropenia or infections were reported in three (5%) and four

  16. Influence of habitual dietary fibre intake on the responsiveness of the gut microbiota to a prebiotic: protocol for a randomised, double-blind, placebo-controlled, cross-over, single-centre study.

    Science.gov (United States)

    Healey, Genelle; Brough, Louise; Butts, Chrissie; Murphy, Rinki; Whelan, Kevin; Coad, Jane

    2016-09-02

    The commensal gut microbiota have been shown to have an impact on human health as aberrant gut microbiota have been linked to disease. Dietary constituents are influential in shaping the gut microbiota. Diet-specific therapeutic strategies may therefore play a role in optimising human health via beneficial manipulation of the gut microbiota. Research has suggested that an individual's baseline gut microbiota composition may influence how the gut microbiota respond to a dietary intervention and individuals with differing habitual dietary intakes appear to have distinct baseline gut microbiota compositions. The responsiveness of the gut microbiota may therefore be influenced by habitual dietary intakes. This study aims to investigate what influence differing habitual dietary fibre intakes have on the responsiveness of the gut microbiota to a prebiotic intervention. In this randomised, double-blind, placebo-controlled, cross-over, single-centre study, 20 low dietary fibre (dietary fibre intake gut microbiota composition (using 16S rRNA gene sequencing) and functional capacity (faecal short chain fatty acid concentrations and Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt)) as well as appetite (visual analogue scale appetite questionnaire) will be assessed at the beginning and end of each intervention phase. The Massey University Human Ethics Committee approved this study (Massey University HEC: Southern A application-15/34). Results will be disseminated through peer-review journal publications, conference presentations and a summary of findings will be distributed to participants. ACTRN12615000922572; Pre-results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  17. ROS-Responsive Mitochondria-Targeting Blended Nanoparticles: Chemo- and Photodynamic Synergistic Therapy for Lung Cancer with On-Demand Drug Release upon Irradiation with a Single Light Source

    Science.gov (United States)

    Yue, Caixia; Yang, Yuming; Zhang, Chunlei; Alfranca, Gabriel; Cheng, Shangli; Ma, Lijun; Liu, Yanlei; Zhi, Xiao; Ni, Jian; Jiang, Weihua; Song, Jie; de la Fuente, Jesús M.; Cui, Daxiang

    2016-01-01

    Mitochondria in cancer cells maintain a more negative membrane potential than normal cells. Mitochondria are the primary source of cellular reactive oxygen species (ROS), which are necessary for photodynamic therapy. Thus, the strategy of targeting mitochondria can maximize the photodynamic therapeutic efficiency for cancer. Here we report, for the first time, synthesis of a new mitochondria-targeting drug delivery system, ZnPc/CPT-TPPNPs. To synthesize this novel compound, polyethylene glycol was functionalized with thioketal linker-modified camptothecin (TL-CPT) and triphenylphosphonium to form the block copolymer, TL-CPT-PEG1K-TPP. The ZnPc/CPT-TPPNPs was constructed for delivery of the photosensitizer Zinc phthalocyanine (ZnPc) by blending the block copolymer TL-CPT-PEG1K-TPP with 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy (polyethylene glycol)] (DSPE-PEG).Triphenylphosphine can accumulate selectively several hundred-fold within mitochondria. The thioketal linker is ROS-responsive and CPT can be released upon ROS cleavage. We also show that the ZnPc loaded in ZnPc/CPT-TPPNPs absorbed the 633 nm laser to produce ROS, which could be utilized both in photodynamic therapy and to cleave the thioketal linker thereby releasing camptothecin for chemotherapy. Thus, the mitochondria-targeting nanoparticles could elevate photodynamic therapeutic efficacy. Our results showed that surface modification of the nanoparticles with triphenylphosphine cations facilitated efficient subcellular delivery of the photosensitizer to mitochondria. The nanoparticles had a good ROS-responsive effect to release CPT, which could transfer to the nucleus and interfere with DNA replication as a topoisomeraseⅠinhibitor. Thus, the blended nanoparticles provide a new promising approach as a mitochondria-targeting ROS-activated chemo- and photodynamic therapy with a single light source for lung cancer. PMID:27877240

  18. Single dose of glycoengineered anti-CD19 antibody (MEDI551) disrupts experimental autoimmune encephalomyelitis by inhibiting pathogenic adaptive immune responses in the bone marrow and spinal cord while preserving peripheral regulatory mechanisms.

    Science.gov (United States)

    Chen, Ding; Blazek, Monica; Ireland, Sara; Ortega, Sterling; Kong, Xiangmei; Meeuwissen, Anouk; Stowe, Ann; Carter, Laura; Wang, Yue; Herbst, Ronald; Monson, Nancy L

    2014-11-15

    Plasma cells and the autoreactive Abs they produce are suspected to contribute to the pathogenesis of multiple sclerosis, but recent attempts to target these components of humoral immunity have failed. MEDI551, an anti-CD19 Ab that depletes mature B cells including plasma cells may offer a compelling alternative that reduces pathogenic adaptive immune responses while sparing regulatory mechanisms. Indeed, our data demonstrate that a single dose of MEDI551, given before or during ongoing experimental autoimmune encephalomyelitis, disrupts development of the disease. Leukocyte infiltration into the spinal cord is significantly reduced, as well as short-lived and long-lived autoreactive CD138(+) plasma cells in the spleen and bone marrow, respectively. In addition, potentially protective CD1d(hi)CD5(+) regulatory B cells show resistance to depletion, and myelin-specific Foxp3(+) regulatory T cells are expanded. Taken together, these results demonstrate that MEDI551 disrupts experimental autoimmune encephalomyelitis by inhibiting multiple proinflammatory components whereas preserving regulatory populations. Copyright © 2014 by The American Association of Immunologists, Inc.

  19. The metabolic response of P. putida KT2442 producing high levels of polyhydroxyalkanoate under single- and multiple-nutrient-limited growth: Highlights from a multi-level omics approach

    Directory of Open Access Journals (Sweden)

    Poblete-Castro Ignacio

    2012-03-01

    Full Text Available Abstract Background Pseudomonas putida KT2442 is a natural producer of polyhydroxyalkanoates (PHAs, which can substitute petroleum-based non-renewable plastics and form the basis for the production of tailor-made biopolymers. However, despite the substantial body of work on PHA production by P. putida strains, it is not yet clear how the bacterium re-arranges its whole metabolism when it senses the limitation of nitrogen and the excess of fatty acids as carbon source, to result in a large accumulation of PHAs within the cell. In the present study we investigated the metabolic response of KT2442 using a systems biology approach to highlight the differences between single- and multiple-nutrient-limited growth in chemostat cultures. Results We found that 26, 62, and 81% of the cell dry weight consist of PHA under conditions of carbon, dual, and nitrogen limitation, respectively. Under nitrogen limitation a specific PHA production rate of 0.43 (g·(g·h-1 was obtained. The residual biomass was not constant for dual- and strict nitrogen-limiting growth, showing a different feature in comparison to other P. putida strains. Dual limitation resulted in patterns of gene expression, protein level, and metabolite concentrations that substantially differ from those observed under exclusive carbon or nitrogen limitation. The most pronounced differences were found in the energy metabolism, fatty acid metabolism, as well as stress proteins and enzymes belonging to the transport system. Conclusion This is the first study where the interrelationship between nutrient limitations and PHA synthesis has been investigated under well-controlled conditions using a system level approach. The knowledge generated will be of great assistance for the development of bioprocesses and further metabolic engineering work in this versatile organism to both enhance and diversify the industrial production of PHAs.

  20. Lanthanide single molecule magnets

    CERN Document Server

    Tang, Jinkui

    2015-01-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs, and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures – an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and...

  1. Lanthanide single molecule magnets

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jinkui; Zhang, Peng [Chinese Academy of Sciences, Changchun (China). Changchun Inst. of Applied Chemistry

    2015-10-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures - an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and explore new directions.

  2. Impact of Moringa oleifera lam. Leaf powder supplementation versus nutritional counseling on the body mass index and immune response of HIV patients on antiretroviral therapy: a single-blind randomized control trial.

    Science.gov (United States)

    Tshingani, Koy; Donnen, Philippe; Mukumbi, Henri; Duez, Pierre; Dramaix-Wilmet, Michèle

    2017-08-22

    To achieve effective antiretroviral therapy (ART) outcomes, adherence to an antiretroviral regimen and a good immunometabolic response are essential. Food insecurity can act as a real barrier to adherence to both of these factors. Many people living with human immunodeficiency virus (PLHIV) treated with ART in the Democratic Republic of the Congo (DRC) are faced with nutritional challenges. A significant proportion are affected by under nutrition, which frequently leads to therapeutic failure. Some HIV care facilities recommend supplementation with Moringa oleifera (M.O.) Lam. leaf powder to combat marginal and major nutritional deficiencies. This study aims to assess the impact of M.O. Lam. leaf powder supplementation compared to nutritional counseling on the nutritional and immune status of PLHIV treated with ART. A single-blind randomized control trial was carried out from May to September 2013 at an outpatient clinic for HIV-infected patients in Kinshasa (DRC). Sixty adult patients who were at stable HIV/AIDS clinical staging 2, 3 or 4 according to the World Health Organization (WHO), and were undergoing ART were recruited. After random allocation, 30 patients in the Moringa intervention group (MG) received the M.O. Lam. leaf powder daily over 6 months, and 30 in the control group (CG) received nutritional counseling over the same period. Changes in the body mass index (BMI) were measured monthly and biological parameters were measured upon admission and at the end of the study for the patients in both groups. The two study groups were similar in terms of long-term nutritional exposure, sociodemographic, socioeconomic, clinical, and biological features. At 6 months follow-up, patients in the MG exhibited a significantly greater increase in BMI and albumin levels than those in the CG. The interaction between the sociodemographic, clinical, and biological characteristics of patients in the two groups was not significant, with the exception of professional

  3. Single Audit: Single Audit Act Effectiveness Issues

    National Research Council Canada - National Science Library

    Thompson, Sally

    2002-01-01

    As discussed in the report we are releasing today, our work to review agency actions to ensure that recipients take timely and appropriate corrective actions to fix audit findings contained in single...

  4. Single photon from a single trapped atom

    International Nuclear Information System (INIS)

    Dingjan, J.; Jones, M.P.A.; Beugnon, J.; Darquiee, B.; Bergamini, S.; Browaeys, A.; Messin, G.; Grangier, P.

    2005-01-01

    Full text: A quantum treatment of the interaction between atoms and light usually begins with the simplest model system: a two-level atom interacting with a monochromatic light wave. Here we demonstrate an elegant experimental realization of this system using an optically trapped single rubidium atom illuminated by resonant light pulses. We observe Rabi oscillations, and show that this system can be used as a highly efficient triggered source of single photons with a well-defined polarisation. In contrast to other sources based on neutral atoms and trapped ions, no optical cavity is required. We achieved a flux of single photons of about 10 4 s -1 at the detector, and observe complete antibunching. This source has potential applications for distributed atom-atom entanglement using single photons. (author)

  5. Search for Single Top Production at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Echenard, B; Eline, A; El-Mamouni, H; Engler, A; Eppling, F J; Ewers, A; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hakobyan, R S; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krenz, W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S A; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Lübelsmeyer, K; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nisati, A; Nowak, H; Ofierzynski, R A; Organtini, G; Palomares, C; Pandoulas, D; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofiev, D O; Prokofev, D; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, Juan Antonio; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Sanders, M P; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schopper, Herwig Franz; Schotanus, D J; Schwering, G; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S V; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R P; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wallraff, W; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2002-01-01

    Single top production in e^+e^- annihilations is searched for in data collected by the L3 detector at centre-of-mass energies from 189 to 209 GeV, corresponding to a total integrated luminosity of 634 pb-1. Investigating hadronic and semileptonic top decays, no evidence of single top production at LEP is obtained and upper limits on the single top cross section as a function of the centre-of-mass energy are derived. Limits on possible anomalous couplings, as well as on the scale of contact interactions responsible for single top production are determined.

  6. Threshold received sound pressure levels of single 1-2 kHz and 6-7 kHz up-sweeps and down-sweeps causing startle responses in a harbor porpoise (Phocoena phocoena)

    NARCIS (Netherlands)

    Kastelein, R.A.; Steen, N.; Gransier, R.; Wensveen, P.J.; Jong, C.A.F. de

    2012-01-01

    Mid-frequency and low-frequency sonar systems produce frequency-modulated sweeps which may affect harbor porpoises. To study the effect of sweeps on behavioral responses (specifically startle responses, which we define as sudden changes in swimming speed and/or direction), a harbor porpoise in a

  7. The single entity option

    International Nuclear Information System (INIS)

    Friedlander, M.C.; Roberts, K.M.

    1997-01-01

    Traditionally, an owner hires an engineer to design a power facility or other project and then circulates the completed plans to several contractors for competitive bidding. Although there are many variations on this theme, there is an alternative method which is growing in popularity--the design-build concept. In this construction method, the same entity designs and constructs the facility. The design builder may be a single firm with both design and construction capacity in-house, or it may be a combination of two or more firms with complementary abilities. If there are multiple firms, they may be structured as a joint venture or with one of the firms prime and the others in a subcontracting role. The critical aspect is that the owner contracts with one entity which has the responsibility for both designing and constructing the facility. According to statistics compiled by the Design-Build Institute of America and F.W. Dodge DATALINE2, a national reporter of construction statistics and information, from April 1995 to April 1996 the number of design-build contracts increased 103 percent over the previous year. Of a total $212 billion construction market, about $37.2 billion--18 percent--was design build. The strongest growth was in the category of industrial--plants, refineries, factories and warehouses--in which the concept use was up more than 300 percent from the previous year

  8. Single frequency intracavity SRO

    DEFF Research Database (Denmark)

    Abitan, Haim; Buchhave, Preben

    2000-01-01

    Summary form only given. A single resonance optical parametric oscillator (SRO) is inserted intracavity to a CW high power, single frequency, and ring Nd:YVO4 laser. We obtain a stable single frequency CW SRO with output at 1.7-1.9 μm (idler) and a resonating signal at 2.3-2.6 μm. The behavior...

  9. Predictive factors for response and prognostic factors for long-term survival in consecutive, single institution patients with locally advanced and/or metastatic transitional cell carcinoma following cisplatin-based chemotherapy

    DEFF Research Database (Denmark)

    Jessen, Christian; Agerbaek, Mads; Von Der Maase, Hans

    2009-01-01

    PURPOSE: The study was undertaken to identify pre-treatment clinical and histopathological factors of importance for response and survival after cisplatin-based combination chemotherapy, in patients with locally advanced or metastatic transitional cell carcinoma of the urothelium. PATIENTS...

  10. Meningococcal serogroup B-specific responses after vaccination with bivalent rLP2086: 4 year follow-up of a randomised, single-blind, placebo-controlled, phase 2 trial.

    Science.gov (United States)

    Marshall, Helen S; Richmond, Peter C; Beeslaar, Johannes; Jiang, Qin; Jansen, Kathrin U; Garcés-Sánchez, Maria; Martinón-Torres, Federico; Szenborn, Leszek; Wysocki, Jacek; Eiden, Joseph; Harris, Shannon L; Jones, Thomas R; Lee, Su-San; Perez, John L

    2017-01-01

    Bivalent rLP2086 is a recombinant factor H binding protein-based vaccine approved in the USA for prevention of meningococcal serogroup B disease in 10-25-year-olds. We aimed to assess the persistence of bactericidal antibodies up to 4 years after a three-dose schedule of bivalent rLP2086. We did this randomised, single-blind, placebo-controlled, phase 2 trial at 25 sites in Australia, Poland, and Spain. In stage 1 of the study (February, 2009-May, 2010), healthy adolescents (aged 11-18 years) were randomly assigned, via an interactive voice and web-response system with computer-generated sequential random numbers, to receive either ascending doses of vaccine (60 μg, 120 μg, and 200 μg) or placebo at months 0, 2, and 6. Dispensing staff were not masked to group allocation, but allocation was concealed from principal investigators, participants and their guardians, and laboratory personnel. In stage 2 of the study (reported here), we enrolled healthy adolescents who had received three doses of 120 μg bivalent rLP2086 (the optimum dose level identified in stage 1) or saline. Immunogenicity was determined in serum bactericidal antibody assay using human complement (hSBA) by use of four meningococcal serogroup B test strains expressing vaccine-heterologous factor H binding protein variants: PMB80 (A22), PMB2001 (A56), PMB2948 (B24), and PMB2707 (B44). Immunogenicity in stage 2 was assessed at months 6, 12, 24, and 48 post-vaccination. We did analysis by intention to treat. This trial is registered as ClinicalTrials.gov number NCT00808028. Between March 17, 2010, and Feb 8, 2011, 170 participants who received 120 μg of bivalent rLP2086 and 80 participants who received placebo in stage 1 of the study were entered into stage 2; 210 participants completed stage 2 up to 48 months. 1 month after the third vaccination, 93% (n=139/149) to 100% (n=48/48) of vaccine recipients achieved protective hSBA titres equal to or greater than the lower limit of quantification to each

  11. The HIV/AIDS vaccine candidate MVA-B administered as a single immunogen in humans triggers robust, polyfunctional, and selective effector memory T cell responses to HIV-1 antigens.

    Science.gov (United States)

    Gómez, Carmen Elena; Nájera, José Luis; Perdiguero, Beatriz; García-Arriaza, Juan; Sorzano, Carlos Oscar S; Jiménez, Victoria; González-Sanz, Rubén; Jiménez, José Luis; Muñoz-Fernández, María Angeles; López Bernaldo de Quirós, Juan Carlos; Guardo, Alberto C; García, Felipe; Gatell, José M; Plana, Montserrat; Esteban, Mariano

    2011-11-01

    Attenuated poxvirus vectors expressing human immunodeficiency virus type 1 (HIV-1) antigens are considered promising HIV/AIDS vaccine candidates. Here, we describe the nature of T cell immune responses induced in healthy volunteers participating in a phase I clinical trial in Spain after intramuscular administration of three doses of the recombinant MVA-B-expressing monomeric gp120 and the fused Gag-Pol-Nef (GPN) polyprotein of clade B. The majority (92.3%) of the volunteers immunized had a positive specific T cell response at any time postvaccination as detected by gamma interferon (IFN-γ) intracellular cytokine staining (ICS) assay. The CD4(+) T cell responses were predominantly Env directed, whereas the CD8(+) T cell responses were similarly distributed against Env, Gag, and GPN. The proportion of responders after two doses of MVA-B was similar to that obtained after the third dose of MVA-B vaccination, and the responses were sustained (84.6% at week 48). Vaccine-induced CD8(+) T cells to HIV-1 antigens after 1 year were polyfunctional and distributed mainly within the effector memory (TEM) and terminally differentiated effector memory (TEMRA) T cell populations. Antivector T cell responses were mostly induced by CD8(+) T cells, highly polyfunctional, and of TEMRA phenotype. These findings demonstrate that the poxvirus MVA-B vaccine candidate given alone is highly immunogenic, inducing broad, polyfunctional, and long-lasting CD4 and CD8 T cell responses to HIV-1 antigens, with preference for TEM. Thus, on the basis of the immune profile of MVA-B in humans, this immunogen can be considered a promising HIV/AIDS vaccine candidate.

  12. Single Cell Isolation and Analysis

    Directory of Open Access Journals (Sweden)

    Ping Hu

    2016-10-01

    Full Text Available Increasing evidence shows that the heterogeneity of individual cells within a genetically identical population can be critical to their peculiar function and fate. Conventional cell based assays mainly analysis the average responses from a population cells, while the difference within individual cells may often be masked. The cell size, RNA transcripts and protein expression level are quite different within individual cells and these variations are key point to answer the problems in cancer, neurobiology, stem cell biology, immunology and developmental biology. To better understand the cell-to-cell variations, the single cell analysis can provide much more detailed information which may be helpful for therapeutic decisions in an increasingly personalized medicine. In this review, we will focus on the recent development in single cell analysis, including methods used in single cell isolation, analysis and some application examples. The review provides the historical background to single cell analysis, discusses limitations, and current and future possibilities in this exciting field of research.

  13. A measurement of the calorimeter response to single hadrons and determination of the jet energy scale uncertainty using LHC Run-1 $pp$-collision data with the ATLAS detector

    CERN Document Server

    Aaboud, Morad; Abbott, Brad; Abdallah, Jalal; Abdinov, Ovsat; Abeloos, Baptiste; Aben, Rosemarie; AbouZeid, Ossama; Abraham, Nicola; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Agricola, Johannes; Aguilar-Saavedra, Juan Antonio; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Ali, Babar; Aliev, Malik; Alimonti, Gianluca; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allen, Benjamin William; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Alstaty, Mahmoud; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antel, Claire; Antonelli, Mario; Antonov, Alexey; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Armitage, Lewis James; Arnaez, Olivier; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Artz, Sebastian; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Augsten, Kamil; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Baca, Matthew John; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Baines, John; Baker, Oliver Keith; Baldin, Evgenii; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Balunas, William Keaton; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Barak, Liron; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisits, Martin-Stefan; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska-Blenessy, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barranco Navarro, Laura; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Bechtle, Philip; Beck, Hans~Peter; Becker, Kathrin; Becker, Maurice; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bedognetti, Matteo; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Andrew Stuart; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Belyaev, Nikita; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez, Jose; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Beringer, Jürg; Berlendis, Simon; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertram, Iain Alexander; Bertsche, Carolyn; Bertsche, David; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Biedermann, Dustin; Bielski, Rafal; Biesuz, Nicolo Vladi; Biglietti, Michela; Bilbao De Mendizabal, Javier; Billoud, Thomas Remy Victor; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biondi, Silvia; Bjergaard, David Martin; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Blunier, Sylvain; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Boerner, Daniela; Bogaerts, Joannes Andreas; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bokan, Petar; Bold, Tomasz; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Bortfeldt, Jonathan; Bortoletto, Daniela; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Bossio Sola, Jonathan David; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Boutle, Sarah Kate; Boveia, Antonio; Boyd, James; Boyko, Igor; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Broughton, James; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Bruni, Lucrezia Stella; Brunt, Benjamin; Bruschi, Marco; Bruscino, Nello; Bryant, Patrick; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Budagov, Ioulian; Buehrer, Felix; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burckhart, Helfried; Burdin, Sergey; Burgard, Carsten Daniel; Burghgrave, Blake; Burka, Klaudia; Burke, Stephen; Burmeister, Ingo; Burr, Jonathan Thomas Peter; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Butler, John; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cairo, Valentina; Cakir, Orhan; Calace, Noemi; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Callea, Giuseppe; Caloba, Luiz; Calvente Lopez, Sergio; Calvet, David; Calvet, Samuel; Calvet, Thomas Philippe; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminal Armadans, Roger; Camincher, Clement; Campana, Simone; Campanelli, Mario; Camplani, Alessandra; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Carbone, Ryne Michael; Cardarelli, Roberto; Cardillo, Fabio; Carli, Ina; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Casper, David William; Castaneda-Miranda, Elizabeth; Castelijn, Remco; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavallaro, Emanuele; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerda Alberich, Leonor; Cerio, Benjamin; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chan, Stephen Kam-wah; Chan, Yat Long; Chang, Philip; Chapman, John Derek; Charlton, Dave; Chatterjee, Avishek; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Che, Siinn; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Shenjian; Chen, Shion; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Huajie; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiarelli, Giorgio; Chiodini, Gabriele; Chisholm, Andrew; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chomont, Arthur Rene; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocca, Claudia; Ciocio, Alessandra; Cirotto, Francesco; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Michael; Clark, Philip James; Clarke, Robert; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Colasurdo, Luca; Cole, Brian; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consorti, Valerio; Constantinescu, Serban; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cormier, Kyle James Read; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Crawley, Samuel Joseph; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cueto, Ana; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cúth, Jakub; Czirr, Hendrik; Czodrowski, Patrick; D'amen, Gabriele; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dado, Tomas; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Dang, Nguyen Phuong; Daniells, Andrew Christopher; Dann, Nicholas Stuart; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Merlin; Davison, Peter; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Benedetti, Abraham; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Maria, Antonio; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Dehghanian, Nooshin; Deigaard, Ingrid; Del Gaudio, Michela; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Denysiuk, Denys; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Dette, Karola; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Clemente, William Kennedy; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Du, Yanyan; Duarte-Campderros, Jorge; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duffield, Emily Marie; Duflot, Laurent; Dührssen, Michael; Dumancic, Mirta; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dutta, Baishali; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Edwards, Nicholas Charles; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellajosyula, Venugopal; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Ennis, Joseph Stanford; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Federica; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farina, Christian; Farina, Edoardo Maria; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fawcett, William James; Fayard, Louis; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Feremenga, Last; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Flaschel, Nils; Fleck, Ivor; Fleischmann, Philipp; Fletcher, Gareth Thomas; Fletcher, Rob Roy MacGregor; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Forcolin, Giulio Tiziano; Formica, Andrea; Forti, Alessandra; Foster, Andrew Geoffrey; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; Fressard-Batraneanu, Silvia; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fusayasu, Takahiro; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gach, Grzegorz; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Louis Guillaume; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gascon Bravo, Alberto; Gasnikova, Ksenia; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Gecse, Zoltan; Gee, Norman; Geich-Gimbel, Christoph; Geisen, Marc; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Geng, Cong; Gentile, Simonetta; Gentsos, Christos; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghasemi, Sara; Ghazlane, Hamid; Ghneimat, Mazuza; Giacobbe, Benedetto; Giagu, Stefano; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gignac, Matthew; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuli, Francesco; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Giulia; Gonella, Laura; Gongadze, Alexi; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goudet, Christophe Raymond; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Gozani, Eitan; Graber, Lars; Grabowska-Bold, Iwona; Gradin, Per Olov Joakim; Grafström, Per; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Gratchev, Vadim; Gravila, Paul Mircea; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Grefe, Christian; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Grevtsov, Kirill; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Groh, Sabrina; Grohs, Johannes Philipp; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guan, Wen; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Guo, Yicheng; Gupta, Ruchi; Gupta, Shaun; Gustavino, Giuliano; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Hadef, Asma; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamilton, Andrew; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Haney, Bijan; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hartmann, Nikolai Marcel; Hasegawa, Makoto; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hayakawa, Daiki; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Jochen Jens; Heinrich, Lukas; Heinz, Christian; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Henkelmann, Steffen; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohn, David; Holmes, Tova Ray; Homann, Michael; Hong, Tae Min; Hooberman, Benjamin Henry; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Hu, Shuyang; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Huo, Peng; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Yuriy; Iliadis, Dimitrios; Ilic, Nikolina; Ince, Tayfun; Introzzi, Gianluca; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Ishijima, Naoki; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ito, Fumiaki; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Paul; Jain, Vivek; Jakobi, Katharina Bianca; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanneau, Fabien; Jeanty, Laura; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Hai; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Johansson, Per; Johns, Kenneth; Johnson, William Joseph; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Sarah; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Jovicevic, Jelena; Ju, Xiangyang; Juste Rozas, Aurelio; Köhler, Markus Konrad; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kaji, Toshiaki; Kajomovitz, Enrique; Kalderon, Charles William; Kaluza, Adam; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneti, Steven; Kanjir, Luka; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kaplan, Laser Seymour; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karentzos, Efstathios; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kasahara, Kota; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Kato, Chikuma; Katre, Akshay; Katzy, Judith; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazanin, Vassili; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Kentaro, Kawade; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khader, Mazin; Khalil-zada, Farkhad; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kido, Shogo; Kilby, Callum; Kim, Hee Yeun; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Knapik, Joanna; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koehler, Nicolas Maximilian; Koffas, Thomas; Koffeman, Els; Koi, Tatsumi; Kolanoski, Hermann; Kolb, Mathis; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Kowalewska, Anna Bozena; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozakai, Chihiro; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kravchenko, Anton; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuechler, Jan Thomas; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lammers, Sabine; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lanfermann, Marie Christine; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Lazovich, Tomo; Lazzaroni, Massimo; Le, Brian; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Quilleuc, Eloi; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Benoit; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Lerner, Giuseppe; Leroy, Claude; Lesage, Arthur; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Dave; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Qi; Li, Shu; Li, Xingguo; Li, Yichen; Liang, Zhijun; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Lindquist, Brian Edward; Lionti, Anthony Eric; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Hao; Liu, Hongbin; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanlin; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina Maria; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loew, Kevin Michael; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan David; Long, Robin Eamonn; Longo, Luigi; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lopez Solis, Alvaro; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Haonan; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luedtke, Christian; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Luzi, Pierre Marc; Lynn, David; Lysak, Roman; Lytken, Else; Lyubushkin, Vladimir; Ma, Hong; Ma, Lian Liang; Ma, Yanhui; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Maček, Boštjan; Machado Miguens, Joana; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeda, Junpei; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Maneira, José; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Manousos, Athanasios; Mansoulie, Bruno; Mansour, Jason Dhia; Mantifel, Rodger; Mantoani, Matteo; Manzoni, Stefano; Mapelli, Livio; Marceca, Gino; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marjanovic, Marija; Marley, Daniel; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martinez Outschoorn, Verena; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mc Fadden, Neil Christopher; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McClymont, Laurie; McDonald, Emily; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melini, Davide; Mellado Garcia, Bruce Rafael; Melo, Matej; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer Zu Theenhausen, Hanno; Miano, Fabrizio; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mistry, Khilesh; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Molander, Simon; Moles-Valls, Regina; Monden, Ryutaro; Mondragon, Matthew Craig; Mönig, Klaus; Monk, James; Monnier, Emmanuel; Montalbano, Alyssa; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Stefanie; Mori, Daniel; Mori, Tatsuya; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morvaj, Ljiljana; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Mullier, Geoffrey; Munoz Sanchez, Francisca Javiela; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Muškinja, Miha; Myagkov, Alexey; Myska, Miroslav; Nachman, Benjamin Philip; Nackenhorst, Olaf; Nagai, Koichi; Nagai, Ryo; Nagano, Kunihiro; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Narrias Villar, Daniel Isaac; Naryshkin, Iouri; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nguyen Manh, Tuan; Nickerson, Richard; Nicolaidou, Rosy; Nielsen, Jason; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Norjoharuddeen, Nurfikri; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nurse, Emily; Nuti, Francesco; O'grady, Fionnbarr; O'Neil, Dugan; O'Rourke, Abigail Alexandra; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Ochoa-Ricoux, Juan Pedro; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Oleiro Seabra, Luis Filipe; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onogi, Kouta; Onyisi, Peter; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Pacheco Rodriguez, Laura; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palazzo, Serena; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Adam Jackson; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pascuzzi, Vincent; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Penc, Ondrej; Peng, Cong; Peng, Haiping; Penwell, John; Peralva, Bernardo; Perego, Marta Maria; Perepelitsa, Dennis; Perez Codina, Estel; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petroff, Pierre; Petrolo, Emilio; Petrov, Mariyan; Petrucci, Fabrizio; Pettersson, Nora Emilia; Peyaud, Alan; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pilcher, James; Pilkington, Andrew; Pin, Arnaud Willy J; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pires, Sylvestre; Pirumov, Hayk; Pitt, Michael; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pozo Astigarraga, Mikel Eukeni; Pralavorio, Pascal; Pranko, Aliaksandr; Prell, Soeren; Price, Darren; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Puddu, Daniele; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Raine, John Andrew; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Ratti, Maria Giulia; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Ravinovich, Ilia; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Reale, Marilea; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reichert, Joseph; Reisin, Hernan; Rembser, Christoph; Ren, Huan; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rifki, Othmane; Rijssenbeek, Michael; Rimoldi, Adele; Rimoldi, Marco; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Rizzi, Chiara; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodina, Yulia; Rodriguez Perez, Andrea; Rodriguez Rodriguez, Daniel; Roe, Shaun; Rogan, Christopher Sean; Røhne, Ole; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosenthal, Oliver; Rosien, Nils-Arne; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Jonatan; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryu, Soo; Ryzhov, Andrey; Rzehorz, Gerhard Ferdinand; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saha, Puja; Sahinsoy, Merve; Saimpert, Matthias; Saito, Tomoyuki; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Salazar Loyola, Javier Esteban; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sammel, Dirk; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Savic, Natascha; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schachtner, Balthasar Maria; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schier, Sheena; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt-Sommerfeld, Korbinian Ralf; Schmieden, Kristof; Schmitt, Christian; Schmitt, Stefan; Schmitz, Simon; Schneider, Basil; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schott, Matthias; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schuh, Natascha; Schulte, Alexandra; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Sessa, Marco; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shaikh, Nabila Wahab; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyed Ruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Sicho, Petr; Sickles, Anne Marie; Sidebo, Per Edvin; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silverstein, Samuel; Simak, Vladislav; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simon, Manuel; Sinervo, Pekka; Sinev, Nikolai; Sioli, Maximiliano; Siragusa, Giovanni; Sivoklokov, Serguei; Sjölin, Jörgen; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Slovak, Radim; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smiesko, Juraj; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smith, Russell; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Sokhrannyi, Grygorii; Solans Sanchez, Carlos; Solar, Michael; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Son, Hyungsuk; Song, Hong Ye; Sood, Alexander; Sopczak, Andre; Sopko, Vit; Sorin, Veronica; Sosa, David; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin; Spagnolo, Stefania; Spalla, Margherita; Spangenberg, Martin; Spanò, Francesco; Sperlich, Dennis; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; St Denis, Richard Dante; Stabile, Alberto; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Giordon; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Stärz, Steffen; Staszewski, Rafal; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Suchek, Stanislav; Sugaya, Yorihito; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Svatos, Michal; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Masahiro; Tanaka, Reisaburo; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tapia Araya, Sebastian; Tapprogge, Stefan; Tarem, Shlomit; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Aaron; Taylor, Geoffrey; Taylor, Pierre Thor Elliot; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira-Dias, Pedro; Temming, Kim Katrin; Temple, Darren; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tisserant, Sylvain; Todome, Kazuki; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Baojia(Tony); Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Trofymov, Artur; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tseng, Jeffrey; Tsiareshka, Pavel; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsui, Ka Ming; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tu, Yanjun; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turgeman, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tyndel, Mike; Ucchielli, Giulia; Ueda, Ikuo; Ughetto, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valdes Santurio, Eduardo; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Graaf, Harry; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vasquez, Jared Gregory; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veeraraghavan, Venkatesh; Veloce, Laurelle Maria; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigani, Luigi; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vittori, Camilla; Vivarelli, Iacopo; Vlachos, Sotirios; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wallangen, Veronica; Wang, Chao; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Tingting; Wang, Wenxiao; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Washbrook, Andrew; Watkins, Peter; Watson, Alan; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Michael David; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Whallon, Nikola Lazar; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilk, Fabian; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winston, Oliver James; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wolf, Tim Michael Heinz; Wolter, Marcin Wladyslaw; Wolters, Helmut; Worm, Steven D; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yamaguchi, Daiki; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yang, Zongchang; Yao, Weiming; Yap, Yee Chinn; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yuen, Stephanie P; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zakharchuk, Nataliia; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zeng, Jian Cong; Zeng, Qi; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Guangyi; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Rui; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Mingliang; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zwalinski, Lukasz

    2017-01-13

    A measurement of the calorimeter response to isolated charged hadrons in the ATLAS detector at the LHC is presented. This measurement is performed with 3.2 nb$^{-1}$ of proton--proton collision data at $\\sqrt{s}=7$ TeV from 2010 and 0.1 nb$^{-1}$ of data at $\\sqrt{s}=8$ TeV from 2012. A number of aspects of the calorimeter response to isolated hadrons are explored. After accounting for energy deposited by neutral particles, there is a 5\\% discrepancy in the modelling, using Geant4 physics lists, of the calorimeter response to isolated charged hadrons in the central calorimeter region. The description of the response to anti-protons at low momenta is found to be improved with respect to previous analyses. The electromagnetic and hadronic calorimeters are also examined separately, and the detector simulation is found to describe the response in the hadronic calorimeter well. The jet energy scale uncertainty and correlations in scale between jets of different momenta are derived based on these studies. The uncer...

  14. A measurement of the calorimeter response to single hadrons and determination of the jet energy scale uncertainty using LHC Run-1 pp-collision data with the ATLAS detector

    Energy Technology Data Exchange (ETDEWEB)

    Aaboud, M. [Univ. Mohamed Premier et LPTPM, Oujda (Morocco). Faculte des Sciences; Aad, G. [CPPM, Aix-Marseille Univ. et CNRS/IN2P3, Marseille (France); Abbott, B. [Oklahoma Univ., Norman, OK (United States). Homer L. Dodge Dept. of Physics and Astronomy; Collaboration: ATLAS Collaboration; and others

    2017-01-15

    A measurement of the calorimeter response to isolated charged hadrons in the ATLAS detector at the LHC is presented. This measurement is performed with 3.2 nb{sup -1} of proton-proton collision data at √(s) = 7 TeV from 2010 and 0.1 nb{sup -1} of data at √(s) = 8 TeV from 2012. A number of aspects of the calorimeter response to isolated hadrons are explored. After accounting for energy deposited by neutral particles, there is a 5% discrepancy in the modelling, using various sets of Geant4 hadronic physics models, of the calorimeter response to isolated charged hadrons in the central calorimeter region. The description of the response to anti-protons at low momenta is found to be improved with respect to previous analyses. The electromagnetic and hadronic calorimeters are also examined separately, and the detector simulation is found to describe the response in the hadronic calorimeter well. The jet energy scale uncertainty and correlations in scale between jets of different momenta and pseudorapidity are derived based on these studies. The uncertainty is 2-5% for jets with transverse momenta above 2 TeV, where this method provides the jet energy scale uncertainty for ATLAS. (orig.)

  15. Single ventricle cardiac defect

    International Nuclear Information System (INIS)

    Eren, B.; Turkmen, N.; Fedakar, R.; Cetin, V.

    2010-01-01

    Single ventricle heart is defined as a rare cardiac abnormality with a single ventricle chamber involving diverse functional and physiological defects. Our case is of a ten month-old baby boy who died shortly after admission to the hospital due to vomiting and diarrhoea. Autopsy findings revealed cyanosis of finger nails and ears. Internal examination revealed; large heart, weighing 60 grams, single ventricle, without a septum and upper membranous part. Single ventricle is a rare pathology, hence, this paper aims to discuss this case from a medico-legal point of view. (author)

  16. Effect of simultaneous, single oral doses of beta-carotene with lutein or lycopene on the beta-carotene and retinyl ester responses in the triacylglycerol-rich lipoprotein fraction of men

    NARCIS (Netherlands)

    Berg, H. van den; Vliet, T. van

    1998-01-01

    The effects of lutein and lycopene on β-carotene absorption and cleavage were investigated in 12 male subjects. Responses of carotenoids and retinyl palmitate in the triacylglycerol-rich lipoprotein (TRL) fraction after a separate 15-mg β-carotene dose were compared with those after a dose of 15 mg

  17. A DOSE–RESPONSE ANALYSIS OF THE REPRODUCTIVE EFFECTS OF A SINGLE GESTATIONAL DOSE OF 2,3,7,8-TETRACHLORODIBENZO-P-DIOXIN IN MALE LONG EVANS HOODED RAT OFFSPRING

    Science.gov (United States)

    Male rats exposed in utero to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) display reduced fertility as a consequence of the direct action of TCDD on the epididymides, as well as delayed puberty and altered reproductive organ weights. The current study provides dose-response data f...

  18. Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice

    Directory of Open Access Journals (Sweden)

    Thomas Katelyn

    2006-06-01

    Full Text Available Abstract Background Immunotherapy for Alzheimer's disease (AD is emerging as a potential treatment. However, a clinical trial (AN1792 was halted after adverse effects occurred in a small subset of subjects, which may have been caused by a T cell-mediated immunological response. In general, aging limits the humoral immune response, therefore, immunogens and vaccination regimes are required that induce a strong antibody response with less potential for an adverse immune response. Method In the current study, we immunized both wildtype and J20 APP-tg mice with a priming injection of Aβ1–40/42, followed by multiple intranasal boosts with the novel immunogen dAβ1–15 (16 copies of Aβ1–15 on a lysine tree, Aβ1–15 peptide or Aβ1–40/42 full length peptide. Results J20 APP-tg mice primed with Aβ1–40/42 subcutaneously and subsequently boosted intranasally with Aβ1–15 peptide did not generate a cellular or humoral immune response. In contrast, J20 APP-tg mice boosted intranasally with dAβ1–15 or full length Aβ1–40/42 produced high levels of anti-Aβ antibodies. Splenocyte proliferation was minimal in mice immunized with dAβ1–15. Wildtype littermates of the J20 APP-tg mice produced higher amounts of anti-Aβ antibodies compared to APP-tg mice but also had low T cell proliferation. The anti-Aβ antibodies were mainly composed of IgG2b and directed to an epitope within the Aβ1–7 region, regardless of the immunogen. Examination of the brain showed a significant reduction in Aβ plaque burden in the J20 APP-tg mice producing antibodies compared to controls. Biochemically, Aβ40 or Aβ42 were also reduced in brain homogenates and elevated in plasma but the changes did not reach significance. Conclusion Our results demonstrate that priming with full length Aβ40/42 followed by boosting with dAβ1–15 but not Aβ1–15 peptide led to a robust humoral immune response with a minimal T cell response in J20 APP-tg mice. In addition, A

  19. A single gene defect causing claustrophobia

    OpenAIRE

    El-Kordi, Ahmed; Kästner, Anne; Grube, Sabrina; Klugmann, M.; Begemann, Martin; Sperling, Swetlana; Hammerschmidt, K.; Hammer, Christian; Stepniak, Beata; Patzig, J.; Monasterio-Schrader, Patricia; Strenzke, N.; Flügge, G.; Werner, Hauke B.; Pawlak, R.

    2013-01-01

    Claustrophobia, the well-known fear of being trapped in narrow/closed spaces, is often considered a conditioned response to traumatic experience. Surprisingly, we found that mutations affecting a single gene, encoding a stress-regulated neuronal protein, can cause claustrophobia. Gpm6a-deficient mice develop normally and lack obvious behavioral abnormalities. However, when mildly stressed by single-housing, these mice develop a striking claustrophobia-like phenotype, which is not inducible in...

  20. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    GENERAL ARTICLE. Single-Molecule Spectroscopy. Every Molecule is Different! Kankan Bhattacharyya. Keywords. Single-molecule spectroscopy. (SMS), confocal microscopy,. FCS, sm-FRET, FLIM. 1 High-resolution spectrum re- fers to a spectrum consisting of very sharp lines. The sharp lines clearly display transitions to ...

  1. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    RESONANCE. February 2015. GENERAL ARTICLE. Single-Molecule Spectroscopy. Every Molecule is Different! Kankan Bhattacharyya. Keywords. Single-molecule ..... Resonance Energy. Transfer (FRET) is an elegant technique to measure the distance between a donor and an acceptor molecule. FRET refers to the.

  2. Single photon and nonlocality

    Indian Academy of Sciences (India)

    critical analysis of the concept of hidden variable used by the authors of [1] shows that the reasoning is not correct. Keywords. Nonlocality; single particle; hidden variables. PACS Nos 03.67.Ba; 03.65.Ta; 32.80.Lg; 07.79.Fc. 1. Introduction. Quantum nonlocality [2] for single particle is a subject of debate since the origin.

  3. Single gaze gestures

    DEFF Research Database (Denmark)

    Møllenbach, Emilie; Lilholm, Martin; Gail, Alastair

    2010-01-01

    This paper examines gaze gestures and their applicability as a generic selection method for gaze-only controlled interfaces. The method explored here is the Single Gaze Gesture (SGG), i.e. gestures consisting of a single point-to-point eye movement. Horizontal and vertical, long and short SGGs were...

  4. Understanding Single Adulthood.

    Science.gov (United States)

    Stein, Peter J.

    The life styles and life chances of the unmarried include elements of choices. Singles may be grouped and characterized according to whether their status may be considered stable or temporary. A life cycle, or continuum model of singlehood is reviewed, including its different factors, or phases. A new model for singles is proposed--a life spiral…

  5. Single-sided NMR

    CERN Document Server

    Casanova, Federico; Blümich, Bernhard

    2011-01-01

    Single-Sided NMR describes the design of the first functioning single-sided tomograph, the related measurement methods, and a number of applications. One of the key advantages to this method is the speed at which the images are obtained.

  6. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  7. Single Nanoparticle Plasmonic Sensors

    Directory of Open Access Journals (Sweden)

    Manish Sriram

    2015-10-01

    Full Text Available The adoption of plasmonic nanomaterials in optical sensors, coupled with the advances in detection techniques, has opened the way for biosensing with single plasmonic particles. Single nanoparticle sensors offer the potential to analyse biochemical interactions at a single-molecule level, thereby allowing us to capture even more information than ensemble measurements. We introduce the concepts behind single nanoparticle sensing and how the localised surface plasmon resonances of these nanoparticles are dependent upon their materials, shape and size. Then we outline the different synthetic approaches, like citrate reduction, seed-mediated and seedless growth, that enable the synthesis of gold and silver nanospheres, nanorods, nanostars, nanoprisms and other nanostructures with tunable sizes. Further, we go into the aspects related to purification and functionalisation of nanoparticles, prior to the fabrication of sensing surfaces. Finally, the recent developments in single nanoparticle detection, spectroscopy and sensing applications are discussed.

  8. Single-photon imaging

    CERN Document Server

    Seitz, Peter

    2011-01-01

    The acquisition and interpretation of images is a central capability in almost all scientific and technological domains. In particular, the acquisition of electromagnetic radiation, in the form of visible light, UV, infrared, X-ray, etc. is of enormous practical importance. The ultimate sensitivity in electronic imaging is the detection of individual photons. With this book, the first comprehensive review of all aspects of single-photon electronic imaging has been created. Topics include theoretical basics, semiconductor fabrication, single-photon detection principles, imager design and applications of different spectral domains. Today, the solid-state fabrication capabilities for several types of image sensors has advanced to a point, where uncoooled single-photon electronic imaging will soon become a consumer product. This book is giving a specialist´s view from different domains to the forthcoming “single-photon imaging” revolution. The various aspects of single-photon imaging are treated by internati...

  9. Single-Phase PLLs

    DEFF Research Database (Denmark)

    Golestan, Saeed; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez

    2017-01-01

    Single-phase phase-locked loops (PLLs) are popular for the synchronization and control of single-phase gridconnected converters. They are also widely used for monitoring and diagnostic purposes in the power and energy areas. In recent years, a large number of single-phase PLLs with different...... structures and properties have been proposed in the literature. The main aim of this paper is to provide a review of these PLLs. To this end, the single-phase PLLs are first classified into two major categories: 1) power-based PLLs (pPLLs), and 2) quadrature signal generation-based PLLs (QSG......-PLLs). The members of each category are then described and their pros and cons are discussed. This work provides a deep insight into characteristics of different single-phase PLLs and, therefore, can be considered as a reference for researchers and engineers....

  10. Characterization of a single peptide derived from cytochrome P4501B1 that elicits spontaneous human leukocyte antigen (HLA)-A1 as well as HLA-B35 restricted CD8 T-cell responses in cancer patients

    DEFF Research Database (Denmark)

    Kvistborg, P.; Hadrup, S.R.; Andersen, M.H.

    2008-01-01

    Cytochrome P450 1B1 (CYP1B1) is widely expressed in human malignancies, but silent in most normal tissues. Importantly, the protein is believed to play an important role in the survival and growth of cancer cells in a stressed environment, e.g., as a result of hypoxia or chemotherapy. Thus......, targeting of CYP1B1 represents a potentially successful strategy in the treatment of metastatic cancer, e.g., by therapeutic vaccination. Herein, we describe the characterization of a novel peptide from the CYP1B1 protein (CYP240), which is spontaneously recognized by CD8 T cells in cancer patients....... Rare but strong responses were detected in HLA-A1-positive patients, and more frequent responses were detected in HLA-B35-positive patients. No reactivity against the peptide could be detected in healthy donors. Furthermore, we demonstrated that peptide-specific T cells were able to lyze target cells...

  11. Immunization of chickens with an agonistic monoclonal anti-chicken CD40 antibody-hapten complex: rapid and robust IgG response induced by a single subcutaneous injection.

    Science.gov (United States)

    Chen, Chang-Hsin; Abi-Ghanem, Daad; Waghela, Suryakant D; Chou, Wen-Ko; Farnell, Morgan B; Mwangi, Waithaka; Berghman, Luc R

    2012-04-30

    Producing diagnostic antibodies in chicken egg yolk represents an alternate animal system that offers many advantages including high productivity at low cost. Despite being an excellent counterpart to mammalian antibodies, chicken IgG from yolk still represents an underused resource. The potential of agonistic monoclonal anti-CD40 antibodies (mAb) as a powerful immunological adjuvant has been demonstrated in mammals, but not in chickens. We recently reported an agonistic anti-chicken CD40 mAb (designated mAb 2C5) and showed that it may have potential as an immunological adjuvant. In this study, we examined the efficacy of targeting a short peptide to chicken CD40 [expressed by the antigen-presenting cells (APCs)] in enhancing an effective IgG response in chickens. For this purpose, an immune complex consisting of one streptavidin molecule, two directionally biotinylated mAb 2C5 molecules, and two biotinylated peptide molecules was produced. Chickens were immunized subcutaneously with doses of this complex ranging from 10 to 90 μg per injection once, and relative quantification of the peptide-specific IgG response showed that the mAb 2C5-based complex was able to elicit a strong IgG response as early as four days post-immunization. This demonstrates that CD40-targeting antigen to chicken APCs can significantly enhance antibody responses and induce immunoglobulin isotype-switching. This immunization strategy holds promise for rapid production of hapten-specific IgG in chickens. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Clinical features, early treatment responses, and outcomes of pediatric acute lymphoblastic leukemia in China with or without specific fusion transcripts: a single institutional study of 1,004 patients.

    Science.gov (United States)

    Gao, Chao; Zhao, Xiao-Xi; Li, Wei-Jing; Cui, Lei; Zhao, Wei; Liu, Shu-Guang; Yue, Zhi-Xia; Jiao, Ying; Wu, Min-Yuan; Li, Zhi-Gang

    2012-11-01

    Acute lymphoblastic leukemia (ALL) with distinct fusion transcripts has unique clinical features. In this study, the incidence, clinical characteristics, early treatment response, and outcomes of 1,004 Chinese pediatric ALLs were analyzed. Patients with TEL-AML1 and E2A-PBX1 fusion genes or other B cell precursor ALLs (BCP-ALL) had favorable clinical features, were sensitive to prednisone, had low minimal residual disease (MRD), and an excellent prognosis, with a 5-year event-free survival (EFS) of 84-92%. T-ALL was associated with a high WBC, increased age, more central nervous system involvement, a poor prednisone response, and high MRD, with a 5-year EFS of 68.4 ± 5.2%. Patients with BCR-ABL and MLL rearrangements usually had adverse clinical presentations and treatment responses, and a dismal prognosis, with 5-year EFS of 27.3 and 57.4%, respectively. We also showed that BCR-ABL and MLL rearrangements, the prednisone response, and MRD were independent prognostic factors. Interestingly, the BCH-2003 protocol resulted in a better outcome for E2A-PBX1(+) patients than the CCLG-2008 protocol. Intermediate and late relapses were more common in TEL-AML1(+) patients and other BCP-ALLs compared with other subgroups (P = 0.018). Therefore, this study suggests that a fusion gene-specific chemotherapy regimen and/or targeted therapy should be developed to improve further the cure rate of pediatric ALL. Copyright © 2012 Wiley Periodicals, Inc.

  13. Persistence of immune responses after a single dose of Novartis meningococcal serogroup A, C, W-135 and Y CRM-197 conjugate vaccine (Menveo®) or Menactra® among healthy adolescents.

    Science.gov (United States)

    Gill, Christopher J; Baxter, Roger; Anemona, Alessandra; Ciavarro, Giuseppe; Dull, Peter

    2010-11-01

    The persis